Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Single Molecule Screening of Disease DNA Without Amplification

Energy Technology Data Exchange (ETDEWEB)

Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

2006-01-01

The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

[Single-molecule detection and characterization of DNA replication based on DNA origami].

Science.gov (United States)

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

DNA analysis by single molecule stretching in nanofluidic biochips

DEFF Research Database (Denmark)

Abad, E.; Juarros, A.; Retolaza, A.

2011-01-01

Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

Science.gov (United States)

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Thermophoretic forces on DNA measured with a single-molecule spring balance

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

2014-01-01

We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

Science.gov (United States)

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

Science.gov (United States)

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Highly parallel translation of DNA sequences into small molecules.

Directory of Open Access Journals (Sweden)

Rebecca M Weisinger

Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

Specificity of DNA import into isolated mitochondria from plants and mammals

Directory of Open Access Journals (Sweden)

Koulintchenko M. V.

2014-01-01

Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

Science.gov (United States)

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

International Nuclear Information System (INIS)

Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

2003-01-01

DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

International Nuclear Information System (INIS)

Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

2007-01-01

Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

How to read and write mechanical information in DNA molecules

Science.gov (United States)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

2009-01-01

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

DNA molecules and human therapeutics | Danquah | African Journal ...

African Journals Online (AJOL)

Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

International Nuclear Information System (INIS)

An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

2007-01-01

We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

Science.gov (United States)

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Automation of a single-DNA molecule stretching device

DEFF Research Database (Denmark)

Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

2015-01-01

We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

Science.gov (United States)

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

Science.gov (United States)

Abdalla, S; Obaid, A; Al-Marzouki, F M

2017-12-01

Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

Studying DNA looping by single-molecule FRET.

Science.gov (United States)

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Rapid and inexpensive method for isolating plasmid DNA

International Nuclear Information System (INIS)

Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

1997-01-01

A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

[The effect of spermine on acid-base equilibrium in DNA molecule].

Science.gov (United States)

Slonitskiĭ, S V; Kuptsov, V Iu

1990-01-01

The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

OpenAIRE

Buyukdagli, Sahin

2016-01-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

Quantifying DNA melting transitions using single-molecule force spectroscopy

International Nuclear Information System (INIS)

Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

2009-01-01

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

Quantifying DNA melting transitions using single-molecule force spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

2009-01-21

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

A 3D-DNA Molecule Made of PlayMais

Science.gov (United States)

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

Science.gov (United States)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

A single molecule DNA flow stretching microscope for undergraduates

NARCIS (Netherlands)

Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

2011-01-01

The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

Directory of Open Access Journals (Sweden)

Zdepski Anna

2011-05-01

Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

Science.gov (United States)

Friedrich, Sarah; Wang, Tza-Huei

Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

Directory of Open Access Journals (Sweden)

Marijn T J van Loenhout

Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

Science.gov (United States)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

Science.gov (United States)

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

DNA replication at the single-molecule level

NARCIS (Netherlands)

Stratmann, S.A.; Oijen, A.M. van

2014-01-01

A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

International Nuclear Information System (INIS)

Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

2008-01-01

Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

Single-molecule analysis of DNA replication in Xenopus egg extracts

NARCIS (Netherlands)

Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

International Nuclear Information System (INIS)

Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

2007-01-01

We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

Science.gov (United States)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Inhibition of DNA glycosylases via small molecule purine analogs.

Directory of Open Access Journals (Sweden)

Aaron C Jacobs

Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

Real-time single-molecule observation of rolling-circle DNA replication

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

2009-01-01

We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

Single-strand DNA molecule translocation through nanoelectrode gaps

International Nuclear Information System (INIS)

Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

2007-01-01

Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2014-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

Science.gov (United States)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

Science.gov (United States)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

Directory of Open Access Journals (Sweden)

Scott S Walker

Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

Science.gov (United States)

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

Science.gov (United States)

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

International Nuclear Information System (INIS)

Han, J.H.; Stratowa, C.; Rutter, W.J.

1987-01-01

The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

Science.gov (United States)

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

Science.gov (United States)

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

OpenAIRE

Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

2018-01-01

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

Energy Technology Data Exchange (ETDEWEB)

Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

DNA isolation from rat tail or ear

NARCIS (Netherlands)

Cuppen, E.

2010-01-01

This protocol describes a rapid procedure for isolating DNA from rat tail or ear punches. The simplest version of the protocol can be scaled for use in 96-well (deep-well) plates. The quality of the DNA is sufficient for any polymerase chain reaction (PCR)-based genotyping approach.

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

Science.gov (United States)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

Analysis of DNA interactions using single-molecule force spectroscopy.

Science.gov (United States)

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

Characterization of Botrytis cinerea isolates from chickpea: DNA ...

African Journals Online (AJOL)

Administrator

2010-11-15

Nov 15, 2010 ... 2Department of Plant Sciences, University of Hyderabad, Hyderabad 500 046, India. ... similarity of the isolates varied from 14-44%, and the isolates were separated ..... application to human mitochondrial DNA restriction sites.

Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

Directory of Open Access Journals (Sweden)

Jonghyun Park

2010-11-01

Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

DEFF Research Database (Denmark)

Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

2011-01-01

We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

Quorum sensing molecules production by nosocomial and soil isolates Acinetobacter baumannii.

Science.gov (United States)

Erdönmez, Demet; Rad, Abbas Yousefi; Aksöz, Nilüfer

2017-12-01

Acinetobacter species remain alive in hospitals on various surfaces, both dry and moist, forming an important source of hospital infections. These bacteria are naturally resistant to many antibiotic classes. Although the role of the quorum sensing system in regulating the virulence factors of Acinetobacter species has not been fully elucidated, it has been reported that they play a role in bacterial biofilm formation. The biofilm formation helps them to survive under unfavorable growth conditions and antimicrobial treatments. It is based on the accumulation of bacterial communication signal molecules in the area. In this study, we compared the bacterial signal molecules of 50 nosocomial Acinetobacter baumannii strain and 20 A. baumannii strain isolated from soil. The signal molecules were detected by the biosensor bacteria (Chromobacterium violaceum 026, Agrobacterium tumefaciens A136, and Agrobacterium tumefaciens NTL1) and their separation was determined by thin-layer chromatography. As a result, it has been found that soil-borne isolates can produce 3-oxo-C8-AHL and C8-AHL, whereas nosocomial-derived isolates can produce long-chain signals such as C10-AHL, C12-AHL, C14-AHL and C16-AHL. According to these results, it is possible to understand that these signal molecules are found in the infection caused by A. baumannii. The inhibition of this signaling molecules in a communication could use to prevent multiple antibiotic resistance of these bacteria.

Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

Science.gov (United States)

Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

1995-01-01

Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

Science.gov (United States)

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

DEFF Research Database (Denmark)

Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

2010-01-01

DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

Radiation-induced transformations of isolated organic molecules in solid rare gas matrices

International Nuclear Information System (INIS)

Feldman, V.I.

1998-01-01

Complete text of publication follows. The studies of radiation-chemical behaviour of isolated organic molecules in rigid inert media are of considerable interest for radiation chemistry and general structural chemistry. Previous efforts were limited to the ESR studies of radicals resulting from some small hydrocarbon molecules in frozen rare gas solutions. Recently, we developed an approach to the radiation chemistry of isolated organic molecules using classic matrix isolation procedure for sample preparation and a combination of ESR and IR spectroscopy for characterization of paramagnetic and diamagnetic species resulting form electron irradiation or organic molecules in solid rare gas matrices at 10-15 K. The results obtained reveal high efficiency of energy transfer from rare gas matrix to organic molecules. The total radiation-chemical yields of degradation of organic molecules in argon and xenon matrices were measured directly by IR spectroscopy. The studies of the effect of electron scavengers on the radiolysis of organic molecules in solid rare gases show that the main primary process is positive hole transfer from matrix to additive molecule. ESR spectra of a number of radical cations (alkanes, ethers, arenes) were first characterized in a low-disturbing environment. It was found that the electronic characteristics (IP, polarizability) of the matrix used had crucial effect on trapping and degradation of primary organic radical cations. Using matrices with various IP provides an unique possibility to examine the chemical meaning of excess energy resulting from exothermic positive hole transfer, that is, to follow the fate of excited cations in condensed phase

Comparative DNA isolation behaviours of silica and polymer based sorbents in batch fashion: monodisperse silica microspheres with bimodal pore size distribution as a new sorbent for DNA isolation.

Science.gov (United States)

Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali

2018-02-01

Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.

Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

International Nuclear Information System (INIS)

Mardis, E.R.; Roe, B.A.

1989-01-01

Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

Single-molecule denaturation mapping of DNA in nanofluidic channels

DEFF Research Database (Denmark)

Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

2010-01-01

Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

Science.gov (United States)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

Science.gov (United States)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

Science.gov (United States)

Lobuglio, Katherine Frances

1990-01-01

Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

Comparison of different DNA isolation methods and use of dodecyle trimethyl ammonium bromide (DTAB for the isolation of DNA from meat products

Directory of Open Access Journals (Sweden)

Yusuf OZsENSOY

2016-12-01

Conclusion: DNA isolation kit, another best method, is recommended due to quality and quantity of DNA for researchers who do not want that phenol/chloroform method have toxic substances. This study is also the first study in which DTAB method is used for DNA extraction from meat products. [J Adv Vet Anim Res 2016; 3(4.000: 368-374

Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

African Journals Online (AJOL)

Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...

Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

Directory of Open Access Journals (Sweden)

Greta Zubaite

2017-02-01

Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

NARCIS (Netherlands)

Moayed, F.; Mashaghi, A.; Tans, S.J.

2013-01-01

Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

Single molecule DNA detection with an atomic vapor notch filter

Energy Technology Data Exchange (ETDEWEB)

Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

2015-12-01

The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

Single-molecule studies of DNA transcription using atomic force microscopy

International Nuclear Information System (INIS)

Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

2012-01-01

Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs

International Nuclear Information System (INIS)

Travis, G.H.; Sutcliffe, J.G.

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, the authors developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA

Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

CERN Document Server

Williams, Mark C

2011-01-01

This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

Good quality Vitis RNA obtained from an adapted DNA isolation protocol

Directory of Open Access Journals (Sweden)

Isabel Baiges

2003-03-01

Full Text Available Grapevine is a woody plant, whose high carbohydrate and phenolic compound contents usually interferes with nucleic acid isolation. After we tried several protocols for isolating RNA from the Vitis rootstock Richter- 110 (R-110 with little or no success, we adapted a method reported to be satisfactory for grapevine DNA isolation, to extract RNA. With slight protocol modifications, we succeeded to obtain polysaccharide- and phenolic-free RNA preparations from all vegetative tissues, without excessive sample handling. RNA isolated by the reported method permitted to obtain highly pure mRNA (messenger RNA to construct a cDNA (complementary DNA library and allowed gene transcription analysis by reverse Northern, which guarantees RNA integrity. This method may also be suitable for other plant species with high polysaccharide or phenolic contents.

Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

NARCIS (Netherlands)

Hohlbein, J.; Kapanidis, A.N.

2016-01-01

Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

Does Extracellular DNA Production Vary in Staphylococcal Biofilms Isolated From Infected Implants versus Controls?

Science.gov (United States)

Zatorska, Beata; Groger, Marion; Moser, Doris; Diab-Elschahawi, Magda; Lusignani, Luigi Segagni; Presterl, Elisabeth

2017-08-01

Prosthetic implant infections caused by Staphylococcus aureus and epidermidis are major challenges for early diagnosis and treatment owing to biofilm formation on the implant surface. Extracellular DNA (eDNA) is actively excreted from bacterial cells in biofilms, contributing to biofilm stability, and may offer promise in the detection or treatment of such infections. (1) Does DNA structure change during biofilm formation? (2) Are there time-dependent differences in eDNA production during biofilm formation? (3) Is there differential eDNA production between clinical and control Staphylococcal isolates? (4) Is eDNA production correlated to biofilm thickness? We investigated eDNA presence during biofilm formation in 60 clinical and 30 control isolates of S aureus and S epidermidis. The clinical isolates were isolated from patients with infections of orthopaedic prostheses and implants: 30 from infected hip prostheses and 30 from infected knee prostheses. The control isolates were taken from healthy volunteers who had not been exposed to antibiotics and a hospital environment during the previous 3 and 12 months, respectively. Control S epidermidis was isolated from the skin of the antecubital fossa, and control S aureus was isolated from the nares. For the biofilm experiments the following methods were used to detect eDNA: (1) fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI), (2) eDNA extraction using a commercial kit, and (3) confocal laser scanning microscopy for 24-hour biofilm observation using propidium iodide and concanavalin-A staining; TOTO ® -1 and SYTO ® 60 staining were used for observation and quantification of eDNA after 6 and 24 hours of biofilm formation. Additionally antibiotic resistance was described. eDNA production as observed by confocal laser scanning microscopy was greater in clinical isolates than controls (clinical isolates mean ± SD: 1.84% ± 1.31%; control mean ± SD: 1.17% ± 1.37%; p biofilm formation. After 24 hours, the

Single Molecule Study of DNA Organization and Recombination

Science.gov (United States)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

Science.gov (United States)

Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

2016-01-01

Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

Directory of Open Access Journals (Sweden)

Mária Džunková

Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

OpenAIRE

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

Characterization of Botrytis cinerea isolates from chickpea: DNA ...

African Journals Online (AJOL)

Characterization of Botrytis cinerea isolates from chickpea: DNA polymorphisms, cultural, morphological and virulence characteristics. Suresh Pande, Mamta Sharma, G. Krishna Kishore, L. Shivram, U. Naga Mangala ...

Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

Czech Academy of Sciences Publication Activity Database

Hanzálek, Petr; Kypr, Jaroslav

2001-01-01

Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

Polyphenolics free DNA isolation and optimization of PCR-RAPD for ...

African Journals Online (AJOL)

, and good quality high molecular weight DNA samples. DNA was isolated from the mature and fresh young tender leaves obtained from various Italian wild populations of fennel. We performed a modified cetyl trimethyl ammonium bromide ...

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

NARCIS (Netherlands)

Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

1999-01-01

By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

DEFF Research Database (Denmark)

Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

2012-01-01

Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

Accurate episomal HIV 2-LTR circles quantification using optimized DNA isolation and droplet digital PCR.

Science.gov (United States)

Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Trypsteen, Wim; Messiaen, Peter; Vermeire, Jolien; Verhasselt, Bruno; Vervisch, Karen; Vandekerckhove, Linos; De Spiegelaere, Ward

2014-01-01

In HIV-infected patients on combination antiretroviral therapy (cART), the detection of episomal HIV 2-LTR circles is a potential marker for ongoing viral replication. Quantification of 2-LTR circles is based on quantitative PCR or more recently on digital PCR assessment, but is hampered due to its low abundance. Sample pre-PCR processing is a critical step for 2-LTR circles quantification, which has not yet been sufficiently evaluated in patient derived samples. We compared two sample processing procedures to more accurately quantify 2-LTR circles using droplet digital PCR (ddPCR). Episomal HIV 2-LTR circles were either isolated by genomic DNA isolation or by a modified plasmid DNA isolation, to separate the small episomal circular DNA from chromosomal DNA. This was performed in a dilution series of HIV-infected cells and HIV-1 infected patient derived samples (n=59). Samples for the plasmid DNA isolation method were spiked with an internal control plasmid. Genomic DNA isolation enables robust 2-LTR circles quantification. However, in the lower ranges of detection, PCR inhibition caused by high genomic DNA load substantially limits the amount of sample input and this impacts sensitivity and accuracy. Moreover, total genomic DNA isolation resulted in a lower recovery of 2-LTR templates per isolate, further reducing its sensitivity. The modified plasmid DNA isolation with a spiked reference for normalization was more accurate in these low ranges compared to genomic DNA isolation. A linear correlation of both methods was observed in the dilution series (R2=0.974) and in the patient derived samples with 2-LTR numbers above 10 copies per million peripheral blood mononuclear cells (PBMCs), (R2=0.671). Furthermore, Bland-Altman analysis revealed an average agreement between the methods within the 27 samples in which 2-LTR circles were detectable with both methods (bias: 0.3875±1.2657 log10). 2-LTR circles quantification in HIV-infected patients proved to be more

X-ray Diffraction from Isolated and Strongly Aligned Gas-Phase Molecules with a Free-Electron Laser

DEFF Research Database (Denmark)

Küpper, Jochen; Stern, Stephan; Holmegaard, Lotte

2014-01-01

We report experimental results on x-ray diffraction of quantum-state-selected and strongly aligned ensembles of the prototypical asymmetric rotor molecule 2,5-diiodobenzonitrile using the Linac Coherent Light Source. The experiments demonstrate first steps toward a new approach to diffractive...... imaging of distinct structures of individual, isolated gas-phase molecules. We confirm several key ingredients of single molecule diffraction experiments: the abilities to detect and count individual scattered x-ray photons in single shot diffraction data, to deliver state-selected, e. g., structural......-isomer-selected, ensembles of molecules to the x-ray interaction volume, and to strongly align the scattering molecules. Our approach, using ultrashort x-ray pulses, is suitable to study ultrafast dynamics of isolated molecules....

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

How to determine local stretching and tension in a flow-stretched DNA molecule

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

2016-01-01

We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

On the identification techniques for ionizing radiation structure breaks in the DNA molecule

International Nuclear Information System (INIS)

Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

2012-01-01

In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

International Nuclear Information System (INIS)

Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

1979-01-01

The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

Testing of DNA isolation for the identification of hemp

Directory of Open Access Journals (Sweden)

Tomáš Vyhnánek

2015-12-01

Full Text Available Hemp is diploid organism (2n = 2x = 20, genome size 534 Mb with nine pairs of autosomes plus XX (♀ or XY (♂ chromosomes. Cannabis sativa L. is an important economic plant for the production of food, fibre, oils, and intoxicants. Genotypes (varieties or chemovar of hemp with low Δ9-tetrahydrocannabinol content are used for industrial applications. Varieties with high Δ9-tetrahydrocannabinol or high cannabidiol content are used for medicinal applications. Biochemical and molecular methods can be used for identification and classification. An important step for molecular biology methods is to obtain the matrix of the native and sufficiently pure DNA. We tested two different experimental variant of samples (20 mg and 100 mg of seeds, oilcake and dried flowers for analysis of the Italian variety Carmagnola for analysis (harvested in 2014, Hempoint Ltd., Czech Republic. The DNeasy® Plant Mini Kit (Qiagen, GE was used to isolate the DNA. The DNA concentration and purity was assessed by agarose electrophoresis and via a spectrophotometer. Samples of lower weight yielded lower values of DNA concentration (average 16.30 - 38.90 ng.µL-1, but with better purity than samples of higher weight (ratio A260nm/A280nm for low-weight samples was near 1.80. To test the applicability of DNA analysis, we used two SSR markers (CAN1347 and CAN2913. PCR products were separated on 1% agarose and on 8% polyacrylamide electrophoresis. DNA samples obtained from samples of higher weight exhibited less PCR amplification than samples of lower weight. We found no effect of sample weight on the formation of non-specific amplification products during the PCR reaction. Based on our results we can be recommended for practical isolation procedure using DNeasy® Plant Mini Kit with lower of sample weight (20 mg. In future work the procedure for DNA isolating from wheat-cannabis products, e. g. breads, rolls or pasta, will be optimized.

Why Do Simple Molecules with "Isolated" Phenyl Rings Emit Visible Light?

Science.gov (United States)

Zhang, Haoke; Zheng, Xiaoyan; Xie, Ni; He, Zikai; Liu, Junkai; Leung, Nelson L C; Niu, Yingli; Huang, Xuhui; Wong, Kam Sing; Kwok, Ryan T K; Sung, Herman H Y; Williams, Ian D; Qin, Anjun; Lam, Jacky W Y; Tang, Ben Zhong

2017-11-15

π-Bonds connected with aromatic rings were generally believed as the standard structures for constructing highly efficient fluorophores. Materials without these typical structures, however, exhibited only low fluorescence quantum yields and emitted in the ultraviolet spectral region. In this work, three molecules, namely bis(2,4,5-trimethylphenyl)methane, 1,1,2,2-tetrakis(2,4,5-trimethylphenyl)ethane, and 1,1,2,2-tetraphenylethane, with nonconjugated structures and isolated phenyl rings were synthesized and their photophysical properties were systematically investigated. Interestingly, the emission spectra of these three molecules could be well extended to 600 nm with high solid-state quantum yields of up to 70%. Experimental and theoretical analyses proved that intramolecular through-space conjugation between the "isolated" phenyl rings played an important role for this abnormal phenomenon.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

Science.gov (United States)

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens.

Science.gov (United States)

Saeidi, Saman; McKain, Michael R; Kellogg, Elizabeth A

2018-03-08

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

Science.gov (United States)

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

Science.gov (United States)

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

Science.gov (United States)

Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

2017-01-01

During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

A rapid and low-cost DNA extraction method for isolating ...

African Journals Online (AJOL)

The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

Electrostatic force microscopy: imaging DNA and protein polarizations one by one

International Nuclear Information System (INIS)

Mikamo-Satoh, Eriko; Yamada, Fumihiko; Takagi, Akihiko; Matsumoto, Takuya; Kawai, Tomoji

2009-01-01

We present electrostatic force microscopy images of double-stranded DNA and transcription complex on an insulating mica substrate obtained with molecular resolution using a frequency-mode noncontact atomic force microscope. The electrostatic potential images show that both DNA and transcription complexes are polarized with an upward dipole moment. Potential differences of these molecules from the mica substrate enabled us to estimate dipole moments of isolated DNA and transcription complex in zero external field to be 0.027 D/base and 0.16 D/molecule, respectively. Scanning capacitance microscopy demonstrates characteristic contrast inversion between DNA and transcription complex images, indicating the difference in electric polarizability of these molecules. These findings indicate that the electrostatic properties of individual biological molecules can be imaged on an insulator substrate while retaining complex formation.

Modified method for combined DNA and RNA isolation from peanut and other oil seeds.

Science.gov (United States)

Dang, Phat M; Chen, Charles Y

2013-02-01

Isolation of good quality RNA and DNA from seeds is difficult due to high levels of polysaccharides, polyphenols, and lipids that can degrade or co-precipitate with nucleic acids. Standard RNA extraction methods utilizing guanidinium-phenol-chloroform extraction has not shown to be successful. RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted selection and other genetic studies. We describe a modified method to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both RNA and DNA from the same seed tissues. High quality nucleic acids were observed based on A(260)/A(280) and A(260)/A(230) ratios above 2.0 and distinct bands on gel-electrophoresis. RNA was shown to be suitable for reverse transcriptase polymerase chain reaction based on actin or 60S ribosomal primer amplification and DNA was shown to have a single band on gel-electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.

Role of isolated and clustered DNA damage and the post-irradiating repair process in the effects of heavy ion beam irradiation

International Nuclear Information System (INIS)

Tokuyama, Yuka; Terato, Hiroaki; Furusawa, Yoshiya; Ide, Hiroshi; Yasui, Akira

2015-01-01

Clustered DNA damage is a specific type of DNA damage induced by ionizing radiation. Any type of ionizing radiation traverses the target DNA molecule as a beam, inducing damage along its track. Our previous study showed that clustered DNA damage yields decreased with increased linear energy transfer (LET), leading us to investigate the importance of clustered DNA damage in the biological effects of heavy ion beam radiation. In this study, we analyzed the yield of clustered base damage (comprising multiple base lesions) in cultured cells irradiated with various heavy ion beams, and investigated isolated base damage and the repair process in post-irradiation cultured cells. Chinese hamster ovary (CHO) cells were irradiated by carbon, silicon, argon and iron ion beams with LETs of 13, 55, 90 and 200 keV µm -1 , respectively. Agarose gel electrophoresis of the cells with enzymatic treatments indicated that clustered base damage yields decreased as the LET increased. The aldehyde reactive probe procedure showed that isolated base damage yields in the irradiated cells followed the same pattern. To analyze the cellular base damage process, clustered DNA damage repair was investigated using DNA repair mutant cells. DNA double-strand breaks accumulated in CHO mutant cells lacking Xrcc1 after irradiation, and the cell viability decreased. On the other hand, mouse embryonic fibroblast (Mef) cells lacking both Nth1 and Ogg1 became more resistant than the wild type Mef. Thus, clustered base damage seems to be involved in the expression of heavy ion beam biological effects via the repair process. (author)

Restricted diffusion of DNA segments within the isolated Escherichia coli nucleoid.

NARCIS (Netherlands)

Cunha, S.; Woldringh, C.L.; Odijk, T.

2005-01-01

To study the dynamics and organization of the DNA within isolated Escherichia coli nucleoids, we track the movement of a specific DNA region. Labeling of such a region is achieved using the Lac-O/Lac-I system. The Lac repressor-GFP fusion protein binds to the DNA section where tandem repeats of the

Isolation of DNA methyltransferase from plants

International Nuclear Information System (INIS)

Ehrlich, K.; Malbroue, C.

1987-01-01

DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from [ 3 H]AdoMet incorporated into acid precipitable material per h at 30 0 ). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30 0

Isolation and characterization of a marsupial DNA photolyase

Energy Technology Data Exchange (ETDEWEB)

Sabourin, C.L.K.; Ley, R.D.

1988-05-01

Post UV-B (280-320 nm) exposure to UV-A (320-400 nm) reverses pyrimidine dimers in the epidermal DNA of the South American opossum Monodelphis domestica. To demonstrate that the observed photorepair is mediated by an enzyme, we have isolated a DNA photolyase from the opossum. DNA photolyase from liver was purified 3000-fold by ammonium sulfate fractionation and phenylsepharose, hydroxylapatite, DEAE-cellulose and DNA-cellulose column chromatography. Heat denaturation completely eliminated the photoreactivating activity. The enzyme was active in the pH range of 5.5 to 8.5 with a pH optimum of 7.5. The enzyme has an apparent molecular weight of 32 000 under nondenaturing conditions. The activity of the enzyme was not affected by sodium chloride up to 250 mM. The action spectrum for the purified DNA photolyase showed activity in the range of 325-475 nm with peak activity at 375 nm.

Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

International Nuclear Information System (INIS)

Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

1990-01-01

Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

Directory of Open Access Journals (Sweden)

Fatemeh Moayed

Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

DNA expressions - A formal notation for DNA

NARCIS (Netherlands)

Vliet, Rudy van

2015-01-01

We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

Non liquid nitrogen-based-method for isolation of DNA from ...

African Journals Online (AJOL)

A simple, efficient, reliable and cost-effective method for isolation of total genomic DNA from fungi, suitable for polymerase chain reaction (PCR) amplification and other molecular applications was described. The main advantages of the method are: (1) does not require the use of liquid nitrogen for preparation of fungi DNA; ...

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

Science.gov (United States)

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

[DNA: from Miescher to Venter and beyond].

Science.gov (United States)

Gabryelska, Marta M; Szymański, Maciej; Barciszewski, Jan

2009-01-01

DNA, one of the most famous molecules is 140-years-old. Its history has engaged three centuries of experiments, leading us to a point, where the Homo sapiens genome sequence is known. The "DNA breakthrough" is dated on 1953, when James Watson and Francis Crick proposed the model of molecular structure of DNA. But the origin of that great achievement goes back to 1869 and early efforts of Friedrich Miescher, the Swiss doctor, who isolated DNA (than termed nuclein) for the first time. Since that time wealth information on "nuclein", its functions, structure and usage has been collected and formed a basis for modern molecular biology, chemical biology and biotechnology. This article describes the events and circumstances of the most important DNA discoveries since its first isolation up to completing the human genome project and deep DNA sequencing techniques application.

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

Science.gov (United States)

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

Isolation and characterization of a marsupial DNA photolyase

International Nuclear Information System (INIS)

Sabourin, C.L.K.; Ley, R.D.

1988-01-01

Post UV-B (280-320 nm) exposure to UV-A (320-400 nm) reverses pyrimidine dimers in the epidermal DNA of the South American opossum Monodelphis domestica. To demonstrate that the observed photorepair is mediated by an enzyme, we have isolated a DNA photolyase from the opossum. DNA photolyase from liver was purified 3000-fold by ammonium sulfate fractionation and phenylsepharose, hydroxylapatite, DEAE-cellulose and DNA-cellulose column chromatography. Heat denaturation completely eliminated the photoreactivating activity. The enzyme was active in the pH range of 5.5 to 8.5 with a pH optimum of 7.5. The enzyme has an apparent molecular weight of 32 000 under nondenaturing conditions. The activity of the enzyme was not affected by sodium chloride up to 250 mM. The action spectrum for the purified DNA photolyase showed activity in the range of 325-475 nm with peak activity at 375 nm. (author)

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

Science.gov (United States)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Supercoiled circular DNA of an insect granulosis virus.

Science.gov (United States)

Tweeten, K A; Bulla, L A; Consigli, R A

1977-08-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

Directory of Open Access Journals (Sweden)

George Lezin

Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

Isolate extended state in the DNA molecular transistor with surface interaction

Energy Technology Data Exchange (ETDEWEB)

Wang, Le, E-mail: wang_le917@gs.zzu.edu.cn; Qin, Zhi-Jie

2016-02-01

The field effect characteristic of a DNA molecular device is investigated in a tight binding model with binary disorder and side site correlation. Using the transfer-matrix method and Landauer–Büttiker theory, we find that the system has isolated extended state that is irrespective of the DNA sequence and can be modulated by the gate voltage. When the gate voltage reaches some proper value, the isolated extended state appears at the Fermi level of the system and the long range charge transport is greatly enhanced. We attribute this phenomenon to the combination of the external field, the surface interaction, and the intrinsic disorder of DNA. The result is a generic feature of the nanowire with binary disorder and surface interaction.

Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

International Nuclear Information System (INIS)

Pham, Quang Trung

2014-01-01

The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

Science.gov (United States)

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

OpenAIRE

Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

1999-01-01

A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

Science.gov (United States)

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

Science.gov (United States)

Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

1995-01-01

Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

Cloning and expression of cDNA coding for bouganin.

Science.gov (United States)

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

Solid-phase DNA isolation from food matrices using hydrophilic magnetic microspheres

Czech Academy of Sciences Publication Activity Database

Trachtová, Š.; Španová, A.; Tóth, J.; Prettl, Z.; Horák, Daniel; Gyenis, J.; Rittich, B.

2015-01-01

Roč. 94, April (2015), s. 375-381 ISSN 0960-3085 R&D Projects: GA ČR GAP206/12/0381 Institutional support: RVO:61389013 Keywords : DNA compaction * magnetic microspheres * DNA isolation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.687, year: 2015

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

DNA barcoding and isolation of vertically transmitted ascomycetes in sorghum from Burkina Faso

DEFF Research Database (Denmark)

Stokholm, Michaela S.; Wulff, Ednar Gadelha; Zida, Elisabeth P.

2016-01-01

-day-old seedlings was analyzed by 18S ribosomal DNA (rDNA) amplicon sequencing. More than 99% of the fungal rDNA was found to originate from ascomycetes. The distribution of ascomycetes at species level was subsequently analyzed by barcoding of ITS2 rDNA. Eighteen Operational Taxonomic Units (OTUs) were identified......Molecular identification of fungal taxa commonly transmitted through seeds of sorghum in Western Africa is lacking. In the present study, farm-saved seeds, collected from four villages in Northern Burkina Faso, were surface sterilized and the distribution of fungal DNA in seeds and seven...... samples collected in Central Burkina Faso confirming a common occurrence. E. sorghinum was highly predominant in seedlings both measured by DNA analysis and by isolation. The dominance of E. sorghinum was particularly strong in roots from poorly growing seedlings. Pathogenicity of E. sorghinum isolates...

Developing a biological dosimeter based on mitochondrial DNA

Energy Technology Data Exchange (ETDEWEB)

Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

1996-12-31

Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

Developing a biological dosimeter based on mitochondrial DNA

International Nuclear Information System (INIS)

Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

1995-01-01

Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

Application of real-time PCR to postharvest physiology – DNA isolation

Science.gov (United States)

Real-time PCR technology has been widely used in the postharvest plant physiology research. One of the difficulties to isolate DNA from plant martial and pathogen cells is the presence of rigid polysaccharide cell walls and capsules, which physically protect DNA from cell lysis. Many materials requi...

Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

Science.gov (United States)

Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

2014-10-21

Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

Science.gov (United States)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

Science.gov (United States)

Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

2017-10-01

Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

Science.gov (United States)

Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

2011-01-01

A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

International Nuclear Information System (INIS)

Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

1976-01-01

Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

Theoretical study on magnetism induced by H vacancy in isolated Alq3 and Gaq3 molecules

Science.gov (United States)

Ju, Lin; Xu, Tongshuai; Zhang, Yongjia; Sun, Li

2017-10-01

The magnetism induced by H vacancy in isolated Alq3 and Gaq3 molecules has been studied based on density functional theory. The isolated stoichiometric Alq3 and Gaq3 molecules are non-magnetic. With an H vacancy, both Alq3 and Gaq3 molecules could show magnetism, which are mainly due to the polarization of the C 2p electrons and the magnetic moments are mainly distributed at most nearby C atoms of H vacancies. This is because the unpaired electron on the C atom appears, when the H atom nearby is removed. Six cases of the H vacancy introduced in the Alq3 and Gaq3 molecules are considered, respectively. By comparing the relative defect formation energy, the V H3 vacancy is most likely to appear in the two kinds of molecules. In addition, for the ground state configuration of isolated Alq3 and Gaq3 molecules with two H vacancies, the energy of the ferromagnetic state is lower than that of the antiferromagnetic state, which means that the ferromagnetic state is stable. The ferromagnetic mechanism can be explained by the Heisenberg direct exchange interaction between two the polarized C atoms. Our work opens a new way to synthesize organic magnetic materials and perfects the theory of organic ferromagnetism by introducing the d 0 ferromagnetism.

Matrix isolation sublimation: An apparatus for producing cryogenic beams of atoms and molecules

Energy Technology Data Exchange (ETDEWEB)

Sacramento, R. L.; Alves, B. X.; Silva, B. A.; Wolff, W.; Cesar, C. L. [Instituto de Física, Universidade Federal do Rio de Janeiro, Caixa Postal 68528, 21941-972 Rio de Janeiro, RJ (Brazil); Oliveira, A. N. [Instituto de Física, Universidade Federal do Rio de Janeiro, Caixa Postal 68528, 21941-972 Rio de Janeiro, RJ (Brazil); INMETRO, Av. Nossa Senhora das Graças, 50 25250-020 Duque de Caxias, RJ (Brazil); Li, M. S. [Instituto de Física de São Carlos, Universidade de São Paulo, Ave. Trabalhador São Carlense, 400, 13565-590 São Carlos, SP (Brazil)

2015-07-15

We describe the apparatus to generate cryogenic beams of atoms and molecules based on matrix isolation sublimation. Isolation matrices of Ne and H{sub 2} are hosts for atomic and molecular species which are sublimated into vacuum at cryogenic temperatures. The resulting cryogenic beams are used for high-resolution laser spectroscopy. The technique also aims at loading atomic and molecular traps.

See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

NARCIS (Netherlands)

van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

2008-01-01

Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

Science.gov (United States)

Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

2012-03-14

We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

Science.gov (United States)

Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

2017-12-14

Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

Science.gov (United States)

Haslan, Ezgi; Kimiran-Erdem, Ayten

2013-09-01

In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

[Isolation and partial characterization of DNA topoisomerase I from the nucleoids of white mustard chloroplasts].

Science.gov (United States)

Belkina, G G; Pogul'skaia, E V; Iurina, N P

2004-01-01

DNA topoisomerase was isolated for the first time from nucleoids of white mustard (Sinapis alba L.) chloroplasts. The enzyme had a molecular weight of 70 kDa; it was ATP-independent, required the presence of mono- (K+) and bivalent (Mg2+) cations, and was capable of relaxing both negatively and positively supercoiled DNA. These results suggest that the enzyme isolated belongs to type IB DNA topoisomerases.

Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

Science.gov (United States)

Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

2007-12-15

The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

International Nuclear Information System (INIS)

Waters, R.

1980-01-01

The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

Directory of Open Access Journals (Sweden)

Angel Alberto Noda

2014-06-01

Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

A protocol for large scale genomic DNA isolation for cacao genetics ...

African Journals Online (AJOL)

Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the preservation of tissue samples for future use in cacao genome studies. The present study proposes a method for the ...

Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

NARCIS (Netherlands)

Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

2016-01-01

We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

Science.gov (United States)

Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

2003-10-01

Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

Science.gov (United States)

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

Directory of Open Access Journals (Sweden)

Mengyi Yang

2018-01-01

Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

Isolation and characterization of the dnaA gene of Rickettsia prowazekii

International Nuclear Information System (INIS)

Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

1998-01-01

The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

Science.gov (United States)

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

Energy Technology Data Exchange (ETDEWEB)

Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

2008-12-16

Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

Energy Technology Data Exchange (ETDEWEB)

Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-12-04

Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer

2017-09-14

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

Comparison of field-collected ascovirus isolates by DNA hybridization, host range, and histopathology.

Science.gov (United States)

Hamm, J J; Styer, E L; Federici, B A

1998-09-01

Six field-collected ascovirus isolates obtained from five noctuid species in the continental United States were compared with respect to the general relatedness of their DNA, host range, and histopathology. Two isolates were from Spodoptera frugiperda, and the other four were from Autographa precationis, Heliothis virescens, Helicoverpa zea, and Trichoplusia ni. DNA-DNA hybridization studies showed that the six isolates belonged to three distinct viral species, with the isolates from S. frugiperda composing one species, those from A. precationis and H. virescens a second species, and those from H. zea and T. ni a third species. The host range and histopathology of each isolate was studied in eight noctuid species, S. frugiperda, Spodoptera ornithogalli, Spodoptera exigua, Spodoptera eridania, H. virescens, H. zea, A. precationis, and Feltia subterranea. Though some variation existed between the different isolates of each viral species, distinct patterns were apparent for each. The viral species from S. frugiperda had a host range that was limited primarily to Spodoptera species and both isolates of this virus only replicated and caused significant pathology in the fat body, whereas the viral species from A. precationis and H. virescens had a much broader host range that included most of the species tested, but also had a tissue tropism primarily restricted to the fat body. The viral species from T. ni and H. zea readily infected all the hosts tested, where the principal site of replication and significant pathology was the epidermis. In many test hosts, however, this viral species also replicated and caused significant pathology in the tracheal epithelium and to a lesser extent in the fat body. Aside from contributing to knowledge of ascovirus biology, these studies indicate that DNA hybridization profiles combined with studies of host range and tissue tropism can be used as characters for defining ascovirus species. Copyright 1998 Academic Press.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

DNA and bone structure preservation in medieval human skeletons.

Science.gov (United States)

Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

2015-06-01

Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Induction and isolation of DNA transformation mutants in the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Hegerich, P.A.; Bruschi, C.V.

1987-01-01

The objective of this research was to induce and isolate mutants of the yeast Saccharomyces cerevisiae which have become transformable by purified plasmid DNA. Non-transformable yeast cells were mutagenized by ultraviolet light using a 65% lethal dose (480 ergs/mm 2 ). After a period of overnight liquid holding recovery, the irradiated cells were subjected to DNA transformation using our CaCl 2 protocol with the multi-marker shuttle plasmid pBB carrying the LEU 2 leucine gene. Following transformation the colonies that grew on selective leucineless medium were identified and subjected to further genetic analysis. From a total of 1 x 10 9 cells the authors have isolated 7 colonies deriving from putative mutants that have acquired the capability to uptake plasmid DNA. The transformants were cured from the plasmid by its mitotic loss on non-selective medium, then re-transformed to verify their genetic competence to give rise to a number of transformants comparable to transformable strains. We have identified and isolated one mutant, coded trs-1, which is able to reproduce a frequency of transformation comparable with the tranformable control. They, therefore, conclude that this mutant is specific for plasmid DNA transformation and that the mutation is mitotically stable

Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

DEFF Research Database (Denmark)

Atabay, H. I.; Bang, Dang Duong; Aydin, F.

2002-01-01

Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

Science.gov (United States)

Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

2016-12-15

Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

Science.gov (United States)

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A simple method for DNA isolation from Xanthomonas spp.

Directory of Open Access Journals (Sweden)

Gomes Luiz Humberto

2000-01-01

Full Text Available A simple DNA isolation method was developed with routine chemicals that yields high quality and integrity preparations when compared to some of the most well known protocols. The method described does not require the use of lysing enzymes, water bath and the DNA was obtained within 40 minutes The amount of nucleic acid extracted (measured in terms of absorbancy at 260 nm from strains of Xanthomonas spp., Pseudomonas spp. and Erwinia spp. was two to five times higher than that of the most commonly used method.

Isolation and Characterisation of Some Microalgae Bioactive Molecules

Directory of Open Access Journals (Sweden)

Emeka Ugoala

2016-12-01

Full Text Available This study involved the isolation, structure elucidation, and biological screening of secondary metabolites in freshwater microalgae for bioactive and chemically novel compounds. Isolates were fractionated and purified from the methanol, ethyl acetate, dichloromethane, petroleum ether and aqueous extracts of microalgae via column chromatography technique over silica gel using a gradient mixture of solvents. The chemical structures of isolated compounds have been elucidated using Solid-state cross polarization (CP and magic angle spinning (MAS 13C-NMR spectroscopic technique at spectrometer frequency at a field strength corresponding to 91.3695 MHz for 13C and 363.331 MHz for 1H. Of the nine compounds isolated, eight have a glycan skeleton with attached amino acids units. Two of the eight contain beta amino acids units. These are not very common metabolites but hold promise as drug leads. The elements of diversity in the isolates were the gluco and manno configurations of the pyranose ring, the α-configurations at the anomeric centre, and the positions of the carbohydrate and amino acid sectors in the ring. These molecules are not easily available through gene technology since they are post translational products resulting from the activity of glycosyl hydrolases and transferases. The chemical shifts were rationalized in terms of the number of sugar residues, the sugar ring structures, the positions and anomeric configurations of the inter-sugar linkages. Considering all the NMR data, it was concluded that the compounds were glycylglycylglycylglycine, α-D-glucopyranosyl-2-amino-4-methylpentanoic acid, α-D-glucopyranosyl-2-methylamino-4-methylpentanoic acid, α-D-glucopyranosyl-2-amino-4-methylpentanoate, α-D-glucopyranosyl-glycylglycine, α-D-glucopyranosyl-3-aminobutanoic acid, α-D-glucopyranosyl-2,4,7-triaminooctantrioic acid, α-D-mannopyranosyl-2-amino-3-methylbutanoic acid and α-D-mannopyranosyl-3-aminobutanoic acid.

Diffractive Imaging of Coherent Nuclear Motion in Isolated Molecules

Energy Technology Data Exchange (ETDEWEB)

Yang, Jie; Guehr, Markus; Shen, Xiaozhe; Li, Renkai; Vecchione, Theodore; Coffee, Ryan; Corbett, Jeff; Fry, Alan; Hartmann, Nick; Hast, Carsten; Hegazy, Kareem; Jobe, Keith; Makasyuk, Igor; Robinson, Joseph; Robinson, Matthew S.; Vetter, Sharon; Weathersby, Stephen; Yoneda, Charles; Wang, Xijie; Centurion, Martin

2016-10-03

Observing the motion of the nuclear wave packets during a molecular reaction, in both space and time, is crucial for understanding and controlling the outcome of photoinduced chemical reactions. We have imaged the motion of a vibrational wave packet in isolated iodine molecules using ultrafast electron diffraction with relativistic electrons. The time-varying interatomic distance was measured with a precision 0.07 Å and temporal resolution of 230 fs full width at half maximum. The method is not only sensitive to the position but also the shape of the nuclear wave packet.

Isolation of Retroelement from Plant Genomic DNA

OpenAIRE

sprotocols

2014-01-01

Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

Directory of Open Access Journals (Sweden)

Hsiu-Fang Fan

2018-05-01

Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

International Nuclear Information System (INIS)

Tabet, J.

2007-11-01

The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

On the trends of Fukui potential and hardness potential derivatives in isolated atoms vs. atoms in molecules.

Science.gov (United States)

Bhattacharjee, Rituparna; Roy, Ram Kinkar

2014-10-28

In the present study, trends of electronic contribution to molecular electrostatic potential [Vel(r¯)(r=0)], Fukui potential [v(+)f|(r=0) and v(-)f|(r=0)] and hardness potential derivatives [Δ(+)h(k) and Δ(-)h(k)] for isolated atoms as well as atoms in molecules are investigated. The generated numerical values of these three reactivity descriptors in these two electronically different situations are critically analyzed through the relevant formalism. Values of Vel(r¯) (when r → 0, i.e., on the nucleus) are higher for atoms in molecules than that of isolated atoms. In contrast, higher values of v(+)|(r=0) and v(-)|(r=0) are observed for isolated atoms compared to the values for atoms in a molecule. However, no such regular trend is observed for the Δ(+)h(k) and Δ(-)h(k) values, which is attributed to the uncertainty in the Fukui function values of atoms in molecules. The sum of Fukui potential and the sum of hardness potential derivatives in molecules are also critically analyzed, which shows the efficacy of orbital relaxation effects in quantifying the values of these parameters. The chemical consequence of the observed trends of these descriptors in interpreting electron delocalization, electronic relaxation and non-negativity of atomic Fukui function indices is also touched upon. Several commonly used molecules containing carbon as well as heteroatoms are chosen to make the investigation more insightful.

Leaf storage conditions and genomic DNA isolation efficiency in ...

African Journals Online (AJOL)

SERVER

2008-03-04

Mar 4, 2008 ... Full Length Research Paper. Leaf storage ... 2006; Chen and Yang, 2004; Nan et al., 2003; Ipek and. Madison, 2001 ... the same function of pure DNA isolation. These are .... eppendorf tube and then dropped in liquid nitrogen for 2 min. The weighed ..... the solubility of polysaccharides in ethanol, effectively.

Replication of kinetoplast minicircle DNA

International Nuclear Information System (INIS)

Sheline, C.T.

1989-01-01

These studies describe the isolation and characterization of early minicircle replication intermediates from Crithidia fasciculata, and Leishmania tarentolae, the mitochondrial localization of a type II topoisomerase (TIImt) in C. fasciculata, and the implication of the aforementioned TIImt in minicircle replication in L. tarentolae. Early minicircle replication intermediates from C. fasciculata were identified and characterized using isolated kinetoplasts to incorporate radiolabeled nucleotides into its DNA. The pulse-label in an apparent theta-type intermediate chase into two daughter molecules. A uniquely gapped, ribonucleotide primed, knotted molecule represents the leading strand in the model proposed, and a highly gapped molecule represents the lagging strand. This theta intermediate is repaired in vitro to a doubly nicked catenated dimer which was shown to result from the replication of a single parental molecule. Very similar intermediates were found in the heterogeneous population of minicircles of L. tarentolae. The sites of the Leishmania specific discontinuities were mapped and shown to lie within the universally conserved sequence blocks in identical positions as compared to C. fasciculata and Trypanosoma equiperdum

Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

Directory of Open Access Journals (Sweden)

Ilko Bald

2014-09-01

Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

DEFF Research Database (Denmark)

Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

2016-01-01

A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

International Nuclear Information System (INIS)

Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

Science.gov (United States)

Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

2010-03-01

Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

Isolation and identification of female DNA on postcoital penile swabs.

Science.gov (United States)

Cina, S J; Collins, K A; Pettenati, M J; Fitts, M

2000-06-01

After sexual assault, cells originating from the assailant may be recovered from the victim. Through polymerase chain reaction (PCR)-based technology, positive scientific identification of the assailant may be made from these cells. Described is a prospective study describing a method for positively identifying cells from a female sex partner obtained from postcoital swabs of the penis of the male sex partner. Swabs were taken from the penis of a man at 1- to 24-hour intervals after coitus. DNA was isolated from each swab through standard organic extraction methods. The presence of female DNA was detected using the gender-specific amelogenin marker. Extracted DNA was amplified for eight different genetic loci using the Promega PowerPlex kit (Promega) and Amplitaq Gold (Perkin Elmer). Amplified samples were electrophoresed on precast sequencing gels (Hitachi) and were analyzed fluorescently using Hitachi's FMBIO 2 fluorescent scanner and software. Each sample obtained from a penile swab or condom was compared to male and female buccal controls. Female DNA was isolated from all postcoital penile swabs as determined by exclusive amplification of the X-chromosome specific 212 base pair amelogenin marker. In all cases, scientific identification of the female DNA from the swabs was determined by coamplification of eight STR loci (PowerPlex) and was compared to female and male control profiles. Cells shed from a female victim during sexual intercourse can be retrieved from the penis of a male offender after sexual intercourse during a 1- to 24-hour postcoital interval. DNA can be extracted from these cells and can be used to scientifically identify the female sexual participant through PCR-based technology. It is suggested that penile swabs be taken from alleged perpetrators of sexual assaults to associate them with a female victim.

Rapid isolation of high molecular weight DNA from single dried ...

African Journals Online (AJOL)

ANAND

For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

Science.gov (United States)

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Development of a Novel Self-Enclosed Sample Preparation Device for DNA/RNA Isolation in Space

Science.gov (United States)

Zhang, Ye; Mehta, Satish K.; Pensinger, Stuart J.; Pickering, Karen D.

2011-01-01

Modern biology techniques present potentials for a wide range of molecular, cellular, and biochemistry applications in space, including detection of infectious pathogens and environmental contaminations, monitoring of drug-resistant microbial and dangerous mutations, identification of new phenotypes of microbial and new life species. However, one of the major technological blockades in enabling these technologies in space is a lack of devices for sample preparation in the space environment. To overcome such an obstacle, we constructed a prototype of a DNA/RNA isolation device based on our novel designs documented in the NASA New Technology Reporting System (MSC-24811-1/3-1). This device is self-enclosed and pipette free, purposely designed for use in the absence of gravity. Our design can also be modified easily for preparing samples in space for other applications, such as flowcytometry, immunostaining, cell separation, sample purification and separation according to its size and charges, sample chemical labeling, and sample purification. The prototype of our DNA/RNA isolation device was tested for efficiencies of DNA and RNA isolation from various cell types for PCR analysis. The purity and integrity of purified DNA and RNA were determined as well. Results showed that our developed DNA/RNA isolation device offers similar efficiency and quality in comparison to the samples prepared using the standard protocol in the laboratory.

A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

Science.gov (United States)

Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

2012-05-15

Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

Human cultured cells are capable to incorporate isolated plant mitochondria loaded with exogenous DNA

Directory of Open Access Journals (Sweden)

Laktionov P. P.

2012-07-01

Full Text Available Aim. To investigate the possibility of human cultured cells to incorporate isolated mitochondria together with exogenous DNA introduced into organelles. Methods. Two approaches were used for this purpose, fluorescent labelling of mitochondria and/or DNA with subsequent analysis of the cells subjected to incubation by microscopy or by quantitative PCR. Results. We have shown that human cultured cells lines, HeLa and HUVEC, are capable to uptake isolated plant mitochondria and that this process depends on the incubation time and concentration of organelles present in medium. The incorporated mitochondria can serve as vehicles to deliver exogenous DNA into human cells, this DNA is then distributed in different cell compartments. Conclusions. These results are preliminary and need further investigations, including testing the possibility of human cells to incorporate the mitochondria of human or animal origin and creating genetic construction which could provide certain selectivity or stability of the transferred exogenous DNA upon cell uptake of the mitochondria as vectors.

Isolation and characterization of the human uracil DNA glycosylase gene

International Nuclear Information System (INIS)

Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

1989-01-01

A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

Identification of a DNA restriction-modification system in Pectobacterium carotovorum strains isolated from Poland.

Science.gov (United States)

Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E

2006-02-01

Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.

Electronic properties and assambly of DNA-based molecules on gold surfaces

DEFF Research Database (Denmark)

Salvatore, Princia

, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-05-01

Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

Science.gov (United States)

Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

2000-08-01

Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

Improving the yield and quality of DNA isolated from white-rot fungi.

Science.gov (United States)

Kuhad, R C; Kapoor, R K; Lal, R

2004-01-01

A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

Science.gov (United States)

Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

2013-01-01

To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

DEFF Research Database (Denmark)

Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

2007-01-01

We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

2017-01-01

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Shake and stew: a non-destructive PCR-ready DNA isolation method from a single preserved fish larva.

Science.gov (United States)

Alvarado Bremer, J R; Smith, B L; Moulton, D L; Lu, C-P; Cornic, M

2014-01-01

A rapid non-destructive alternative to isolate DNA from an individual fish larva is presented, based on the suspension of epithelial cells through vortex forces, and the release of DNA in a heated alkaline solution. DNA from >6056 fish larvae isolated using this protocol has yielded a high PCR amplification success rate (>93%), suggesting its applicability to other taxonomic groups or sources when tissue amount is the limiting factor. © 2014 The Fisheries Society of the British Isles.

Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

DEFF Research Database (Denmark)

Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

2016-01-01

that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

Effects of atmospheric pressure plasmas on isolated and cellular DNA-a review.

Science.gov (United States)

Arjunan, Krishna Priya; Sharma, Virender K; Ptasinska, Sylwia

2015-01-29

Atmospheric Pressure Plasma (APP) is being used widely in a variety of biomedical applications. Extensive research in the field of plasma medicine has shown the induction of DNA damage by APP in a dose-dependent manner in both prokaryotic and eukaryotic systems. Recent evidence suggests that APP-induced DNA damage shows potential benefits in many applications, such as sterilization and cancer therapy. However, in several other applications, such as wound healing and dentistry, DNA damage can be detrimental. This review reports on the extensive investigations devoted to APP interactions with DNA, with an emphasis on the critical role of reactive species in plasma-induced damage to DNA. The review consists of three main sections dedicated to fundamental knowledge of the interactions of reactive oxygen species (ROS)/reactive nitrogen species (RNS) with DNA and its components, as well as the effects of APP on isolated and cellular DNA in prokaryotes and eukaryotes.

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

Science.gov (United States)

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

Directory of Open Access Journals (Sweden)

Afrooz DANESHPARVAR

2017-06-01

Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

Science.gov (United States)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

Charge transport properties of a twisted DNA molecule: A renormalization approach

Energy Technology Data Exchange (ETDEWEB)

Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2016-10-20

In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

Directory of Open Access Journals (Sweden)

Tess V Clendenen

Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Optimization of DNA isolation and PCR protocol for RAPD analysis ...

African Journals Online (AJOL)

hope&shola

The method involves a modified CTAB extraction employing polyvinyl ... The technique is ideal for isolation of DNA from different plant species and .... The tubes were incubated at 65°C in hot air oven or water bath for 60-90 min with intermittent shaking and .... permission to collect germ plasm Financial assistance (to.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of pyrimidine dimer content of isolated DNA by nuclease digestion

International Nuclear Information System (INIS)

Farland, W.H.; Sutherland, B.M.

1980-01-01

Isolated DNA is highly susceptible to degradation by exogenous nucleases. Complete digestion is possible with a number of well-characterized enzymes from a variety of sources. Treatment of DNA with a battery of enzymes including both phosphodiesterase and phosphatase activities yields a mixture of nucleosides and inorganic phosphate (P/sub i/) as a final product. Unlike native DNA, ultraviolet-irradiated DNA is resistant to complete digestion. Setlow et al. demonstrated that the structural changes in the DNA responsible for the nuclease resistance were the formation of cyclobutyl pyrimidine dimers, the major photoproduct in UV-irradiated DNA. Using venom phosphodiesterase, they demonstrated that UV irradiation of DNA affected both the rate and extent of enzymatic hydrolysis. In addition, it was demonstrated that the major nuclease-resistant product of this hydrolysis was an oligonucleotide containing dimerized pyrimidines. Treatment of the DNA to split the dimers, either photochemically or photoenzymatically, rendered the polymer more susceptible to hydrolysis by the phosphodiesterase. The specificity of photoreactivating enzyme for pyrimidine dimers lends support to the role of these structures in conferring nuclease resistance to UV-irradiated DNA. The nuclease resistance of DNA containing dimers has been the basis of several assays for the measurement of these photoproducts. Sutherland and Chamberlin reported the development of a rapid and sensitive assay for dimers in 32 P-labeled DNA

Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

Science.gov (United States)

Kühnemund, M; Nilsson, M

2015-05-15

Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

Science.gov (United States)

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

KAUST Repository

So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

2014-01-01

This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

KAUST Repository

So, Hongyun

2014-11-24

This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

Isolation of proteins involved in the replication of adenoviral DNA in vitro

International Nuclear Information System (INIS)

Lichy, J.H.; Nagata, K.; Friefeld, B.R.; Enomoto, T.; Field, J.; Guggenheimer, R.A.; Ikeda, J.E.; Horwitz, M.S.; Hurwitz, J.

1983-01-01

The simple mechanism of replication of adenoviral DNA has made adenovirus an especially useful model system for studies of eukaryotic replication mechanisms. The availability of this in vitro system that replicates exogenously added Ad DNA-pro has made it possible to characterize the factors involved in replication. The results presented in this paper summarize our further fractionation of the in vitro system. First, the properties of two factors purified from the uninfected nuclear extract are described. Second, the separation of the pTP/Ad Pol complex into subunits and the properties of the isolated subunits are presented. The 140K protein is shown to possess the Ad DNA polymerase activity. The results suggest that the only DNA polymerase required for adenoviral DNA replication in vitro is the 140K Ad DNA polymerase and that this enzyme is probably a viral gene product. 50 references, 10 figures, 3 tables

UV laser-induced histone-DNA crosslinking proceeds via the N-terminal tails

International Nuclear Information System (INIS)

Stefanovski, V.; Dimitrov, S.; Angelov, D.; Keskinova, E.; Pashev, I.

1990-01-01

The covalent crosslinking of histones to DNA by UV laser irradiation is accomplished solely via the N-terminal part of the molecule. Irradiated isolated calfthymus nuclei are treated with clostripain. The crosslinked protein-DNA complexes are isolated and the presence of each core histone analyzed by dot-immunoassay using antibodies, specific to the central globular domain of the respective histone. The reaction is negative for all core histones i.e. the globular domain is absent. It means that this domain has not been crosslinked to DNA and, once cleaved by clostripain, it has been stripped from DNA during the centrigugation in CsCl. This peculiar property of the crosslinked procedure makes it particularly useful in addressing some yet unanswered questions concerning histone-DNA interactions, such as the interaction of the N-terminal tails with linker DNA, the effect of the transient postsynthetic histone acetylation on its interaction with DNA, etc. These questions are now under study. 1 fig., 6 refs

The T-cell accessory molecule CD4 recognizes a monomorphic determinant on isolated Ia

DEFF Research Database (Denmark)

Gay, D; Buus, S; Pasternak, J

1988-01-01

The membrane protein CD4 is commonly found on mature T cells specific for antigen in association with class II major histocompatibility complex (MHC; Ia) proteins. This correlation has led to the suggestion that CD4 binds to a monomorphic region of the Ia molecule on the antigen-presenting cell...... proteins into a planar membrane system, we show that different Ia molecules can greatly enhance the ability of a CD4+ but not a CD4- variant of this class I-restricted T hybrid to respond to isolated class I molecules. T-cell responses can be strongly augmented by the concurrent expression of CD4 on the T...... cell and any of four different Ia proteins on planar membranes, thus supporting the idea that CD4 binds to a monomorphic region of the Ia molecule and increases the avidity with which the T cell can interact with its target....

Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

Directory of Open Access Journals (Sweden)

Haowei Wang

Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

2018-01-01

Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

2018-01-10

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

Directory of Open Access Journals (Sweden)

Jamal, H.

2005-01-01

Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

International Nuclear Information System (INIS)

Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

2008-01-01

We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

Energy Technology Data Exchange (ETDEWEB)

Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki

1980-09-19

Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

2009-07-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

International Nuclear Information System (INIS)

Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

2009-01-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Studying DNA Looping by Single-Molecule FRET

OpenAIRE

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

International Nuclear Information System (INIS)

Chen, J.; Varner, J.E.

1985-01-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

Comparative Analysis of the Genomic DNA Isolation Methods on Inula sp. (Asteraceae

Directory of Open Access Journals (Sweden)

Emre SEVİNDİK

2016-12-01

Full Text Available Simple, fast, low-cost and high throughput protocols are required for DNA isolation of plant species. In this study, phenol chloroform isoamyl alcohol and commercial (Sigma DNA isolation kit methods were applied on some Inula species that belong to Asteraceae family. Genomic DNA amounts, A260, A280, A260/A230 and purity degrees (A260/A280 that were obtained through both methods were measured through electrophoresis and spectrophotometer. Additionally, PCR amplification was realized by primer pairs specific to nrDNA ITS, cpDNA ndhF (972F-1603R and trnL-F regions. Results showed that maximum genomic DNA in nanograms obtained by phenol chloroform isoamyl alcohol method. The study also revealed that I. macrocephala had the maximum DNA and I. heterolepis had the minimum DNA amount. A260/A280 purity degrees showed that the highest and lowest purity in gDNAs obtained through phenol-choloform isoamyl alcohol method were in I.aucheriana and I. salicina, respectively. The highest and lowest purity degrees of gDNAs obtained through commercial kit was observed in I. fragilis and I. macrocephala samples, respectively. PCR amplification results showed that while band profiles of each three regions (ITS, trnL-F and ndhF did not yield positive results in PCR amplifications using phenol-choloform isoamyl alcohol method; PCR band profiles obtained through commercial kit yielded positive results. As a result, it is fair to say that the relation of genomic DNA with PCR was found to be more efficient although the maximum amount of genomic DNA was obtained through phenol chloroform isoamyl alcohol method.

Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

KAUST Repository

Raducanu, Vlad-Stefan

2016-05-01

Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Directory of Open Access Journals (Sweden)

Moore JE

2006-01-01

Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Science.gov (United States)

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

Directory of Open Access Journals (Sweden)

Veronika Lancíková

2014-02-01

Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

Detection of irradiated fresh, chilled, and frozen foods by the mitochondrial DNA method

International Nuclear Information System (INIS)

Machioni, E.; Bergaentzle, M.; Todoriki, S.; Hasselmann, C.; Kuntz, F.

1996-01-01

DNA molecules are very sensitive to ionising radiation, even at low doses. Strand breaks are easy to detect despite the generally low DNA content of foods, but such ruptures are not specific to radiation processing. Preliminary experiments showed that cellular DNA in beef underwent strong enzymatic degradation during storage at +4 o C and thus radiation effects could not be isolated. In order to make DNA strand rupture more specific to radiation (other than by deep freezing) it appears necessary to isolate the irradiated DNA from cell enzymes. This is the case for mitochondrial DNA which is protected from enzymatic degradation by the mitochondrial walls but not from radiation. It can, therefore, be assumed that DNA strand breaks in mitochondria will be specific to ionising radiation. The aim of this work is to develop and validate the proposed test on different food samples (meat and fish products) which are already or may be industrially irradiated in the near future. (author)

Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

Science.gov (United States)

Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

2015-04-01

DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

DNA-A of a highly pathogenic Indian cassava mosaic virus isolated from Jatropha curcas causes symptoms in Nicotiana benthamiana.

Science.gov (United States)

Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian

2014-04-01

Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.

Reliable genotyping of the koala (Phascolarctos cinereus) using DNA isolated from a single faecal pellet.

Science.gov (United States)

Wedrowicz, Faye; Karsa, Mawar; Mosse, Jennifer; Hogan, Fiona E

2013-07-01

The koala, an Australian icon, has been added to the threatened species list. Rationale for the listing includes proposed declines in population size, threats to populations (e.g. disease) and loss and fragmentation of habitat. There is now an urgent need to obtain accurate data to assess the status of koala populations in Australia, to ensure the long-term viability of this species. Advances in genetic techniques have enabled DNA analysis to study and inform the management of wild populations; however, sampling of individual koalas is difficult in tall, often remote, eucalypt forest. The collection of faecal pellets (scats) from the forest floor presents an opportunistic sampling strategy, where DNA can be collected without capturing or even sighting an individual. Obtaining DNA via noninvasive sampling can be used to rapidly sample a large proportion of a population; however, DNA from noninvasively collected samples is often degraded. Factors influencing DNA quality and quantity include environmental exposure, diet and methods of sample collection, storage and DNA isolation. Reduced DNA quality and quantity can introduce genotyping errors and provide inaccurate DNA profiles, reducing confidence in the ability of such data to inform management/conservation strategies. Here, we present a protocol that produces a reliable individual koala genotype from a single faecal pellet and highlight the importance of optimizing DNA isolation and analysis for the species of interest. This method could readily be adapted for genetic studies of mammals other than koalas, particularly those whose diet contains high proportions of volatile materials that are likely to induce DNA damage. © 2013 John Wiley & Sons Ltd.

Use of scintillometric quantitation of unscheduled DNA synthesis in isolated rat hepatocytes for the screening of genotoxic agents

International Nuclear Information System (INIS)

Hsia, M.T.

1987-01-01

The induction of unscheduled DNA synthesis has been considered as a suitable endpoint for the screening of genotoxic agents. Experimentally, unscheduled DNA synthesis is most frequently measured by autoradiography. The purpose of this report was to examine the usefulness of the liquid scintillation counting technique in measuring unscheduled DNA synthesis response in isolated rat hepatocytes. The various liquid scintillation counting-based unscheduled DNA synthesis assay procedures were examined according to the following groupings: (1) procedures based on the acid precipitation of cellular macromolecules, (2) procedures based on isopycnic gradient centrifugation of solubilized cells, (3) procedures based on nuclei isolation in conjunction with other DNA purification methods, and (4) procedures based on the selective retention of hepatocellular DNA. Limited cases in which test chemicals gave positive unscheduled DNA synthesis response in liquid scintillation counting-based assays and negative unscheduled DNA synthesis response in autoradiography-based assays are presented. It is concluded that liquid scintillation counting-based unscheduled DNA synthesis assays represent an appropriate system for inclusion in carcinogenicity and mutagenicity testing programs

Radiation-induced DNA damage as a function of DNA hydration

International Nuclear Information System (INIS)

Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.

1995-01-01

Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

Science.gov (United States)

Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

2012-10-15

Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

Science.gov (United States)

Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

2007-06-15

The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

The Isolation of DNA by Polycharged Magnetic Particles: An Analysis of the Interaction by Zeta Potential and Particle Size.

Science.gov (United States)

Haddad, Yazan; Xhaxhiu, Kledi; Kopel, Pavel; Hynek, David; Zitka, Ondrej; Adam, Vojtech

2016-04-20

Magnetic isolation of biological targets is in major demand in the biotechnology industry today. This study considers the interaction of four surface-modified magnetic micro- and nanoparticles with selected DNA fragments. Different surface modifications of nanomaghemite precursors were investigated: MAN37 (silica-coated), MAN127 (polyvinylpyrrolidone-coated), MAN158 (phosphate-coated), and MAN164 (tripolyphosphate-coated). All particles were positive polycharged agglomerated monodispersed systems. Mean particle sizes were 0.48, 2.97, 2.93, and 3.67 μm for MAN37, MAN127, MAN164, and MAN158, respectively. DNA fragments exhibited negative zeta potential of -0.22 mV under binding conditions (high ionic strength, low pH, and dehydration). A decrease in zeta potential of particles upon exposure to DNA was observed with exception of MAN158 particles. The measured particle size of MAN164 particles increased by nearly twofold upon exposure to DNA. Quantitative PCR isolation of DNA with a high retrieval rate was observed by magnetic particles MAN127 and MAN164. Interaction between polycharged magnetic particles and DNA is mediated by various binding mechanisms such as hydrophobic and electrostatic interactions. Future development of DNA isolation technology requires an understanding of the physical and biochemical conditions of this process.

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

Science.gov (United States)

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

International Nuclear Information System (INIS)

Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

2011-01-01

To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

OpenAIRE

Noor Adila, A. K.; Farah Diba, A. B.; Zamri, Z.; Wan Mohtar, W. Y.; Aidil, A. H.; Mahadi, N. M.; Murad, A. M. A.

2007-01-01

A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP), hexacetyltrimethylammonium bromide (CTAB) or w...

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

Science.gov (United States)

Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

1997-03-01

Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

In silico single-molecule manipulation of DNA with rigid body dynamics.

Directory of Open Access Journals (Sweden)

Pascal Carrivain

2014-02-01

Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

Science.gov (United States)

McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

2016-08-06

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

DNA: Polymer and molecular code

Science.gov (United States)

Shivashankar, G. V.

1999-10-01

The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

PDB4DNA: Implementation of DNA geometry from the Protein Data Bank (PDB) description for Geant4-DNA Monte-Carlo simulations

Science.gov (United States)

Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.

2015-07-01

This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.

Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

Directory of Open Access Journals (Sweden)

Rawnak Laila

2017-01-01

Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

Science.gov (United States)

Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

2000-12-01

Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

NARCIS (Netherlands)

Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

2002-01-01

Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

Energy Technology Data Exchange (ETDEWEB)

Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2015-01-07

Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

Science.gov (United States)

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Samira Mohammadi

2017-01-01

Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Detailed adsorption mechanism of plasmid DNA by newly isolated cellulose from waste flower spikes of Thypa latifolia using quantum chemical calculations.

Science.gov (United States)

Mujtaba, Muhammad; Kaya, Murat; Akyuz, Lalehan; Erdonmez, Demet; Akyuz, Bahar; Sargin, Idris

2017-09-01

Current study was designed to use the newly obtained cellulose from waste flower spikes of Thypa latifolia plant for plasmid DNA adsorption. Cellulose was isolated according to a previously described method including acid and base treatment, and cellulose content was recorded as 17%. T. latifolia cellulose was physicochemically characterized via FT-IR, TGA and SEM techniques. Detailed mechanism of plasmid DNA adsorption by newly isolated cellulose was described using chemical quantum calculations. To check the effect of Cu ++ immobilization on the affinity of cellulose for plasmid DNA, copper ions were immobilized onto T. latifolia cellulose. pUC18 plasmid DNA was used for adsorption studies. Membranes prepared with only T. latifolia cellulose and Cu ++ immobilized T. latifolia cellulose revealed different adsorption ratios as 43.9 and 86.9% respectively. This newly isolated cellulose from waste flower spikes of T. latifolia can be utilized as a suitable carrier for plasmid DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

DEFF Research Database (Denmark)

Olsen, Eva Maria

2012-01-01

Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Directory of Open Access Journals (Sweden)

Stefan Niemann

2009-10-01

Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Science.gov (United States)

Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

2009-10-12

Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

DNA-Protected Silver Clusters for Nanophotonics

Directory of Open Access Journals (Sweden)

Elisabeth Gwinn

2015-02-01

Full Text Available DNA-protected silver clusters (AgN-DNA possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.

Structure of a stacked anthraquinone–DNA complex

Science.gov (United States)

De Luchi, Daniela; Usón, Isabel; Wright, Glenford; Gouyette, Catherine; Subirana, Juan A.

2010-01-01

The crystal structure of the telomeric sequence d(UBrAGG) interacting with an anthraquinone derivative has been solved by MAD. In all previously studied complexes of intercalating drugs, the drug is usually sandwiched between two DNA base pairs. Instead, the present structure looks like a crystal of stacked anthraquinone molecules in which isolated base pairs are intercalated. Unusual base pairs are present in the structure, such as G·G and A·UBr reverse Watson–Crick base pairs. PMID:20823516

Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

Energy Technology Data Exchange (ETDEWEB)

Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

2009-09-01

Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

Variation of DNA damage levels in peripheral blood mononuclear cells isolated in different laboratories

DEFF Research Database (Denmark)

Godschalk, Roger W L; Ersson, Clara; Stępnik, Maciej

2014-01-01

This study investigated the levels of DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG) sensitive sites, as assessed by the comet assay, in peripheral blood mononuclear cells (PBMC) from healthy women from five different countries in Europe. The laboratory in each country (referred...... to as 'centre') collected and cryopreserved PBMC samples from three donors, using a standardised cell isolation protocol. The samples were analysed in 13 different laboratories for DNA damage, which is measured by the comet assay. The study aim was to assess variation in DNA damage in PBMC samples that were......%) by standardisation of the primary comet assay endpoint with calibration curve samples. The level of DNA strand breaks in the samples from two of the centres (0.56-0.61 lesions/10(6) bp) was significantly higher compared with the other three centres (0.41-0.45 lesions/10(6) bp). In contrast, there was no difference...

Overexpression of Aldo-Keto-Reductase in Azole-resistant Clinical Isolates of Candida Glabrata Determined by cDNA-AFLP

Directory of Open Access Journals (Sweden)

Mansour Heidari

2013-01-01

Full Text Available Background: Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata.Methods: The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection inimmunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazoleand itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns ofthe organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potentialgene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains.Results and conclusions: The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinicalisolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

DNA nanotechnology-enabled biosensors.

Science.gov (United States)

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

Science.gov (United States)

Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

2013-12-01

Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

Science.gov (United States)

Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

2015-03-01

Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

OpenAIRE

Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

1988-01-01

A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

Directory of Open Access Journals (Sweden)

Noor Adila, A. K.

2007-01-01

Full Text Available A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP, hexacetyltrimethylammonium bromide (CTAB or without using PVB or CTAB. For RNA isolation, we tested two published protocols, one of which is based on TRI REAGENT (Molecular Research Center, USA and another is simple method employing phenol for RNA extraction and LiCl for precipitation. We found that the protocol involving the use of CTAB produced the highest genomic DNA yield with the best quality compared to other protocols. In the presence of CTAB, unwanted polysaccharides were removed and this method yielded an average amount of 816 ± 12.2 µg DNA/g mycelia with UV absorbance ratios A260/280 and A260/230 of 1.67 ± 0.64 and 1.97 ± 0.23, respectively. The genomic DNA isolated via this protocol is also suitable for PCR amplification and restriction enzyme digestion. As for RNA isolation, the method involving phenol extraction and LiCl precipitation produced the highest yield of RNA with an average amount of 372 ± 6.0 µg RNA/g mycelia. The RNA appears to be relatively pure since it has UV absorbance ratios A260/280 and A260/230 of 1.89 ± 2.00 and 1.99 ± 0.03, respectively. Finally, we have demonstrated that this method could produce RNA of sufficient quality for RT-PCR that amplified a 600 bp fragment of ∆12-fatty acid desaturase gene in C. bainieri.

Direct Visualization of DNA Replication Dynamics in Zebrafish Cells.

Science.gov (United States)

Kuriya, Kenji; Higashiyama, Eriko; Avşar-Ban, Eriko; Tamaru, Yutaka; Ogata, Shin; Takebayashi, Shin-ichiro; Ogata, Masato; Okumura, Katsuzumi

2015-12-01

Spatiotemporal regulation of DNA replication in the S-phase nucleus has been extensively studied in mammalian cells because it is tightly coupled with the regulation of other nuclear processes such as transcription. However, little is known about the replication dynamics in nonmammalian cells. Here, we analyzed the DNA replication processes of zebrafish (Danio rerio) cells through the direct visualization of replicating DNA in the nucleus and on DNA fiber molecules isolated from the nucleus. We found that zebrafish chromosomal DNA at the nuclear interior was replicated first, followed by replication of DNA at the nuclear periphery, which is reminiscent of the spatiotemporal regulation of mammalian DNA replication. However, the relative duration of interior DNA replication in zebrafish cells was longer compared to mammalian cells, possibly reflecting zebrafish-specific genomic organization. The rate of replication fork progression and ori-to-ori distance measured by the DNA combing technique were ∼ 1.4 kb/min and 100 kb, respectively, which are comparable to those in mammalian cells. To our knowledge, this is a first report that measures replication dynamics in zebrafish cells.

DNA Open states and DNA hydratation

International Nuclear Information System (INIS)

Lema-Larre, B. de; Martin-Landrove, M

1995-01-01

It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

Mitochondrial DNA structure of an isolated Tunisian Berber population and its relationship with Mediterranean populations.

Science.gov (United States)

Ben Halim, Nizar; Hsouna, Sana; Lasram, Khaled; Chargui, Mariem; Khemira, Laaroussi; Saidane, Rachid; Abdelhak, Sonia; Kefi, Rym

2018-02-01

Douiret is an isolated Berber population from South-Eastern Tunisia. The strong geographic and cultural isolation characterising this population might have contributed to remarkable endogamy and consanguinity, which were practiced for several centuries. The objective of this study is to evaluate the mitochondrial DNA (mtDNA) genetic structure of Douiret and to compare it to other Mediterranean populations with a special focus on major haplogroup T. Genomic DNA was extracted from blood samples of 58 unrelated individuals collected from the different patrilineal lineages of the population. The hypervariable region 1 of the mtDNA was amplified and sequenced. For comparative analyses, additional HVS1 sequences (n = 4857) were compiled from previous studies. The maternal background of the studied sample from Douiret was mainly of Eurasian origin (74%) followed by Sub-Saharan (17%) and North African (3%) lineages. Douiret harbours the highest frequency of haplogroup T in the Mediterranean region, assigned to the unique subclade T1a (38%). Phylogenetic analysis showed an outlier position of Douiret at the Mediterranean level. The genetic structure of Douiret highlights the presence of founders, most likely of Near/Middle Eastern origin, who conquered this area during the Middle/Late Upper Palaeolithic and Neolithic dispersals.

Determination of melting curves of irradiated DNA preparations and of preparations isolated from irradiated calf lymph nodes

International Nuclear Information System (INIS)

Grabowska, B.

1977-01-01

Measurements of melting curves enabled to establish differences of melting temperature, hyperchromic effect and breadth of the helix - coil phase transition dependent on dose of the ionizing radiation applied and on kind of the irradiated object. Changes of the investigated parameters of DNA irradiated after isolation were detectably more pronounced that of DNA from irradiated lymph nodes. The obtained results suggest a protective role of tissue to the secondary structure of DNA. (author)

DNA-polymerase induced by Herpesvirus papio (HVP) in cells of lymphoblastoid cultures derived from lymphomatous baboons. Report V.

Science.gov (United States)

Djachenko, A G; Lapin, B A

1981-01-01

A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

Science.gov (United States)

Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

2018-01-09

Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

Science.gov (United States)

Eernisse, D J

1992-04-01

DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

Fluorescence Microscopy of Nanochannel-Confined DNA.

Science.gov (United States)

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

International Nuclear Information System (INIS)

Yamamoto, Takatoki; Fujii, Teruo

2010-01-01

Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

Analysis of isolates within species of anuran trypanosomes using random amplified polymorphic DNA.

Science.gov (United States)

Lun, Z R; Desser, S S

1996-01-01

A total of 20 decamer primers were used to generate random applied polymorphic DNA (RAPD) markers from 5 isolates of Trypanosoma fallisi, 3 isolates of T. ranarum, 2 isolates of T. rotatorium, and 2 isolates of T. rotatorium-like trypanosomes in addition to 2 species from the American Type Culture Collection, T. chattoni (ATCC 50294) and Trypanosoma sp. (ATCC 50295). A slight polymorphism was observed among the four isolates of T. fallisi obtained form American toads, Bufo americanus, collected in Algonquin Park, Ontario, Canada, and an isolate obtained from the same species of host collected in Marquette, Michigan, United States, and produced similarity coefficients ranging from 80.7% to 96.9%. Pronounced polymorphism was recorded among the three isolates of T. ranarum from bullfrogs, Rana catesbeiana, collected in Ontario, Canada, and in Maryland, United States, and from a Northern leopard frog, R. pipiens, collected in Minnesota (USA). The similarity coefficients ranged from 54.7% to 59.5%, suggesting that alleles of these isolates were conserved over a wide geographic range. The high degree of polymorphism observed in two isolates of T. rotatorium from a bullfrog collected in Ontario and two isolates of a T. rotatorium-like parasite from the green frog R. clamitans, collected in Louisiana (USA) suggests that they are different species. These results reflect the high similarity among isolates from the same geographic location and the pronounced polymorphism apparent among isolates from distant geographic locations.

Visual Analysis of DNA Microarray Data for Accurate Molecular Identification of Non-albicans Candida Isolates from Patients with Candidemia Episodes

OpenAIRE

De Luca Ferrari, Michela; Ribeiro Resende, Mariângela; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Gonoi, Tohru; Mikami, Yuzuru; Tominaga, Kenichiro; Kamei, Katsuhiko; Zaninelli Schreiber, Angelica; Trabasso, Plinio; Moretti, Maria Luiza

2013-01-01

The performance of a visual slide-based DNA microarray for the identification of non-albicans Candida spp. was evaluated. Among 167 isolates that had previously been identified by Vitek 2, the agreement between DNA microarray and sequencing results was 97.6%. This DNA microarray platform showed excellent performance.

Packaging DNA Origami into Viral Protein Cages.

Science.gov (United States)

Linko, Veikko; Mikkilä, Joona; Kostiainen, Mauri A

2018-01-01

The DNA origami technique is a widely used method to create customized, complex, spatially well-defined two-dimensional (2D) and three-dimensional (3D) DNA nanostructures. These structures have huge potential to serve as smart drug-delivery vehicles and molecular devices in various nanomedical and biotechnological applications. However, so far only little is known about the behavior of these novel structures in living organisms or in cell culture/tissue models. Moreover, enhancing pharmacokinetic bioavailability and transfection properties of such structures still remains a challenge. One intriguing approach to overcome these issues is to coat DNA origami nanostructures with proteins or lipid membranes. Here, we show how cowpea chlorotic mottle virus (CCMV) capsid proteins (CPs) can be used for coating DNA origami nanostructures. We present a method for disassembling native CCMV particles and isolating the pure CP dimers, which can further bind and encapsulate a rectangular DNA origami shape. Owing to the highly programmable nature of DNA origami, packaging of DNA nanostructures into viral protein cages could find imminent uses in enhanced targeting and cellular delivery of various active nano-objects, such as enzymes and drug molecules.

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

Science.gov (United States)

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-01-01

and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

Science.gov (United States)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

Science.gov (United States)

Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

2017-01-01

The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

Energy Technology Data Exchange (ETDEWEB)

Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

2015-06-01

Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

Directory of Open Access Journals (Sweden)

Gamal Mohamedin Hassan

2016-01-01

Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

Isolated single-molecule magnets on native gold.

Science.gov (United States)

Zobbi, Laura; Mannini, Matteo; Pacchioni, Mirko; Chastanet, Guillaume; Bonacchi, Daniele; Zanardi, Chiara; Biagi, Roberto; Del Pennino, Umberto; Gatteschi, Dante; Cornia, Andrea; Sessoli, Roberta

2005-03-28

The incorporation of thioether groups in the structure of a Mn12 single-molecule magnet, [Mn12(O12)(L)16(H2O)4] with L = 4-(methylthio)benzoate, is a successful route to the deposition of well-separated clusters on native gold surfaces and to the addressing of individual molecules by scanning tunnelling microscopy.

Water versus DNA A new deal for proton transport modeling in biological matter

International Nuclear Information System (INIS)

Champion, C; Quinto, M A; Monti, J M; Galassi, M E; Fojón, O A; Hanssen, J; Rivarola, R D; Week, P F

2015-01-01

Water vapor is a common surrogate of DNA for modeling the proton-induced ionizing processes in living tissue exposed to radiations. The present study aims at scrutinizing the validity of this approximation and then revealing new insights into proton-induced energy transfers by a comparative analysis between water and realistic biological medium. In this context, self-consistent quantum mechanical modeling of the ionization and electron capture processes is reported within the continuum distorted wave-eikonal initial state framework for both isolated water molecules and DNA components impacted by proton beams. (paper)

A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

Science.gov (United States)

Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

2017-11-17

The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

Molecular profiles of Venezuelan isolates of Trypanosoma sp. by random amplified polymorphic DNA method.

Science.gov (United States)

Perrone, T M; Gonzatti, M I; Villamizar, G; Escalante, A; Aso, P M

2009-05-12

Nine Trypanosoma sp. Venezuelan isolates, initially presumed to be T. evansi, were collected from three different hosts, capybara (Apure state), horse (Apure state) and donkey (Guarico state) and compared by the random amplification polymorphic DNA technique (RAPD). Thirty-one to 46 reproducible fragments were obtained with 12 of the 40 primers that were used. Most of the primers detected molecular profiles with few polymorphisms between the seven horse, capybara and donkey isolates. Quantitative analyses of the RAPD profiles of these isolates revealed a high degree of genetic conservation with similarity coefficients between 85.7% and 98.5%. Ten of the primers generated polymorphic RAPD profiles with two of the three Trypanosoma sp. horse isolates, namely TeAp-N/D1 and TeGu-N/D1. The similarity coefficient between these two isolates and the rest, ranged from 57.9% to 68.4% and the corresponding dendrogram clustered TeAp-N/D1 and Te Gu-N/D1 in a genetically distinct group.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

International Nuclear Information System (INIS)

Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

1999-01-01

The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

International Nuclear Information System (INIS)

Hayes, S.; Hayes, C.; Brand, L.

1981-01-01

A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

DNA damage, homology-directed repair, and DNA methylation.

Directory of Open Access Journals (Sweden)

Concetta Cuozzo

2007-07-01

Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

Science.gov (United States)

Sharp, Richard J.; Williams, Ralph A. D.

1988-01-01

Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

DNA repair in Haemophilus influenzae: isolation and characterization of an ultraviolet sensitive mutator mutant

International Nuclear Information System (INIS)

Walter, R.B.

1985-01-01

DNA repair in Haemophilus influenzae appears to be quite different from that seen in Escherichia coli in that H. influenzae shows neither SOS nor adaptation phenomena. Repair of DNA lesions in H. influenzae has been seen to occur via recombinational, excision, and mismatch repair pathways acting independently of one another. The author has isolated an ultraviolet (UV)-sensitive mutator mutant (mutB1) of H. influenzae Rd which shows deficiencies in both recombinational and mismatch repair pathways. This mutant is sensitive to a variety of DNA damaging agents as well as being hypermutable by alkylating agents and base analogues. MutB1 cells do not show post-UV DNA breakdown but do begin excision after UV irradiation. Genetic transformation with UV-irradiated DNA on mut B1 recipients shows that high (HE) and low (LE) efficiency markers are transformed at a ratio of 1.0 as in the mismatch repair deficient hex 1 mutant; however, kinetics of UV-inactivation experiments indicate that HE markers are sensitized and act as LE markers do on wild type recipients. Thus, the mutB gene product appears to play a role in both DNA repair and genetic transformation. A model is outlined which presents a role for a DNA helicase in both DNA repair and genetic transformation of H. influenzae

Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

Directory of Open Access Journals (Sweden)

Zach Hensel

Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

DNA microarray genotyping and virulence and antimicrobial resistance gene profiling of methicillin-resistant Staphylococcus aureus bloodstream isolates from renal patients.

LENUS (Irish Health Repository)

McNicholas, Sinead

2012-02-01

Thirty-six methicillin-resistant Staphylococcus aureus (MRSA) bloodstream isolates from renal patients were genetically characterized by DNA microarray analysis and spa typing. The isolates were highly clonal, belonging mainly to ST22-MRSA-IV. The immune evasion and enterotoxin gene clusters were found in 29\\/36 (80%) and 33\\/36 (92%) isolates, respectively.

DNA microarray genotyping and virulence and antimicrobial resistance gene profiling of methicillin-resistant Staphylococcus aureus bloodstream isolates from renal patients.

LENUS (Irish Health Repository)

McNicholas, Sinead

2011-12-01

Thirty-six methicillin-resistant Staphylococcus aureus (MRSA) bloodstream isolates from renal patients were genetically characterized by DNA microarray analysis and spa typing. The isolates were highly clonal, belonging mainly to ST22-MRSA-IV. The immune evasion and enterotoxin gene clusters were found in 29\\/36 (80%) and 33\\/36 (92%) isolates, respectively.

Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

International Nuclear Information System (INIS)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

2017-01-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

Science.gov (United States)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

2017-03-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

Science.gov (United States)

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

Quantitive DNA Fiber Mapping

Energy Technology Data Exchange (ETDEWEB)

Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-01-28

Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

Towards Point-of-Care Diagnosis of Pulmonary Tuberculosis and Drug Susceptibility Testing by Whole Genome Sequencing of DNA Isolated from Sputum

Directory of Open Access Journals (Sweden)

Kayzad S. Nilgiriwala

2017-12-01

Full Text Available Preliminary screening of pulmonary tuberculosis (TB in India still relies on sputum microscopy, which has low sensitivity leading to high rate of false negatives. Moreover, conventional phenotypic drug susceptibility testing (DST is conducted over a period of weeks leading to delays in correct treatment. Next generation sequencing technologies (Illumina and Oxford Nanopore have made it possible to sequence miniscule amount of DNA and generate enough data within a day for detecting specific microbes and their DST profile. Sputum samples from two pulmonary TB patients were processed by decontamination and DNA was isolated from the decontaminated sputum sediments. The isolated DNA was used for sequencing by Illumina and by MinION (Oxford Nanopore Technologies. The sequence data was used to diagnose TB and to determine the DST profiles for the first- and second-line drugs by Mykrobe Predictor. Validation was conducted by sequencing DNA (by Illumina isolated from pure growth culture from both the samples individually. DNA sequencing data (for both, Ilumina and MinION from one of the sputum samples indicated the presence of Mycobacterium tuberculosis (M. tb resistant to streptomycin, isoniazid, rifampicin and ethambutol and its lineage was predicted to be Beijing East Asia. The second sample indicated the presence of M. tb sensitive to the first- and second-line drugs by MinION and showed minor resistance call only to rifampicin by Illumina. Lineage of the second sample was predicted to be East Africa Indian Ocean, whereas Illumina data indicated it to be Delhi Central Asia. The two samples were correctly diagnosed for the presence of M. tb in the sputum DNA. Their DST profiles and lineage were also successfully determined from both the sequencing platforms (with minor discrepancies paving the way towards diagnosis and DST of TB from DNA isolated from sputum samples at point-of-care. Nanopore sequencing currently requires skilled personnel for DNA

DNA dosimetry applied to problems in genetic toxicology

International Nuclear Information System (INIS)

Rahn, R.O.; Sellin, H.

1984-01-01

Studies have been conducted using uv, metal ions, and polyaromatic hydrocarbons as DNA damaging agents. A method has been devised for removing Pt-base adducts from DNA and for separating these adducts chromatographically. This method has been applied to DNA isolated from tissue culture cells treated with cisplatin. The results indicate that a significant (approx. 35%) portion of the cisplatin binds in a form which is the same as that found in DNA treated in vitro. This adduct consists of two guanine molecules connected by a platinum atom. A very useful tool in photobiological research has been the substitution of BrdUrd for Thd in DNA. Following radiation, debromination and damage to the sugar phosphate backbone results. However, the actual chemical event responsible for the observed enhanced cell killing is not known. Attempts to answer this question have employed the use of IdUrd instead of BrdUrd, because of certain spectroscopic and chemical advantages. Current research deals with the mechanisms by which the uracil radical formed upon dehalogenation reacts with its environment to pick up a hydrogen atom and form uracil

DNA nanotechnology

Science.gov (United States)

Seeman, Nadrian C.; Sleiman, Hanadi F.

2018-01-01

DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

Development of a Competent and Trouble Free DNA Isolation Protocol for Downstream Genetic Analyses in Glycine Species

Directory of Open Access Journals (Sweden)

Muhammad Amjad Nawaz

2016-08-01

Full Text Available Extraction of deoxyribose nucleic acid (DNA from plants is preliminary step in molecular biology. Fast and cost effective genomic DNA isolation from Glycine species for downstream application is a major bottleneck. Here we report a high throughput and trouble free method for genomic DNA extraction from leaf and seeds of Glycine species with high quality and quantity. Protocol reports the optimization by employing different concentrations of CTAB and PVP in extraction buffer. Efficiency of optimized protocol was compared with frequently used DNA extraction methods. Wide adoptability and utility of this protocol was confirmed by DNA extraction from leaves as well as seeds of G. max, G. soja, G. tomentella and G. latifolia. Extracted DNA was successfully subjected to PCR amplification of five microsatellite markers and four putative glycosyltransferase genes. DNA extraction protocol is reproducible, trouble free, rapid and can be adopted for plant molecular biology applications.

DNA maintenance in plastids and mitochondria of plants

Directory of Open Access Journals (Sweden)

Delene J Oldenburg

2015-10-01

Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.

An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

Directory of Open Access Journals (Sweden)

Kaur Jatinder

2010-05-01

Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

Isolation and Purification of an Early Pregnancy Factor–Like Molecule from Culture Supernatants Obtained from Lymphocytes of Pregnant Women

OpenAIRE

Aranha, Clara; Natraj, Usha; Iyer, K. S.; Shahani, Savitri

1998-01-01

Purpose:Our purpose was to determine whether lymphocytes synthesize proteins during pregnancy, to observe whether one of the proteins synthesized has early pregnancy factor (EPF)–like activity and to isolate and purify this molecule from culture supernatants obtained from stimulated lymphocytes of pregnant women.

Single Molecule Nano-Metronome

Science.gov (United States)

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Preparation and Characterization of Super-paramagnetic Nano-beads for DNA Isolation

Institute of Scientific and Technical Information of China (English)

Xin XIE; Xu ZHANG; Bing Bin YU; wei Yang FE

2004-01-01

Unique coupling reagent, bis-(2-hydroxyethyl methacrylate) phosphate was used to prepare coated and functionalized superparamagnetic nanobeads, leading to a simple, effective method for coating the nanobeads. With this method, the thickness of the coating layer and the functional group contents on the nano-beads could be controlled by changing the quantity of the coated monomers. The nanobeads were characterized by means of transmission electron microscopy (TEM) and Fourier transformation infrared spectroscopy (FTIR). The carboxyl-modified magnetic nano-beads were employed to streamline the protocol of isolation of genomic DNA from the human whole blood.

Rhodotorula mucilaginosa, a quorum quenching yeast exhibiting lactonase activity isolated from a tropical shoreline.

Science.gov (United States)

Ghani, Norshazliza Ab; Sulaiman, Joanita; Ismail, Zahidah; Chan, Xin-Yue; Yin, Wai-Fong; Chan, Kok-Gan

2014-04-09

Two microbial isolates from a Malaysian shoreline were found to be capable of degrading N-acylhomoserine lactones. Both Matrix Assisted Laser Desorption Ionization-Time of Flight-Mass Spectrometry and 18S rDNA phylogenetic analyses confirmed that these isolates are Rhodotorula mucilaginosa. Quorum quenching activities were detected by a series of bioassays and rapid resolution liquid chromatography analysis. The isolates were able to degrade various quorum sensing molecules namely N-hexanoyl-L-homoserine lactone (C6-HSL), N-(3-oxo-hexanoyl)-L-homoserine lactone (3-oxo-C6-HSL) and N-(3-hydroxyhexanoyl)-L-homoserine lactone (3-hydroxy-C6-HSL). Using a relactonisation assay to verify the quorum quenching mechanism, it is confirmed that Rh. mucilaginosa degrades the quorum sensing molecules via lactonase activity. To the best of our knowledge, this is the first documentation of the fact that Rh. mucilaginosa has activity against a broad range of AHLs namely C6-HSL, 3-oxo-C6-HSL and 3-hydroxy-C6-HSL.

Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

Science.gov (United States)

Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

2018-03-27

Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA Repair Systems

Indian Academy of Sciences (India)

DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

NARCIS (Netherlands)

Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.

2001-01-01

A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

Science.gov (United States)

Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

2006-05-01

A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

Science.gov (United States)

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

Science.gov (United States)

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Atomically precise arrays of fluorescent silver clusters: a modular approach for metal cluster photonics on DNA nanostructures.

Science.gov (United States)

Copp, Stacy M; Schultz, Danielle E; Swasey, Steven; Gwinn, Elisabeth G

2015-03-24

The remarkable precision that DNA scaffolds provide for arraying nanoscale optical elements enables optical phenomena that arise from interactions of metal nanoparticles, dye molecules, and quantum dots placed at nanoscale separations. However, control of ensemble optical properties has been limited by the difficulty of achieving uniform particle sizes and shapes. Ligand-stabilized metal clusters offer a route to atomically precise arrays that combine desirable attributes of both metals and molecules. Exploiting the unique advantages of the cluster regime requires techniques to realize controlled nanoscale placement of select cluster structures. Here we show that atomically monodisperse arrays of fluorescent, DNA-stabilized silver clusters can be realized on a prototypical scaffold, a DNA nanotube, with attachment sites separated by <10 nm. Cluster attachment is mediated by designed DNA linkers that enable isolation of specific clusters prior to assembly on nanotubes and preserve cluster structure and spectral purity after assembly. The modularity of this approach generalizes to silver clusters of diverse sizes and DNA scaffolds of many types. Thus, these silver cluster nano-optical elements, which themselves have colors selected by their particular DNA templating oligomer, bring unique dimensions of control and flexibility to the rapidly expanding field of nano-optics.

Multiphoton processes in isolated atoms and molecules

International Nuclear Information System (INIS)

Sudbo, A.S.

1979-11-01

The theory of coherent excitation of a multilevel quantum mechanical system is developed. Damping of the system is taken into account by the use of a density matrix formalism. General properties of the wave function and/or the density matrix are discussed. The physical implications for the behavior of the system are described, together with possible applications of the formalism, including the infrared multiphoton excitation of molecules, and optical pumping in alkali atoms. Experimental results are presented on the infrared multiphoton dissociation of molecules, followed by a discussion of the general features of this process. The experimental results were obtained using a crossed laser and molecular beam method, and the emphasis is on determining the properties of the dissociating molecule and the dissociation products. The dissociation process is shown to be described very well by the standard statistical theory (RRKM theory) of unimolecular reactions, a brief presentation of which is also included

Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

Isolation and mapping of a C3'H gene (CYP98A49) from globe artichoke, and its expression upon UV-C stress

NARCIS (Netherlands)

Moglia, A.; Comino, C.; Portis, E.; Acquadro, A.; Vos, de C.H.; Beekwilder, M.J.; Lanteri, S.

2009-01-01

Globe artichoke represents a natural source of phenolic compounds with dicaffeoylquinic acids along with their biosynthetic precursor chlorogenic acid (5-caffeoylquinic acid) as the predominant molecules. We report the isolation and characterization of a full-length cDNA and promoter of a globe

Amplification of a transcriptionally active DNA sequence in the human brain

International Nuclear Information System (INIS)

Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

1986-01-01

The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

Science.gov (United States)

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Structural Transitions in Supercoiled Stretched DNA

Science.gov (United States)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

Stabilization of chromosomes by DNA intercalators for flow karyotyping and identification by banding of isolated chromosomes

NARCIS (Netherlands)

Aten, J. A.; Buys, C. H.; van der Veen, A. Y.; Mesa, J. R.; Yu, L. C.; Gray, J. W.; Osinga, J.; Stap, J.

1987-01-01

A number of structurally unrelated DNA intercalators have been studied as stabilizers of mitotic chromosomes during isolation from rodent and human metaphase cells. Seven out of the nine intercalators tested were found to be useful as chromosome stabilizing agents. Chromosome suspensions prepared in

A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

Science.gov (United States)

Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

2008-07-01

Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

Science.gov (United States)

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Single Molecule Nano-Metronome

OpenAIRE

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2006-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

Science.gov (United States)

Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

2002-01-01

To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

Modeling DNA

Science.gov (United States)

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

International Nuclear Information System (INIS)

Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

1988-01-01

Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

Directory of Open Access Journals (Sweden)

Stalis Norma Ethica

2013-12-01

Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

The elastic theory of a single DNA molecule

Indian Academy of Sciences (India)

methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

International Nuclear Information System (INIS)

Kobzarenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

2012-01-01

The effect of excess energy on the primary radical cations of bifunctional carbonyl compounds and aliphatic alkynes was simulated by matrix isolation method using rare gas matrices with various ionization potentials. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. It was shown that the radical cations of bifunctional compounds (CH 3 OCH 2 COCH 3 and CH 3 COCOCH 3 ) dissociated effectively yielding · CH 3 radicals upon irradiation in solid argon matrix at T≤16 K. In addition to isolated methyl radicals, the radical pairs consisting of two methyl radicals separated by two CO molecules were detected in the case of diacetyl. The probability of fragmentation decreases with the decreasing excess energy by switching from Ar to Xe. In general, bifunctional molecules were found to be less stable to “hot” ionic fragmentation in low-temperature solids in comparison with simple prototype compounds. In the case of alkynes of the R--C≡CH type, a noticeable yield of fragmentation products was observed when R=–C(CH 3 ) 3 , but it was negligible for R=–CH 3 . The mechanisms of “hot” reactions and excess energy relaxation are discussed. - Highlights: ► Radiolysis of bifunctional organic compounds and alkynes. ► Dependence of “hot” fragmentation probability from molecular structure. ► Ions of bifunctional compounds are less stable than those of monofunctional ones. ► Alkynes are rather stable to “hot” fragmentation.

Biofunctionalization of zinc oxide nanowires for DNA sensory applications

Directory of Open Access Journals (Sweden)

Rudolph Bettina

2011-01-01

Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

Hydroxychavicol, a key ingredient of Piper betle induces bacterial cell death by DNA damage and inhibition of cell division.

Science.gov (United States)

Singh, Deepti; Narayanamoorthy, Shwetha; Gamre, Sunita; Majumdar, Ananda Guha; Goswami, Manish; Gami, Umesh; Cherian, Susan; Subramanian, Mahesh

2018-05-20

Antibiotic resistance is a global problem and there is an urgent need to augment the arsenal against pathogenic bacteria. The emergence of different drug resistant bacteria is threatening human lives to be pushed towards the pre-antibiotic era. Botanical sources remain a vital source of diverse organic molecules that possess antibacterial property as well as augment existing antibacterial molecules. Piper betle, a climber, is widely used in south and south-east Asia whose leaves and nuts are consumed regularly. Hydroxychavicol (HC) isolated from Piper betle has been reported to possess antibacterial activity. It is currently not clear how the antibacterial activity of HC is manifested. In this investigation we show HC generates superoxide in E. coli cells. Antioxidants protected E. coli against HC induced cell death while gshA mutant was more sensitive to HC than wild type. DNA damage repair deficient mutants are hypersensitive to HC and HC induces the expression of DNA damage repair genes that repair oxidative DNA damage. HC treated E. coli cells are inhibited from growth and undergo DNA condensation. In vitro HC binds to DNA and cleaves it in presence of copper. Our data strongly indicates HC mediates bacterial cell death by ROS generation and DNA damage. Damage to iron sulfur proteins in the cells contribute to amplification of oxidative stress initiated by HC. Further HC is active against a number of Gram negative bacteria isolated from patients with a wide range of clinical symptoms and varied antibiotic resistance profiles. Copyright © 2018 Elsevier Inc. All rights reserved.

Concentrating and labeling genomic DNA in a nanofluidic array

DEFF Research Database (Denmark)

Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

2018-01-01

, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

Science.gov (United States)

Freeman, S.; Pham, M.; Rodriguez, R.J.

1993-01-01

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

Detection of DNA hybridizations using solid-state nanopores

International Nuclear Information System (INIS)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

2010-01-01

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Detection of DNA hybridizations using solid-state nanopores

Energy Technology Data Exchange (ETDEWEB)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

2010-08-20

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Beyond DNA repair: DNA-PK function in cancer

OpenAIRE