WorldWideScience

Sample records for isolated dna molecules

  1. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  2. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  3. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  4. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  5. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  6. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  7. Quantification of ion-induced molecular fragmentation of isolated 2-deoxy-D-ribose molecules

    NARCIS (Netherlands)

    Alvarado Chacon, F.; Bari, S.; Hoekstra, R.A.; Schlathölter, T.A.

    2006-01-01

    Recent experiments on low energy ion-induced damage to DNA building blocks indicate that ion induced DNA damage is dominated by deoxyribose disintegration (Phys. Rev. Lett., 2005, 95, 153201). We have studied interactions of keV H+ and Heq+ with isolated deoxyribose molecules by means of high

  8. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  9. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  10. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  11. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  12. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  13. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  14. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  15. DNA isolation from rat tail or ear

    NARCIS (Netherlands)

    Cuppen, E.

    2010-01-01

    This protocol describes a rapid procedure for isolating DNA from rat tail or ear punches. The simplest version of the protocol can be scaled for use in 96-well (deep-well) plates. The quality of the DNA is sufficient for any polymerase chain reaction (PCR)-based genotyping approach.

  16. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  17. Multiphoton processes in isolated atoms and molecules

    International Nuclear Information System (INIS)

    Sudbo, A.S.

    1979-11-01

    The theory of coherent excitation of a multilevel quantum mechanical system is developed. Damping of the system is taken into account by the use of a density matrix formalism. General properties of the wave function and/or the density matrix are discussed. The physical implications for the behavior of the system are described, together with possible applications of the formalism, including the infrared multiphoton excitation of molecules, and optical pumping in alkali atoms. Experimental results are presented on the infrared multiphoton dissociation of molecules, followed by a discussion of the general features of this process. The experimental results were obtained using a crossed laser and molecular beam method, and the emphasis is on determining the properties of the dissociating molecule and the dissociation products. The dissociation process is shown to be described very well by the standard statistical theory (RRKM theory) of unimolecular reactions, a brief presentation of which is also included

  18. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  19. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  20. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  1. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  2. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  3. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  4. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  5. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  6. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  7. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  8. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  9. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  10. An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

    Science.gov (United States)

    Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

    2006-10-01

    In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

  11. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  12. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  15. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  16. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  17. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  18. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  19. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  20. Isolation of DNA methyltransferase from plants

    International Nuclear Information System (INIS)

    Ehrlich, K.; Malbroue, C.

    1987-01-01

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from [ 3 H]AdoMet incorporated into acid precipitable material per h at 30 0 ). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30 0

  1. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  2. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  3. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  5. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  6. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  7. Characterization of Botrytis cinerea isolates from chickpea: DNA ...

    African Journals Online (AJOL)

    Characterization of Botrytis cinerea isolates from chickpea: DNA polymorphisms, cultural, morphological and virulence characteristics. Suresh Pande, Mamta Sharma, G. Krishna Kishore, L. Shivram, U. Naga Mangala ...

  8. Characterization of Botrytis cinerea isolates from chickpea: DNA ...

    African Journals Online (AJOL)

    Administrator

    2010-11-15

    Nov 15, 2010 ... 2Department of Plant Sciences, University of Hyderabad, Hyderabad 500 046, India. ... similarity of the isolates varied from 14-44%, and the isolates were separated ..... application to human mitochondrial DNA restriction sites.

  9. Diffractive Imaging of Coherent Nuclear Motion in Isolated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jie; Guehr, Markus; Shen, Xiaozhe; Li, Renkai; Vecchione, Theodore; Coffee, Ryan; Corbett, Jeff; Fry, Alan; Hartmann, Nick; Hast, Carsten; Hegazy, Kareem; Jobe, Keith; Makasyuk, Igor; Robinson, Joseph; Robinson, Matthew S.; Vetter, Sharon; Weathersby, Stephen; Yoneda, Charles; Wang, Xijie; Centurion, Martin

    2016-10-03

    Observing the motion of the nuclear wave packets during a molecular reaction, in both space and time, is crucial for understanding and controlling the outcome of photoinduced chemical reactions. We have imaged the motion of a vibrational wave packet in isolated iodine molecules using ultrafast electron diffraction with relativistic electrons. The time-varying interatomic distance was measured with a precision 0.07 Å and temporal resolution of 230 fs full width at half maximum. The method is not only sensitive to the position but also the shape of the nuclear wave packet.

  10. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  11. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  12. Isolation and Characterisation of Some Microalgae Bioactive Molecules

    Directory of Open Access Journals (Sweden)

    Emeka Ugoala

    2016-12-01

    Full Text Available This study involved the isolation, structure elucidation, and biological screening of secondary metabolites in freshwater microalgae for bioactive and chemically novel compounds. Isolates were fractionated and purified from the methanol, ethyl acetate, dichloromethane, petroleum ether and aqueous extracts of microalgae via column chromatography technique over silica gel using a gradient mixture of solvents. The chemical structures of isolated compounds have been elucidated using Solid-state cross polarization (CP and magic angle spinning (MAS 13C-NMR spectroscopic technique at spectrometer frequency at a field strength corresponding to 91.3695 MHz for 13C and 363.331 MHz for 1H. Of the nine compounds isolated, eight have a glycan skeleton with attached amino acids units. Two of the eight contain beta amino acids units. These are not very common metabolites but hold promise as drug leads. The elements of diversity in the isolates were the gluco and manno configurations of the pyranose ring, the α-configurations at the anomeric centre, and the positions of the carbohydrate and amino acid sectors in the ring. These molecules are not easily available through gene technology since they are post translational products resulting from the activity of glycosyl hydrolases and transferases. The chemical shifts were rationalized in terms of the number of sugar residues, the sugar ring structures, the positions and anomeric configurations of the inter-sugar linkages. Considering all the NMR data, it was concluded that the compounds were glycylglycylglycylglycine, α-D-glucopyranosyl-2-amino-4-methylpentanoic acid, α-D-glucopyranosyl-2-methylamino-4-methylpentanoic acid, α-D-glucopyranosyl-2-amino-4-methylpentanoate, α-D-glucopyranosyl-glycylglycine, α-D-glucopyranosyl-3-aminobutanoic acid, α-D-glucopyranosyl-2,4,7-triaminooctantrioic acid, α-D-mannopyranosyl-2-amino-3-methylbutanoic acid and α-D-mannopyranosyl-3-aminobutanoic acid.

  13. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...

  14. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  15. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  16. Specificity of DNA import into isolated mitochondria from plants and mammals

    Directory of Open Access Journals (Sweden)

    Koulintchenko M. V.

    2014-01-01

    Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.

  17. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  18. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  19. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  20. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  1. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  2. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  3. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  4. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  5. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Occurrence, isolation and DNA identification of Streptococcus ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... Streptococcus thermophilus involved in Algerian ... among reference, and wild strains of S. thermophilus and for their differentiation from Enterococcus spp. ..... Isolation and characterization of Lactobacillus delbrueckii ssp.

  7. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  8. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  9. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  10. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  11. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  12. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  13. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  14. Isolated single-molecule magnets on native gold.

    Science.gov (United States)

    Zobbi, Laura; Mannini, Matteo; Pacchioni, Mirko; Chastanet, Guillaume; Bonacchi, Daniele; Zanardi, Chiara; Biagi, Roberto; Del Pennino, Umberto; Gatteschi, Dante; Cornia, Andrea; Sessoli, Roberta

    2005-03-28

    The incorporation of thioether groups in the structure of a Mn12 single-molecule magnet, [Mn12(O12)(L)16(H2O)4] with L = 4-(methylthio)benzoate, is a successful route to the deposition of well-separated clusters on native gold surfaces and to the addressing of individual molecules by scanning tunnelling microscopy.

  15. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  16. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  17. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  18. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  19. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  20. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  1. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  2. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  3. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  4. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  5. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  6. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  7. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  8. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  9. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  10. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  11. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  12. Optimization of DNA isolation and PCR protocol for RAPD analysis ...

    African Journals Online (AJOL)

    hope&shola

    The method involves a modified CTAB extraction employing polyvinyl ... The technique is ideal for isolation of DNA from different plant species and .... The tubes were incubated at 65°C in hot air oven or water bath for 60-90 min with intermittent shaking and .... permission to collect germ plasm Financial assistance (to.

  13. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    SERVER

    2008-03-04

    Mar 4, 2008 ... Full Length Research Paper. Leaf storage ... 2006; Chen and Yang, 2004; Nan et al., 2003; Ipek and. Madison, 2001 ... the same function of pure DNA isolation. These are .... eppendorf tube and then dropped in liquid nitrogen for 2 min. The weighed ..... the solubility of polysaccharides in ethanol, effectively.

  14. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  15. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  16. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  17. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  18. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  19. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  20. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  1. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  2. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  3. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  4. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  5. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  6. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  7. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  9. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  10. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  11. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  12. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)

    2012-07-27

    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  13. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  14. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  15. Matrix isolation sublimation: An apparatus for producing cryogenic beams of atoms and molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sacramento, R. L.; Alves, B. X.; Silva, B. A.; Wolff, W.; Cesar, C. L. [Instituto de Física, Universidade Federal do Rio de Janeiro, Caixa Postal 68528, 21941-972 Rio de Janeiro, RJ (Brazil); Oliveira, A. N. [Instituto de Física, Universidade Federal do Rio de Janeiro, Caixa Postal 68528, 21941-972 Rio de Janeiro, RJ (Brazil); INMETRO, Av. Nossa Senhora das Graças, 50 25250-020 Duque de Caxias, RJ (Brazil); Li, M. S. [Instituto de Física de São Carlos, Universidade de São Paulo, Ave. Trabalhador São Carlense, 400, 13565-590 São Carlos, SP (Brazil)

    2015-07-15

    We describe the apparatus to generate cryogenic beams of atoms and molecules based on matrix isolation sublimation. Isolation matrices of Ne and H{sub 2} are hosts for atomic and molecular species which are sublimated into vacuum at cryogenic temperatures. The resulting cryogenic beams are used for high-resolution laser spectroscopy. The technique also aims at loading atomic and molecular traps.

  16. A simple method for DNA isolation from Xanthomonas spp.

    Directory of Open Access Journals (Sweden)

    Gomes Luiz Humberto

    2000-01-01

    Full Text Available A simple DNA isolation method was developed with routine chemicals that yields high quality and integrity preparations when compared to some of the most well known protocols. The method described does not require the use of lysing enzymes, water bath and the DNA was obtained within 40 minutes The amount of nucleic acid extracted (measured in terms of absorbancy at 260 nm from strains of Xanthomonas spp., Pseudomonas spp. and Erwinia spp. was two to five times higher than that of the most commonly used method.

  17. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  18. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  19. Radiation-induced transformations of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Feldman, V.I.

    1998-01-01

    Complete text of publication follows. The studies of radiation-chemical behaviour of isolated organic molecules in rigid inert media are of considerable interest for radiation chemistry and general structural chemistry. Previous efforts were limited to the ESR studies of radicals resulting from some small hydrocarbon molecules in frozen rare gas solutions. Recently, we developed an approach to the radiation chemistry of isolated organic molecules using classic matrix isolation procedure for sample preparation and a combination of ESR and IR spectroscopy for characterization of paramagnetic and diamagnetic species resulting form electron irradiation or organic molecules in solid rare gas matrices at 10-15 K. The results obtained reveal high efficiency of energy transfer from rare gas matrix to organic molecules. The total radiation-chemical yields of degradation of organic molecules in argon and xenon matrices were measured directly by IR spectroscopy. The studies of the effect of electron scavengers on the radiolysis of organic molecules in solid rare gases show that the main primary process is positive hole transfer from matrix to additive molecule. ESR spectra of a number of radical cations (alkanes, ethers, arenes) were first characterized in a low-disturbing environment. It was found that the electronic characteristics (IP, polarizability) of the matrix used had crucial effect on trapping and degradation of primary organic radical cations. Using matrices with various IP provides an unique possibility to examine the chemical meaning of excess energy resulting from exothermic positive hole transfer, that is, to follow the fate of excited cations in condensed phase

  20. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  1. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  2. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  3. Isolation and identification of female DNA on postcoital penile swabs.

    Science.gov (United States)

    Cina, S J; Collins, K A; Pettenati, M J; Fitts, M

    2000-06-01

    After sexual assault, cells originating from the assailant may be recovered from the victim. Through polymerase chain reaction (PCR)-based technology, positive scientific identification of the assailant may be made from these cells. Described is a prospective study describing a method for positively identifying cells from a female sex partner obtained from postcoital swabs of the penis of the male sex partner. Swabs were taken from the penis of a man at 1- to 24-hour intervals after coitus. DNA was isolated from each swab through standard organic extraction methods. The presence of female DNA was detected using the gender-specific amelogenin marker. Extracted DNA was amplified for eight different genetic loci using the Promega PowerPlex kit (Promega) and Amplitaq Gold (Perkin Elmer). Amplified samples were electrophoresed on precast sequencing gels (Hitachi) and were analyzed fluorescently using Hitachi's FMBIO 2 fluorescent scanner and software. Each sample obtained from a penile swab or condom was compared to male and female buccal controls. Female DNA was isolated from all postcoital penile swabs as determined by exclusive amplification of the X-chromosome specific 212 base pair amelogenin marker. In all cases, scientific identification of the female DNA from the swabs was determined by coamplification of eight STR loci (PowerPlex) and was compared to female and male control profiles. Cells shed from a female victim during sexual intercourse can be retrieved from the penis of a male offender after sexual intercourse during a 1- to 24-hour postcoital interval. DNA can be extracted from these cells and can be used to scientifically identify the female sexual participant through PCR-based technology. It is suggested that penile swabs be taken from alleged perpetrators of sexual assaults to associate them with a female victim.

  4. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  6. Testing of DNA isolation for the identification of hemp

    Directory of Open Access Journals (Sweden)

    Tomáš Vyhnánek

    2015-12-01

    Full Text Available Hemp is diploid organism (2n = 2x = 20, genome size 534 Mb with nine pairs of autosomes plus XX (♀ or XY (♂ chromosomes. Cannabis sativa L. is an important economic plant for the production of food, fibre, oils, and intoxicants. Genotypes (varieties or chemovar of hemp with low Δ9-tetrahydrocannabinol content are used for industrial applications. Varieties with high Δ9-tetrahydrocannabinol or high cannabidiol content are used for medicinal applications. Biochemical and molecular methods can be used for identification and classification. An important step for molecular biology methods is to obtain the matrix of the native and sufficiently pure DNA. We tested two different experimental variant of samples (20 mg and 100 mg of seeds, oilcake and dried flowers for analysis of the Italian variety Carmagnola for analysis (harvested in 2014, Hempoint Ltd., Czech Republic. The DNeasy® Plant Mini Kit (Qiagen, GE was used to isolate the DNA. The DNA concentration and purity was assessed by agarose electrophoresis and via a spectrophotometer. Samples of lower weight yielded lower values of DNA concentration (average 16.30 - 38.90 ng.µL-1, but with better purity than samples of higher weight (ratio A260nm/A280nm for low-weight samples was near 1.80. To test the applicability of DNA analysis, we used two SSR markers (CAN1347 and CAN2913. PCR products were separated on 1% agarose and on 8% polyacrylamide electrophoresis. DNA samples obtained from samples of higher weight exhibited less PCR amplification than samples of lower weight. We found no effect of sample weight on the formation of non-specific amplification products during the PCR reaction. Based on our results we can be recommended for practical isolation procedure using DNeasy® Plant Mini Kit with lower of sample weight (20 mg. In future work the procedure for DNA isolating from wheat-cannabis products, e. g. breads, rolls or pasta, will be optimized.

  7. Isolation and characterization of a marsupial DNA photolyase

    International Nuclear Information System (INIS)

    Sabourin, C.L.K.; Ley, R.D.

    1988-01-01

    Post UV-B (280-320 nm) exposure to UV-A (320-400 nm) reverses pyrimidine dimers in the epidermal DNA of the South American opossum Monodelphis domestica. To demonstrate that the observed photorepair is mediated by an enzyme, we have isolated a DNA photolyase from the opossum. DNA photolyase from liver was purified 3000-fold by ammonium sulfate fractionation and phenylsepharose, hydroxylapatite, DEAE-cellulose and DNA-cellulose column chromatography. Heat denaturation completely eliminated the photoreactivating activity. The enzyme was active in the pH range of 5.5 to 8.5 with a pH optimum of 7.5. The enzyme has an apparent molecular weight of 32 000 under nondenaturing conditions. The activity of the enzyme was not affected by sodium chloride up to 250 mM. The action spectrum for the purified DNA photolyase showed activity in the range of 325-475 nm with peak activity at 375 nm. (author)

  8. Isolation and characterization of a marsupial DNA photolyase

    Energy Technology Data Exchange (ETDEWEB)

    Sabourin, C.L.K.; Ley, R.D.

    1988-05-01

    Post UV-B (280-320 nm) exposure to UV-A (320-400 nm) reverses pyrimidine dimers in the epidermal DNA of the South American opossum Monodelphis domestica. To demonstrate that the observed photorepair is mediated by an enzyme, we have isolated a DNA photolyase from the opossum. DNA photolyase from liver was purified 3000-fold by ammonium sulfate fractionation and phenylsepharose, hydroxylapatite, DEAE-cellulose and DNA-cellulose column chromatography. Heat denaturation completely eliminated the photoreactivating activity. The enzyme was active in the pH range of 5.5 to 8.5 with a pH optimum of 7.5. The enzyme has an apparent molecular weight of 32 000 under nondenaturing conditions. The activity of the enzyme was not affected by sodium chloride up to 250 mM. The action spectrum for the purified DNA photolyase showed activity in the range of 325-475 nm with peak activity at 375 nm.

  9. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  10. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  11. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  12. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  13. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  14. Theoretical study on magnetism induced by H vacancy in isolated Alq3 and Gaq3 molecules

    Science.gov (United States)

    Ju, Lin; Xu, Tongshuai; Zhang, Yongjia; Sun, Li

    2017-10-01

    The magnetism induced by H vacancy in isolated Alq3 and Gaq3 molecules has been studied based on density functional theory. The isolated stoichiometric Alq3 and Gaq3 molecules are non-magnetic. With an H vacancy, both Alq3 and Gaq3 molecules could show magnetism, which are mainly due to the polarization of the C 2p electrons and the magnetic moments are mainly distributed at most nearby C atoms of H vacancies. This is because the unpaired electron on the C atom appears, when the H atom nearby is removed. Six cases of the H vacancy introduced in the Alq3 and Gaq3 molecules are considered, respectively. By comparing the relative defect formation energy, the V H3 vacancy is most likely to appear in the two kinds of molecules. In addition, for the ground state configuration of isolated Alq3 and Gaq3 molecules with two H vacancies, the energy of the ferromagnetic state is lower than that of the antiferromagnetic state, which means that the ferromagnetic state is stable. The ferromagnetic mechanism can be explained by the Heisenberg direct exchange interaction between two the polarized C atoms. Our work opens a new way to synthesize organic magnetic materials and perfects the theory of organic ferromagnetism by introducing the d 0 ferromagnetism.

  15. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  16. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  17. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  18. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  19. Comparison of different DNA isolation methods and use of dodecyle trimethyl ammonium bromide (DTAB for the isolation of DNA from meat products

    Directory of Open Access Journals (Sweden)

    Yusuf OZsENSOY

    2016-12-01

    Conclusion: DNA isolation kit, another best method, is recommended due to quality and quantity of DNA for researchers who do not want that phenol/chloroform method have toxic substances. This study is also the first study in which DTAB method is used for DNA extraction from meat products. [J Adv Vet Anim Res 2016; 3(4.000: 368-374

  20. Quorum sensing molecules production by nosocomial and soil isolates Acinetobacter baumannii.

    Science.gov (United States)

    Erdönmez, Demet; Rad, Abbas Yousefi; Aksöz, Nilüfer

    2017-12-01

    Acinetobacter species remain alive in hospitals on various surfaces, both dry and moist, forming an important source of hospital infections. These bacteria are naturally resistant to many antibiotic classes. Although the role of the quorum sensing system in regulating the virulence factors of Acinetobacter species has not been fully elucidated, it has been reported that they play a role in bacterial biofilm formation. The biofilm formation helps them to survive under unfavorable growth conditions and antimicrobial treatments. It is based on the accumulation of bacterial communication signal molecules in the area. In this study, we compared the bacterial signal molecules of 50 nosocomial Acinetobacter baumannii strain and 20 A. baumannii strain isolated from soil. The signal molecules were detected by the biosensor bacteria (Chromobacterium violaceum 026, Agrobacterium tumefaciens A136, and Agrobacterium tumefaciens NTL1) and their separation was determined by thin-layer chromatography. As a result, it has been found that soil-borne isolates can produce 3-oxo-C8-AHL and C8-AHL, whereas nosocomial-derived isolates can produce long-chain signals such as C10-AHL, C12-AHL, C14-AHL and C16-AHL. According to these results, it is possible to understand that these signal molecules are found in the infection caused by A. baumannii. The inhibition of this signaling molecules in a communication could use to prevent multiple antibiotic resistance of these bacteria.

  1. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  2. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  5. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  6. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. The T-cell accessory molecule CD4 recognizes a monomorphic determinant on isolated Ia

    DEFF Research Database (Denmark)

    Gay, D; Buus, S; Pasternak, J

    1988-01-01

    The membrane protein CD4 is commonly found on mature T cells specific for antigen in association with class II major histocompatibility complex (MHC; Ia) proteins. This correlation has led to the suggestion that CD4 binds to a monomorphic region of the Ia molecule on the antigen-presenting cell...... proteins into a planar membrane system, we show that different Ia molecules can greatly enhance the ability of a CD4+ but not a CD4- variant of this class I-restricted T hybrid to respond to isolated class I molecules. T-cell responses can be strongly augmented by the concurrent expression of CD4 on the T...... cell and any of four different Ia proteins on planar membranes, thus supporting the idea that CD4 binds to a monomorphic region of the Ia molecule and increases the avidity with which the T cell can interact with its target....

  8. Polyphenolics free DNA isolation and optimization of PCR-RAPD for ...

    African Journals Online (AJOL)

    , and good quality high molecular weight DNA samples. DNA was isolated from the mature and fresh young tender leaves obtained from various Italian wild populations of fennel. We performed a modified cetyl trimethyl ammonium bromide ...

  9. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  10. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  11. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  12. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  13. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  14. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.

    1989-01-01

    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  15. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  16. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  17. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  18. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  19. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  20. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  1. Why Do Simple Molecules with "Isolated" Phenyl Rings Emit Visible Light?

    Science.gov (United States)

    Zhang, Haoke; Zheng, Xiaoyan; Xie, Ni; He, Zikai; Liu, Junkai; Leung, Nelson L C; Niu, Yingli; Huang, Xuhui; Wong, Kam Sing; Kwok, Ryan T K; Sung, Herman H Y; Williams, Ian D; Qin, Anjun; Lam, Jacky W Y; Tang, Ben Zhong

    2017-11-15

    π-Bonds connected with aromatic rings were generally believed as the standard structures for constructing highly efficient fluorophores. Materials without these typical structures, however, exhibited only low fluorescence quantum yields and emitted in the ultraviolet spectral region. In this work, three molecules, namely bis(2,4,5-trimethylphenyl)methane, 1,1,2,2-tetrakis(2,4,5-trimethylphenyl)ethane, and 1,1,2,2-tetraphenylethane, with nonconjugated structures and isolated phenyl rings were synthesized and their photophysical properties were systematically investigated. Interestingly, the emission spectra of these three molecules could be well extended to 600 nm with high solid-state quantum yields of up to 70%. Experimental and theoretical analyses proved that intramolecular through-space conjugation between the "isolated" phenyl rings played an important role for this abnormal phenomenon.

  2. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  3. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  4. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  5. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  6. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  7. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  8. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in order to establish the storage conditions for the collected samples before DNA extraction. Secondly, the aim was to determine the best protocol for the extraction of high quality DNA, ...

  9. Restricted diffusion of DNA segments within the isolated Escherichia coli nucleoid.

    NARCIS (Netherlands)

    Cunha, S.; Woldringh, C.L.; Odijk, T.

    2005-01-01

    To study the dynamics and organization of the DNA within isolated Escherichia coli nucleoids, we track the movement of a specific DNA region. Labeling of such a region is achieved using the Lac-O/Lac-I system. The Lac repressor-GFP fusion protein binds to the DNA section where tandem repeats of the

  10. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  11. [Isolation and partial characterization of DNA topoisomerase I from the nucleoids of white mustard chloroplasts].

    Science.gov (United States)

    Belkina, G G; Pogul'skaia, E V; Iurina, N P

    2004-01-01

    DNA topoisomerase was isolated for the first time from nucleoids of white mustard (Sinapis alba L.) chloroplasts. The enzyme had a molecular weight of 70 kDa; it was ATP-independent, required the presence of mono- (K+) and bivalent (Mg2+) cations, and was capable of relaxing both negatively and positively supercoiled DNA. These results suggest that the enzyme isolated belongs to type IB DNA topoisomerases.

  12. Comparative DNA isolation behaviours of silica and polymer based sorbents in batch fashion: monodisperse silica microspheres with bimodal pore size distribution as a new sorbent for DNA isolation.

    Science.gov (United States)

    Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali

    2018-02-01

    Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.

  13. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  14. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  15. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  16. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  17. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  18. DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

    Directory of Open Access Journals (Sweden)

    Angel Alberto Noda

    2014-06-01

    Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

  19. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  20. Leaf storage conditions and genomic DNA isolation efficiency in ...

    African Journals Online (AJOL)

    SERVER

    2008-03-04

    Mar 4, 2008 ... Storage of plant tissues for DNA is important to avoid degradation of DNA. Preliminary studies were conducted on Ocimum gratissimum L. in order to establish the storage conditions for the collected samples before DNA extraction. Secondly, the aim was to determine the best protocol for the extraction.

  1. X-ray Diffraction from Isolated and Strongly Aligned Gas-Phase Molecules with a Free-Electron Laser

    DEFF Research Database (Denmark)

    Küpper, Jochen; Stern, Stephan; Holmegaard, Lotte

    2014-01-01

    We report experimental results on x-ray diffraction of quantum-state-selected and strongly aligned ensembles of the prototypical asymmetric rotor molecule 2,5-diiodobenzonitrile using the Linac Coherent Light Source. The experiments demonstrate first steps toward a new approach to diffractive...... imaging of distinct structures of individual, isolated gas-phase molecules. We confirm several key ingredients of single molecule diffraction experiments: the abilities to detect and count individual scattered x-ray photons in single shot diffraction data, to deliver state-selected, e. g., structural......-isomer-selected, ensembles of molecules to the x-ray interaction volume, and to strongly align the scattering molecules. Our approach, using ultrashort x-ray pulses, is suitable to study ultrafast dynamics of isolated molecules....

  2. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  3. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobzarenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2012-01-01

    The effect of excess energy on the primary radical cations of bifunctional carbonyl compounds and aliphatic alkynes was simulated by matrix isolation method using rare gas matrices with various ionization potentials. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. It was shown that the radical cations of bifunctional compounds (CH 3 OCH 2 COCH 3 and CH 3 COCOCH 3 ) dissociated effectively yielding · CH 3 radicals upon irradiation in solid argon matrix at T≤16 K. In addition to isolated methyl radicals, the radical pairs consisting of two methyl radicals separated by two CO molecules were detected in the case of diacetyl. The probability of fragmentation decreases with the decreasing excess energy by switching from Ar to Xe. In general, bifunctional molecules were found to be less stable to “hot” ionic fragmentation in low-temperature solids in comparison with simple prototype compounds. In the case of alkynes of the R--C≡CH type, a noticeable yield of fragmentation products was observed when R=–C(CH 3 ) 3 , but it was negligible for R=–CH 3 . The mechanisms of “hot” reactions and excess energy relaxation are discussed. - Highlights: ► Radiolysis of bifunctional organic compounds and alkynes. ► Dependence of “hot” fragmentation probability from molecular structure. ► Ions of bifunctional compounds are less stable than those of monofunctional ones. ► Alkynes are rather stable to “hot” fragmentation.

  4. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  5. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Accurate episomal HIV 2-LTR circles quantification using optimized DNA isolation and droplet digital PCR.

    Science.gov (United States)

    Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Trypsteen, Wim; Messiaen, Peter; Vermeire, Jolien; Verhasselt, Bruno; Vervisch, Karen; Vandekerckhove, Linos; De Spiegelaere, Ward

    2014-01-01

    In HIV-infected patients on combination antiretroviral therapy (cART), the detection of episomal HIV 2-LTR circles is a potential marker for ongoing viral replication. Quantification of 2-LTR circles is based on quantitative PCR or more recently on digital PCR assessment, but is hampered due to its low abundance. Sample pre-PCR processing is a critical step for 2-LTR circles quantification, which has not yet been sufficiently evaluated in patient derived samples. We compared two sample processing procedures to more accurately quantify 2-LTR circles using droplet digital PCR (ddPCR). Episomal HIV 2-LTR circles were either isolated by genomic DNA isolation or by a modified plasmid DNA isolation, to separate the small episomal circular DNA from chromosomal DNA. This was performed in a dilution series of HIV-infected cells and HIV-1 infected patient derived samples (n=59). Samples for the plasmid DNA isolation method were spiked with an internal control plasmid. Genomic DNA isolation enables robust 2-LTR circles quantification. However, in the lower ranges of detection, PCR inhibition caused by high genomic DNA load substantially limits the amount of sample input and this impacts sensitivity and accuracy. Moreover, total genomic DNA isolation resulted in a lower recovery of 2-LTR templates per isolate, further reducing its sensitivity. The modified plasmid DNA isolation with a spiked reference for normalization was more accurate in these low ranges compared to genomic DNA isolation. A linear correlation of both methods was observed in the dilution series (R2=0.974) and in the patient derived samples with 2-LTR numbers above 10 copies per million peripheral blood mononuclear cells (PBMCs), (R2=0.671). Furthermore, Bland-Altman analysis revealed an average agreement between the methods within the 27 samples in which 2-LTR circles were detectable with both methods (bias: 0.3875±1.2657 log10). 2-LTR circles quantification in HIV-infected patients proved to be more

  7. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  8. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  9. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  10. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  11. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  12. Systematic biases in DNA copy number originate from isolation procedures

    NARCIS (Netherlands)

    van Heesch, S.; Mokry, M.; Boskova, V.; Junker, W.; Mehon, R.; Toonen, P.; de Bruijn, E.; Shull, J.D.; Aitman, T.J.; Cuppen, E.; Guryev, V.

    2013-01-01

    BACKGROUND: The ability to accurately detect DNA copy number variation in both a sensitive and quantitative manner is important in many research areas. However, genome-wide DNA copy number analyses are complicated by variations in detection signal. RESULTS: While GC content has been used to correct

  13. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  14. Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

    Science.gov (United States)

    Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2011-01-01

    A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

  15. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  16. DNA barcoding and isolation of vertically transmitted ascomycetes in sorghum from Burkina Faso

    DEFF Research Database (Denmark)

    Stokholm, Michaela S.; Wulff, Ednar Gadelha; Zida, Elisabeth P.

    2016-01-01

    -day-old seedlings was analyzed by 18S ribosomal DNA (rDNA) amplicon sequencing. More than 99% of the fungal rDNA was found to originate from ascomycetes. The distribution of ascomycetes at species level was subsequently analyzed by barcoding of ITS2 rDNA. Eighteen Operational Taxonomic Units (OTUs) were identified......Molecular identification of fungal taxa commonly transmitted through seeds of sorghum in Western Africa is lacking. In the present study, farm-saved seeds, collected from four villages in Northern Burkina Faso, were surface sterilized and the distribution of fungal DNA in seeds and seven...... samples collected in Central Burkina Faso confirming a common occurrence. E. sorghinum was highly predominant in seedlings both measured by DNA analysis and by isolation. The dominance of E. sorghinum was particularly strong in roots from poorly growing seedlings. Pathogenicity of E. sorghinum isolates...

  17. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  18. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  19. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  20. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  1. A protocol for large scale genomic DNA isolation for cacao genetics ...

    African Journals Online (AJOL)

    Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the preservation of tissue samples for future use in cacao genome studies. The present study proposes a method for the ...

  2. Non liquid nitrogen-based-method for isolation of DNA from ...

    African Journals Online (AJOL)

    A simple, efficient, reliable and cost-effective method for isolation of total genomic DNA from fungi, suitable for polymerase chain reaction (PCR) amplification and other molecular applications was described. The main advantages of the method are: (1) does not require the use of liquid nitrogen for preparation of fungi DNA; ...

  3. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  4. Solid-phase DNA isolation from food matrices using hydrophilic magnetic microspheres

    Czech Academy of Sciences Publication Activity Database

    Trachtová, Š.; Španová, A.; Tóth, J.; Prettl, Z.; Horák, Daniel; Gyenis, J.; Rittich, B.

    2015-01-01

    Roč. 94, April (2015), s. 375-381 ISSN 0960-3085 R&D Projects: GA ČR GAP206/12/0381 Institutional support: RVO:61389013 Keywords : DNA compaction * magnetic microspheres * DNA isolation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.687, year: 2015

  5. Application of real-time PCR to postharvest physiology – DNA isolation

    Science.gov (United States)

    Real-time PCR technology has been widely used in the postharvest plant physiology research. One of the difficulties to isolate DNA from plant martial and pathogen cells is the presence of rigid polysaccharide cell walls and capsules, which physically protect DNA from cell lysis. Many materials requi...

  6. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  7. Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

  8. An efficient DNA isolation method for tropical plants

    African Journals Online (AJOL)

    walkinnet

    2013-05-08

    May 8, 2013 ... 2Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, P. R. ... yielded high-quality DNA from 10 tropical plants including cassava, rubber tree, banana, etc. ..... Major Projects (GrantNo.

  9. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    Bc-repetitive extragenic palindromic polymerase chain reaction (Bc-Rep PCR) analysis was conducted on seven Bacillus thuringiensis isolates accessed from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) culture collection and on five local isolates of entomopathogenic spore-forming bacteria.

  10. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  11. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobrazenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2011-01-01

    Complete text of publication follows. Elucidation of high-energy reaction pathways in the condensed phase is an important issue for basic understanding of the radiation stability of complex organic molecules. As was shown previously, organic radical cations (RC) may undergo fragmentation or rearrangement in solid matrices due to excess energy. The probability of this process depends on both ionization potential (IP) of the molecule and molecular structure. In the present work we have studied the role of 'hot' ionic reaction channels for RC of some bifunctional compounds and alkynes. The effect of excess energy was simulated by matrix isolation method as described in detail earlier. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. In the present work it was shown that the RC of bifunctional compounds (CH 3 OCH 2 COCH 3 , CH 3 CO(CH 2 ) n COCH 3 , n 0/2) dissociated efficiently producing · CH 3 radicals upon irradiation in solid argon matrix at T ≤ 16 K. The probability of fragmentation decreases with decrease of excess energy by switching from Ar to Xe. It is worth noting that acetone RC does not show fragmentation under these conditions. Thus, bifunctional molecules were found to be less stable to 'hot' ionic fragmentation in low-temperature solids in comparison with simple prototype carbonyl compounds. In the case of alkynes of the R-C ≡ CH type, a noticeable yield of fragmentation products was observed when R = -C(CH 3 ) 3 , but it was negligible for R = -CH 3 . It means that the presence of triple bond stabilizes the molecular skeleton of linear alkynes toward 'hot' fragmentation, similarly as it was shown for alkenes. The mechanisms of 'hot' reactions and excess energy relaxation are discussed. This work was supported by the Russian Foundation for Basic Research (project 09-03-00848a).

  12. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  13. Isolation of a sex-linked DNA sequence in cranes.

    Science.gov (United States)

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  14. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  15. Isolation and characterization of the dnaA gene of Rickettsia prowazekii

    International Nuclear Information System (INIS)

    Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

    1998-01-01

    The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

  16. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  17. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  19. Modified method for combined DNA and RNA isolation from peanut and other oil seeds.

    Science.gov (United States)

    Dang, Phat M; Chen, Charles Y

    2013-02-01

    Isolation of good quality RNA and DNA from seeds is difficult due to high levels of polysaccharides, polyphenols, and lipids that can degrade or co-precipitate with nucleic acids. Standard RNA extraction methods utilizing guanidinium-phenol-chloroform extraction has not shown to be successful. RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted selection and other genetic studies. We describe a modified method to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both RNA and DNA from the same seed tissues. High quality nucleic acids were observed based on A(260)/A(280) and A(260)/A(230) ratios above 2.0 and distinct bands on gel-electrophoresis. RNA was shown to be suitable for reverse transcriptase polymerase chain reaction based on actin or 60S ribosomal primer amplification and DNA was shown to have a single band on gel-electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.

  20. Improving the yield and quality of DNA isolated from white-rot fungi.

    Science.gov (United States)

    Kuhad, R C; Kapoor, R K; Lal, R

    2004-01-01

    A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

  1. Effects of atmospheric pressure plasmas on isolated and cellular DNA-a review.

    Science.gov (United States)

    Arjunan, Krishna Priya; Sharma, Virender K; Ptasinska, Sylwia

    2015-01-29

    Atmospheric Pressure Plasma (APP) is being used widely in a variety of biomedical applications. Extensive research in the field of plasma medicine has shown the induction of DNA damage by APP in a dose-dependent manner in both prokaryotic and eukaryotic systems. Recent evidence suggests that APP-induced DNA damage shows potential benefits in many applications, such as sterilization and cancer therapy. However, in several other applications, such as wound healing and dentistry, DNA damage can be detrimental. This review reports on the extensive investigations devoted to APP interactions with DNA, with an emphasis on the critical role of reactive species in plasma-induced damage to DNA. The review consists of three main sections dedicated to fundamental knowledge of the interactions of reactive oxygen species (ROS)/reactive nitrogen species (RNS) with DNA and its components, as well as the effects of APP on isolated and cellular DNA in prokaryotes and eukaryotes.

  2. Does Extracellular DNA Production Vary in Staphylococcal Biofilms Isolated From Infected Implants versus Controls?

    Science.gov (United States)

    Zatorska, Beata; Groger, Marion; Moser, Doris; Diab-Elschahawi, Magda; Lusignani, Luigi Segagni; Presterl, Elisabeth

    2017-08-01

    Prosthetic implant infections caused by Staphylococcus aureus and epidermidis are major challenges for early diagnosis and treatment owing to biofilm formation on the implant surface. Extracellular DNA (eDNA) is actively excreted from bacterial cells in biofilms, contributing to biofilm stability, and may offer promise in the detection or treatment of such infections. (1) Does DNA structure change during biofilm formation? (2) Are there time-dependent differences in eDNA production during biofilm formation? (3) Is there differential eDNA production between clinical and control Staphylococcal isolates? (4) Is eDNA production correlated to biofilm thickness? We investigated eDNA presence during biofilm formation in 60 clinical and 30 control isolates of S aureus and S epidermidis. The clinical isolates were isolated from patients with infections of orthopaedic prostheses and implants: 30 from infected hip prostheses and 30 from infected knee prostheses. The control isolates were taken from healthy volunteers who had not been exposed to antibiotics and a hospital environment during the previous 3 and 12 months, respectively. Control S epidermidis was isolated from the skin of the antecubital fossa, and control S aureus was isolated from the nares. For the biofilm experiments the following methods were used to detect eDNA: (1) fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI), (2) eDNA extraction using a commercial kit, and (3) confocal laser scanning microscopy for 24-hour biofilm observation using propidium iodide and concanavalin-A staining; TOTO ® -1 and SYTO ® 60 staining were used for observation and quantification of eDNA after 6 and 24 hours of biofilm formation. Additionally antibiotic resistance was described. eDNA production as observed by confocal laser scanning microscopy was greater in clinical isolates than controls (clinical isolates mean ± SD: 1.84% ± 1.31%; control mean ± SD: 1.17% ± 1.37%; p biofilm formation. After 24 hours, the

  3. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  4. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  5. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  6. Good quality Vitis RNA obtained from an adapted DNA isolation protocol

    Directory of Open Access Journals (Sweden)

    Isabel Baiges

    2003-03-01

    Full Text Available Grapevine is a woody plant, whose high carbohydrate and phenolic compound contents usually interferes with nucleic acid isolation. After we tried several protocols for isolating RNA from the Vitis rootstock Richter- 110 (R-110 with little or no success, we adapted a method reported to be satisfactory for grapevine DNA isolation, to extract RNA. With slight protocol modifications, we succeeded to obtain polysaccharide- and phenolic-free RNA preparations from all vegetative tissues, without excessive sample handling. RNA isolated by the reported method permitted to obtain highly pure mRNA (messenger RNA to construct a cDNA (complementary DNA library and allowed gene transcription analysis by reverse Northern, which guarantees RNA integrity. This method may also be suitable for other plant species with high polysaccharide or phenolic contents.

  7. A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

    Directory of Open Access Journals (Sweden)

    George Lezin

    Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

  8. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  9. Human cultured cells are capable to incorporate isolated plant mitochondria loaded with exogenous DNA

    Directory of Open Access Journals (Sweden)

    Laktionov P. P.

    2012-07-01

    Full Text Available Aim. To investigate the possibility of human cultured cells to incorporate isolated mitochondria together with exogenous DNA introduced into organelles. Methods. Two approaches were used for this purpose, fluorescent labelling of mitochondria and/or DNA with subsequent analysis of the cells subjected to incubation by microscopy or by quantitative PCR. Results. We have shown that human cultured cells lines, HeLa and HUVEC, are capable to uptake isolated plant mitochondria and that this process depends on the incubation time and concentration of organelles present in medium. The incorporated mitochondria can serve as vehicles to deliver exogenous DNA into human cells, this DNA is then distributed in different cell compartments. Conclusions. These results are preliminary and need further investigations, including testing the possibility of human cells to incorporate the mitochondria of human or animal origin and creating genetic construction which could provide certain selectivity or stability of the transferred exogenous DNA upon cell uptake of the mitochondria as vectors.

  10. On the trends of Fukui potential and hardness potential derivatives in isolated atoms vs. atoms in molecules.

    Science.gov (United States)

    Bhattacharjee, Rituparna; Roy, Ram Kinkar

    2014-10-28

    In the present study, trends of electronic contribution to molecular electrostatic potential [Vel(r¯)(r=0)], Fukui potential [v(+)f|(r=0) and v(-)f|(r=0)] and hardness potential derivatives [Δ(+)h(k) and Δ(-)h(k)] for isolated atoms as well as atoms in molecules are investigated. The generated numerical values of these three reactivity descriptors in these two electronically different situations are critically analyzed through the relevant formalism. Values of Vel(r¯) (when r → 0, i.e., on the nucleus) are higher for atoms in molecules than that of isolated atoms. In contrast, higher values of v(+)|(r=0) and v(-)|(r=0) are observed for isolated atoms compared to the values for atoms in a molecule. However, no such regular trend is observed for the Δ(+)h(k) and Δ(-)h(k) values, which is attributed to the uncertainty in the Fukui function values of atoms in molecules. The sum of Fukui potential and the sum of hardness potential derivatives in molecules are also critically analyzed, which shows the efficacy of orbital relaxation effects in quantifying the values of these parameters. The chemical consequence of the observed trends of these descriptors in interpreting electron delocalization, electronic relaxation and non-negativity of atomic Fukui function indices is also touched upon. Several commonly used molecules containing carbon as well as heteroatoms are chosen to make the investigation more insightful.

  11. Effects of ionising radiation on isolated and cellular DNA

    International Nuclear Information System (INIS)

    Cadet, J.; Artignan, X.; Berger, M.; Douki, T.; Gromova, M.; Polverelli, M.; Ravanat, J.L.

    1997-01-01

    In the present survey, emphasis has been placed on mechanistic aspects of the radiation-induced decomposition of the base moities of DNA and model compounds. An almost complete description of the radical reactions mediated by both OH radicals (indirect effects) and one-electron oxidation (direct effects) is now possible for guanine compounds in aerated aqueous solution. In addition, the results of a comparison of a targeted assay (high performance liquid chromatography-electrochemical method) and a non specific method ('comet assay') for monitoring radiation-induced DNA damage within human cells are reported. (authors)

  12. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  13. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    User

    Full Length Research Paper ... resulted in a search for better techniques for classifying ... only a few laboratories worldwide are able to perform a ... MATERIALS AND METHODS. Bacterial ... s with distilled water and blotted dry with tissue paper (Kimberly- ... A test on the quality and quantity of DNA extracted was conducted.

  14. Optimization of FTA technology for large scale plant DNA isolation ...

    African Journals Online (AJOL)

    Conventional methods for DNA acquisition and storage require expensive reagents and equipments. Experimental fields located in remote areas and large sample size presents greater challenge to developing country institutions constrained financially. FTATM technology uses a single format utilizing basic tools found in ...

  15. Isolation and characterization of microsatellite DNA loci from Sillago ...

    Indian Academy of Sciences (India)

    A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...

  16. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Administrator

    2011-09-21

    Sep 21, 2011 ... *DNA diluted a thousand times to measure OD. silkworms are raised .... using gel extraction kit (Hi Media) and cloned into pGEMT easy vector (Promega) ..... Laboratory Press, Cold Spring Harbor, New York. Sharma J, Yadav ...

  17. Comparative study of Microsporum canis isolates by DNA fingerprinting.

    Science.gov (United States)

    Shafiee, Shabnam; Khosravi, Ali Reza; Ashrafi Tamai, Iradj

    2014-08-01

    Microsporum canis is a zoophilic fungus and it is an important agent of dermatophytosis. Cats act as important reservoirs. Clinically, it is too difficult to differentiate dermatophytosis caused by various species, also this fungus loses its morphological characteristics easily because of subculture; so using of rapid and accurate laboratory techniques for identifying the dermatophytes is important, therefore, RAPD-PCR was applied for the differentiation of the isolates. In this study, 10 M. canis isolates were detected in cats, dog, human, fox and rabbit at the Mycology Research Center, Faculty of Veterinary Medicine, University of Tehran. For running the RAPD-PCR, PCR set system and three random primers OPU 15, OPU 13 and OPA 04 were used. Then phylogenetic tree and similarity coefficient table were drawn. The results showed that there were some common bands between M. canis isolates. There were some specific bands for each isolates, as well. Our study showed, despite the typical morphology of the whole isolates, they were placed in different branches in molecular typing. © 2014 Blackwell Verlag GmbH.

  18. DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

    Science.gov (United States)

    Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

    2017-10-01

    Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

  19. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Directory of Open Access Journals (Sweden)

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  20. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  1. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  2. Analysis of pyrimidine dimer content of isolated DNA by nuclease digestion

    International Nuclear Information System (INIS)

    Farland, W.H.; Sutherland, B.M.

    1980-01-01

    Isolated DNA is highly susceptible to degradation by exogenous nucleases. Complete digestion is possible with a number of well-characterized enzymes from a variety of sources. Treatment of DNA with a battery of enzymes including both phosphodiesterase and phosphatase activities yields a mixture of nucleosides and inorganic phosphate (P/sub i/) as a final product. Unlike native DNA, ultraviolet-irradiated DNA is resistant to complete digestion. Setlow et al. demonstrated that the structural changes in the DNA responsible for the nuclease resistance were the formation of cyclobutyl pyrimidine dimers, the major photoproduct in UV-irradiated DNA. Using venom phosphodiesterase, they demonstrated that UV irradiation of DNA affected both the rate and extent of enzymatic hydrolysis. In addition, it was demonstrated that the major nuclease-resistant product of this hydrolysis was an oligonucleotide containing dimerized pyrimidines. Treatment of the DNA to split the dimers, either photochemically or photoenzymatically, rendered the polymer more susceptible to hydrolysis by the phosphodiesterase. The specificity of photoreactivating enzyme for pyrimidine dimers lends support to the role of these structures in conferring nuclease resistance to UV-irradiated DNA. The nuclease resistance of DNA containing dimers has been the basis of several assays for the measurement of these photoproducts. Sutherland and Chamberlin reported the development of a rapid and sensitive assay for dimers in 32 P-labeled DNA

  3. Isolation of proteins involved in the replication of adenoviral DNA in vitro

    International Nuclear Information System (INIS)

    Lichy, J.H.; Nagata, K.; Friefeld, B.R.; Enomoto, T.; Field, J.; Guggenheimer, R.A.; Ikeda, J.E.; Horwitz, M.S.; Hurwitz, J.

    1983-01-01

    The simple mechanism of replication of adenoviral DNA has made adenovirus an especially useful model system for studies of eukaryotic replication mechanisms. The availability of this in vitro system that replicates exogenously added Ad DNA-pro has made it possible to characterize the factors involved in replication. The results presented in this paper summarize our further fractionation of the in vitro system. First, the properties of two factors purified from the uninfected nuclear extract are described. Second, the separation of the pTP/Ad Pol complex into subunits and the properties of the isolated subunits are presented. The 140K protein is shown to possess the Ad DNA polymerase activity. The results suggest that the only DNA polymerase required for adenoviral DNA replication in vitro is the 140K Ad DNA polymerase and that this enzyme is probably a viral gene product. 50 references, 10 figures, 3 tables

  4. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  5. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    Science.gov (United States)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

  6. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  7. Isolation and Purification of an Early Pregnancy Factor–Like Molecule from Culture Supernatants Obtained from Lymphocytes of Pregnant Women

    OpenAIRE

    Aranha, Clara; Natraj, Usha; Iyer, K. S.; Shahani, Savitri

    1998-01-01

    Purpose:Our purpose was to determine whether lymphocytes synthesize proteins during pregnancy, to observe whether one of the proteins synthesized has early pregnancy factor (EPF)–like activity and to isolate and purify this molecule from culture supernatants obtained from stimulated lymphocytes of pregnant women.

  8. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  9. From isolated light-harvesting complexes to the thylakoid membrane: a single-molecule perspective

    Science.gov (United States)

    Gruber, J. Michael; Malý, Pavel; Krüger, Tjaart P. J.; Grondelle, Rienk van

    2018-01-01

    The conversion of solar radiation to chemical energy in plants and green algae takes place in the thylakoid membrane. This amphiphilic environment hosts a complex arrangement of light-harvesting pigment-protein complexes that absorb light and transfer the excitation energy to photochemically active reaction centers. This efficient light-harvesting capacity is moreover tightly regulated by a photoprotective mechanism called non-photochemical quenching to avoid the stress-induced destruction of the catalytic reaction center. In this review we provide an overview of single-molecule fluorescence measurements on plant light-harvesting complexes (LHCs) of varying sizes with the aim of bridging the gap between the smallest isolated complexes, which have been well-characterized, and the native photosystem. The smallest complexes contain only a small number (10-20) of interacting chlorophylls, while the native photosystem contains dozens of protein subunits and many hundreds of connected pigments. We discuss the functional significance of conformational dynamics, the lipid environment, and the structural arrangement of this fascinating nano-machinery. The described experimental results can be utilized to build mathematical-physical models in a bottom-up approach, which can then be tested on larger in vivo systems. The results also clearly showcase the general property of biological systems to utilize the same system properties for different purposes. In this case it is the regulated conformational flexibility that allows LHCs to switch between efficient light-harvesting and a photoprotective function.

  10. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  11. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  12. Analysis of isolates within species of anuran trypanosomes using random amplified polymorphic DNA.

    Science.gov (United States)

    Lun, Z R; Desser, S S

    1996-01-01

    A total of 20 decamer primers were used to generate random applied polymorphic DNA (RAPD) markers from 5 isolates of Trypanosoma fallisi, 3 isolates of T. ranarum, 2 isolates of T. rotatorium, and 2 isolates of T. rotatorium-like trypanosomes in addition to 2 species from the American Type Culture Collection, T. chattoni (ATCC 50294) and Trypanosoma sp. (ATCC 50295). A slight polymorphism was observed among the four isolates of T. fallisi obtained form American toads, Bufo americanus, collected in Algonquin Park, Ontario, Canada, and an isolate obtained from the same species of host collected in Marquette, Michigan, United States, and produced similarity coefficients ranging from 80.7% to 96.9%. Pronounced polymorphism was recorded among the three isolates of T. ranarum from bullfrogs, Rana catesbeiana, collected in Ontario, Canada, and in Maryland, United States, and from a Northern leopard frog, R. pipiens, collected in Minnesota (USA). The similarity coefficients ranged from 54.7% to 59.5%, suggesting that alleles of these isolates were conserved over a wide geographic range. The high degree of polymorphism observed in two isolates of T. rotatorium from a bullfrog collected in Ontario and two isolates of a T. rotatorium-like parasite from the green frog R. clamitans, collected in Louisiana (USA) suggests that they are different species. These results reflect the high similarity among isolates from the same geographic location and the pronounced polymorphism apparent among isolates from distant geographic locations.

  13. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  14. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.

    2002-01-01

    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  15. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  16. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  17. Variation of DNA damage levels in peripheral blood mononuclear cells isolated in different laboratories

    DEFF Research Database (Denmark)

    Godschalk, Roger W L; Ersson, Clara; Stępnik, Maciej

    2014-01-01

    This study investigated the levels of DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG) sensitive sites, as assessed by the comet assay, in peripheral blood mononuclear cells (PBMC) from healthy women from five different countries in Europe. The laboratory in each country (referred...... to as 'centre') collected and cryopreserved PBMC samples from three donors, using a standardised cell isolation protocol. The samples were analysed in 13 different laboratories for DNA damage, which is measured by the comet assay. The study aim was to assess variation in DNA damage in PBMC samples that were......%) by standardisation of the primary comet assay endpoint with calibration curve samples. The level of DNA strand breaks in the samples from two of the centres (0.56-0.61 lesions/10(6) bp) was significantly higher compared with the other three centres (0.41-0.45 lesions/10(6) bp). In contrast, there was no difference...

  18. Comparative Analysis of the Genomic DNA Isolation Methods on Inula sp. (Asteraceae

    Directory of Open Access Journals (Sweden)

    Emre SEVİNDİK

    2016-12-01

    Full Text Available Simple, fast, low-cost and high throughput protocols are required for DNA isolation of plant species. In this study, phenol chloroform isoamyl alcohol and commercial (Sigma DNA isolation kit methods were applied on some Inula species that belong to Asteraceae family. Genomic DNA amounts, A260, A280, A260/A230 and purity degrees (A260/A280 that were obtained through both methods were measured through electrophoresis and spectrophotometer. Additionally, PCR amplification was realized by primer pairs specific to nrDNA ITS, cpDNA ndhF (972F-1603R and trnL-F regions. Results showed that maximum genomic DNA in nanograms obtained by phenol chloroform isoamyl alcohol method. The study also revealed that I. macrocephala had the maximum DNA and I. heterolepis had the minimum DNA amount. A260/A280 purity degrees showed that the highest and lowest purity in gDNAs obtained through phenol-choloform isoamyl alcohol method were in I.aucheriana and I. salicina, respectively. The highest and lowest purity degrees of gDNAs obtained through commercial kit was observed in I. fragilis and I. macrocephala samples, respectively. PCR amplification results showed that while band profiles of each three regions (ITS, trnL-F and ndhF did not yield positive results in PCR amplifications using phenol-choloform isoamyl alcohol method; PCR band profiles obtained through commercial kit yielded positive results. As a result, it is fair to say that the relation of genomic DNA with PCR was found to be more efficient although the maximum amount of genomic DNA was obtained through phenol chloroform isoamyl alcohol method.

  19. Reliable genotyping of the koala (Phascolarctos cinereus) using DNA isolated from a single faecal pellet.

    Science.gov (United States)

    Wedrowicz, Faye; Karsa, Mawar; Mosse, Jennifer; Hogan, Fiona E

    2013-07-01

    The koala, an Australian icon, has been added to the threatened species list. Rationale for the listing includes proposed declines in population size, threats to populations (e.g. disease) and loss and fragmentation of habitat. There is now an urgent need to obtain accurate data to assess the status of koala populations in Australia, to ensure the long-term viability of this species. Advances in genetic techniques have enabled DNA analysis to study and inform the management of wild populations; however, sampling of individual koalas is difficult in tall, often remote, eucalypt forest. The collection of faecal pellets (scats) from the forest floor presents an opportunistic sampling strategy, where DNA can be collected without capturing or even sighting an individual. Obtaining DNA via noninvasive sampling can be used to rapidly sample a large proportion of a population; however, DNA from noninvasively collected samples is often degraded. Factors influencing DNA quality and quantity include environmental exposure, diet and methods of sample collection, storage and DNA isolation. Reduced DNA quality and quantity can introduce genotyping errors and provide inaccurate DNA profiles, reducing confidence in the ability of such data to inform management/conservation strategies. Here, we present a protocol that produces a reliable individual koala genotype from a single faecal pellet and highlight the importance of optimizing DNA isolation and analysis for the species of interest. This method could readily be adapted for genetic studies of mammals other than koalas, particularly those whose diet contains high proportions of volatile materials that are likely to induce DNA damage. © 2013 John Wiley & Sons Ltd.

  20. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens.

    Science.gov (United States)

    Saeidi, Saman; McKain, Michael R; Kellogg, Elizabeth A

    2018-03-08

    Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

  1. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  3. Effects of 31 FDA approved small-molecule kinase inhibitors on isolated rat liver mitochondria.

    Science.gov (United States)

    Zhang, Jun; Salminen, Alec; Yang, Xi; Luo, Yong; Wu, Qiangen; White, Matthew; Greenhaw, James; Ren, Lijun; Bryant, Matthew; Salminen, William; Papoian, Thomas; Mattes, William; Shi, Qiang

    2017-08-01

    The FDA has approved 31 small-molecule kinase inhibitors (KIs) for human use as of November 2016, with six having black box warnings for hepatotoxicity (BBW-H) in product labeling. The precise mechanisms and risk factors for KI-induced hepatotoxicity are poorly understood. Here, the 31 KIs were tested in isolated rat liver mitochondria, an in vitro system recently proposed to be a useful tool to predict drug-induced hepatotoxicity in humans. The KIs were incubated with mitochondria or submitochondrial particles at concentrations ranging from therapeutic maximal blood concentrations (Cmax) levels to 100-fold Cmax levels. Ten endpoints were measured, including oxygen consumption rate, inner membrane potential, cytochrome c release, swelling, reactive oxygen species, and individual respiratory chain complex (I-V) activities. Of the 31 KIs examined only three including sorafenib, regorafenib and pazopanib, all of which are hepatotoxic, caused significant mitochondrial toxicity at concentrations equal to the Cmax, indicating that mitochondrial toxicity likely contributes to the pathogenesis of hepatotoxicity associated with these KIs. At concentrations equal to 100-fold Cmax, 18 KIs were found to be toxic to mitochondria, and among six KIs with BBW-H, mitochondrial injury was induced by regorafenib, lapatinib, idelalisib, and pazopanib, but not ponatinib, or sunitinib. Mitochondrial liability at 100-fold Cmax had a positive predictive power (PPV) of 72% and negative predictive power (NPV) of 33% in predicting human KI hepatotoxicity as defined by product labeling, with the sensitivity and specificity being 62% and 44%, respectively. Similar predictive power was obtained using the criterion of Cmax ≥1.1 µM or daily dose ≥100 mg. Mitochondrial liability at 1-2.5-fold Cmax showed a 100% PPV and specificity, though the NPV and sensitivity were 32% and 14%, respectively. These data provide novel mechanistic insights into KI hepatotoxicity and indicate that

  4. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  5. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  6. Comparison of field-collected ascovirus isolates by DNA hybridization, host range, and histopathology.

    Science.gov (United States)

    Hamm, J J; Styer, E L; Federici, B A

    1998-09-01

    Six field-collected ascovirus isolates obtained from five noctuid species in the continental United States were compared with respect to the general relatedness of their DNA, host range, and histopathology. Two isolates were from Spodoptera frugiperda, and the other four were from Autographa precationis, Heliothis virescens, Helicoverpa zea, and Trichoplusia ni. DNA-DNA hybridization studies showed that the six isolates belonged to three distinct viral species, with the isolates from S. frugiperda composing one species, those from A. precationis and H. virescens a second species, and those from H. zea and T. ni a third species. The host range and histopathology of each isolate was studied in eight noctuid species, S. frugiperda, Spodoptera ornithogalli, Spodoptera exigua, Spodoptera eridania, H. virescens, H. zea, A. precationis, and Feltia subterranea. Though some variation existed between the different isolates of each viral species, distinct patterns were apparent for each. The viral species from S. frugiperda had a host range that was limited primarily to Spodoptera species and both isolates of this virus only replicated and caused significant pathology in the fat body, whereas the viral species from A. precationis and H. virescens had a much broader host range that included most of the species tested, but also had a tissue tropism primarily restricted to the fat body. The viral species from T. ni and H. zea readily infected all the hosts tested, where the principal site of replication and significant pathology was the epidermis. In many test hosts, however, this viral species also replicated and caused significant pathology in the tracheal epithelium and to a lesser extent in the fat body. Aside from contributing to knowledge of ascovirus biology, these studies indicate that DNA hybridization profiles combined with studies of host range and tissue tropism can be used as characters for defining ascovirus species. Copyright 1998 Academic Press.

  7. Isolating human DNA repair genes using rodent-cell mutants

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-01-01

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab

  8. Stabilization of chromosomes by DNA intercalators for flow karyotyping and identification by banding of isolated chromosomes

    NARCIS (Netherlands)

    Aten, J. A.; Buys, C. H.; van der Veen, A. Y.; Mesa, J. R.; Yu, L. C.; Gray, J. W.; Osinga, J.; Stap, J.

    1987-01-01

    A number of structurally unrelated DNA intercalators have been studied as stabilizers of mitotic chromosomes during isolation from rodent and human metaphase cells. Seven out of the nine intercalators tested were found to be useful as chromosome stabilizing agents. Chromosome suspensions prepared in

  9. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  10. Isolate extended state in the DNA molecular transistor with surface interaction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Le, E-mail: wang_le917@gs.zzu.edu.cn; Qin, Zhi-Jie

    2016-02-01

    The field effect characteristic of a DNA molecular device is investigated in a tight binding model with binary disorder and side site correlation. Using the transfer-matrix method and Landauer–Büttiker theory, we find that the system has isolated extended state that is irrespective of the DNA sequence and can be modulated by the gate voltage. When the gate voltage reaches some proper value, the isolated extended state appears at the Fermi level of the system and the long range charge transport is greatly enhanced. We attribute this phenomenon to the combination of the external field, the surface interaction, and the intrinsic disorder of DNA. The result is a generic feature of the nanowire with binary disorder and surface interaction.

  11. Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

    2016-01-01

    that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

  12. DNA repair in Haemophilus influenzae: isolation and characterization of an ultraviolet sensitive mutator mutant

    International Nuclear Information System (INIS)

    Walter, R.B.

    1985-01-01

    DNA repair in Haemophilus influenzae appears to be quite different from that seen in Escherichia coli in that H. influenzae shows neither SOS nor adaptation phenomena. Repair of DNA lesions in H. influenzae has been seen to occur via recombinational, excision, and mismatch repair pathways acting independently of one another. The author has isolated an ultraviolet (UV)-sensitive mutator mutant (mutB1) of H. influenzae Rd which shows deficiencies in both recombinational and mismatch repair pathways. This mutant is sensitive to a variety of DNA damaging agents as well as being hypermutable by alkylating agents and base analogues. MutB1 cells do not show post-UV DNA breakdown but do begin excision after UV irradiation. Genetic transformation with UV-irradiated DNA on mut B1 recipients shows that high (HE) and low (LE) efficiency markers are transformed at a ratio of 1.0 as in the mismatch repair deficient hex 1 mutant; however, kinetics of UV-inactivation experiments indicate that HE markers are sensitized and act as LE markers do on wild type recipients. Thus, the mutB gene product appears to play a role in both DNA repair and genetic transformation. A model is outlined which presents a role for a DNA helicase in both DNA repair and genetic transformation of H. influenzae

  13. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  14. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  15. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  16. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  17. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  18. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  19. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  20. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  1. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  2. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  3. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    Science.gov (United States)

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  4. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  5. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  6. Antibiofilm and antibacterial effects of specific chitosan molecules on Staphylococcus aureus isolates associated with bovine mastitis

    Science.gov (United States)

    Asli, Abdelhamid; Brouillette, Eric; Ster, Céline; Ghinet, Mariana Gabriela; Brzezinski, Ryszard; Lacasse, Pierre; Jacques, Mario

    2017-01-01

    Staphylococcus aureus is one of the major pathogens causing bovine intramammary infections (IMIs) and mastitis. Mastitis is the primary cause for the use of antibiotics in dairy farms but therapeutic failure is often observed. One of the reasons for the lack of effectiveness of antibiotic therapy despite the observed susceptibility of bacterial isolates in vitro are bacterial biofilms. In this study, we used chitosan of well-defined molecular weight (0.4–0.6, 1.3, 2.6 and 4.0 kDa) and investigated their antibiofilm and antibacterial activities in in vitro and in vivo models related to S. aureus IMIs. A chitosan of at least 6 units of glucosamine was necessary for maximum antibacterial activity. The 2.6 and 4.0 kDa forms were able to prevent biofilm production by the biofilm hyperproducer strain S. aureus 2117 and a bovine MRSA (methicillin-resistant S. aureus). The intramammary administration of the 2.6 kDa chitosan showed no adverse effects in mice or in cows, as opposed to the slight inflammatory effect observed in mammary glands with the 4.0 kDa derivative. The 2.6 kDa chitosan killed bacteria embedded in pre-established biofilms in a dose-dependent manner with a >3 log10 reduction in CFU at 4 mg/ml. Also, the 2.6 kDa chitosan could prevent the persistence of the internalized MRSA into the mammary epithelial cell line MAC-T. An in vitro checkerboard assay showed that the 2.6 kDa chitosan produced a synergy with the macrolide class of antibiotics (e.g., tilmicosin) and reduced the MIC of both molecules by 2–8 times. Finally, the intramammary administration of the 2.6 kDa chitosan alone (P<0.01) or in combination with tilmicosin (P<0.0001) reduced the colonization of mammary glands in a murine IMI model. Our results suggest that the use of chitosan alone or in combination with a low dose of a macrolide could help reduce antibiotic use in dairy farms. PMID:28486482

  7. Antibiofilm and antibacterial effects of specific chitosan molecules on Staphylococcus aureus isolates associated with bovine mastitis.

    Directory of Open Access Journals (Sweden)

    Abdelhamid Asli

    Full Text Available Staphylococcus aureus is one of the major pathogens causing bovine intramammary infections (IMIs and mastitis. Mastitis is the primary cause for the use of antibiotics in dairy farms but therapeutic failure is often observed. One of the reasons for the lack of effectiveness of antibiotic therapy despite the observed susceptibility of bacterial isolates in vitro are bacterial biofilms. In this study, we used chitosan of well-defined molecular weight (0.4-0.6, 1.3, 2.6 and 4.0 kDa and investigated their antibiofilm and antibacterial activities in in vitro and in vivo models related to S. aureus IMIs. A chitosan of at least 6 units of glucosamine was necessary for maximum antibacterial activity. The 2.6 and 4.0 kDa forms were able to prevent biofilm production by the biofilm hyperproducer strain S. aureus 2117 and a bovine MRSA (methicillin-resistant S. aureus. The intramammary administration of the 2.6 kDa chitosan showed no adverse effects in mice or in cows, as opposed to the slight inflammatory effect observed in mammary glands with the 4.0 kDa derivative. The 2.6 kDa chitosan killed bacteria embedded in pre-established biofilms in a dose-dependent manner with a >3 log10 reduction in CFU at 4 mg/ml. Also, the 2.6 kDa chitosan could prevent the persistence of the internalized MRSA into the mammary epithelial cell line MAC-T. An in vitro checkerboard assay showed that the 2.6 kDa chitosan produced a synergy with the macrolide class of antibiotics (e.g., tilmicosin and reduced the MIC of both molecules by 2-8 times. Finally, the intramammary administration of the 2.6 kDa chitosan alone (P<0.01 or in combination with tilmicosin (P<0.0001 reduced the colonization of mammary glands in a murine IMI model. Our results suggest that the use of chitosan alone or in combination with a low dose of a macrolide could help reduce antibiotic use in dairy farms.

  8. Shake and stew: a non-destructive PCR-ready DNA isolation method from a single preserved fish larva.

    Science.gov (United States)

    Alvarado Bremer, J R; Smith, B L; Moulton, D L; Lu, C-P; Cornic, M

    2014-01-01

    A rapid non-destructive alternative to isolate DNA from an individual fish larva is presented, based on the suspension of epithelial cells through vortex forces, and the release of DNA in a heated alkaline solution. DNA from >6056 fish larvae isolated using this protocol has yielded a high PCR amplification success rate (>93%), suggesting its applicability to other taxonomic groups or sources when tissue amount is the limiting factor. © 2014 The Fisheries Society of the British Isles.

  9. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  10. Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

    Science.gov (United States)

    Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

    2015-01-01

    Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations

  11. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  12. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  13. Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

    Directory of Open Access Journals (Sweden)

    Jamal, H.

    2005-01-01

    Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

  14. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Science.gov (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  15. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi

    2017-01-01

    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  16. Induction and isolation of DNA transformation mutants in the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Hegerich, P.A.; Bruschi, C.V.

    1987-01-01

    The objective of this research was to induce and isolate mutants of the yeast Saccharomyces cerevisiae which have become transformable by purified plasmid DNA. Non-transformable yeast cells were mutagenized by ultraviolet light using a 65% lethal dose (480 ergs/mm 2 ). After a period of overnight liquid holding recovery, the irradiated cells were subjected to DNA transformation using our CaCl 2 protocol with the multi-marker shuttle plasmid pBB carrying the LEU 2 leucine gene. Following transformation the colonies that grew on selective leucineless medium were identified and subjected to further genetic analysis. From a total of 1 x 10 9 cells the authors have isolated 7 colonies deriving from putative mutants that have acquired the capability to uptake plasmid DNA. The transformants were cured from the plasmid by its mitotic loss on non-selective medium, then re-transformed to verify their genetic competence to give rise to a number of transformants comparable to transformable strains. We have identified and isolated one mutant, coded trs-1, which is able to reproduce a frequency of transformation comparable with the tranformable control. They, therefore, conclude that this mutant is specific for plasmid DNA transformation and that the mutation is mitotically stable

  17. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  18. Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

    OpenAIRE

    Noor Adila, A. K.; Farah Diba, A. B.; Zamri, Z.; Wan Mohtar, W. Y.; Aidil, A. H.; Mahadi, N. M.; Murad, A. M. A.

    2007-01-01

    A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP), hexacetyltrimethylammonium bromide (CTAB) or w...

  19. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  20. Identification of a DNA restriction-modification system in Pectobacterium carotovorum strains isolated from Poland.

    Science.gov (United States)

    Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E

    2006-02-01

    Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.

  1. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  2. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  3. Role of isolated and clustered DNA damage and the post-irradiating repair process in the effects of heavy ion beam irradiation

    International Nuclear Information System (INIS)

    Tokuyama, Yuka; Terato, Hiroaki; Furusawa, Yoshiya; Ide, Hiroshi; Yasui, Akira

    2015-01-01

    Clustered DNA damage is a specific type of DNA damage induced by ionizing radiation. Any type of ionizing radiation traverses the target DNA molecule as a beam, inducing damage along its track. Our previous study showed that clustered DNA damage yields decreased with increased linear energy transfer (LET), leading us to investigate the importance of clustered DNA damage in the biological effects of heavy ion beam radiation. In this study, we analyzed the yield of clustered base damage (comprising multiple base lesions) in cultured cells irradiated with various heavy ion beams, and investigated isolated base damage and the repair process in post-irradiation cultured cells. Chinese hamster ovary (CHO) cells were irradiated by carbon, silicon, argon and iron ion beams with LETs of 13, 55, 90 and 200 keV µm -1 , respectively. Agarose gel electrophoresis of the cells with enzymatic treatments indicated that clustered base damage yields decreased as the LET increased. The aldehyde reactive probe procedure showed that isolated base damage yields in the irradiated cells followed the same pattern. To analyze the cellular base damage process, clustered DNA damage repair was investigated using DNA repair mutant cells. DNA double-strand breaks accumulated in CHO mutant cells lacking Xrcc1 after irradiation, and the cell viability decreased. On the other hand, mouse embryonic fibroblast (Mef) cells lacking both Nth1 and Ogg1 became more resistant than the wild type Mef. Thus, clustered base damage seems to be involved in the expression of heavy ion beam biological effects via the repair process. (author)

  4. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  5. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  6. 77 FR 54584 - Final Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH...

    Science.gov (United States)

    2012-09-05

    ... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...

  7. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners

  8. Characterization of methicillin-resistant Staphylococcus aureus isolated from healthy turkeys and broilers using DNA microarrays

    Directory of Open Access Journals (Sweden)

    Hosny El-Adawy

    2016-12-01

    Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA is a major human health problem and recently, domestic animals, in particular pigs and poultry are discussed as carriers and possible reservoirs of MRSA. Twenty seven S. aureus isolates from five turkey farms (n=18 and two broiler farms (n=9 were obtained by culturing of choana and skin swabs from apparently healthy birds, identified by Taqman-based real-time duplex nuc-mecA-PCR and characterized by spa typing as well as by a DNA microarray based assay which covered, amongst others, a considerable number of antibiotic resistance genes, species controls and virulence markers. The antimicrobial susceptibility profiles were tested by agar diffusion assays and genotypically confirmed by the microarray. Five different spa types (3 in turkeys and 2 in broilers were detected. The majority of MRSA isolates (24/27 belonged to clonal complex 398-MRSA-V. The most frequently occurring spa types were accordingly t011, t034 and t899. A single CC5-MRSA-III isolated from turkey and CC398-MRSA with an unidentified/truncated SCCmec element in turkey and broiler were additionally detected. The phenotypic antimicrobial resistance profiles of S. aureus isolated from both turkeys and broilers against 14 different antimicrobials showed that all isolates were resistant to ampicillin, cefoxitin, oxacillin, doxycycline and tetracycline. Moreover, all S. aureus isolated from broilers were resistant to erythromycin and azithromycin. All isolates were susceptible to gentamicin, chloramphenicol, sulphonamides and fusidic acid. The resistance rate against ciprofloxacin was 55.6% in broiler isolates and 42.1% in turkey isolates. All tetracycline resistant isolates possessed genes tetK/M. All erythromycin-resistant broiler isolates carried ermA. Only one broiler isolate (11.1% carried genes ermA, ermB and ermC, while 55.6% of turkey isolates possessed ermA and ermB genes.Neither PVL genes (lukF/S-PV, animal-associated leukocidin

  9. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  10. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  11. Magnetic hydrophilic poly(2-hydroxyethyl methacrylate-co-glycidyl methacrylate) microspheres for DNA isolation from faeces

    Czech Academy of Sciences Publication Activity Database

    Trachtová, Š.; Obermajer, T.; Španová, A.; Matijašić, B. B.; Rogelj, I.; Horák, Daniel; Rittich, B.

    2012-01-01

    Roč. 555, č. 1 (2012), s. 263-270 ISSN 1542-1406. [International Conference on Frontiers of Polymers and Advanced Materials /11./. Pretoria, 22.05.2011-27.05.2011] R&D Projects: GA MŠk 2B06053 Institutional research plan: CEZ:AV0Z40500505 Keywords : DNA isolation * magnetic microspheres * mouse faeces Subject RIV: EE - Microbiology, Virology Impact factor: 0.530, year: 2012

  12. Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

  13. Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

    Science.gov (United States)

    Haslan, Ezgi; Kimiran-Erdem, Ayten

    2013-09-01

    In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

  14. Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

    International Nuclear Information System (INIS)

    Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

  15. Mitochondrial DNA structure of an isolated Tunisian Berber population and its relationship with Mediterranean populations.

    Science.gov (United States)

    Ben Halim, Nizar; Hsouna, Sana; Lasram, Khaled; Chargui, Mariem; Khemira, Laaroussi; Saidane, Rachid; Abdelhak, Sonia; Kefi, Rym

    2018-02-01

    Douiret is an isolated Berber population from South-Eastern Tunisia. The strong geographic and cultural isolation characterising this population might have contributed to remarkable endogamy and consanguinity, which were practiced for several centuries. The objective of this study is to evaluate the mitochondrial DNA (mtDNA) genetic structure of Douiret and to compare it to other Mediterranean populations with a special focus on major haplogroup T. Genomic DNA was extracted from blood samples of 58 unrelated individuals collected from the different patrilineal lineages of the population. The hypervariable region 1 of the mtDNA was amplified and sequenced. For comparative analyses, additional HVS1 sequences (n = 4857) were compiled from previous studies. The maternal background of the studied sample from Douiret was mainly of Eurasian origin (74%) followed by Sub-Saharan (17%) and North African (3%) lineages. Douiret harbours the highest frequency of haplogroup T in the Mediterranean region, assigned to the unique subclade T1a (38%). Phylogenetic analysis showed an outlier position of Douiret at the Mediterranean level. The genetic structure of Douiret highlights the presence of founders, most likely of Near/Middle Eastern origin, who conquered this area during the Middle/Late Upper Palaeolithic and Neolithic dispersals.

  16. Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

    Science.gov (United States)

    Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

    2018-03-27

    Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  18. Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

    Science.gov (United States)

    Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

    2012-10-15

    Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  20. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  1. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  2. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  3. Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers

    DEFF Research Database (Denmark)

    Stern, Stephan; Holmegaard, Lotte; Filsinger, Frank

    2014-01-01

    We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Cohere...

  4. A new fast algorithm for solving the minimum spanning tree problem based on DNA molecules computation.

    Science.gov (United States)

    Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei

    2013-10-01

    The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  5. Genetic diversity of Clavispora lusitaniae isolated from Agave fourcroydes Lem, as revealed by DNA fingerprinting.

    Science.gov (United States)

    Pérez-Brito, Daisy; Magaña-Alvarez, Anuar; Lappe-Oliveras, Patricia; Cortes-Velazquez, Alberto; Torres-Calzada, Claudia; Herrera-Suarez, Teófilo; Larqué-Saavedra, Alfonso; Tapia-Tussell, Raul

    2015-01-01

    This study characterized Clavispora lusitaniae strains isolated from different stages of the processing and early fermentation of a henequen (Agave fourcroydes) spirit produced in Yucatan, Mexico using a molecular technique. Sixteen strains identified based on morphological features, obtained from different substrates, were typed molecularly. Nine different versions of the divergent D1/D2 domain of the large-subunit ribosomal DNA sequence were identified among the C. lusitaniae strains. The greatest degree of polymorphism was found in the 90-bp structural motif of the D2 domain. The MSP-PCR technique was able to differentiate 100% of the isolates. This study provides significant insight into the genetic diversity of the mycobiota present during the henequen fermentation process, especially that of C. lusitaniae, for which only a few studies in plants have been published. The applied MSP-PCR markers were very efficient in revealing olymorphisms between isolates of this species.

  6. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  7. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  8. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  9. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  10. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  11. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  12. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa

    2011-01-01

    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  13. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  14. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  15. Molecular profiles of Venezuelan isolates of Trypanosoma sp. by random amplified polymorphic DNA method.

    Science.gov (United States)

    Perrone, T M; Gonzatti, M I; Villamizar, G; Escalante, A; Aso, P M

    2009-05-12

    Nine Trypanosoma sp. Venezuelan isolates, initially presumed to be T. evansi, were collected from three different hosts, capybara (Apure state), horse (Apure state) and donkey (Guarico state) and compared by the random amplification polymorphic DNA technique (RAPD). Thirty-one to 46 reproducible fragments were obtained with 12 of the 40 primers that were used. Most of the primers detected molecular profiles with few polymorphisms between the seven horse, capybara and donkey isolates. Quantitative analyses of the RAPD profiles of these isolates revealed a high degree of genetic conservation with similarity coefficients between 85.7% and 98.5%. Ten of the primers generated polymorphic RAPD profiles with two of the three Trypanosoma sp. horse isolates, namely TeAp-N/D1 and TeGu-N/D1. The similarity coefficient between these two isolates and the rest, ranged from 57.9% to 68.4% and the corresponding dendrogram clustered TeAp-N/D1 and Te Gu-N/D1 in a genetically distinct group.

  16. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

    NARCIS (Netherlands)

    Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.

    2001-01-01

    A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

  17. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  18. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  19. Determination of melting curves of irradiated DNA preparations and of preparations isolated from irradiated calf lymph nodes

    International Nuclear Information System (INIS)

    Grabowska, B.

    1977-01-01

    Measurements of melting curves enabled to establish differences of melting temperature, hyperchromic effect and breadth of the helix - coil phase transition dependent on dose of the ionizing radiation applied and on kind of the irradiated object. Changes of the investigated parameters of DNA irradiated after isolation were detectably more pronounced that of DNA from irradiated lymph nodes. The obtained results suggest a protective role of tissue to the secondary structure of DNA. (author)

  20. Interactive measurement and characterization of DNA molecules by analysis of AFM images

    Czech Academy of Sciences Publication Activity Database

    Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.

    2005-01-01

    Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005

  1. Function of the UVR marker in dark repair of DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

    1975-01-01

    It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

  2. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    Science.gov (United States)

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  3. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  4. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs

    International Nuclear Information System (INIS)

    Travis, G.H.; Sutcliffe, J.G.

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, the authors developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA

  5. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  6. Snake Venom PLA2s Inhibitors Isolated from Brazilian Plants: Synthetic and Natural Molecules

    Science.gov (United States)

    Carvalho, B. M. A.; Santos, J. D. L.; Xavier, B. M.; Almeida, J. R.; Resende, L. M.; Martins, W.; Marcussi, S.; Marangoni, S.; Stábeli, R. G.; Calderon, L. A.; Soares, A. M.; Da Silva, S. L.; Marchi-Salvador, D. P.

    2013-01-01

    Ophidian envenomation is an important health problem in Brazil and other South American countries. In folk medicine, especially in developing countries, several vegetal species are employed for the treatment of snakebites in communities that lack prompt access to serum therapy. However, the identification and characterization of the effects of several new plants or their isolated compounds, which are able to inhibit the activities of snake venom, are extremely important and such studies are imperative. Snake venom contains several organic and inorganic compounds; phospholipases A2 (PLA2s) are one of the principal toxic components of venom. PLA2s display a wide variety of pharmacological activities, such as neurotoxicity, myotoxicity, cardiotoxicity, anticoagulant, hemorrhagic, and edema-inducing effects. PLA2 inhibition is of pharmacological and therapeutic interests as these enzymes are involved in several inflammatory diseases. This review describes the results of several studies of plant extracts and their isolated active principles, when used against crude snake venoms or their toxic fractions. Isolated inhibitors, such as steroids, terpenoids, and phenolic compounds, are able to inhibit PLA2s from different snake venoms. The design of specific inhibitors of PLA2s might help in the development of new pharmaceutical drugs, more specific antivenom, or even as alternative approaches for treating snakebites. PMID:24171158

  7. Snake Venom PLA2s Inhibitors Isolated from Brazilian Plants: Synthetic and Natural Molecules

    Directory of Open Access Journals (Sweden)

    B. M. A. Carvalho

    2013-01-01

    Full Text Available Ophidian envenomation is an important health problem in Brazil and other South American countries. In folk medicine, especially in developing countries, several vegetal species are employed for the treatment of snakebites in communities that lack prompt access to serum therapy. However, the identification and characterization of the effects of several new plants or their isolated compounds, which are able to inhibit the activities of snake venom, are extremely important and such studies are imperative. Snake venom contains several organic and inorganic compounds; phospholipases A2 (PLA2s are one of the principal toxic components of venom. PLA2s display a wide variety of pharmacological activities, such as neurotoxicity, myotoxicity, cardiotoxicity, anticoagulant, hemorrhagic, and edema-inducing effects. PLA2 inhibition is of pharmacological and therapeutic interests as these enzymes are involved in several inflammatory diseases. This review describes the results of several studies of plant extracts and their isolated active principles, when used against crude snake venoms or their toxic fractions. Isolated inhibitors, such as steroids, terpenoids, and phenolic compounds, are able to inhibit PLA2s from different snake venoms. The design of specific inhibitors of PLA2s might help in the development of new pharmaceutical drugs, more specific antivenom, or even as alternative approaches for treating snakebites.

  8. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    Directory of Open Access Journals (Sweden)

    Emmanuelle eFiore

    2015-08-01

    Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  9. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  10. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  11. Preparation and Characterization of Super-paramagnetic Nano-beads for DNA Isolation

    Institute of Scientific and Technical Information of China (English)

    Xin XIE; Xu ZHANG; Bing Bin YU; wei Yang FE

    2004-01-01

    Unique coupling reagent, bis-(2-hydroxyethyl methacrylate) phosphate was used to prepare coated and functionalized superparamagnetic nanobeads, leading to a simple, effective method for coating the nanobeads. With this method, the thickness of the coating layer and the functional group contents on the nano-beads could be controlled by changing the quantity of the coated monomers. The nanobeads were characterized by means of transmission electron microscopy (TEM) and Fourier transformation infrared spectroscopy (FTIR). The carboxyl-modified magnetic nano-beads were employed to streamline the protocol of isolation of genomic DNA from the human whole blood.

  12. Matrix isolation-infrared and mass spectrometric studies of high-temperature molecules

    International Nuclear Information System (INIS)

    Dickinson, S.

    1987-08-01

    Matrix isolation-infrared spectroscopy and mass spectrometry have been developed at AEE Winfrith to study the high-temperature vapour species which could be generated during a hypothetical severe reactor accident. The principles of the techniques and the instruments are described in detail, and examples of their application to specific systems discussed. Although these examples refer to high-temperature chemical species which are relevant to reactor safety assessments, the techniques are equally applicable to other processes where the characterisation of transient vapour-phase species is required. (author)

  13. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes?

    Science.gov (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi

    2012-01-01

    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  14. Development of a Competent and Trouble Free DNA Isolation Protocol for Downstream Genetic Analyses in Glycine Species

    Directory of Open Access Journals (Sweden)

    Muhammad Amjad Nawaz

    2016-08-01

    Full Text Available Extraction of deoxyribose nucleic acid (DNA from plants is preliminary step in molecular biology. Fast and cost effective genomic DNA isolation from Glycine species for downstream application is a major bottleneck. Here we report a high throughput and trouble free method for genomic DNA extraction from leaf and seeds of Glycine species with high quality and quantity. Protocol reports the optimization by employing different concentrations of CTAB and PVP in extraction buffer. Efficiency of optimized protocol was compared with frequently used DNA extraction methods. Wide adoptability and utility of this protocol was confirmed by DNA extraction from leaves as well as seeds of G. max, G. soja, G. tomentella and G. latifolia. Extracted DNA was successfully subjected to PCR amplification of five microsatellite markers and four putative glycosyltransferase genes. DNA extraction protocol is reproducible, trouble free, rapid and can be adopted for plant molecular biology applications.

  15. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    Science.gov (United States)

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  17. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  18. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  19. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Science.gov (United States)

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.

    2012-01-01

    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  20. Isolation and in silico evaluation of antidiabetic molecules of Cynodon dactylon (L.).

    Science.gov (United States)

    Annapurna, Hasthi V; Apoorva, Babu; Ravichandran, Natesan; Arun, Kallur Purushothaman; Brindha, Pemaiah; Swaminathan, Sethuraman; Vijayalakshmi, Mahadevan; Nagarajan, Arumugam

    2013-02-01

    Cynodon dactylon is a potential source of metabolites such as flavanoids, alkaloids, glycosides and β-sitosterol and has been traditionally employed to treat urinary tract and other microbial infections and dysentery. The present work attempts to evaluate the activity of C. dactylon extracts for glycemic control. Aqueous extracts of C. dactylon analyzed by HPLC-ESI MS have identified the presence of apigenin, luteolin, 6-C-pentosyl-8-C-hexosyl apigenin and 6-C-hexosyl-8-C-pentosyl luteolin. Evaluation of hypoglycemic activity through an extensive in silico docking approach with PPARγ (Peroxisome Proliferator-Activated Receptor), GLUT-4 (glucose transporter-4) and SGLT2 (sodium glucose co-transporter-2) revealed that luteolin, apigenin, 6-C-pentosyl-8-C-hexosyl apigenin, 6-C-hexosyl-8-C-pentosyl luteolin interact with SGLT2. Interactions of these molecules with Gln 295 and Asp 294 residues of SGLT2 have been shown to compare well with that of the phase III drug, dapagliflozin. These residues have been proven to be responsible for sugar sensing and transport. This work establishes C. dactylon extract as a potential SGLT2 inhibitor for diabetic neuropathy thus enabling a possibility of this plant extract as a new alternative to existing diabetic approaches. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    Science.gov (United States)

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  2. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  3. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  4. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  5. Neutralizing antibody and anti-retroviral drug sensitivities of HIV-1 isolates resistant to small molecule CCR5 inhibitors

    International Nuclear Information System (INIS)

    Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.

    2008-01-01

    The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo

  6. Use of scintillometric quantitation of unscheduled DNA synthesis in isolated rat hepatocytes for the screening of genotoxic agents

    International Nuclear Information System (INIS)

    Hsia, M.T.

    1987-01-01

    The induction of unscheduled DNA synthesis has been considered as a suitable endpoint for the screening of genotoxic agents. Experimentally, unscheduled DNA synthesis is most frequently measured by autoradiography. The purpose of this report was to examine the usefulness of the liquid scintillation counting technique in measuring unscheduled DNA synthesis response in isolated rat hepatocytes. The various liquid scintillation counting-based unscheduled DNA synthesis assay procedures were examined according to the following groupings: (1) procedures based on the acid precipitation of cellular macromolecules, (2) procedures based on isopycnic gradient centrifugation of solubilized cells, (3) procedures based on nuclei isolation in conjunction with other DNA purification methods, and (4) procedures based on the selective retention of hepatocellular DNA. Limited cases in which test chemicals gave positive unscheduled DNA synthesis response in liquid scintillation counting-based assays and negative unscheduled DNA synthesis response in autoradiography-based assays are presented. It is concluded that liquid scintillation counting-based unscheduled DNA synthesis assays represent an appropriate system for inclusion in carcinogenicity and mutagenicity testing programs

  7. Assessing universality of DNA barcoding in geographically isolated selected desert medicinal species of Fabaceae and Poaceae

    Science.gov (United States)

    Hussain, Fatma; Ahmed, Nisar; Ghorbani, Abdolbaset

    2018-01-01

    In pursuit of developing fast and accurate species-level molecular identification methods, we tested six DNA barcodes, namely ITS2, matK, rbcLa, ITS2+matK, ITS2+rbcLa, matK+rbcLa and ITS2+matK+rbcLa, for their capacity to identify frequently consumed but geographically isolated medicinal species of Fabaceae and Poaceae indigenous to the desert of Cholistan. Data were analysed by BLASTn sequence similarity, pairwise sequence divergence in TAXONDNA, and phylogenetic (neighbour-joining and maximum-likelihood trees) methods. Comparison of six barcode regions showed that ITS2 has the highest number of variable sites (209/360) for tested Fabaceae and (106/365) Poaceae species, the highest species-level identification (40%) in BLASTn procedure, distinct DNA barcoding gap, 100% correct species identification in BM and BCM functions of TAXONDNA, and clear cladding pattern with high nodal support in phylogenetic trees in both families. ITS2+matK+rbcLa followed ITS2 in its species-level identification capacity. The study was concluded with advocating the DNA barcoding as an effective tool for species identification and ITS2 as the best barcode region in identifying medicinal species of Fabaceae and Poaceae. Current research has practical implementation potential in the fields of pharmaco-vigilance, trade of medicinal plants and biodiversity conservation. PMID:29576968

  8. Iminium ion chemistry of mitosene DNA alkylating agents. Enriched 13C NMR and isolation studies.

    Science.gov (United States)

    Ouyang, A; Skibo, E B

    2000-05-16

    Described herein is a study of the reductive alkylation chemistry of mitosene antitumor agents. We employed a 13C-enriched electrophilic center to probe the fate of the iminium ion resulting from reductive activation. The 13C-labeled center permitted the identification of complex products resulting from alkylation reactions. In the case of DNA reductive alkylation, the type and number of alkylation sites were readily assessed by 13C NMR. Although there has been much excellent work done in the area of mitosene chemistry and biochemistry, the present study provides a number of new findings: (1) The major fate of the iminium ion is head-to-tail polymerization, even in dilute solutions. (2) Dithionite reductive activation results in the formation of mitosene sulfite esters as well as the previously observed sulfonate adducts. (3) The mitosene iminium ion alkylates the adenosine 6-amino group as well as the guanosine 2-amino group. The identification of the latter adduct was greatly facilitated by the 13C-label at the electrophilic center. (4) The mitosene iminium ion alkylates DNA at both nitrogen and oxygen centers without any apparent base selectivity. The complexity of mitosene reductive alkylation of DNA will require continued adduct isolation studies.

  9. Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

    2013-01-01

    Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

  10. Preparation and isolation of dithiolene thiophosphoryl molecules as stable, protected forms of dithiolene ligands.

    Science.gov (United States)

    Arumugam, Kuppuswamy; Bollinger, James E; Fink, Mark; Donahue, James P

    2007-04-16

    The reaction of P4S10 with acyloins, RC(O)CH(OH)R, in refluxing dioxane, followed by the addition of alkylating agents, forms dithiolene thiophosphoryl thiolate compounds, (R2C2S2)P(S)(SR'), which are readily isolated and purified. The compounds that have been prepared and identified spectroscopically are those with R = p-anisyl, R' = Me (1); R = p-anisyl, R' = Bz (2); R = Ph, R' = Me (4); R = Et, R' = Bz (5). Compounds 1, 2, and 4 were structurally characterized by X-ray crystallography and found to possess a tetrahedral coordination geometry about the phosphorus atom, with overall Cs symmetry. In each case, the mirror plane bisects the dithiolene S-P-S chelate and contains the thiophosphoryl bond, which ranges in length from 1.9241(8) to 1.9361(7) A. The use of 2-(bromomethyl)naphthalene as organic electrophile in the P4S10/acyloin reaction produced bis(2-methylnaphthalenyl) disulfide as the only identifiable product. The substitution of Lawesson's reagent for P4S10 in reactions with acyloins produced deoxy acyloin rather than products resulting from chalcogen exchange. Compounds 1-2 and 4-5 are Group 5 analogues of 1,3-dithiol-2-ones, (R2C2S2)C=O, and undergo a similar hydrolysis in aqueous base to liberate ene-1,2-dithiolate dianions from which corresponding metal dithiolene complexes may be prepared. Deprotection of 1 in MeO-/MeOH, followed by the addition of NiCl2.6H2O and then I2, produces square planar [Ni(S2C2(C6H4-p-OCH3)2)2] (8) in 93% yield. A high-resolution structure of 8 (P) reveals dithiolene C-C and C-S bond lengths that are clearly indicative of the thionyl radical monoanionic nature of the ligand. The use of isolated (R2C2S2)P(S)(SR') compounds as a dithiolene ligand source for the preparation of metal dithiolene complexes offers the advantages of clean reactivity and high yield.

  11. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  12. Isolation and molecular characterization of biofouling bacteria and profiling of quorum sensing signal molecules from membrane bioreactor activated sludge.

    Science.gov (United States)

    Lade, Harshad; Paul, Diby; Kweon, Ji Hyang

    2014-02-04

    The formation of biofilm in a membrane bioreactor depends on the production of various signaling molecules like N-acyl homoserine lactones (AHLs). In the present study, a total of 200 bacterial strains were isolated from membrane bioreactor activated sludge and screened for AHLs production using two biosensor systems, Chromobacterium violaceum CV026 and Agrobacterium tumefaciens A136. A correlation between AHLs production and biofilm formation has been made among screened AHLs producing strains. The 16S rRNA gene sequence analysis revealed the dominance of Aeromonas and Enterobacter sp. in AHLs production; however few a species of Serratia, Leclercia, Pseudomonas, Klebsiella, Raoultella and Citrobacter were also identified. The chromatographic characterization of sludge extract showed the presence of a broad range of quorum sensing signal molecules. Further identification of sludge AHLs by thin layer chromatography bioassay and high performance liquid chromatography confirms the presence of C4-HSL, C6-HSL, C8-HSL, 3-oxo-C8-HSL, C10-HSL, C12-HSL, 3-oxo-C12-HSL and C14-HSL. The occurrence of AHLs in sludge extract and dominance of Aeromonas and Enterobacter sp. in activated sludge suggests the key role of these bacterial strains in AHLs production and thereby membrane fouling.

  13. Isolation and Molecular Characterization of Biofouling Bacteria and Profiling of Quorum Sensing Signal Molecules from Membrane Bioreactor Activated Sludge

    Directory of Open Access Journals (Sweden)

    Harshad Lade

    2014-02-01

    Full Text Available The formation of biofilm in a membrane bioreactor depends on the production of various signaling molecules like N-acyl homoserine lactones (AHLs. In the present study, a total of 200 bacterial strains were isolated from membrane bioreactor activated sludge and screened for AHLs production using two biosensor systems, Chromobacterium violaceum CV026 and Agrobacterium tumefaciens A136. A correlation between AHLs production and biofilm formation has been made among screened AHLs producing strains. The 16S rRNA gene sequence analysis revealed the dominance of Aeromonas and Enterobacter sp. in AHLs production; however few a species of Serratia, Leclercia, Pseudomonas, Klebsiella, Raoultella and Citrobacter were also identified. The chromatographic characterization of sludge extract showed the presence of a broad range of quorum sensing signal molecules. Further identification of sludge AHLs by thin layer chromatography bioassay and high performance liquid chromatography confirms the presence of C4-HSL, C6-HSL, C8-HSL, 3-oxo-C8-HSL, C10-HSL, C12-HSL, 3-oxo-C12-HSL and C14-HSL. The occurrence of AHLs in sludge extract and dominance of Aeromonas and Enterobacter sp. in activated sludge suggests the key role of these bacterial strains in AHLs production and thereby membrane fouling.

  14. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  15. The Isolation of DNA by Polycharged Magnetic Particles: An Analysis of the Interaction by Zeta Potential and Particle Size.

    Science.gov (United States)

    Haddad, Yazan; Xhaxhiu, Kledi; Kopel, Pavel; Hynek, David; Zitka, Ondrej; Adam, Vojtech

    2016-04-20

    Magnetic isolation of biological targets is in major demand in the biotechnology industry today. This study considers the interaction of four surface-modified magnetic micro- and nanoparticles with selected DNA fragments. Different surface modifications of nanomaghemite precursors were investigated: MAN37 (silica-coated), MAN127 (polyvinylpyrrolidone-coated), MAN158 (phosphate-coated), and MAN164 (tripolyphosphate-coated). All particles were positive polycharged agglomerated monodispersed systems. Mean particle sizes were 0.48, 2.97, 2.93, and 3.67 μm for MAN37, MAN127, MAN164, and MAN158, respectively. DNA fragments exhibited negative zeta potential of -0.22 mV under binding conditions (high ionic strength, low pH, and dehydration). A decrease in zeta potential of particles upon exposure to DNA was observed with exception of MAN158 particles. The measured particle size of MAN164 particles increased by nearly twofold upon exposure to DNA. Quantitative PCR isolation of DNA with a high retrieval rate was observed by magnetic particles MAN127 and MAN164. Interaction between polycharged magnetic particles and DNA is mediated by various binding mechanisms such as hydrophobic and electrostatic interactions. Future development of DNA isolation technology requires an understanding of the physical and biochemical conditions of this process.

  16. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  17. In vitro characterization of multivalent adhesion molecule 7-based inhibition of multidrug-resistant bacteria isolated from wounded military personnel

    Science.gov (United States)

    Krachler, Anne Marie; Mende, Katrin; Murray, Clinton; Orth, Kim

    2012-01-01

    Treatment of wounded military personnel at military medical centers is often complicated by colonization and infection of wounds with pathogenic bacteria. These include nosocomially transmitted, often multidrug-resistant pathogens such as Acinetobacter baumannii-calcoaceticus complex, Pseudomonas aeruginosa and extended spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae. We analyzed the efficacy of multivalent adhesion molecule (MAM) 7-based anti-adhesion treatment of host cells against aforementioned pathogens in a tissue culture infection model. Herein, we observed that a correlation between two important hallmarks of virulence, attachment and cytotoxicity, could serve as a useful predictor for the success of MAM7-based inhibition against bacterial infections. Initially, we characterized 20 patient isolates (five from each pathogen mentioned above) in terms of genotypic diversity, antimicrobial susceptibility and important hallmarks of pathogenicity (biofilm formation, attachment to and cytotoxicity toward cultured host cells). All isolates displayed a high degree of genotypic diversity, which was also reflected by large strain-to-strain variability in terms of biofilm formation, attachment and cytotoxicity within each group of pathogen. Using non-pathogenic bacteria expressing MAM7 or latex beads coated with recombinant MAM7 for anti-adhesion treatment, we showed a decrease in cytotoxicity, indicating that MAM7 has potential as a prophylactic agent to attenuate infection by multidrug-resistant bacterial pathogens. PMID:22722243

  18. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  19. Discordant genotyping results using DNA isolated from anti-doping control urine samples.

    Science.gov (United States)

    Choong, Eva; Schulze, Jenny J; Ericsson, Magnus; Rane, Anders; Ekström, Lena

    2017-07-01

    The UGT2B17 gene deletion polymorphism is known to correlate to urinary concentration of testosterone-glucuronide and hence this genotype exerts a large impact on the testosterone/epitestosterone (T/E) ratio, a biomarker for testosterone doping. The objective of this study was to assess if DNA isolated from athletes' urine samples (n = 713) obtained in routine doping controls could be targeted for genotyping analysis for future integration in the athlete's passport. A control population (n = 21) including both urine and blood DNA was used for genotyping concordance test. Another aim was to study a large group (n = 596) of authentic elite athletes in respect of urinary steroid profile in relation to genetic variation. First we found that the genotype results when using urine-derived DNA did not correlate sufficiently with the genotype obtained from whole blood DNA. Secondly we found males with one or two UGT2B17 alleles had higher T/E (mean 1.63 ± 0.93) than females (mean 1.28 ± 1.08), p˂0.001. Unexpectedly, we found that several male del/del athletes in power sports had a T/E ˃1. If men in power sport exert a different urinary steroid profile needs to be further investigated. The other polymorphisms investigated in the CYP17A1, UGT2B7 and UGT2B15 genes did not show any associations with testosterone and epitestosterone concentrations. Our results show that genotyping using urine samples according to our method is not useful in an anti-doping setting. Instead, it is of importance for the anti-doping test programs to include baseline values in the ABP to minimize any putative impact of genotype. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    Science.gov (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  1. DNA-A of a highly pathogenic Indian cassava mosaic virus isolated from Jatropha curcas causes symptoms in Nicotiana benthamiana.

    Science.gov (United States)

    Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian

    2014-04-01

    Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.

  2. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    Science.gov (United States)

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  3. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  4. Development of a Novel Self-Enclosed Sample Preparation Device for DNA/RNA Isolation in Space

    Science.gov (United States)

    Zhang, Ye; Mehta, Satish K.; Pensinger, Stuart J.; Pickering, Karen D.

    2011-01-01

    Modern biology techniques present potentials for a wide range of molecular, cellular, and biochemistry applications in space, including detection of infectious pathogens and environmental contaminations, monitoring of drug-resistant microbial and dangerous mutations, identification of new phenotypes of microbial and new life species. However, one of the major technological blockades in enabling these technologies in space is a lack of devices for sample preparation in the space environment. To overcome such an obstacle, we constructed a prototype of a DNA/RNA isolation device based on our novel designs documented in the NASA New Technology Reporting System (MSC-24811-1/3-1). This device is self-enclosed and pipette free, purposely designed for use in the absence of gravity. Our design can also be modified easily for preparing samples in space for other applications, such as flowcytometry, immunostaining, cell separation, sample purification and separation according to its size and charges, sample chemical labeling, and sample purification. The prototype of our DNA/RNA isolation device was tested for efficiencies of DNA and RNA isolation from various cell types for PCR analysis. The purity and integrity of purified DNA and RNA were determined as well. Results showed that our developed DNA/RNA isolation device offers similar efficiency and quality in comparison to the samples prepared using the standard protocol in the laboratory.

  5. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  6. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  7. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  8. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  9. Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

    Science.gov (United States)

    Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

    2007-06-15

    The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

  10. Comparative analysis of five DNA isolation protocols and three drying methods for leaves samples of Nectandra megapotamica (Spreng. Mez

    Directory of Open Access Journals (Sweden)

    Leonardo Severo da Costa

    2016-06-01

    Full Text Available The aim of the study was to establish a DNA isolation protocol Nectandra megapotamica (Spreng. Mez., able to obtain samples of high yield and quality for use in genomic analysis. A commercial kit and four classical methods of DNA extraction were tested, including three cetyltrimethylammonium bromide (CTAB-based and one sodium dodecyl sulfate (SDS-based methods. Three drying methods for leaves samples were also evaluated including drying at room temperature (RT, in an oven at 40ºC (S40, and in a microwave oven (FMO. The DNA solutions obtained from different types of leaves samples using the five protocols were assessed in terms of cost, execution time, and quality and yield of extracted DNA. The commercial kit did not extract DNA with sufficient quantity or quality for successful PCR reactions. Among the classic methods, only the protocols of Dellaporta and of Khanuja yielded DNA extractions for all three types of foliar samples that resulted in successful PCR reactions and subsequent enzyme restriction assays. Based on the evaluated variables, the most appropriate DNA extraction method for Nectandra megapotamica (Spreng. Mez. was that of Dellaporta, regardless of the method used to dry the samples. The selected method has a relatively low cost and total execution time. Moreover, the quality and quantity of DNA extracted using this method was sufficient for DNA sequence amplification using PCR reactions and to get restriction fragments.

  11. Isolation of reovirus T3D mutants capable of infecting human tumor cells independent of junction adhesion molecule-A.

    Directory of Open Access Journals (Sweden)

    Diana J M van den Wollenberg

    Full Text Available Mammalian Reovirus is a double-stranded RNA virus with a distinctive preference to replicate in and lyse transformed cells. On that account, Reovirus type 3 Dearing (T3D is clinically evaluated as oncolytic agent. The therapeutic efficacy of this approach depends in part on the accessibility of the reovirus receptor Junction Adhesion Molecule-A (JAM-A on the target cells. Here, we describe the isolation and characterization of reovirus T3D mutants that can infect human tumor cells independent of JAM-A. The JAM-A-independent (jin mutants were isolated on human U118MG glioblastoma cells, which do not express JAM-A. All jin mutants harbour mutations in the S1 segments close to the region that encodes the sialic acid-binding pocket in the shaft of the spike protein. In addition, two of the jin mutants encode spike proteins with a Q336R substitution in their head domain. The jin mutants can productively infect a wide range of cell lines that resist wt reovirus T3D infection, including chicken LMH cells, hamster CHO cells, murine endothelioma cells, human U2OS and STA-ET2.1 cells, but not primary human fibroblasts. The jin-mutants rely on the presence of sialic-acid residues on the cell surface for productive infection, as is evident from wheat germ agglutinin (WGA inhibition experiments, and from the jin-reovirus resistance of CHO-Lec2 cells, which have a deficiency of sialic-acids on their glycoproteins. The jin mutants may be useful as oncolytic agents for use in tumors in which JAM-A is absent or inaccessible.

  12. Isolation and sequence analysis of the wheat B genome subtelomeric DNA

    Directory of Open Access Journals (Sweden)

    Huneau Cecile

    2009-09-01

    Full Text Available Abstract Background Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. Results The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119 737 bp was annotated. It is composed of 33% transposable elements (TEs, 8.2% Spelt52 (namely, the subfamily Spelt52.2 and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11 666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0. Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Conclusion Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat

  13. Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

    Science.gov (United States)

    Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

    2009-09-05

    Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time

  14. Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

    Directory of Open Access Journals (Sweden)

    Noor Adila, A. K.

    2007-01-01

    Full Text Available A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP, hexacetyltrimethylammonium bromide (CTAB or without using PVB or CTAB. For RNA isolation, we tested two published protocols, one of which is based on TRI REAGENT (Molecular Research Center, USA and another is simple method employing phenol for RNA extraction and LiCl for precipitation. We found that the protocol involving the use of CTAB produced the highest genomic DNA yield with the best quality compared to other protocols. In the presence of CTAB, unwanted polysaccharides were removed and this method yielded an average amount of 816 ± 12.2 µg DNA/g mycelia with UV absorbance ratios A260/280 and A260/230 of 1.67 ± 0.64 and 1.97 ± 0.23, respectively. The genomic DNA isolated via this protocol is also suitable for PCR amplification and restriction enzyme digestion. As for RNA isolation, the method involving phenol extraction and LiCl precipitation produced the highest yield of RNA with an average amount of 372 ± 6.0 µg RNA/g mycelia. The RNA appears to be relatively pure since it has UV absorbance ratios A260/280 and A260/230 of 1.89 ± 2.00 and 1.99 ± 0.03, respectively. Finally, we have demonstrated that this method could produce RNA of sufficient quality for RT-PCR that amplified a 600 bp fragment of ∆12-fatty acid desaturase gene in C. bainieri.

  15. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    Lindy L. Esterhuizen

    2012-09-01

    Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  16. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  17. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  18. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  19. Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

    International Nuclear Information System (INIS)

    Hayes, S.; Hayes, C.; Brand, L.

    1981-01-01

    A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

  20. Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

    Science.gov (United States)

    Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

    2015-04-01

    DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

  1. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    Science.gov (United States)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  2. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

    Science.gov (United States)

    Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

    2010-11-01

    Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

  5. Visual Analysis of DNA Microarray Data for Accurate Molecular Identification of Non-albicans Candida Isolates from Patients with Candidemia Episodes

    OpenAIRE

    De Luca Ferrari, Michela; Ribeiro Resende, Mariângela; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Gonoi, Tohru; Mikami, Yuzuru; Tominaga, Kenichiro; Kamei, Katsuhiko; Zaninelli Schreiber, Angelica; Trabasso, Plinio; Moretti, Maria Luiza

    2013-01-01

    The performance of a visual slide-based DNA microarray for the identification of non-albicans Candida spp. was evaluated. Among 167 isolates that had previously been identified by Vitek 2, the agreement between DNA microarray and sequencing results was 97.6%. This DNA microarray platform showed excellent performance.

  6. Genetic Variability of Beauveria bassiana and a DNA Marker for Environmental Monitoring of a Highly Virulent Isolate Against Cosmopolites sordidus.

    Science.gov (United States)

    Ferri, D V; Munhoz, C F; Neves, P M O; Ferracin, L M; Sartori, D; Vieira, M L C; Fungaro, M H P

    2012-12-01

    The banana weevil Cosmopolites sordidus (Germar) is one of a number of pests that attack banana crops. The use of the entomopathogenic fungus Beauveria bassiana as a biological control agent for this pest may contribute towards reducing the application of chemical insecticides on banana crops. In this study, the genetic variability of a collection of Brazilian isolates of B. bassiana was evaluated. Samples were obtained from various geographic regions of Brazil, and from different hosts of the Curculionidae family. Based on the DNA fingerprints generated by RAPD and AFLP, we found that 92 and 88 % of the loci were polymorphic, respectively. The B. bassiana isolates were attributed to two genotypic clusters based on the RAPD data, and to three genotypic clusters, when analyzed with AFLP. The nucleotide sequences of nuclear ribosomal DNA intergenic spacers confirmed that all isolates are in fact B. bassiana. Analysis of molecular variance showed that variability among the isolates was not correlated with geographic origin or hosts. A RAPD-specific marker for isolate CG 1024, which is highly virulent to C. sordidus, was cloned and sequenced. Based on the sequences obtained, specific PCR primers BbasCG1024F (5'-TGC GGC TGA GGA GGA CT-3') and BbasCG1024R (5'-TGC GGC TGA GTG TAG AAC-3') were designed for detecting and monitoring this isolate in the field.

  7. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  8. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  9. Isolating Sperm from Cell Mixtures Using Magnetic Beads Coupled with an Anti-PH-20 Antibody for Forensic DNA Analysis.

    Directory of Open Access Journals (Sweden)

    Xing-Chun Zhao

    Full Text Available Vaginal swabs taken in rape cases usually contain epithelial cells from the victim and sperm from the assailant and forensic DNA analysis requires separation of sperm from these cell mixtures. PH-20, which is a glycosylphosphatidylinositol-anchored hyaluronidase located on the head of sperm, has important functions in fertilization. Here we describe a newly developed method for sperm isolation using anti-PH-20 antibody-coupled immunomagnetic beads (anti-PH-20 IMBs. Optical microscopy and scanning electron microscopy showed the IMBs recognized the head of sperm specifically and exhibited a great capacity to capture sperm cells. However, we found it necessary to incubate the IMB-sperm complex with DNase I before sperm lysis in order to remove any female DNA completely. We compared the sensitivity of anti-PH-20 IMBs in sperm and epithelial cell discrimination to those coated with a different anti-sperm antibody (anti-SP-10, anti-ADAM2 or anti-JLP. Only the anti-PH-20 IMBs succeeded in isolating sperm from cell mixtures at a sperm/epithelial cell ratio of 103:105. Further, our method exhibited greater power and better stability for sperm isolation compared to the traditional differential lysis strategy. Taken together, the anti-PH-20 IMB method described here could be effective for the isolation of sperm needed to obtain a single-sourced DNA profile as an aid to identifying the perpetrator in sexual assault cases.

  10. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  11. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  12. Isolation of bacterial extrachromosomal DNA from human dental plaque associated with periodontal disease, using transposon-aided capture (TRACA).

    Science.gov (United States)

    Warburton, Philip J; Allan, Elaine; Hunter, Stephanie; Ward, John; Booth, Veronica; Wade, William G; Mullany, Peter

    2011-11-01

    The human oral cavity is host to a complex microbial community estimated to comprise >700 bacterial species, of which at least half are thought to be not yet cultivable in vitro. To investigate the plasmids present in this community, we used a transposon-aided capture system, which allowed the isolation of plasmids from human oral supra- and subgingival plaque samples. Thirty-two novel plasmids and a circular molecule that could be an integrase-generated circular intermediate were isolated. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. DNA microarray genotyping and virulence and antimicrobial resistance gene profiling of methicillin-resistant Staphylococcus aureus bloodstream isolates from renal patients.

    LENUS (Irish Health Repository)

    McNicholas, Sinead

    2012-02-01

    Thirty-six methicillin-resistant Staphylococcus aureus (MRSA) bloodstream isolates from renal patients were genetically characterized by DNA microarray analysis and spa typing. The isolates were highly clonal, belonging mainly to ST22-MRSA-IV. The immune evasion and enterotoxin gene clusters were found in 29\\/36 (80%) and 33\\/36 (92%) isolates, respectively.

  14. DNA microarray genotyping and virulence and antimicrobial resistance gene profiling of methicillin-resistant Staphylococcus aureus bloodstream isolates from renal patients.

    LENUS (Irish Health Repository)

    McNicholas, Sinead

    2011-12-01

    Thirty-six methicillin-resistant Staphylococcus aureus (MRSA) bloodstream isolates from renal patients were genetically characterized by DNA microarray analysis and spa typing. The isolates were highly clonal, belonging mainly to ST22-MRSA-IV. The immune evasion and enterotoxin gene clusters were found in 29\\/36 (80%) and 33\\/36 (92%) isolates, respectively.

  15. Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    Science.gov (United States)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

    2017-03-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

  16. Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    International Nuclear Information System (INIS)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

    2017-01-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

  17. Hybridization change of DNA and nuclear RNA synthesized immediately after ionizing irradiation in spleen cells isolated from 615 mice

    International Nuclear Information System (INIS)

    Meng Ziqiang

    1986-01-01

    DNA hybridization with nuclear RNA(nRNA) synthesized immediately after 60 Co Gamma-irradiation in the spleen cells freshly isolated from inbred line 615 mice was investigated, using the technique of Gillespie and Spiegelman. In RNA/DNA hybridization percentage experiment, it was showed that the hybridization of normal DNA with labelled nRNA synthesized in irradiated cells reached the saturation point at a much faster rate than with labelled normal nRNA. The hybridization percentage of nRNA synthesized in irradiated cells was higher than that of normal nRNA during the different reaction time before the saturation point of DNA with nRNA synthesized in irradiated cells, but it was lower than that of normal nRNA after the zone of high repetitive DNA sequences was stimulated, however, the transcription of some base sequences in the zone of low repetitive DNA sequences was seriously inhibited. Measurements of the exhaustion rates of pulse-labelled nRNA were carried out as described by Greene and Flickinger Biochim. In these studies, pulse-labelled nRNA synthesized in unirradiated and irradiated cells were compared by exhausion with DNA at hybridization time of 4 or 24 hours, When the hybridization time was 4 hours, the nRNA synthesized in irradiated cells displayed a faster exhaustion rate than the control nRNA. But if the hybridization time was 24 hours, the exhaustion rate of nRNA synthesized in irradiated cells reduced. These results demostrated that Gamma-irradiation changed the proportion of transcription of some nRNA species and implayed that the sensitivities of the transcription activeties of the different repetitive DNA sequences to Gamma-irradiation were different, and so were the transcription activeties of the different base sequences in the same repetitive DNA sequences

  18. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    Science.gov (United States)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  19. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  20. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    International Nuclear Information System (INIS)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  1. Developing a biological dosimeter based on mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

  2. Developing a biological dosimeter based on mitochondrial DNA

    International Nuclear Information System (INIS)

    Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

    1995-01-01

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

  3. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  4. An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

    Directory of Open Access Journals (Sweden)

    Kaur Jatinder

    2010-05-01

    Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

  5. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  6. Protection of radiation induced DNA and membrane damages by total triterpenes isolated from Ganoderma lucidum (Fr.) P. Karst.

    Science.gov (United States)

    Smina, T P; Maurya, D K; Devasagayam, T P A; Janardhanan, K K

    2015-05-25

    The total triterpenes isolated from the fruiting bodies of Ganoderma lucidum was examined for its potential to prevent γ-radiation induced membrane damage in rat liver mitochondria and microsomes. The effects of total triterpenes on γ-radiation-induced DNA strand breaks in pBR 322 plasmid DNA in vitro and human peripheral blood lymphocytes ex vivo were evaluated. The protective effect of total triterpenes against γ-radiation-induced micronuclei formations in mice bone marrow cells in vivo were also evaluated. The results indicated the significant effectiveness of Ganoderma triterpenes in protecting the DNA and membrane damages consequent to the hazardous effects of radiation. The findings suggest the potential use of Ganoderma triterpenes in radio therapy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

    Science.gov (United States)

    Sharp, Richard J.; Williams, Ralph A. D.

    1988-01-01

    Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

  8. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  9. Isolation of high-quality DNA in 16 aromatic and medicinal Colombian species using silica-based extraction columns

    Directory of Open Access Journals (Sweden)

    Vega Vela Nelson Enrique

    2011-12-01

    Full Text Available

    Aromatic and medicinal plant species are a valuable resource for research and development of pharmaceutical, cosmetic, crop protection and nutritional agents, due to the high amount of bioactive phytochemicals that they contain. However, these compounds are a major obstacle in the isolation of high-quality DNA suitable for genetic analyses. In this paper, we report a protocol that optimizes the use of the cationic detergent CTAB and the reductant β-mercaptoethanol in cell lysis. The elimination of plant secondary metabolites such as polysaccharides and polyphenols, that typically co-isolate with DNA, was achieved using the chemical denaturing properties of the guanidinium cation, which together with the adsorbent chemical specificity of the silica, resulted in the purification of high-quality DNA suitable for digestion with restriction enzymes and optimal for PCR amplification of AFLP-type molecular markers. This protocol was evaluated on 16 Colombian aromatic and medicinal plant species promising for their essential oils. The results allow suggesting that this procedure might be appropriate for other species, tissues and sample types recalcitrant to DNA extraction.

  10. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  11. Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

    Science.gov (United States)

    Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

    2002-01-01

    To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

  12. Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

    Science.gov (United States)

    Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

    2010-12-01

    Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

  13. Transcriptome analysis by cDNA-AFLP of Suillus luteus Cd-tolerant and Cd-sensitive isolates.

    Science.gov (United States)

    Ruytinx, Joske; Craciun, Adrian R; Verstraelen, Karen; Vangronsveld, Jaco; Colpaert, Jan V; Verbruggen, Nathalie

    2011-04-01

    The ectomycorrhizal basidiomycete Suillus luteus (L.:Fr.), a typical pioneer species which associates with young pine trees colonizing disturbed sites, is a common root symbiont found at heavy metal contaminated sites. Three Cd-sensitive and three Cd-tolerant isolates of S. luteus, isolated respectively from non-polluted and a heavy metal-polluted site in Limburg (Belgium), were used for a transcriptomic analysis. We identified differentially expressed genes by cDNA-AFLP analysis. The possible roles of some of the encoded proteins in heavy metal (Cd) accumulation and tolerance are discussed. Despite the high conservation of coding sequences in S. luteus, a large intraspecific variation in the transcript profiles was observed. This variation was as large in Cd-tolerant as in sensitive isolates and may help this pioneer species to adapt to novel environments.

  14. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  15. A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

    Science.gov (United States)

    Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

    2008-07-01

    Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

  16. Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

    Science.gov (United States)

    Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

    2014-02-01

    We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Isolation of deletion alleles by G4 DNA-induced mutagenesis

    NARCIS (Netherlands)

    Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

    Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

  18. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  19. Isolation and characterization of high affinity aptamers against DNA polymerase iota.

    Science.gov (United States)

    Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

    2012-02-01

    Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

  20. Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

    Science.gov (United States)

    Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

    2000-12-01

    Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

  1. Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Irshad M. Sulaiman

    2014-06-01

    Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.

  2. The Identification of Complex Organic Molecules in the Interstellar Medium: Using Lasers and Matrix Isolation Spectroscopy to Simulate the Interstellar Environment

    Science.gov (United States)

    Stone, Bradley M.

    1998-01-01

    The Astrochemistry Group at NASA Ames Research Center is interested in the identification of large organic molecules in the interstellar medium Many smaller organic species (e.g. hydrocarbons, alcohols, etc.) have been previously identified by their radiofrequency signature due to molecular rotations. However, this becomes increasingly difficult to observe as the size of the molecule increases. Our group in interested in the identification of the carriers of the Diffuse Interstellar Bands (absorption features observed throughout the visible and near-infrared in the spectra of stars, due to species in the interstellar medium). Polycyclic Aromatic Hydrocarbons (PAHs) and related molecules are thought to be good candidates for these carriers. Laboratory experiments am performed at Ames to simulate the interstellar environment, and to compare spectra obtained from molecules in the laboratory to those derived astronomically. We are also interested in PAHs with respect to their possible connection to the UIR (Unidentified infrared) and ERE (Extended Red Emission) bands - emission features found to emanate from particular regions of our galaxy (e.g. Orion nebula, Red Rectangle, etc.). An old, "tried and proven spectroscopic technique, matrix isolation spectroscopy creates molecular conditions ideal for performing laboratory astrophysics.

  3. Stroke Status Evoked Adhesion Molecule Genetic Alterations in Astrocytes Isolated from Stroke-Prone Spontaneously Hypertensive Rats and the Apigenin Inhibition of Their Expression

    Directory of Open Access Journals (Sweden)

    Kazuo Yamagata

    2010-01-01

    Full Text Available We examined the possibility that the expression of adhesion molecules is regulated differently in cultured astrocytes from stroke-prone spontaneously hypertensive rats (SHRSP/IZM rats than in those from Wistar Kyoto rats (WKY/IZM by tumor necrosis factor-alpha (TNF- or hypoxia and reoxygenation (H/R and the inhibitory effects of apigenin. It was found that the expression of vascular cell adhesion molecule-1 (VCAM-1 by TNF- in astrocytes isolated from SHRSP/IZM was increased compared with that in WKY/IZM. The expression of monocyte chemotactic protein-1 (MCP-1 mRNA induced by H/R in SHRSP/IZM astrocytes was increased compared with that in normal oxygen concentrations. Apigenin strongly attenuated TNF--induced VCAM-1 mRNA and protein expression and suppressed the adhesion of U937 cells and SHRSP/IZM astrocytes. These results suggest that the expression levels of adhesion molecules during H/R affect disease outcome and can drive SHRSP/IZM to stroke. It is suggested that apigenin regulates adhesion molecule expression in reactive astrocytes during ischemia.

  4. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  5. Isolating DNA from sexual assault cases: a comparison of standard methods with a nuclease-based approach

    Science.gov (United States)

    2012-01-01

    Background Profiling sperm DNA present on vaginal swabs taken from rape victims often contributes to identifying and incarcerating rapists. Large amounts of the victim’s epithelial cells contaminate the sperm present on swabs, however, and complicate this process. The standard method for obtaining relatively pure sperm DNA from a vaginal swab is to digest the epithelial cells with Proteinase K in order to solubilize the victim’s DNA, and to then physically separate the soluble DNA from the intact sperm by pelleting the sperm, removing the victim’s fraction, and repeatedly washing the sperm pellet. An alternative approach that does not require washing steps is to digest with Proteinase K, pellet the sperm, remove the victim’s fraction, and then digest the residual victim’s DNA with a nuclease. Methods The nuclease approach has been commercialized in a product, the Erase Sperm Isolation Kit (PTC Labs, Columbia, MO, USA), and five crime laboratories have tested it on semen-spiked female buccal swabs in a direct comparison with their standard methods. Comparisons have also been performed on timed post-coital vaginal swabs and evidence collected from sexual assault cases. Results For the semen-spiked buccal swabs, Erase outperformed the standard methods in all five laboratories and in most cases was able to provide a clean male profile from buccal swabs spiked with only 1,500 sperm. The vaginal swabs taken after consensual sex and the evidence collected from rape victims showed a similar pattern of Erase providing superior profiles. Conclusions In all samples tested, STR profiles of the male DNA fractions obtained with Erase were as good as or better than those obtained using the standard methods. PMID:23211019

  6. Characterization of field isolates of Magnaporthe oryzae with mating type, DNA fingerprinting, and pathogenicity assays

    Science.gov (United States)

    Due to the harmful nature of the rice blast fungus, Magnaporthe oryzae, it is beneficial to characterize field isolates to help aid in the deployment of resistance (R) genes in rice. In the present study, 190 field isolates of M. oryzae, collected from rice fields of Yunnan province in China, were a...

  7. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  8. Isolation and Characterization of a Double Stranded DNA Megavirus Infecting the Toxin-Producing Haptophyte Prymnesium parvum

    Directory of Open Access Journals (Sweden)

    Ben A. Wagstaff

    2017-03-01

    Full Text Available Prymnesium parvum is a toxin-producing haptophyte that causes harmful algal blooms globally, leading to large-scale fish kills that have severe ecological and economic implications. For the model haptophyte, Emiliania huxleyi, it has been shown that large dsDNA viruses play an important role in regulating blooms and therefore biogeochemical cycling, but much less work has been done looking at viruses that infect P. parvum, or the role that these viruses may play in regulating harmful algal blooms. In this study, we report the isolation and characterization of a lytic nucleo-cytoplasmic large DNA virus (NCLDV collected from the site of a harmful P. parvum bloom. In subsequent experiments, this virus was shown to infect cultures of Prymnesium sp. and showed phylogenetic similarity to the extended Megaviridae family of algal viruses.

  9. Stability of cell-free DNA from maternal plasma isolated following a single centrifugation step.

    Science.gov (United States)

    Barrett, Angela N; Thadani, Henna A; Laureano-Asibal, Cecille; Ponnusamy, Sukumar; Choolani, Mahesh

    2014-12-01

    Cell-free fetal DNA can be used for prenatal testing with no procedure-related risk to the fetus. However, yield of fetal DNA is low compared with maternal cell-free DNA fragments, resulting in technical challenges for some downstream applications. To maximize the fetal fraction, careful blood processing procedures are essential. We demonstrate that fetal fraction can be preserved using a single centrifugation step followed by postage of plasma to the laboratory for further processing. Digital PCR was used to quantify copies of total, maternal, and fetal DNA present in single-spun plasma at time points over a two-week period, compared with immediately processed double-spun plasma, with storage at room temperature, 4°C, and -80°C representing different postage scenarios. There was no significant change in total, maternal, or fetal DNA copy numbers when single-spun plasma samples were stored for up to 1 week at room temperature and 2 weeks at -80°C compared with plasma processed within 4 h. Following storage at 4°C no change in composition of cell-free DNA was observed. Single-spun plasma can be transported at room temperature if the journey is expected to take one week or less; shipping on dry ice is preferable for longer journeys. © 2014 John Wiley & Sons, Ltd.

  10. Estimation of isolation times of the island species in the Drosophila simulans complex from multilocus DNA sequence data.

    Directory of Open Access Journals (Sweden)

    Shannon R McDermott

    2008-06-01

    Full Text Available The Drosophila simulans species complex continues to serve as an important model system for the study of new species formation. The complex is comprised of the cosmopolitan species, D. simulans, and two island endemics, D. mauritiana and D. sechellia. A substantial amount of effort has gone into reconstructing the natural history of the complex, in part to infer the context in which functional divergence among the species has arisen. In this regard, a key parameter to be estimated is the initial isolation time (t of each island species. Loci in regions of low recombination have lower divergence within the complex than do other loci, yet divergence from D. melanogaster is similar for both classes. This might reflect gene flow of the low-recombination loci subsequent to initial isolation, but it might also reflect differential effects of changing population size on the two recombination classes of loci when the low-recombination loci are subject to genetic hitchhiking or pseudohitchhikingNew DNA sequence variation data for 17 loci corroborate the prior observation from 13 loci that DNA sequence divergence is reduced in genes of low recombination. Two models are presented to estimate t and other relevant parameters (substitution rate correction factors in lineages leading to the island species and, in the case of the 4-parameter model, the ratio of ancestral to extant effective population size from the multilocus DNA sequence data.In general, it appears that both island species were isolated at about the same time, here estimated at approximately 250,000 years ago. It also appears that the difference in divergence patterns of genes in regions of low and higher recombination can be reconciled by allowing a modestly larger effective population size for the ancestral population than for extant D. simulans.

  11. Comparison of pathogen DNA isolation methods from large volumes of whole blood to improve molecular diagnosis of bloodstream infections.

    Directory of Open Access Journals (Sweden)

    Anne J M Loonen

    Full Text Available For patients suffering from bloodstream infections (BSI molecular diagnostics from whole blood holds promise to provide fast and adequate treatment. However, this approach is hampered by the need of large blood volumes. Three methods for pathogen DNA isolation from whole blood were compared, i.e. an enzymatic method (MolYsis, 1-5 ml, the novel non-enzymatic procedure (Polaris, 1-5 ml, and a method that does not entail removal of human DNA (Triton-Tris-EDTA EasyMAG, 200 µl. These methods were evaluated by processing blood spiked with 0-1000 CFU/ml of Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans. Downstream detection was performed with real-time PCR assays. Polaris and MolYsis processing followed by real-time PCRs enabled pathogen detection at clinically relevant concentrations of 1-10 CFU/ml blood. By increasing sample volumes, concurrent lower cycle threshold (Ct values were obtained at clinically relevant pathogen concentrations, demonstrating the benefit of using larger blood volumes. A 100% detection rate at a concentration of 10 CFU/ml for all tested pathogens was obtained with the Polaris enrichment, whereas comparatively lower detection rates were measured for MolYsis (50-67% and EasyMAG (58-79%. For the samples with a concentration of 1 CFU/ml Polaris resulted in most optimal detection rates of 70-75% (MolYsis 17-50% and TTE-EasyMAG 20-36%. The Polaris method was more reproducible, less labour intensive, and faster (45 minutes (including Qiagen DNA extraction vs. 2 hours (MolYsis. In conclusion, Polaris and MolYsis enrichment followed by DNA isolation and real-time PCR enables reliable and sensitive detection of bacteria and fungi from 5 ml blood. With Polaris results are available within 3 hours, showing potential for improved BSI diagnostics.

  12. Colletotrichum isolates related to Anthracnose of cashew trees in Brazil: morphological and molecular description using LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Ana Maria Queijeiro Lopez

    2010-08-01

    Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C

  13. Identification of multiple mRNA and DNA sequences from small tissue samples isolated by laser-assisted microdissection.

    Science.gov (United States)

    Bernsen, M R; Dijkman, H B; de Vries, E; Figdor, C G; Ruiter, D J; Adema, G J; van Muijen, G N

    1998-10-01

    Molecular analysis of small tissue samples has become increasingly important in biomedical studies. Using a laser dissection microscope and modified nucleic acid isolation protocols, we demonstrate that multiple mRNA as well as DNA sequences can be identified from a single-cell sample. In addition, we show that the specificity of procurement of tissue samples is not compromised by smear contamination resulting from scraping of the microtome knife during sectioning of lesions. The procedures described herein thus allow for efficient RT-PCR or PCR analysis of multiple nucleic acid sequences from small tissue samples obtained by laser-assisted microdissection.

  14. Periodically arranged benzene-linker molecules on boron-doped single-crystalline diamond films for DNA

    Czech Academy of Sciences Publication Activity Database

    Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.

    2006-01-01

    Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006

  15. On-chip Detection of Rolling Circle Amplified DNA Molecules from Bacillus Globigii spores and Vibrio Cholerae

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Donolato, Marco

    2014-01-01

    For the first time DNA coils formed by rolling circle amplification are quantified on-chip by Brownian relaxation measurements on magnetic nanobeads using a magnetoresistive sensor. No external magnetic fields are required besides the magnetic field arising from the current through the sensor...

  16. DNA fingerprinting and antimicrobial susceptibility pattern of clinical and environmental Acinetobacter baumannii isolates: a multicentre study.

    Science.gov (United States)

    Salimizand, Himen; Menbari, Shaho; Ramazanzadeh, Rashid; Khonsha, Masomeh; Saleh Vahedi, Mohammad

    2016-08-01

    The aims of this study were to establish antibiotic profile and the molecular epidemiology of Acinetobacter baumannii isolates, with considering the effectiveness of control infection measures across three hospitals in the Kurdistan, west part of Iran. Fifty-four A. baumannii isolates were collected from patients and environmental specimens. Antibiotic susceptibility patterns (Antibio-type) were evaluated for 17 different antibiotics and MIC for imipenem was done. Isolates were assessed for the presence of metallo-beta-lactamases (MBLs), class 1 and 2 integrons, and integrated gene cassettes and blaOXA-likefamilies genes. Repetitive-sequence-based PCR (REP-PCR) was done for analysing clonality and relativeness of isolates (REP-type). Antibiotic susceptibility patterns distinguished 11 distinct Antibio-types and REP-PCR showed three clusters with 20 subclusters, mostly belonged to two clonal subgroups, A1 and B1. blaOXA-51 and blaOXA-23 were detected in 100% (54/54) and 52% (28/54), respectively, while blaOXA-24-like and blaOXA-58 were not present in isolates. MBLs were not detected, but, however, high rate of imipenem resistance was observed (52%). MIC90 of imipenem was 16 mg/ml. Class 1 integrons were detected in 11% (6/54) of isolates followed by 24% (13/54) of class 2. Both classes of integron genes were detected in 15% (8/54) of isolates. Integrated gene cassettes were in low level (11% of class 1 harboring isolates). Two arrays of gene cassettes were revealed, dfrA5-like and dfrA17-aadA5. Infection control surveillance should be considered as a serious manner, even the superficial eradication of hospital acquired pathogens. MBL genes were not induced carbapenem resistance in studied hospital settings, but blaOXA-51 & 23 contributed in imipenem resistant. Integrons had a little share in resistance of A. baumannii isolates.

  17. Small molecule inhibitors uncover synthetic genetic interactions of human flap endonuclease 1 (FEN1 with DNA damage response genes.

    Directory of Open Access Journals (Sweden)

    Thomas A Ward

    Full Text Available Flap endonuclease 1 (FEN1 is a structure selective endonuclease required for proficient DNA replication and the repair of DNA damage. Cellularly active inhibitors of this enzyme have previously been shown to induce a DNA damage response and, ultimately, cell death. High-throughput screens of human cancer cell-lines identify colorectal and gastric cell-lines with microsatellite instability (MSI as enriched for cellular sensitivity to N-hydroxyurea series inhibitors of FEN1, but not the PARP inhibitor olaparib or other inhibitors of the DNA damage response. This sensitivity is due to a synthetic lethal interaction between FEN1 and MRE11A, which is often mutated in MSI cancers through instabilities at a poly(T microsatellite repeat. Disruption of ATM is similarly synthetic lethal with FEN1 inhibition, suggesting that disruption of FEN1 function leads to the accumulation of DNA double-strand breaks. These are likely a result of the accumulation of aberrant replication forks, that accumulate as a consequence of a failure in Okazaki fragment maturation, as inhibition of FEN1 is toxic in cells disrupted for the Fanconi anemia pathway and post-replication repair. Furthermore, RAD51 foci accumulate as a consequence of FEN1 inhibition and the toxicity of FEN1 inhibitors increases in cells disrupted for the homologous recombination pathway, suggesting a role for homologous recombination in the resolution of damage induced by FEN1 inhibition. Finally, FEN1 appears to be required for the repair of damage induced by olaparib and cisplatin within the Fanconi anemia pathway, and may play a role in the repair of damage associated with its own disruption.

  18. Damage to cellular and isolated DNA induced by a metabolite of aspirin

    Energy Technology Data Exchange (ETDEWEB)

    Oikawa, Shinji [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie 514-8507 (Japan)], E-mail: s-oikawa@doc.medic.mie-u.ac.jp; Kobayashi, Hatasu; Tada-Oikawa, Saeko [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie 514-8507 (Japan); JSPS Research Fellow (Japan); Isono, Yoshiaki [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie 514-8507 (Japan); Kawanishi, Shosuke [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie 514-8507 (Japan); Faculty of Pharmaceutical Sciences, Suzuka University of Medical Science, Suzuka, Mie 513-8670 (Japan)

    2009-02-10

    Aspirin has been proposed as a possible chemopreventive agent. On the other hand, a recent cohort study showed that aspirin may increase the risk for pancreatic cancer. To clarify whether aspirin is potentially carcinogenic, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), which is correlated with the incidence of cancer, in cultured cells treated with 2,3-dihydroxybenzoic acid (2,3-DHBA), a metabolite of aspirin. 2,3-DHBA induced 8-oxodG formation in the PANC-1 human pancreatic cancer cell line. 2,3-DHBA-induced DNA single-strand breaks were also revealed by comet assay using PANC-1 cells. Flow cytometric analyses showed that 2,3-DHBA increased the levels of intracellular reactive oxygen species (ROS) in PANC-1 cells. The 8-oxodG formation and ROS generation were also observed in the HL-60 leukemia cell line, but not in the hydrogen peroxide (H{sub 2}O{sub 2})-resistant clone HP100 cells, suggesting the involvement of H{sub 2}O{sub 2}. In addition, an hprt mutation assay supported the mutagenicity of 2,3-DHBA. We investigated the mechanism underlying the 2,3-DHBA-induced DNA damage using {sup 32}P-labeled DNA fragments of human tumor suppressor genes. 2,3-DHBA induced DNA damage in the presence of Cu(II) and NADH. DNA damage induced by 2,3-DHBA was enhanced by the addition of histone peptide-6 [AKRHRK]. Interestingly, 2,3-DHBA and histone peptide-6 caused base damage in the 5'-ACG-3' and 5'-CCG-3' sequences, hotspots of the p53 gene. Bathocuproine, a Cu(I) chelator, and catalase inhibited the DNA damage. Typical hydroxyl radical scavengers did not inhibit the DNA damage. These results suggest that ROS derived from the reaction of H{sub 2}O{sub 2} with Cu(I) participate in the DNA damage. In conclusion, 2,3-DHBA induces oxidative DNA damage and mutations, which may result in carcinogenesis.

  19. Damage to cellular and isolated DNA induced by a metabolite of aspirin

    International Nuclear Information System (INIS)

    Oikawa, Shinji; Kobayashi, Hatasu; Tada-Oikawa, Saeko; Isono, Yoshiaki; Kawanishi, Shosuke

    2009-01-01

    Aspirin has been proposed as a possible chemopreventive agent. On the other hand, a recent cohort study showed that aspirin may increase the risk for pancreatic cancer. To clarify whether aspirin is potentially carcinogenic, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), which is correlated with the incidence of cancer, in cultured cells treated with 2,3-dihydroxybenzoic acid (2,3-DHBA), a metabolite of aspirin. 2,3-DHBA induced 8-oxodG formation in the PANC-1 human pancreatic cancer cell line. 2,3-DHBA-induced DNA single-strand breaks were also revealed by comet assay using PANC-1 cells. Flow cytometric analyses showed that 2,3-DHBA increased the levels of intracellular reactive oxygen species (ROS) in PANC-1 cells. The 8-oxodG formation and ROS generation were also observed in the HL-60 leukemia cell line, but not in the hydrogen peroxide (H 2 O 2 )-resistant clone HP100 cells, suggesting the involvement of H 2 O 2 . In addition, an hprt mutation assay supported the mutagenicity of 2,3-DHBA. We investigated the mechanism underlying the 2,3-DHBA-induced DNA damage using 32 P-labeled DNA fragments of human tumor suppressor genes. 2,3-DHBA induced DNA damage in the presence of Cu(II) and NADH. DNA damage induced by 2,3-DHBA was enhanced by the addition of histone peptide-6 [AKRHRK]. Interestingly, 2,3-DHBA and histone peptide-6 caused base damage in the 5'-ACG-3' and 5'-CCG-3' sequences, hotspots of the p53 gene. Bathocuproine, a Cu(I) chelator, and catalase inhibited the DNA damage. Typical hydroxyl radical scavengers did not inhibit the DNA damage. These results suggest that ROS derived from the reaction of H 2 O 2 with Cu(I) participate in the DNA damage. In conclusion, 2,3-DHBA induces oxidative DNA damage and mutations, which may result in carcinogenesis

  20. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. screening of new isolates of bt and cloning of their dna amplicons

    African Journals Online (AJOL)

    NEMAPPA

    2012-09-18

    Sep 18, 2012 ... Nine new indigenous isolates of Bacillus thuringiensis (Bt) were characterized for their colony type, ... Bt. New gene sequences encoding more active toxins could be ..... Toxicity of a Bacillus thuringiensis israelensis-like strain.

  2. Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

    Science.gov (United States)

    Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

    2015-01-01

    The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601

  3. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    International Nuclear Information System (INIS)

    Chen, J.; Varner, J.E.

    1985-01-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

  4. Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

    Science.gov (United States)

    Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

    1998-04-01

    To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

  5. Detection, characterization and measure of a new radiation-induced damage in isolated and cellular DNA

    International Nuclear Information System (INIS)

    Regulus, P.

    2006-10-01

    Deoxyribonucleic acid (DNA) contains the genetic information and chemical injury to this macromolecule may have severe biological consequences. We report here the detection of 4 new radiation-induced DNA lesions by using a high-performance liquid chromatography coupled to tandem mass spectrometry (HPLC-MS/MS) approach. For that purpose, the characteristic fragmentation of most 2'-deoxy-ribo nucleosides, the loss of 116 Da corresponding to the loss of the 2-deoxyribose moiety, was used in the so-called neutral loss mode of the HPLC-MS/MS. One of the newly detected lesions, named dCyd341 because it is a 2'-deoxycytidine modification exhibiting a molecular weight of 341 Da, was also detected in cellular DNA. Characterization of this modified nucleoside was performed using NMR and exact mass determination of the product obtained by chemical synthesis. A mechanism of formation was then proposed, in which the first event is the H-abstraction at the C4 position of a 2-deoxyribose moiety. Then, the sugar modification produced exhibits a reactive aldehyde that, through reaction with a vicinal cytosine base, gives rise to dCyd341. dCyd341 could be considered as a complex damage since its formation involves a DNA strand break and a cross-link between a damaged sugar residue and a vicinal cytosine base located most probably on the complementary DNA strand. In addition to its characterization, preliminary biological studies revealed that cells are able to remove the lesion from DNA. Repair studies have revealed the ability of cells to excise the lesion. Identification of the repair systems involved could represent an interesting challenge. (author)

  6. Short communication: Conservation of Streptococcus uberis adhesion molecule and the sua gene in strains of Streptococcus uberis isolated from geographically diverse areas.

    Science.gov (United States)

    Yuan, Ying; Dego, Oudessa Kerro; Chen, Xueyan; Abadin, Eurife; Chan, Shangfeng; Jory, Lauren; Kovacevic, Steven; Almeida, Raul A; Oliver, Stephen P

    2014-12-01

    The objective was to identify and sequence the sua gene (GenBank no. DQ232760; http://www.ncbi.nlm.nih.gov/genbank/) and detect Streptococcus uberis adhesion molecule (SUAM) expression by Western blot using serum from naturally S. uberis-infected cows in strains of S. uberis isolated in milk from cows with mastitis from geographically diverse areas of the world. All strains evaluated yielded a 4.4-kb sua-containing PCR fragment that was subsequently sequenced. Deduced SUAM AA sequences from those S. uberis strains evaluated shared >97% identity. The pepSUAM sequence located at the N terminus of SUAM was >99% identical among strains of S. uberis. Streptococcus uberis adhesion molecule expression was detected in all strains of S. uberis tested. These results suggest that sua is ubiquitous among strains of S. uberis isolated from diverse geographic locations and that SUAM is immunogenic. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  8. ISOLATION OF MESOPHYLL PROTOPLASTS FROM MEDITERRANEAN WOODY PLANTS FOR THE STUDY OF DNA INTEGRITY UNDER ABIOTIC STRESS

    Directory of Open Access Journals (Sweden)

    Elena Kuzminsky

    2016-08-01

    Full Text Available Abiotic stresses have considerable negative impact on Mediterranean plant ecosystems and better comprehension of the genetic control of response and adaptation of trees to global changes is urgently needed. The Single Cell Gel Electrophoresis assay could be considered a good estimator of DNA damage in an individual eukaryotic cell. This method has been mainly employed in animal tissues, because the plant cell wall represents an obstacle for the extraction of nuclei; moreover, in Mediterranean woody species, especially in the sclerophyll plants, this procedure can be quite difficult because of the presence of sclerenchyma and hardened cells. On the other hand, these plants represent an interesting material to be studied because of the ability of these plants to tolerate abiotic stress. For instance, holm oak (Quercus ilex L. has been selected as the model plant to identify critical levels of O3 for Southern European forests. Consequently, a quantitative method for the evaluation of cell injury of leaf tissues of this species is required. Optimal conditions for high-yield nuclei isolation were obtained by using protoplast technology and a detailed description of the method is provided and discussed. White poplar (Populus alba L. was used as an internal control for protoplast isolation. Such a method has not been previously reported in newly fully developed leaves of holm oak. This method combined with Single Cell Gel Electrophoresis assay represents a new tool for testing the DNA integrity of leaf tissues in higher plants under stress conditions.

  9. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Concordance of genotype for polymorphisms in DNA isolated from peripheral blood and colorectal cancer tumor samples

    NARCIS (Netherlands)

    van Huis-Tanja, Lieke; Kweekel, Dinemarie; Gelderblom, Hans; Koopman, Miriam; Punt, Kees; Guchelaar, Henk-Jan; van der Straaten, Tahar

    2013-01-01

    Background & aim: Results from different pharmacogenetic association studies in colorectal cancer are often conflicting. Both peripheral blood and formalin-fixed, paraffin-embedded (FFPE) tissue are routinely used as DNA source. This could cause bias due to somatic alterations in tumor tissue, such

  11. DNA-based identification of Armillaria isolates from peach orchards in Mexico state

    Science.gov (United States)

    Ruben Damian Elias Roman; Ned B. Klopfenstein; Dionicio Alvarado Rosales; Mee-Sook Kim; Anna E. Case; Sara M. Ashiglar; John W. Hanna; Amy L. Ross-Davis; Remigio A. Guzman Plazola

    2012-01-01

    A collaborative project between the Programa de Fitopatología, Colegio de Postgraduados, Texcoco, Estado de Mexico and the USDA Forest Service - RMRS, Moscow Forest Pathology Laboratory has begun this year (2011) to assess which species of Armillaria are causing widespread and severe damage to the peach orchards from México state, Mexico. We are employing a DNA-based...

  12. Carboxyl-functionalized magnetic microparticle carrier for isolation and identification of DNA in dairy products

    Czech Academy of Sciences Publication Activity Database

    Horák, Daniel; Rittich, B.; Španová, A.

    2007-01-01

    Roč. 311, č. 1 (2007), s. 249-254 ISSN 0304-8853 R&D Projects: GA ČR GA525/05/0311 Institutional research plan: CEZ:AV0Z40500505 Keywords : magnetic particles * DNA * magnetite Subject RIV: GM - Food Processing Impact factor: 1.704, year: 2007

  13. Preparation of HMW DNA from plant nuclei and chromosomes isolated from root tips

    Czech Academy of Sciences Publication Activity Database

    Šimková, Hana; Čihalíková, Jarmila; Vrána, Jan; Lysák, Martin; Doležel, Jaroslav

    2003-01-01

    Roč. 46, č. 3 (2003), s. 369-373 ISSN 0006-3134 R&D Projects: GA AV ČR IAA6038204 Institutional research plan: CEZ:AV0Z5038910 Keywords : banan * flow cytometry * nuclear DNA content Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  14. Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

    Science.gov (United States)

    Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

    2018-04-18

    Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

  15. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity.

    Science.gov (United States)

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong

    2016-06-01

    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  17. Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices.

    Science.gov (United States)

    Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun

    2018-04-12

    Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Carboxyl-functionalized magnetic microparticle carrier for isolation and identification of DNA in dairy products

    International Nuclear Information System (INIS)

    Horak, Daniel; Rittich, Bohuslav; Spanova, Alena

    2007-01-01

    Magnetite nanoparticles about 14nm in diameter were obtained by chemical coprecipitation of Fe(II) and Fe(III) salts with aqueous ammonia in the presence of poly(ethylene glycol) (PEG). Magnetic poly(glycidyl methacrylate) (PGMA) microspheres about 1μm in diameter were prepared by dispersion polymerization of GMA in aqueous ethanol in the presence of PEG-coated magnetite nanoparticles. The microspheres were hydrolyzed and carboxyl groups introduced by oxidation with KMnO 4 . The particles reversibly bound bacterial DNA of Bifidobacterium and Lactobacillus genera in the presence of high concentrations of PEG 6000 and sodium chloride from crude cell lysates of various dairy products (butter milk, cheese, yoghurt, probiotic tablets) or from cell lyophilisates. The presence of Bifidobacterium and Lactobacillus DNA in samples was confirmed by PCR amplification

  19. Carboxyl-functionalized magnetic microparticle carrier for isolation and identification of DNA in dairy products

    Energy Technology Data Exchange (ETDEWEB)

    Horak, Daniel [Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovskeho Sq. 2, 162 06 Prague 6 (Czech Republic)]. E-mail: horak@imc.cas.cz; Rittich, Bohuslav [Masaryk University Brno, Tvrdeho 14, 602 00 Brno (Czech Republic)]. E-mail: rittich@sci.muni.cz; Spanova, Alena [Masaryk University Brno, Tvrdeho 14, 602 00 Brno (Czech Republic)]. E-mail: spanova@sci.muni.cz

    2007-04-15

    Magnetite nanoparticles about 14nm in diameter were obtained by chemical coprecipitation of Fe(II) and Fe(III) salts with aqueous ammonia in the presence of poly(ethylene glycol) (PEG). Magnetic poly(glycidyl methacrylate) (PGMA) microspheres about 1{mu}m in diameter were prepared by dispersion polymerization of GMA in aqueous ethanol in the presence of PEG-coated magnetite nanoparticles. The microspheres were hydrolyzed and carboxyl groups introduced by oxidation with KMnO{sub 4}. The particles reversibly bound bacterial DNA of Bifidobacterium and Lactobacillus genera in the presence of high concentrations of PEG 6000 and sodium chloride from crude cell lysates of various dairy products (butter milk, cheese, yoghurt, probiotic tablets) or from cell lyophilisates. The presence of Bifidobacterium and Lactobacillus DNA in samples was confirmed by PCR amplification.

  20. Genetic variability within n-rDNA region of ectomycorrhizal isolates ...

    African Journals Online (AJOL)

    In view of this, this study aimed at confirming the earlier identification of these fungi, which was based on morphological characters, and also to find suitable molecular restriction fragment length polymorphism (RFLP) markers for the identification of ECM fungi up to the level of species or isolates as part of an expandable ...

  1. Isolation of anonymous, polymorphic DNA fragments from human chromosome 22q12-qter

    NARCIS (Netherlands)

    J.P. Dumanski (Jan); A.H.M. Geurts van Kessel (Ad); M. Ruttledge (Martin); A. Wladis (Andreas); N. Sugawa (Noriaki); V.P. Collins (Peter); M. Nordenskjöld

    1990-01-01

    textabstractA series of 195 random chromosome 22-specific probes, equivalent to approximately 1% of the size of this chromosome, have been isolated from a chromosome 22-specific bacteriophage lambda genomic library. These probes were mapped to four different regions of chromosome 22 on a panel of

  2. Vingt ans après (Twenty years after). Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    Science.gov (United States)

    Grosberg, Alexander Y.

    2016-09-01

    The effect of DNA topology simplification by type II topoisomerase enzymes was discovered experimentally by Rybenkov et al. [1] 20 years ago - which motivates me to borrow the title for this comment from Alexandre Dumas [2]. Ever since the original discovery, the effect keeps entertaining theorists - but the most surprising fact is that the original experiment was never repeated, let alone improved. I do not understand why it is so. In my opinion, there is an acute need of new experiments, not only repeating the original measurements, but also examining numerous other aspects of the phenomenon. In this sense, the review [3] by Vologodskii, one of the original discoverers, is both timely and important. In his review, Vologodskii concentrates on what I would call mechanical aspect of the problem - how bent are T- and G-segments, what kinds of juxtaposition are relevant, etc. The importance of these issues notwithstanding, I want to complement this approach, and to consider in greater detail the thermodynamics of the process. My main points are as follows: action of topo II enzyme violates detailed balance for DNA, leading to circular currents and dissipation (which is indeed quite a common occurrence in many living systems). These currents are potentially observable, and dissipation measurable, which should challenge experimenters. The main goal of this comment is to show how general phenomenological point of view allows to formulate theoretical prediction for the energy dissipation rate.

  3. Nuclear and mitochondrial DNA reveals isolation of imperilled grey nurse shark populations (Carcharias taurus).

    Science.gov (United States)

    Ahonen, H; Harcourt, R G; Stow, A J

    2009-11-01

    Loss of sharks and other upper-trophic marine predators has sparked worldwide concern for the stability of ocean ecosystems. The grey nurse (ragged-tooth or sand tiger) shark (Carcharias taurus) is Vulnerable on a global scale, Critically Endangered in Australia and presumed extinct in parts of its historical range. We used 193 muscle and fin samples collected from six extant populations to assess global mtDNA and microsatellite diversity and the degree of global population genetic structure. Control region mtDNA diversity was low in every population, and two populations (eastern Australia and Japan) contained only a single mtDNA haplotype. Genetic signatures of recent losses of genetic variation were not yet apparent at microsatellite loci, indicating that this low mtDNA variation is not a result of anthropogenic population declines. Population differentiation was substantial between each population pair except Brazil and South Africa, F(ST) values ranged from 0.050 to 0.699 and 0.100 to 1.00 for microsatellite and mitochondrial data respectively. Bayesian analysis clearly partitioned individuals into five of the populations from which they were sampled. Our data imply a low frequency of immigrant exchange among each of these regions and we suggest that each be recognized as a distinct evolutionary significant unit. In contrast to pelagic species such as whale shark and white shark that may cross ocean basins and where cooperative international efforts are necessary for conservation, grey nurse shark, like many coastal species, need to be managed regionally.

  4. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  5. Isolation and characterization of DNA-dependent ATPases from the Novikoff Hepatoma

    International Nuclear Information System (INIS)

    Thomas, D.C.

    1984-01-01

    Four DNA-dependent ATPases have been purified to apparent homogeneity from extracts of the Novikoff Hepatoma, and named ATPases II, III, IV, and V. The physical and enzymological properties of ATPases II, III, and V are nearly identical, and from tryptic peptide mapping these proteins were determined to be related, though they are still chromatographically distinct; all appear to be dimers. ATPaseIV is unique among the ATPases, and is probably a monomer. ATPase V appears much more stable to thermal inactivation than the similar curves generated by ATPases II, and III. ATPase IV, however, projects of a heat-inactivation curve intermediate to these two types. ATPase II is labelled to a much higher degree than the others when treated with a heterologous protein kinase using gamma-[ 32 P]-ATP. When ATPase II was treated with this kinase, and subsequently run over a DNA-cellulose column, the profile of ATPase II was found to contain small peaks of activity in the positions where ATPases III and V normally elute, suggesting that ATPase II may be a dephosphorylated form of the other two. The ATPases have been extensively characterized with respect to reaction products and requirements, substrate utilization, DNA effector requirements, and effects of ATP analogs

  6. Binding branched and linear DNA structures: From isolated clusters to fully bonded gels

    Science.gov (United States)

    Fernandez-Castanon, J.; Bomboi, F.; Sciortino, F.

    2018-01-01

    The proper design of DNA sequences allows for the formation of well-defined supramolecular units with controlled interactions via a consecution of self-assembling processes. Here, we benefit from the controlled DNA self-assembly to experimentally realize particles with well-defined valence, namely, tetravalent nanostars (A) and bivalent chains (B). We specifically focus on the case in which A particles can only bind to B particles, via appropriately designed sticky-end sequences. Hence AA and BB bonds are not allowed. Such a binary mixture system reproduces with DNA-based particles the physics of poly-functional condensation, with an exquisite control over the bonding process, tuned by the ratio, r, between B and A units and by the temperature, T. We report dynamic light scattering experiments in a window of Ts ranging from 10 °C to 55 °C and an interval of r around the percolation transition to quantify the decay of the density correlation for the different cases. At low T, when all possible bonds are formed, the system behaves as a fully bonded network, as a percolating gel, and as a cluster fluid depending on the selected r.

  7. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  8. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    Directory of Open Access Journals (Sweden)

    Aboubaker M. Garbaj

    2016-11-01

    Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

  9. Mechanistic study of DNA damage and radioprotection of small molecule treatment in the irradiated proliferating and quiescent human lung fibroblast cells

    International Nuclear Information System (INIS)

    Dai, Jiawen; Baskar, Rajamanickam

    2014-01-01

    Ionizing radiation is an invaluable diagnostic and treatment tool used in various clinical applications and also in cancer control. However, assessing normal tissue injury is of a great interest. Since radiation sensitivity varies with different phases of cell cycle, understanding how these cells differ in their sensitivity will help to prevent or reduce the radiation injury. We have used both proliferating and quiescent human normal lung fibroblast cells and investigated key proteins involved in the cell cycle, DNA damage and death, further the radioprotective role of small molecule after low doses (d ≤1Gy) of radiation exposure. Among the cell cycle/death proteins investigated, p53 and phosphorylation of p53 (Ser-15) were induced in both the proliferating and quiescent phases of cells when studied at different time intervals. In the proliferating cells after irradiation along with p53, cyclin dependent kinase (CDK) inhibitors p21, p27 were induced. However, similarly in the quiescent cells along with the p53, p21 and p27 were also induced. The DNA damage assessed by phosphorylation of histone H2AX expression showed an increase even in the non-dividing quiescent cells after 1 Gy of radiation exposure. Whereas cell cycle proteins Cyclin A and E and cell death proteins Bax and cytochrome-c did not show any increase in the quiescent cells. In conclusion, human normal lung fibroblast cells that are not actively dividing are also showed similar radiation response as of proliferating cells. Furthermore, proliferating and quiescent cells treated with small molecules attenuate p53 and its downstream target protein p21 indicating radioprotection of the cells. The specific activation of p53, phosphorylation of p53 (Ser-15), p21 and phosphorylation of histone H2AX following radiation doses of d ≤ 1 Gy in the quiescent cells demonstrated in this study may give us a better understanding about the radiation response of non-dividing fibroblast cells, which is present in many

  10. [DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico].

    Science.gov (United States)

    Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo

    2012-01-01

    To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  11. A multi purpose source chamber at the PLEIADES beamline at SOLEIL for spectroscopic studies of isolated species: cold molecules, clusters, and nanoparticles.

    Science.gov (United States)

    Lindblad, Andreas; Söderström, Johan; Nicolas, Christophe; Robert, Emmanuel; Miron, Catalin

    2013-11-01

    This paper describes the philosophy and design goals regarding the construction of a versatile sample environment: a source capable of producing beams of atoms, molecules, clusters, and nanoparticles in view of studying their interaction with short wavelength (vacuum ultraviolet and x-ray) synchrotron radiation. In the design, specific care has been taken of (a) the use standard components, (b) ensuring modularity, i.e., that swiftly switching between different experimental configurations was possible. To demonstrate the efficiency of the design, proof-of-principle experiments have been conducted by recording x-ray absorption and photoelectron spectra from isolated nanoparticles (SiO2) and free mixed clusters (Ar/Xe). The results from those experiments are showcased and briefly discussed.

  12. Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

    KAUST Repository

    Chauhan, Sushma

    2018-04-22

    Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp–2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas.

  13. [DNA: from Miescher to Venter and beyond].

    Science.gov (United States)

    Gabryelska, Marta M; Szymański, Maciej; Barciszewski, Jan

    2009-01-01

    DNA, one of the most famous molecules is 140-years-old. Its history has engaged three centuries of experiments, leading us to a point, where the Homo sapiens genome sequence is known. The "DNA breakthrough" is dated on 1953, when James Watson and Francis Crick proposed the model of molecular structure of DNA. But the origin of that great achievement goes back to 1869 and early efforts of Friedrich Miescher, the Swiss doctor, who isolated DNA (than termed nuclein) for the first time. Since that time wealth information on "nuclein", its functions, structure and usage has been collected and formed a basis for modern molecular biology, chemical biology and biotechnology. This article describes the events and circumstances of the most important DNA discoveries since its first isolation up to completing the human genome project and deep DNA sequencing techniques application.

  14. Evaluation of genotoxicity and DNA protective effects of mangiferin, a glucosylxanthone isolated from Mangifera indica L. stem bark extract.

    Science.gov (United States)

    Rodeiro, I; Hernandez, S; Morffi, J; Herrera, J A; Gómez-Lechón, M J; Delgado, R; Espinosa-Aguirre, J J

    2012-09-01

    Mangiferin is a glucosylxantone isolated from Mangifera indica L. stem bark. Several studies have shown its pharmacological properties which make it a promising candidate for putative therapeutic use. This study was focused to investigate the in vitro genotoxic effects of mangiferin in the Ames test, SOS Chromotest and Comet assay. The genotoxic effects in bone marrow erythrocytes from NMRI mice orally treated with mangiferin (2000 mg/kg) were also evaluated. Additionally, its potential antimutagenic activity against several mutagens in the Ames test and its effects on CYP1A1 activity were assessed. Mangiferin (50-5000 μg/plate) did not increased the frequency of reverse mutations in the Ames test, nor induced primary DNA damage (5-1000 μg/mL) to Escherichia coli PQ37 cells under the SOS Chromotest. It was observed neither single strand breaks nor alkali-labile sites in blood peripheral lymphocytes or hepatocytes after 1h exposition to 10-500 μg/mL of mangiferin under the Comet assay. Furthermore, micronucleus studies showed mangiferin neither induced cytotoxic activity nor increased the frequency of micronucleated/binucleated cells in mice bone marrow. In short, mangiferin did not induce cytotoxic or genotoxic effects but it protect against DNA damage which would be associated with its antioxidant properties and its capacity to inhibit CYP enzymes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  16. Overexpression of Aldo-Keto-Reductase in Azole-resistant Clinical Isolates of Candida Glabrata Determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Mansour Heidari

    2013-01-01

    Full Text Available Background: Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata.Methods: The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection inimmunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazoleand itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns ofthe organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potentialgene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains.Results and conclusions: The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinicalisolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  17. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices

    Science.gov (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

    2013-01-01

    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  18. Isolation and characterization of the cDNA for cystic fibrosis antigen

    Energy Technology Data Exchange (ETDEWEB)

    Dorin, J R

    1987-01-01

    Cystic fibrosis antigen (CFAg) is a protein which is present in the serum of cystic fibrosis (CF) patients and clinically normal heterozygotes, but not in normal individuals. CFAg has been shown to be a major granulocyte protein in normals, and the gene mapped to chromosome 1. This thesis describes the molecular cloning and subsequent characterization of the cDNA for CFAg. The availability of monoclonal antibodies to CFAg facilitated the identification of myeloid tissues which were actively synthesizing the protein. A specific radiolabeled protein could be immunoprecipitated from /sup 35/S-methionine labelled extracts of chronic myeloid leukemia cells (CML), normal granulocytes and HL-60 cells differentiated towards granulocytes. In CML and granulocytes, CFAg appeared to be one of the most abundantly synthesized proteins.

  19. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  20. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    Science.gov (United States)

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.