WorldWideScience

Sample records for isolated canine coronary

  1. Isolation of canine coronary sinus musculature from the atria by radiofrequency catheter ablation prevents induction of atrial fibrillation.

    Science.gov (United States)

    Morita, Hiroshi; Zipes, Douglas P; Morita, Shiho T; Wu, Jiashin

    2014-12-01

    The junction between the coronary sinus (CS) musculature and both atria contributes to initiation of atrial tachyarrhythmias. The current study investigated the effects of CS isolation from the atria by radiofrequency catheter ablation on the induction and maintenance of atrial fibrillation (AF). Using an optical mapping system, we mapped action potentials at 256 surface sites in 17 isolated and arterially perfused canine atrial tissues containing the entire musculature of the CS, right atrial septum, posterior left atrium, left inferior pulmonary vein, and vein of Marshal. Rapid pacing from each site before and after addition of acetylcholine (0.5 μmol/L) was applied to induce AF. Epicardial radiofrequency catheter ablation at CS-atrial junctions isolated the CS from the atria. Rapid pacing induced sustained AF in all tissues after acetylcholine. Microreentry within the CS drove AF in 88% of preparations. Reentries associated with the vein of Marshall (29%), CS-atrial junctions (53%), right atrium (65%), and pulmonary vein (76%) (frequently with 2-4 simultaneous circuits) were additional drivers of AF. Radiofrequency catheter ablation eliminated AF in 13 tissues before acetylcholine (Patrial tissue. The results suggest that CS can be a substrate of recurrent AF in patients after pulmonary vein isolation and that CS isolation might help prevent recurrent AF. © 2014 American Heart Association, Inc.

  2. Distribution of extracellular potassium and electrophysiologic changes during two-stage coronary ligation in the isolated, perfused canine heart

    NARCIS (Netherlands)

    Coronel, R.; Fiolet, J. W.; Wilms-Schopman, J. G.; Opthof, T.; Schaapherder, A. F.; Janse, M. J.

    1989-01-01

    We studied the relation between [K+]o and the electrophysiologic changes during a "Harris two-stage ligation," which is an occlusion of a coronary artery, preceded by a 30-minute period of 50% reduction of flow through the artery. This two-stage ligation has been reported to be antiarrhythmic. Local

  3. Chlamydia in canine or feline coronary arteriosclerotic lesions.

    Science.gov (United States)

    Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

    2011-09-09

    There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  4. Chlamydia in canine or feline coronary arteriosclerotic lesions

    Directory of Open Access Journals (Sweden)

    Grabarevic Zeljko

    2011-09-01

    Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

  5. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

    1995-12-31

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  6. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Mizak, B.; Plucienniczak, A.

    1995-01-01

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  7. Phenotypic characterization of canine Malassezia spp., isolates

    Directory of Open Access Journals (Sweden)

    Angélica Hurtado-Suárez

    2016-09-01

    Full Text Available Objective. To characterize and identify yeasts of the genus Malassezia by phenotypic features. Materials and methods. First, the macroscopic and microscopic morphological characteristics were described. In addition we performed biochemical and physiological assays as Tweens and Cremophor, including more. Results. Our results evidenced of 105 isolates obtained from dogs diagnosed with external otitis, it was possible to identify two distinct species from 46 isolates within the Malassezia genus: 36.19% (n=38 were identified as M. pachydermatis and 7.62% (n=8 as M. furfur. According to phenotypic patterns the remaining 56.19% (n=59 were reported as Malassezia spp., possibly corresponding to M. furfur and/or M. pachydermatis. Conclusions. Results emphasize the necessity to characterize according to species. It is not feasible to define Malassezia by species based on morphological, biochemical, and physiological findings. Therefore, molecular genotyping should be performed to identify markers allowing a more precise isolate identification. This would broaden our epidemiological knowledge regarding different species involved in canine otitis pathologies.

  8. Distribution of coronary arterial capacitance in a canine model.

    Science.gov (United States)

    Lader, A S; Smith, R S; Phillips, G C; McNamee, J E; Abel, F L

    1998-03-01

    The capacitative properties of the major left coronary arteries, left main (LM), left anterior descending (LAD), and left circumflex (LCX), were studied in 19 open-chest isolated dog hearts. Capacitance was determined by using ramp perfusion and a left ventricular-to-coronary shunt diastolic decay method; both methods gave similar results, indicating a minimal systolic capacitative component. Increased pericardial pressure (PCP), 25 mmHg, was used to experimentally alter transmural wall pressure. The response to increased PCP was different in the LAD vs. LCX; increasing PCP decreased capacitance in the LCX but increased capacitance in the LAD. This may have been due to the different intramural vs. epicardial volume distribution of these vessels and a decrease in intramural tension during increased PCP. Increased PCP decreased LCX capacitance by approximately 13%, but no changes in conductance or zero flow pressure intercept occurred in any of the three vessels, i. e., evidence against the waterfall theory of vascular collapse at these levels of PCP. Coronary arterial capacitance was also linearly related to perfusion pressure.

  9. In vitro activity of difloxacin against canine bacterial isolates

    NARCIS (Netherlands)

    Hoven, van den J.R.; Wagenaar, J.A.; Walker, R.D.

    2000-01-01

    The in vitro activity of difloxacin against canine bacterial isolates from clinical cases was studied in the United States and The Netherlands. Minimal inhibitory concentrations (MIC), the postantibiotic effect, the effect of pH on antimicrobial activity, and the bacterial killing rate tests were

  10. Testosterone biotransformation by the isolated perfused canine pancreas

    International Nuclear Information System (INIS)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

  11. Testosterone biotransformation by the isolated perfused canine pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

    1991-01-01

    There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

  12. Use of corrosion casting techniques to evaluate coronary collateral vessels and anastomoses in hearts of canine cadavers.

    Science.gov (United States)

    Noestelthaller, Arne; Probst, Alexander; Koenig, Horst E

    2005-10-01

    To study and investigate branching patterns of the canine coronary arteries and collateral circulation by use of corrosion casting techniques. 31 hearts obtained from cadavers of clinically normal dogs of various ages and breeds and of either sex. 3-dimensional reproduction of coronary arteries was achieved by postmortem injection and perfusion with casting materials into the aortic sinus via the ascending aorta. Perfused hearts were macerated and carefully irrigated; the air-dried specimens were examined macroscopically and with a magnifying headset. Collateral arteries and inter- and intra-arterial anastomoses were successfully detected in 8 corrosion cast specimens. In total, 9 coronary collateral arteries and 3 interarterial anastomoses were found. Our finding of coronary collateral arteries in canine hearts is in agreement with recent findings in coronary flow study. On the basis of our results, vasodilation treatment to improve collateral vessel remodeling in dogs with myocardial dysfunction may be warranted.

  13. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  14. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  15. Morphological study on coronary ostial and clinicoangiographic analysis of isolated coronary ostial stenosis

    International Nuclear Information System (INIS)

    Kanoh, Tatsuji

    2007-01-01

    A morphological study of coronary ostia was performed in 70 autopsied human hearts, with particular attention being focused on the funnel-shaped structure, aging changes, and relation to atherosclerosis. The following results were obtained: The ostium is particularly well-defined and forms a funnel-shaped structure. The structure is predominantly a double circular shape on the right and comet-shaped on the left. The funnel-shaped structure of coronary ostia is characterized by a longitudinal smooth muscle arrangement in the inner layer and circular one in the outer layer. Including overhang formation, coronary sclerosis of the ostium appears mainly on the upper margin of the funnel-shaped structure of the right ostium and at the upper right margin of the left. In ischemic heart disease, along with changes in coronary arteries themselves, changes in the ostia of these arteries should be paid close attention. Ostial stenosis of the coronary artery in the absence of distal vessel obstructions, isolated ostial stenosis, is a rare form of coronary artery disease. In a previous review of the international literature, the incidence of coronary ostial stenosis varied between 0.13% and 2.7%. Among 7,500 patients undergoing selective coronary cineangiography at Juntendo University Hospital and Juntendo Urayasu Hospital from 1975 to 1990, five women (0.07%) were diagnosed as having ''isolated coronary ostial stenosis'', of which the cause is unknown. Atherosclerosis, particularly early premature atherome, congenital coronary anomaly, fibro-muscular dysplasia, Takayasu's aortitis, humoral factors, spasm, and iatrogenic events have been considered as its causes. In contrast to usual atherosclerotic coronary artery disease, patients with isolated coronary ostial stenosis of unknown etiology were characterized as being middle-aged, premenopausal, slender females having few coronary risk factors, experiencing severe angina pector is with marked ischemic electrocardiogram changes

  16. Chronological analysis of canine parvovirus type 2 isolates in Japan.

    Science.gov (United States)

    Ohshima, Takahisa; Hisaka, Mitsuaki; Kawakami, Kazuo; Kishi, Masahiko; Tohya, Yukinobu; Mochizuki, Masami

    2008-08-01

    Fifty-five canine parvovirus type 2 (CPV) samples, 12 fecal specimens and 43 cell culture isolates, were examined for their genetic characteristics of VP2 gene. They were collected from the diseased dogs at various districts of Japan during 27 years from 1980 to 2006. A fragment of VP2 gene was analyzed by restriction fragment length polymorphism assay and DNA sequencing. The original antigenic type 2 of CPV (CPV-2) was no longer found in the samples since 1984, and two antigenic variants CPV-2a and CPV-2b replaced CPV-2 as predominant types for about 5 years from 1982. A new genetic variant of prototype CPV-2a with non-synonymous substitution at the VP2 amino acid residue 297 from Ser to Ala was first detected in 1987. New CPV-2b with the same amino acid substitution at position 297 as new CPV-2a was also detected from the samples collected in 1997. Since then new CPV-2b has been the predominant CPV over the field of Japan. Several additional amino acid substitutions were detected in the VP2 gene of some recent CPV strains. Neither CPV-2c(a), CPV-2c(b), nor "Glu-426" of the antigenic variants previously found outside the country was detected in any samples tested. Reactivity of new CPV-2a and 2b variants against antibodies produced by the current vaccine products was determined by a cross hemagglutination-inhibition test. The recent field CPV isolates reacted more efficiently to the antibodies produced in dogs vaccinated with the new CPV-2b vaccine strain than the conventional CPV-2 vaccine strain.

  17. Antimicrobial susceptibility profiles of Staphylococcus intermedius isolates from clinical cases of canine pyoderma in South Africa

    Directory of Open Access Journals (Sweden)

    Catherine A. Blunt

    2013-05-01

    Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.

  18. The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney

    Science.gov (United States)

    Larsen, L. E.; Jacobi, J. H.

    1980-06-01

    A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.

  19. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes

    2012-09-01

    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  20. Isolation, culture expansion and characterization of canine bone marrow derived mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    D Kazemi

    2016-07-01

    Full Text Available The purpose of the present study was to isolate, culture expand and characterize canine bone marrow derived mesenchymal stem cells. Bone marrow aspirates of 15 adult male dogs were collected to this end and their mononuclear cells isolated by centrifugation and cultured in standard media. The adherent cells were isolated and their mesenchymal origin was confirmed at 3rd passage by cellular morphology, expression of surface antigens and differentiation to osteogenic and adipogenic lineage. After 4 days, spindle shaped fibroblast like cells which were apparently bone marrow derived mesenchymal stem cells appeared in culture medium and their numbers increased over time. The cells reached 3rd passage with over 75% confluent after a mean of 22.89±5.75 days. Flow cytometric analysis revealed that the cells negatively expressed CD34 and CD45 antigens while positively expressing CD44 and CD105 antigens. Differentiation into osteogenic and adipogenic lineage had taken place after one month culture in induction medium. VDR, COL1A1, BGLAP and SPARC gene expression indicated that mesenchymal stem cells isolated from canine bone marrow had differentiated into osteogenic lineage. These findings can form the basis of any forthcoming clinical studies involving the use of canine mesenchymal stem cells particularly in the field of bone and cartilage regeneration.

  1. Isolation and identification of Helicobacter spp, from canine and feline gastric mucosa

    DEFF Research Database (Denmark)

    Jalava, K.; On, Stephen L.W.; VanDamme, P.A.R.

    1998-01-01

    It is known that virtually all healthy adult dogs and cats harbor spiral helicobacters in their gastric mucosa, Three species, Helicobacter felis, Helicobacter bizzozeronii, and Helicobacter salomonis have been isolated in vitro from the gastric mucosa of these animals. The aims of this study were...... conventional phenotypic tests, whole-cell protein profiling, and ultrastructural analysis in identifying the different species isolated from canine and feline gastric mucose. We cultured 95 and 22 gastric mucosal biopsies from dogs and cats, respectively. Twenty-one H. bizzozeronii strains, 8 H. felis strains......, 8 H. salomonis strains, 3 mixed cultures, 2 "Flexispira rappini"-like organisms, and 3 as get uncharacterized strains were isolated from the dogs, and 3 H. felis strains were isolated from the cats. The methods used here yielded Helicobacter isolation rates of 51% from dogs and 13.6% from cats...

  2. Preliminary development of a live attenuated canine parvovirus vaccine from an isolate of British origin.

    Science.gov (United States)

    Churchill, A E

    1987-04-04

    Canine parvovirus isolated from a case of haemorrhagic enteritis in a breeding kennel in England was passaged and cloned in cultured feline and canine cells. No significant evidence of pathogenicity was found during six serial passages of the modified virus back through young dogs. The attenuated virus was excreted by inoculated animals and spread rapidly to uninoculated animals held in contact. When high titre attenuated virus was given to the six-week-old offspring of a seropositive dam a prompt seroconversion was observed. When the attenuated virus was used as an experimental vaccine in 108 pups in an infected breeding colony a highly significant improvement was obtained in the accumulated morbidity and mortality compared with a parallel group vaccinated with modified live feline panleucopenia virus.

  3. Peroxynitrite-induced relaxation in isolated canine cerebral arteries and mechanisms of action

    International Nuclear Information System (INIS)

    Li Jianfeng; Li Wenyan; Altura, Bella T.; Altura, Burton M.

    2004-01-01

    The present study was undertaken to determine the vascular actions of peroxynitrite (ONOO - ), the product of superoxide and nitric oxide (NO), in isolated canine cerebral arteries and to gain insight into its potential mechanisms of action. In the absence of any vasoactive agent, ONOO - (from 10 -7 to 10 -6 M) was able to reduce the basal tension. In prostaglandin F2α-precontracted canine basilar arterial rings, ONOO - elicited concentration-dependent relaxation at concentrations from 10 -8 to 10 -5 M. The effective concentrations producing approximately 50% maximal relaxation (EC 50 ) to ONOO - were 4.06 x 10 -6 and 4.12 x 10 -6 M in intact and denuded rings, respectively (P > 0.05). No significant differences in relaxation responses were found in ring preparations with or without endothelium (P > 0.05). The presence of either 5 μM methylene blue (MB) or 5 μM 1H-[1,2,4]oxadiazolo-[4,3-α]quinoxalin-1-one (ODQ) significantly inhibited the relaxations induced by ONOO - . Tetraethylammonium chloride (T-2265) significantly decreased the ONOO - -induced relaxations in a concentration-dependent manner. However, ONOO - had no effect on rings precontracted by high KCL (P > 0.05). Addition of low concentrations of calyculin A (50 nM) was able to abolish the ONOO - -induced relaxation. Furthermore, ONOO - significantly inhibited calcium-induced contractions of K + -depolarized canine cerebral rings in a concentration-related manner. Lastly, a variety of pharmacological agents and antagonists including L-NMMA, L-arginine, indomethacin, atropine, naloxone, diphenhydramine, cimetine, glibenclamide, haloperidol, etc., did not influence the relaxant effects of ONOO - on the rings. Our new results suggest that ONOO - -triggered relaxation, on canine cerebral arteries, is mediated by elevation of cyclic guanosine monophosphate (cGMP) levels, membrane hyperpolarization via K+ channel activation, activation of myosin light chain phosphatase activity, and interference with

  4. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells

    Science.gov (United States)

    Russell, Keith A.; Gibson, Thomas W. G.; Chong, Andrew; Co, Carmon; Koch, Thomas G.

    2015-01-01

    Background Mesenchymal stromal cells (MSC) are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS) is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL) has proven to be a suitable alternative to FBS for expansion of human MSC. Hypothesis and Objectives We hypothesized that canine adipose tissue (AT) and bone marrow (BM) MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1) isolation, 2) proliferation, 3) spontaneous differentiation, and 4) directed differentiation. Results 1) Medium with 10% PL was unable to isolate MSC. 2) MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT) or 30% (BM) enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3) Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4) MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis. Conclusions/Significance Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects. PMID:26353112

  5. Canine Platelet Lysate Is Inferior to Fetal Bovine Serum for the Isolation and Propagation of Canine Adipose Tissue- and Bone Marrow-Derived Mesenchymal Stromal Cells.

    Directory of Open Access Journals (Sweden)

    Keith A Russell

    Full Text Available Mesenchymal stromal cells (MSC are increasingly investigated for their clinical utility in dogs. Fetal bovine serum (FBS is a common culture supplement used for canine MSC expansion. However, FBS content is variable, its clinical use carries risk of an immune response, and its cost is increasing due to global demand. Platelet lysate (PL has proven to be a suitable alternative to FBS for expansion of human MSC.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC could be isolated and expanded equally in PL and FBS at conventionally-used concentrations with differentiation of these MSC unaffected by choice of supplement. Our objectives were to evaluate the use of canine PL in comparison with FBS at four stages: 1 isolation, 2 proliferation, 3 spontaneous differentiation, and 4 directed differentiation.1 Medium with 10% PL was unable to isolate MSC. 2 MSC, initially isolated in FBS-supplemented media, followed a dose-dependent response with no significant difference between PL and FBS cultures at up to 20% (AT or 30% (BM enrichment. Beyond these respective peaks, proliferation fell in PL cultures only, while a continued dose-dependent proliferation response was noted in FBS cultures. 3 Further investigation indicated PL expansion culture was inducing spontaneous adipogenesis in concentrations as low as 10% and as early as 4 days in culture. 4 MSC isolated in FBS, but expanded in either FBS or PL, maintained ability to undergo directed adipogenesis and osteogenesis, but not chondrogenesis.Canine PL did not support establishment of MSC colonies from AT and BM, nor expansion of MSC, which appear to undergo spontaneous adipogenesis in response to PL exposure. In vivo studies are warranted to determine if concurrent use of MSC with any platelet-derived products such as platelet-rich plasma are associated with synergistic, neutral or antagonistic effects.

  6. The isolation of canine parvovirus and pathological changes of infected dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-03-01

    Full Text Available The aims of this study are to isolate canine parvovirus (CPV from the field case and to evaluate its histological aspects in CPV infected dogs. Samples were collected from intestine, intestine contained and mucose, as well as dogs feses from diarrhoea and blood diarrhoea. The suspension of those specimen was inoculated into Feline Kidney cells and observed for cythopathic effect (CPE. The presence of CPE indicated that there was viral isolate and continued to further identification using Haemaglutination (HA test with pig red blood cells. Samples with positif in HA test were further identification using Haemaglutination Inhibition (HI test against reference CPV antisera. Isolation result showed that from 81 samples processed, 10 samples indicated CPE in cell cultures, and had agglutinated in pig red blood cells and neutralised reference CPV antisera as the same titer of reference CPV antisera. Nine isolates were obtained from feces and 1 isolate was obtained from Mucose intestine from bloody diarrhoea dogs. Those isolates were also obtained from 1 to 2 days post blood diarrhea clinical signs. Two from 10 cadavers examined showed histological changes to CPV infection. Isolate of CPV, originally from feces, was also obtained from one of the two cadavers. Based on the results it was concluded that more CPV viral isolates can be obtained from bloody diarrhea feces.

  7. Characterization of a new dog isolate of canine distemper virus from China.

    Science.gov (United States)

    Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H

    2011-01-01

    Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.

  8. The influence of hyperthyroidism on vasoconstrictor and vasodilator responses in isolated coronary and renal resistance arteries

    NARCIS (Netherlands)

    Zwaveling, J.; Pfaffendorf, M.; van Zwieten, P. A.

    1997-01-01

    The influence of hyperthyroidism on the functional vascular responsiveness of isolated coronary and renal resistance vessels was investigated. Hyperthyroidism was established by feeding rats for 1 and 4 weeks with 5 mg/kg L-thyroxine (T4)-containing rat chow. Preparations of either coronary or renal

  9. Effect of atrial systole on canine and porcine coronary blood flow.

    Science.gov (United States)

    Bellamy, R F

    1981-09-01

    A feature of phasic coronary flow patterns recorded in conscious chronically instrumented dogs is the atrial cove--a transient depression of arterial flow that occurs during atrial systole. The association between the hemodynamic effects of atrial systole and the atrial cove was studied in anesthetized dogs and pigs with complete heart block. Many atrial coves are available for study in these preparations because atrial activity continues unabated during the diastolic ventricular arrest that follows cessation of electrical pacing. The effect of atrial systole is to translate the pressure-flow relation found during diastole to a higher intercept pressure without change in slope. The increase in the intercept pressure equals the increase in intramyocardial pressure measured with microtransducers embedded in the left ventricular wall. The decrement in flow during the atrial cove is a direct function of the change in intramyocardial pressure and an inverse function of coronary vascular resistance. Each atrial systole is associated with a forward flow transient in the coronary veins, the peak of which occurs at the same instant as does the nadir of atrial flow. These data suggest that the coronary vessels are acting as collapsible tubes and that the waterfall model of the coronary circulation is applicable. The following sequence is proposed to account for the atrial cove. Atrial systole ejects a bolus of blood into the left ventricle increasing both ventricular cavity and intramyocardial pressures. The increase in intramyocardial pressure raises the back pressure opposing coronary flow, reducing the arterial perfusion pressure gradient and causing flow to fall.

  10. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Identification of canine coronary resistance and intramyocardial compliance on the basis of the waterfall model.

    Science.gov (United States)

    Burattini, R; Sipkema, P; van Huis, G A; Westerhof, N

    1985-01-01

    This study was performed to elucidate the effects of cardiac contraction on coronary pressure-flow relations. On the basis of the waterfall mechanism, a lumped model of the coronary arterial system is presented consisting of a proximal (epicardial) compliance, a coronary resistance, and an intramyocardial compliance. A "back"-pressure, assumed to be proportional (constant k) to left ventricular pressure, impedes flow. From steady-state measurements of circumflex coronary artery flow and inflow pressure, together with left ventricular pressure, the values of the three model parameters and the constant k have been estimated. In the control condition proximal compliance is found to be 1.7 X 10(-12) m4s2kg-1, intramyocardial compliance 110 X 10(-12)m4s2kg-1, and resistance 7.5 X 10(9) kgm-4s-1. The proportionality constant k is close to unity. Effects of changes in left ventricular pressure and inflow pressure and the effect of vasoactive drugs on the parameters are also investigated. Changes in coronary resistance are always opposite to changes in intramyocardial compliance. Sensitivity analysis showed that epicardial compliance plays its major role during isovolumic contraction and relaxation; resistance plays a role throughout the cardiac cycle but is more important in diastole than in systole, whereas intramyocardial compliance plays a role in systole and in early diastole.

  12. Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

    Science.gov (United States)

    Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

    2015-02-01

    Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

  13. Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

    Science.gov (United States)

    Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

    2017-01-20

    Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

  14. Effects of ioxaglic acid on cardiac functions during coronary arteriography in canines

    Energy Technology Data Exchange (ETDEWEB)

    Traegaardh, B. (Malmoe Allmaenna Sjukhus, Malmoe, Sweden); Lynch, P.R. (Temple Univ., Philadelphia, PA (USA). School of Medicine)

    1983-01-01

    The new monoacid dimer ioxaglic acid (P286), the non-ionic metrizamide (Amipaque) and diatrizoate (Renografin 76) were compared regarding their effects on left ventricular pressure, the first derivative of left ventricular pressure, aortic pressures and on ECG changes during left and right coronary angiography in dogs. Ioxaglate was found to affect most of these parameters less than diatrizoate probably due to its lower osmolality. Ioxaglate should be regarded suitable for coronary angiography. However, ioxaglate was found to have greater effects on the cardiac function than the equiosmolar metrizamide. This is probably due to the chemotoxicity of the anion or possibly to the sodium content of the ioxaglic acid solution.

  15. Activation patterns of Purkinje fibers during long-duration ventricular fibrillation in an isolated canine heart model.

    Science.gov (United States)

    Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E

    2007-09-04

    The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.

  16. Isolation, culture, characterization, and osteogenic differentiation of canine endometrial mesenchymal stem cell

    Directory of Open Access Journals (Sweden)

    A. K. Sahoo

    2017-12-01

    Full Text Available Aim: In this study, the canine endometrium tissue is characterized for its stem cell properties such as adherence to tissue culture plate (plasticity, short population doubling time, serial clonal passaging, long-term culturing properties, stem cell marker expression, and multilineage differentiation potential. Materials and Methods: The present work describes a novel isolation protocol for obtaining mesenchymal stem cells from the uterine endometrium and is compared with cells derived from umbilical cord matrix as a positive control. These cells are clonogenic, can undergo several population doublings in vitro, and can be differentiated to the osteocytes in mature mesenchymal tissues when grown in osteogenic differentiation media as detected by Alizarin Red-S staining. Results: It is reported for the first time that the cells derived from the canine endometrium (e-multipotent stem cells [MSCs] were able to differentiate into a heterologous cell type: Osteocytes, thus demonstrating the presence of MSCs. Thus, the endometrium may be told as a potential source of MSCs which can be used for various therapeutic purposes. Conclusion: The endometrium can be used as a potential source of MSCs, which can be used for various therapeutic purposes.

  17. Characterisation of canine parvovirus strains isolated from cats with feline panleukopenia.

    Science.gov (United States)

    Decaro, Nicola; Buonavoglia, Domenico; Desario, Costantina; Amorisco, Francesca; Colaianni, Maria Loredana; Parisi, Antonio; Terio, Valentina; Elia, Gabriella; Lucente, Maria Stella; Cavalli, Alessandra; Martella, Vito; Buonavoglia, Canio

    2010-10-01

    Unlike the original canine parvovirus type 2 (CPV-2), CPV-2 variants have gained the ability to replicate in vivo in cats but there is limited information on the disease patterns induced by these variants in the feline host. During 2008, two distinct cases of parvoviral infection were diagnosed in our laboratories. A CPV-2a variant was identified in a 3-month-old Persian kitten displaying clinical sign of feline panleukopenia (FPL) (acute gastroenteritis and marked leukopenia) and oral ulcerations, that died eight days after the onset of the disease. Two pups living in the same pet shop as the cat were found to shed a CPV-2a strain genetically identical to the feline virus and were likely the source of infection. Also, non-fatal infection by a CPV-2c strain occurred in a 2.5-month-old European shorthair kitten displaying non-haemorrhagic diarrhoea and normal white blood cell counts. By sequence analysis of the major capsid protein (VP2) gene, the feline CPV-2c strain showed 100% identity to a recent canine type-2c isolate. Both kittens had been administered multivalent vaccines against common feline pathogens including FPL virus. Whether and to which extent the FPL vaccines can protect cats adequately from the antigenic variants of CPV-2 should be assessed. 2010 Elsevier Ltd. All rights reserved.

  18. Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

    Directory of Open Access Journals (Sweden)

    Yamaguchi Ryoji

    2009-10-01

    Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

  19. Genome Sequence of Canine Parvovirus Strain SC02/2011, Isolated from a Puppy with Severe Diarrhea in South China

    Science.gov (United States)

    Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin

    2012-01-01

    A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228

  20. Compartment analysis of 125I-labelled albumin washout from coronary vessels of isolated perfused hearts

    International Nuclear Information System (INIS)

    Cheng Eap Ng; Seh-Hoon Song

    1978-01-01

    Albumin labelled with 125 I was used as a tracer to investigate the washout kinetics of plasma from the coronary circulation of isolated perfused feline hearts. Compartmentalization with experimental results showed at least two compartments. The model was compared with a three-compartment model found previously for red blood cells. The results indicate that there is a separation of plasma and RBC in the coronary microcirculation. (author)

  1. Electrical neuromodulation for disabling angina pectoris related to isolated stenoses of small epicardial coronary arteries.

    Science.gov (United States)

    Jessurun, G A; Hautvast, R W; DeJongste, M J; Meyler, W J; van Boven AJ; Crijns, H J

    1999-07-01

    Patients with symptomatic small vessel coronary artery disease may be inadequate candidates for revascularization procedures. They may suffer from refractory angina, which does not respond to maximal anti-anginal drug therapy. In addition to patients with end stage coronary artery disease and syndrome X, this newly defined group of subjects with an isolated stenosis of a small coronary artery may benefit from electrical neurostimulation. We describe two patients with intractable angina caused by a significant narrowing of a diagonal branch. This treatment modality should be considered as an alternative method for unsatisfactory revascularization procedures.

  2. Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

    Science.gov (United States)

    Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

    2014-08-01

    Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

  3. Phylogenetic analysis of VP2 gene of canine parvovirus and comparison with Indian and world isolates.

    Science.gov (United States)

    Kaur, G; Chandra, M; Dwivedi, P N

    2016-03-01

    Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.

  4. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain

    OpenAIRE

    Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

    2012-01-01

    Purpose In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. Materials and Methods We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. Result...

  6. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Directory of Open Access Journals (Sweden)

    Zhijun Zhong

    2014-07-01

    Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

  7. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Science.gov (United States)

    Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

    2014-01-01

    Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818

  8. Kinetics of thallium-201 in reperfused canine myocardium after coronary artery occlusion

    International Nuclear Information System (INIS)

    Okada, R.D.

    1984-01-01

    To study the kinetics of thallium-201 in nonsalvaged acutely infarcted myocardium and salvaged myocardium, the tracer was administered after experimental left anterior descending coronary artery reperfusion 2 hours after occlusion. In 19 dogs, thallium activity was then monitored for 4 hours in the reperfused anterior wall and normal posterior wall using miniature cadmium telluride radiation detectors. After sacrifice, 13 of the dogs were found to have an infarcted anterior wall by triphenyltetrazolium-chloride staining. In these dogs, mean (+/- standard deviation) fractional 4 hour thallium clearance was 0.33 +/- 0.08 for the infarct zone and 0.15 +/- 0.06 for the normal control zone (p less than 0.001). When computer-modeled, the clearance curve from the infarct zone was biexponential. The second exponential clearance curve from the infarct zone began 19.1 +/- 3.2 minutes after tracer administration, and was indistinguishable from the monoexponential clearance curve from the normal control zone. Thallium clearance from the blood pool was triexponential, the final exponential clearance curve being indistinguishable from the normal control zone clearance curve. Six dogs were found to have a salvaged noninfarcted anterior wall by triphenyltetrazolium-chloride staining. In these dogs, mean fractional 4 hour thallium clearance was 0.20 +/- 0.07 for the reperfused zone, and 0.19 +/- 0.08 for the normal control zone (p . NS). When computer-modeled, clearance curves for the reperfused and control zones were monoexponential. The monoexponential clearance curve for the salvaged reperfused zone was indistinguishable from the monoexponential clearance curve for normal myocardium

  9. Short communication: isolation and phylogenetic analysis of an avian-origin H3N2 canine influenza virus in dog shelter, China.

    Science.gov (United States)

    Su, Shuo; Yuan, Ziguo; Chen, Jidang; Xie, Jiexiong; Li, Huatao; Huang, Zhen; Zhang, Minze; Du, Guohao; Chen, Zhongming; Tu, Liqing; Zou, Yufei; Miao, Junhao; Wang, Hui; Jia, Kun; Li, Shoujun

    2013-06-01

    A H3N2 canine influenza virus, A/canine/Guangdong/3/2011 (H3N2), was isolated from roaming dogs in rural China. Sequence and phylogenetic analysis of eight gene segments revealed that the A/canine/Guangdong/3/2011 (H3N2) was most similar to a recent H3N2 canine influenza virus isolated in cats from South Korea, which originated from an avian strain. To our knowledge, this is the first report of an avian-origin H3N2 CIV which was isolated from roaming dogs in China. The epidemiologic information provided herein suggests that continued study is required to determine if this virus could be established in the roaming dog population in rural China and pose potential threats to public health.

  10. Age-dependent trends in postoperative mortality and preoperative comorbidity in isolated coronary artery bypass surgery

    DEFF Research Database (Denmark)

    Thorsteinsson, Kristinn; Fonager, Kirsten; Mérie, Charlotte

    2016-01-01

    OBJECTIVES: An increasing number of octogenarians are being subjected to coronary artery bypass grafting (CABG). The purpose of this study was to examine age-dependent trends in postoperative mortality and preoperative comorbidity over time following CABG. METHODS: All patients who underwent isol...

  11. Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.

    Science.gov (United States)

    Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing

    2018-02-01

    A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.

  12. Optical measurement of isolated canine lung filtration coefficients at normal hematocrits.

    Science.gov (United States)

    Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

    1997-12-01

    In this study, lung filtration coefficient (Kfc) values were measured in eight isolated canine lung preparations at normal hematocrit values using three methods: gravimetric, blood-corrected gravimetric, and optical. The lungs were kept in zone 3 conditions and subjected to an average venous pressure increase of 10.24 +/- 0.27 (SE) cmH2O. The resulting Kfc (ml . min-1 . cmH2O-1 . 100 g dry lung wt-1) measured with the gravimetric technique was 0.420 +/- 0.017, which was statistically different from the Kfc measured by the blood-corrected gravimetric method (0.273 +/- 0.018) or the product of the reflection coefficient (sigmaf) and Kfc measured optically (0. 272 +/- 0.018). The optical method involved the use of a Cellco filter cartridge to separate red blood cells from plasma, which allowed measurement of the concentration of the tracer in plasma at normal hematocrits (34 +/- 1.5). The permeability-surface area product was measured using radioactive multiple indicator-dilution methods before, during, and after venous pressure elevations. Results showed that the surface area of the lung did not change significantly during the measurement of Kfc. These studies suggest that sigmafKfc can be measured optically at normal hematocrits, that this measurement is not influenced by blood volume changes that occur during the measurement, and that the optical sigmafKfc agrees with the Kfc obtained via the blood-corrected gravimetric method.

  13. Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain.

    Science.gov (United States)

    Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

    2012-07-01

    In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. The attenuated isolate conferred complete protection against lethal homologous CPV infection in dogs such that they did not develop any clinical symptoms, and their antibody titers against CPV were significantly high at 7-11 days post infection. These results suggest that the virus isolate obtained after passaging can be developed as a novel vaccine against paroviral infection.

  14. Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures.

    Science.gov (United States)

    Mochizuki, Masami; Ohshima, Takahisa; Une, Yumi; Yachi, Akiko

    2008-12-01

    Canine parvovirus type 2 (CPV) is a pathogen that causes severe hemorrhagic gastroenteritis with a high fatality rate in pups worldwide. Since CPV emerged in the late 1970s, its origin has been explored with the conclusion that CPV originated from feline panleukopenia virus or a closely related virus. Both high mutation rate and recombination are assumed to be key factors in the evolution of parvoviruses. Here we provide evidence for natural recombination in CPV isolated from dogs in cell culture. Antigenic and genetic properties of isolates from 10 diseased pups were elucidated. Six pups had been vaccinated beforehand with live combined vaccine containing original antigenic type CPV (CPV-2). Six isolates recovered from 4 vaccinated pups in cell cultures were found to contain either CPV-2 or CPV-2-like viruses. The other isolates, including all those from non-vaccinated pups, were CPV-2b viruses. Antigenic typing of two CPV-2-like isolates, 03-029/M and 1887/f, with a monoclonal antibody panel suggested they were a mixture of CPV-2 and CPV-2a (03-029/M) and a recombinant of CPV-2 and CPV-2b (1887/f). Genetic analysis of the VP1 gene indicated that isolate 03-029/M was a mixture of CPV-2, CPV-2a and a recombinant of CPV-2 and CPV-2a viruses, while isolate 1887/f was composed of a recombinant of CPV-2 and CPV-2b viruses. This is the first demonstration of natural CPV recombination in the field and suggests that recombination in the evolution of CPV is a more frequent and important process than previously believed.

  15. The experimental study of 32P and diallyl trisulfide coating stent for inhibiting neointimal hyperplasia in a canine model of coronary restenosis

    International Nuclear Information System (INIS)

    Xu Shanghua; Jiang Hong; Li Gengshan; Jiang Xuejun; Li Xiaoyan; Chen Yuanxiu; Wang Hairong; Wu Kegui; Nie Xiaomin

    2004-01-01

    Objective: To assesses the efficiency of 32 P and diallyl trisulfide (DT)-coated coronary stents on neointimal proliferation in a canine model of restenosis. Methods: 32 P (740 kBq/stent), DT (210 μg/stent) alone and jointly coated stents were deployed with mild oversizing in both the left circumflex coronary artery (LCX) and the left anterior descending coronary artery (LAD) of 10 dogs. The implantation of protein-coated stents was used as the control. The therapeutic effect was assessed 6 months after the intervention. The dogs were sacrificed and the vessels were excised. For morphologic examinations the tissue sections were stained with HE and Van Gieson. Results: Compared with the control stents, the neointimal area reduced in stents coated with 32 P, DT alone and 32 P+DT [ 32 P: (2.63±0.48) mm 2 , DT: (2.50±0.49) mm 2 , 32 P+DT: (1.42±0.41) mm 2 vs control group: (4.87±0. 80) mm 2 , P=0.001]. 32 P+DT was more effective than either of them alone for reducing the neointimal area (P≤0.005). Both jointly and alone coated stents of 32 P, DT decreased the percent area stenosis [ 32 P: (32.48±4.79)%, DT: (30.04±5.43)%, 32 P+DT: (17.21±4.05)% vs control group: (54.62±6.82)%, P 32 P+DT group compared with 32 P or DT-coated stents group (P≤0.001). Angiographic restenosis (diameter stenosis) was lighter in stents coated with 32 P, DT and 32 P+DT compared with control stents (P 32 P+DT was more effective than 32 P or DT alone for reducing diameter stenosis (P≤0.005). No evidence of 'edge effect' was seen in adjacent, nonstented coronary segments. Conclusion: Coronary stents coated with 32 P plus DT produced a significantly reduced neointimal hyperplasia and restenosis rate in the canine LCX and LAD 6 months after stents implantation

  16. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

    Directory of Open Access Journals (Sweden)

    Gurpreet Kaur

    2015-01-01

    Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  17. Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S

    2015-01-01

    The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

  18. Optical measurement of isolated canine lung filtration coefficients after alloxan infusion.

    Science.gov (United States)

    Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

    1998-04-01

    In this study, lung filtration coefficient (Kfc) was measured in eight isolated canine lung preparations by using three methods: standard gravimetric (Std), blood-corrected gravimetric (BC), and optical. The lungs were held in zone III conditions and were subjected to an average venous pressure increase of 8.79 +/- 0.93 (mean +/- SD) cmH2O. The permeability of the lungs was increased with an infusion of alloxan (75 mg/kg). The resulting Kfc values (in milliliters . min-1 . cmH2O-1 . 100 g dry lung weight-1) measured by using Std and BC gravimetric techniques before vs. after alloxan infusion were statistically different: Std, 0.527 +/- 0.290 vs. 1. 966 +/- 0.283; BC, 0.313 +/- 0.290 vs. 1.384 +/- 0.290. However, the optical technique did not show any statistical difference between pre- and postinjury with alloxan, 0.280 +/- 0.305 vs. 0.483 +/- 0. 297, respectively. The alloxan injury, quantified by using multiple-indicator techniques, showed an increase in permeability and a corresponding decrease in reflection coefficient for albumin (sigmaf). Because the optical method measures the product of Kfc and sigmaf, this study shows that albumin should not be used as an intravascular optical filtration marker when permeability is elevated. However, the optical technique, along with another means of measuring Kfc (such as BC), can be used to calculate the sigmaf of a tracer (in this study, sigmaf of 0.894 at baseline and 0.348 after injury). Another important finding of this study was that the ratio of baseline-to-injury Kfc values was not statistically different for Std and BC techniques, indicating that the percent contribution of slow blood-volume increases does not change because of injury.

  19. Isolated single coronary artery (RII-B type presenting as an inferior wall myocardial infarction: A rare clinical entity

    Directory of Open Access Journals (Sweden)

    Ankur C. Thummar

    2014-09-01

    Full Text Available Isolated single coronary artery without other congenital cardiac anomalies is very rare among the different variations of anomalous coronary patterns. The prognosis in patients with single coronary varies according to the anatomic distribution and associated coronary atherosclerosis. If the left main coronary artery travels between the aorta and pulmonary arteries, it may be a cause of sudden cardiac death. We present multimodality images of a single coronary artery, in which the whole coronary system originated by a single trunk from the right sinus of Valsalva with inter-arterial course of left main coronary artery. This rare type of single coronary artery was classified as RII-B type according to Lipton's scheme of classification. A significant flow-limiting lesions were found in the right coronary artery that was successfully treated with percutaneous coronary intervention.

  20. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  1. Canine Distemper in an isolated population of fishers (Martes pennanti) from California

    Science.gov (United States)

    Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson

    2012-01-01

    Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

  2. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

    Directory of Open Access Journals (Sweden)

    Tan Bin

    2011-11-01

    Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  3. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

    Science.gov (United States)

    Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

    2011-11-16

    A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  4. Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

    Science.gov (United States)

    Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

    2015-10-01

    Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

  5. Efficacy of an inactivated feline panleucopenia virus vaccine against a canine parvovirus isolated from a domestic cat.

    Science.gov (United States)

    Gamoh, K; Senda, M; Inoue, Y; Itoh, O

    2005-09-03

    Canine parvovirus type 2a (CPV-2a) and type 2b (CPV-2b) have recently been isolated from cats throughout the world, and CPV-2b strain FP84 has been reported to be virulent in domestic cats. Although live feline panleucopenia virus (FPLV) vaccines protect domestic cats from CPV infection, the efficacy of inactivated FPLV vaccines has not been established. In this study, two domestic cats were vaccinated with a commercial inactivated FPLV vaccine and challenged with CPV-2b strain FP84 isolated from a domestic cat. The cats were protected against CPV-2b strain FP84 infection and their clinical signs were suppressed, although the two unvaccinated cats showed the typical clinical signs of parvovirus infection.

  6. Presence of infectious RD-114 virus in a proportion of canine parvovirus isolates.

    Science.gov (United States)

    Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

    2012-03-01

    We recently found that certain canine live attenuated vaccines produced using `non-feline' cell lines were contaminated with an infectious feline endogenous retrovirus, termed RD-114 virus. We suspected that RD-114 virus may have contaminated the seed stock of canine parvovirus (CPV) during the production of the contaminated vaccines. In this study, we collected stock viruses of CPVs propagated in a feline cell line, and checked the presence of infectious RD-114 virus. Consequently, we found that RD-114 viral RNA was present in all stock viruses, and 7 out of 18 stock viruses were contaminated with infectious RD-114 virus. We also found that RD-114 virus was stable physically and is capable of retaining its infectivity for a long period at -80°C.

  7. Isolated Unilateral Absent Branch Pulmonary Artery with Peripheral Pulmonary Stenosis and Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    Sunil Abhishek B

    2017-09-01

    Full Text Available Isolated Unilateral Absent Pulmonary Artery (UAPA is a rare congenital anomaly. It is usually associated with congenital heart defects. A 45 year old male patient presented with complaints of fever with cough and expectoration for 15 days and retrosternal chest discomfort for the previous 2 days. ECG showed diffuse ST segment depression with T wave inversion in the inferior and lateral leads. Coronary Angiogram done through the right femoral approach revealed diffusely diseased Left Anterior Descending (LAD artery that was totally cut off at the mid segment. The Left Circumflex (LCx artery was providing blood supply to the right middle and lower lung areas. There was another collateral arising from the Left Subclavian Artery supplying the right middle and lower lung areas. The left pulmonary artery was normal, but branches supplying the middle and lower lobes of the right lung were absent and the upper lobe branch had pulmonary stenosis. UAPA is a rare clinical entity; collaterals from coronaries are extremely rare in this condition and till now there has not been any case report of unilateral absent branch pulmonary artery with peripheral stenosis of other branches, on the affected side and associated coronary artery disease.

  8. Longevity and admission to nursing home according to age after isolated coronary artery bypass surgery

    DEFF Research Database (Denmark)

    Thorsteinsson, Kristinn; Andreasen, Jan; Mortensen, Rikke N

    2016-01-01

    OBJECTIVES: Data on nursing home admission in patient's ≥80 years after isolated coronary artery bypass grafting (CABG) are scarce. The purpose of this study was to evaluate longevity and subsequent admission to a nursing home stratified by age in a nationwide CABG cohort. METHODS: All patients who...... underwent isolated CABG from 1996 to 2012 in Denmark were identified through nationwide registers. The cumulative incidence of admission to a nursing home after CABG was estimated. A Cox regression model was constructed to identify predictors for living in a nursing home 1 year after CABG. Kaplan.......1% of patients ≥80 years had received home care. The proportion of patients admitted to a nursing home at 1, 5 and 10 years after CABG was 0.1, 0.4 and 1.0% (nursing home 1 year postoperatively were: age ≥80 years...

  9. The Effects Of L-Arginine And L-Name On Coronary Flow And Oxidative Stress In Isolated Rat Hearts

    Directory of Open Access Journals (Sweden)

    Sobot Tanja

    2015-12-01

    Full Text Available The aim of this experimental study was to assess the effects of the acute administration of L-arginine alone and in combination with L-NAME (a non-selective NO synthase inhibitor on the coronary flow and oxidative stress markers in isolated rat hearts. The experimental study was performed on hearts isolated from Wistar albino rats (n=12, male, 8 weeks old, body mass of 180-200 g. Retrograde perfusion of the isolated preparations was performed using a modified method according to the Langendorff technique with a gradual increase in the perfusion pressure (40–120 cmH2O. The following values were measured in the collected coronary effluents: coronary flow, released nitrites (NO production marker, superoxide anion radical and the index of lipid peroxidation (measured as thiobarbiturate reactive substances. The experimental protocol was performed under controlled conditions, followed by the administration of L-arginine alone (1 mmol and L-arginine (1 mmol + L-NAME (30 μmol. The results indicated that L-arginine did not significantly increase the coronary flow or the release of NO, TBARS and the superoxide anion radical. These effects were partially blocked by the joint administration of L-arginine + L-NAME, which indicated their competitive effect. Hence, the results of our study do not demonstrate significant effects of L-arginine administration on the coronary flow and oxidative stress markers in isolated rat hearts.

  10. Evaluating coronary reperfusion during acute myocardial infarction in a canine model by gadolinium-DTPA-enhanced magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Tanabe, Kazuaki; Ishibashi, Yutaka; Shimada, Toshio (Shimane Medical Univ., Izumo (Japan)) (and others)

    1993-05-01

    In previous studies, magnetic resonance imaging (MRI) using contrast agents was found to be useful in distinguishing reperfused infarcts from nonreperfused infarcts. However, there have been only a few detailed studies using consecutive MR images for the assessment of myocardial reperfusion during an acute infarction and also no studies have been performed using a percutaneous transluminal coronary occlusion model (closed chest model). We induced acute myocardial infarction in dogs by occluding and then reperfusing the coronary artery with a balloon catheter. ECG-gated MR images were taken using the spin-echo technique before and after Gd-DTPA injection during both coronary artery occlusion and after reperfusion. We defined the intensity ratio (IR) as the signal intensity at the ischemic area divided by that at the nonischemic area on MR images and compared each image by the IR. Without Gd-DTPA, there was no difference between infarcted and normally perfused myocardium. Infarcted myocardium had a low signal intensity (IR=0.68[+-]0.14) soon after Gd-DTPA injection. This difference diminished with time. After reperfusion the infarcted myocardium had a high signal intensity (IR: 1.76[+-]0.34). We conclude that Gd-DTPA-enhanced MRI can distinguish reperfused from nonreperfused infarcts soon after Gd-DTPA administration. (author).

  11. Evaluating coronary reperfusion during acute myocardial infarction in a canine model by gadolinium-DTPA-enhanced magnetic resonance imaging

    International Nuclear Information System (INIS)

    Tanabe, Kazuaki; Ishibashi, Yutaka; Shimada, Toshio

    1993-01-01

    In previous studies, magnetic resonance imaging (MRI) using contrast agents was found to be useful in distinguishing reperfused infarcts from nonreperfused infarcts. However, there have been only a few detailed studies using consecutive MR images for the assessment of myocardial reperfusion during an acute infarction and also no studies have been performed using a percutaneous transluminal coronary occlusion model (closed chest model). We induced acute myocardial infarction in dogs by occluding and then reperfusing the coronary artery with a balloon catheter. ECG-gated MR images were taken using the spin-echo technique before and after Gd-DTPA injection during both coronary artery occlusion and after reperfusion. We defined the intensity ratio (IR) as the signal intensity at the ischemic area divided by that at the nonischemic area on MR images and compared each image by the IR. Without Gd-DTPA, there was no difference between infarcted and normally perfused myocardium. Infarcted myocardium had a low signal intensity (IR=0.68±0.14) soon after Gd-DTPA injection. This difference diminished with time. After reperfusion the infarcted myocardium had a high signal intensity (IR: 1.76±0.34). We conclude that Gd-DTPA-enhanced MRI can distinguish reperfused from nonreperfused infarcts soon after Gd-DTPA administration. (author)

  12. DQ High genotypic diversity among methicillin-resistant Staphylococcus pseudintermedius isolated from canine infections in Denmark

    DEFF Research Database (Denmark)

    Damborg, Peter; Moodley, Arshnee; Aalbaek, Bent

    2016-01-01

    genotypic diversity and antimicrobial resistance of clinical MRSP isolates obtained from dogs, including dogs sampled on multiple occasions, in Denmark over a six-year period. For that purpose a total of 46 clinical MRSP isolates obtained from 36 dogs between 2009 and 2014 were subjected to antimicrobial...... susceptibility testing, multilocus-sequence typing (MLST) and SCCmec typing. Results: Twenty-three sequence types were identified with ST71, mostly associated with SCCmec II-III, as the most common occurring in 13 dogs. Among the remaining 33 isolates, 19 belonged to clonal complex (CC) 258 comprising ST258...... resistant and almost all CC258 isolates being susceptible. Sixteen of the 19 CC258 isolates had oxacillin MICs of 0.5 g/L, whereas MICs for CC71 isolates were consistently above 4 g/L. Four of five dogs representing multiple isolates had distinct STs on different sampling events. Conclusions: The overall...

  13. Risk factors for prolonged hospital stay after isolated coronary artery bypass grafting

    Directory of Open Access Journals (Sweden)

    Elayne Kelen de Oliveira

    2013-09-01

    Full Text Available INTRODUCTION: Characteristics of the patient and the coronary artery bypass grafting may predispose individuals to prolonged hospitalization, increasing costs and morbidity and mortality. OBJECTIVE: The objective of this study was to evaluate individual and perioperative risk factors of prolonged hospitalization in intensive care units and wards. METHODS: We conducted a case-control study of 104 patients undergoing isolated coronary artery bypass grafting with cardiopulmonary bypass. Patients hospitalized >3 days in the intensive care unit or >7 days in the ward were considered for the study. The association between variables was estimated by the chi-square test, odds ratio and logistic regression; P 3 days in the intensive care unit occurred for 22.1% of patients and >7 days in the ward for 27.9%. Among preoperative factors, diabetes (OR=3.17 and smoking (OR=4.07 were predictors of prolonged intensive care unit stay. Combining the pre-, intra-and postoperative variables, only mechanical ventilation for more than 24 hours (OR=6.10 was predictive of intensive care unit outcome. For the ward outcome, the preoperative predictor was left ventricular ejection fraction 24 hours for the intensive care unit and presence of infection for the ward.

  14. Aprotinin vs. tranexamic acid in isolated coronary artery bypass surgery: A multicentre observational study.

    Science.gov (United States)

    Deloge, Elsa; Amour, Julien; Provenchère, Sophie; Rozec, Bertrand; Scherrer, Bruno; Ouattara, Alexandre

    2017-05-01

    Aprotinin appears to be more efficacious than lysine analogues to reduce bleeding and transfusion of blood products in high-transfusion-risk cardiac surgical patients. However, in isolated coronary artery bypass graft (CABG) surgery, the results from head-to-head trials remain less conclusive. Our objective was to compare the efficacies and safety of aprotinin and tranexamic acid (TXA) in patients undergoing isolated on-pump CABG. A multicentre before-and-after study pooling individual data from published trials and unpublished data from three other databases. Four tertiary care teaching hospitals (Haut-Lévêque Hospital in Bordeaux, Pitié-Salpêtrière Hospital and Bichat-Claude Bernard Hospital in Paris, and Laennec Hospital in Nantes). We included data of 2496 isolated on-pump CABG surgery patients who received either aprotinin between November 2003 and May 2008 (n = 1267) or TXA between November 2007 and November 2013 (n = 1229). The primary outcome was total blood loss within 24 h after operation. Secondary outcomes were transfusion of blood products, reoperation for bleeding, renal replacement therapy, ICU length of stay and in-hospital mortality. Adjusted mean (SEM) 24-h blood loss after surgery [483 (11) vs. 634 (11) ml, P < 0.0001] and the proportion of patients requiring intraoperative blood product transfusion (32.7 vs. 46.5%, P = 0.01) were lower in aprotinin-treated patients. No difference was observed with regard to reoperations for bleeding, renal replacement therapy and in-hospital mortality. However, patients receiving aprotinin had a significantly shorter adjusted ICU length of stay. In patients undergoing isolated CABG, aprotinin was more effective than TXA in reducing postoperative blood loss, and no safety concerns were identified. The benefits of aprotinin should be considered when evaluating the risk of major blood loss and transfusion in patients scheduled for isolated CABG surgery.

  15. Identification and antimicrobial susceptibility patterns of Staphylococcus spp. isolated from canine chronic otitis externa

    Directory of Open Access Journals (Sweden)

    Silva N.

    2001-01-01

    Full Text Available Swab samples obtained from 96 dogs with chronic otitis externa were cultured for the isolation of Staphylococcus species. Of 57 staphylococcal strains, 41 (72% were coagulase-negative (CNS. The identification of staphylococci strains was made by standard procedures for the routine identification of staphylococci in clinical practice. S. sciuri was the most frequent species isolated (22.8% from chronic otitis externa in dogs followed by S. intermedius (12.3%, S. auricularis (10.5% and S. aureus (8.8%. Three (5.2% CNS strains could not be identified. Bacterial isolates were susceptible to enrofloxacin, gentamicin, cephalothin, chloramphenicol and neomycin. Resistance was most common to penicillin G, oxacillin and ampicillin.

  16. Isolated persistent left-sided superior vena cava, giant coronary sinus, atrial tachycardia and heart failure in a child

    Directory of Open Access Journals (Sweden)

    Nagaraja Moorthy

    2013-09-01

    Full Text Available Persistence of a left-sided superior vena cava (PLSVC with absent right superior vena cava (isolated PLSVC is a very rare venous malformation and commonly associated with congenital heart disease or alterations of the cardiac situs. We describe an unusual case of a young boy presenting with persistent atrial tachycardia and congestive heart failure. He was detected to have unexplained grossly dilated right atrium, right ventricle with systolic dysfunction and a giant coronary sinus (CS. The dilated CS closely mimicked a pseudo cor-triatriatum on echocardiography. Contrast echocardiography from both arms revealed opacification of the CS before the right atrium. Bilateral upper limb venography confirmed the presence of absent right SVC and isolated persistent left SVC draining into the giant coronary sinus.

  17. Extremely Small Pseudoparamagnetic Iron Oxide Nanoparticle as a Novel Blood Pool T1 Magnetic Resonance Contrast Agent for 3 T Whole-Heart Coronary Angiography in Canines: Comparison With Gadoterate Meglumine.

    Science.gov (United States)

    Park, Eun-Ah; Lee, Whal; So, Young Ho; Lee, Yun-Sang; Jeon, Bong-Sik; Choi, Kyu Sung; Kim, Eung-Gyu; Myeong, Wan-Jae

    2017-02-01

    The aim of this study was to evaluate an extremely small pseudoparamagnetic iron oxide nanoparticle (ESPIO), KEG3, as a potential blood pool agent in 3 T coronary magnetic resonance angiography (MRA) in canine models and compare its efficacy to that of a gadolinium-based contrast agent. Nine mongrel dogs were subjected to whole-heart coronary MRA in 2 separate sessions at 7-day intervals with a 3 T scanner using the FLASH sequence with either gadoterate meglumine (Gd-DOTA) or the ESPIO (KEG3). Coronary MRA was performed twice at each MR examination: the first scan during the administration of the contrast agent and the subsequent second scan at 15 minutes after contrast injection. Objective measurements of the Gd-DOTA and ESPIO images, including the signal-to-noise ratios (SNRs) for the coronary arteries and cardiac veins, contrast-to-noise ratios (CNRs) between the vessels and fat (CNRfat) and the vessels and the myocardium (CNRmyocardium), and subjective image quality scores on a 4-point scale were evaluated and compared. The mean SNRs and CNRs of all vascular regions in the ESPIO images were similar to those of the corresponding regions in the Gd-DOTA images in the first scan (98.1 ± 32.5 vs 79.1 ± 38.4 for SNR of coronary arteries, P = 0.3; 74.2 ± 30.1 vs 61.4 ± 38.5 for CNR, P = 0.7) and more than 2 times higher than the latter in the second scan (95.2 ± 31.3 vs 32.1 ± 8.1 for SNR of coronary arteries, P = 0.008; 76.1 ± 35.8 vs 17.6 ± 19.2 for CNR, P 0.008). Similarly, the mean values of the subjective measurements of the ESPIO images were similar to those of the Gd-DOTA images (3.9 ± 0.3 vs 3.3 ± 0.8 for coronary arteries, P = 0.1) in the first scan and significantly better than the latter in the second scan (3.9 ± 0.2 vs 2.1 ± 0.6 for coronary arteries, P = 0.007). The experimental blood pool agent KEG3 offers equivalent image quality for whole-heart coronary MRA at 3 T upon contrast administration and persistent better quality in the subsequent

  18. Myocardial perfusion magnetic resonance imaging using sliding-window conjugate-gradient HYPR methods in canine with stenotic coronary arteries.

    Science.gov (United States)

    Ge, Lan; Kino, Aya; Lee, Daniel; Dharmakumar, Rohan; Carr, James C; Li, Debiao

    2010-01-01

    First-pass perfusion magnetic resonance imaging (MRI) is a promising technique for detecting ischemic heart disease. However, the diagnostic value of the method is limited by the low spatial coverage, resolution, signal-to-noise ratio (SNR), and cardiac motion-related image artifacts. A combination of sliding window and conjugate-gradient HighlY constrained back-PRojection reconstruction (SW-CG-HYPR) method has been proposed in healthy volunteer studies to reduce the acquisition window for each slice while maintaining the temporal resolution of 1 frame per heartbeat in myocardial perfusion MRI. This method allows for improved spatial coverage, resolution, and SNR. In this study, we use a controlled animal model to test whether the myocardial territory supplied by a stenotic coronary artery can be detected accurately by SW-CG-HYPR perfusion method under pharmacological stress. Results from 6 mongrel dogs (15-25 kg) studies demonstrate the feasibility of SW-CG-HYPR to detect regional perfusion defects. Using this method, the acquisition time per cardiac cycle was reduced by a factor of 4, and the spatial coverage was increased from 2 to 3 slices to 6 slices as compared with the conventional techniques including both turbo-Fast Low Angle Short (FLASH) and echoplanar imaging (EPI). The SNR of the healthy myocardium at peak enhancement with SW-CG-HYPR (12.68 ± 2.46) is significantly higher (P < 0.01) than the turbo-FLASH (8.65 ± 1.93) and EPI (5.48 ± 1.24). The spatial resolution of SW-CG-HYPR images is 1.2 × 1.2 × 8.0 mm, which is better than the turbo-FLASH (1.8 × 1.8 × 8.0 mm) and EPI (2.0 × 1.8 × 8.0 mm). Sliding-window CG-HYPR is a promising technique for myocardial perfusion MRI. This technique provides higher image quality with respect to significantly improved SNR and spatial resolution of the myocardial perfusion images, which might improve myocardial perfusion imaging in a clinical setting.

  19. Isolation of Aureimonas altamirensis, a Brucella canis-like bacterium, from an edematous canine testicle.

    Science.gov (United States)

    Reilly, Thomas J; Calcutt, Michael J; Wennerdahl, Laura A; Williams, Fred; Evans, Tim J; Ganjam, Irene K; Bowman, Jesse W; Fales, William H

    2014-11-01

    Microbiological and histological analysis of a sample from a swollen testicle of a 2-year-old Border Collie dog revealed a mixed infection of the fungus Blastomyces dermatitidis and the Gram-negative bacterium Aureimonas altamirensis. When subjected to an automated microbial identification system, the latter isolate was provisionally identified as Psychrobacter phenylpyruvicus, but the organism shared several biochemical features with Brucella canis and exhibited agglutination, albeit weakly, with anti-B. canis antiserum. Unequivocal identification of the organism was only achieved by 16S ribosomal RNA gene sequencing, ultimately establishing the identity as A. altamirensis. Since its first description in 2006, this organism has been isolated infrequently from human clinical samples, but, to the authors' knowledge, has not been reported from a veterinary clinical sample. While of unknown clinical significance with respect to the pathology observed for the polymicrobial infection described herein, it highlights the critical importance to unambiguously identify the microbe for diagnostic, epidemiological, infection control, and public health purposes. © 2014 The Author(s).

  20. Electrical neuromodulation for disabling angina pectoris related to isolated stenoses of small epicardial coronary arteries

    NARCIS (Netherlands)

    Jessurun, GAJ; Hautvast, RWM; DeJongste, MJL; Meyler, WJ; van Boven, AJ; Crijns, HJGM

    Patients with symptomatic small vessel coronary artery disease may be inadequate candidates for revascularization procedures. They may suffer from refractory angina, which does not respond to maximal anti-anginal drug therapy. In addition to patients with end stage coronary artery disease and

  1. Dietary manipulation and social isolation alter disease progression in a murine model of coronary heart disease.

    Directory of Open Access Journals (Sweden)

    Yumiko Nakagawa-Toyama

    Full Text Available BACKGROUND: Mice with a deficiency in the HDL receptor SR-BI and low expression of a modified apolipoprotein E gene (SR-BI KO/ApoeR61(h/h called 'HypoE' when fed an atherogenic, 'Paigen' diet develop occlusive, atherosclerotic coronary arterial disease (CHD, myocardial infarctions (MI, and heart dysfunction and die prematurely (50% mortality ~40 days after initiation of this diet. Because few murine models share with HypoE mice these cardinal, human-like, features of CHD, HypoE mice represent a novel, small animal, diet-inducible and genetically tractable model for CHD. To better describe the properties of this model, we have explored the effects of varying the composition and timing of administration of atherogenic diets, as well as social isolation vs. group housing, on these animals. METHODOLOGY/PRINCIPAL FINDINGS: HypoE mice were maintained on a standard lab chow diet (control until two months of age. Subsequently they received one of three atherogenic diets (Paigen, Paigen without cholate, Western or control diet for varying times and were housed in groups or singly, and we determined the plasma cholesterol levels, extent of cardiomegaly and/or survival. The rate of disease progression could be reduced by lowering the severity of the atherogenic diet and accelerated by social isolation. Disease could be induced by Paigen diets either containing or free of cholate. We also established conditions under which CHD could be initiated by an atherogenic diet and then subsequently, by replacing this diet with standard lab chow, hypercholesterolemia could be reduced and progression to early death prevented. CONCLUSIONS/SIGNIFICANCE: HypoE mice provide a powerful, surgery-free, diet-'titratable' small animal model that can be used to study the onset of recovery from occlusive, atherosclerotic CHD and heart failure due to MI. HypoE mice can be used for the analysis of the effects of environment (diet, social isolation on a variety of features of

  2. Assessment of hemodynamic significance of isolated stenoses of the left anterior descending coronary artery using thallium-201 myocardial scintigraphy

    International Nuclear Information System (INIS)

    Kalff, V.; Kelly, M.J.; Soward, A.; Harper, R.W.; Currie, P.J.; Lim, Y.L.; Pitt, A.

    1985-01-01

    This study tests the hypothesis that the results of stress thallium-201 myocardial perfusion scans (TI-201) are related to the mean transstenotic pressure gradient of coronary stenoses independent of the percent luminal diameter narrowing seen at angiography. The 22 study patients (20 men, 2 women, mean age 47 years, range 30 to 62) had no previous myocardial infarction. Each underwent a symptom-limited, erect bicycle TI-201 test off antianginal therapy, shortly before percutaneous transluminal coronary angioplasty for isolated left anterior descending coronary artery stenosis. The percent narrowing, mean gradient at percutaneous transluminal coronary angioplasty and presence of a visually apparent TI-201 defect were independently evaluated and results compared. All 4 patients with 90% or greater diameter narrowing had positive TI-201 responses, and the mean gradient was 72 +/- 11 mm Hg. Among the 18 patients with less than 90% diameter narrowing, the mean gradient was higher (p less than 0.001) in the 11 with a positive TI-201 (63 +/- 15 mm Hg) than in the 7 with a negative TI-201 (33 +/- 20 mm Hg), but their percent narrowing did not differ significantly (72 +/- 14% vs 66 +/- 19%). Multiple regression analysis showed that the presence of a TI-201 defect was a strong (p . 0.003) and percent narrowing (p . 0.048) a weak independent predictor for gradient. When the mean gradient was normalized for the prestenotic pressure, both percent narrowing (p . 0.003) and TI-201 defects (p . 0.006) were significant independent predictors

  3. Action of the isolated canine diaphragm on the lower ribs at high lung volumes.

    Science.gov (United States)

    De Troyer, André; Wilson, Theodore A

    2014-10-15

    The normal diaphragm has an inspiratory action on the lower ribs, but subjects with chronic obstructive pulmonary disease commonly have an inward displacement of the lateral portions of the lower rib cage during inspiration. This paradoxical displacement, conventionally called 'Hoover's sign', has traditionally been attributed to the direct action of radially oriented diaphragmatic muscle fibres. In the present study, the inspiratory intercostal muscles in all interspaces in anaesthetized dogs were severed so that the diaphragm was the only muscle active during inspiration. The displacements of the lower ribs along the craniocaudal and laterolateral axes and the changes in pleural pressure (∆Ppl) and transdiaphragmatic pressure were measured during occluded breaths and mechanical ventilation at different lung volumes between functional residual capacity (FRC) and total lung capacity. From these data, the separate effects on rib displacement of ∆Ppl and of the force exerted by the diaphragm on the ribs were determined. Isolated spontaneous diaphragm contraction at FRC displaced the lower ribs cranially and outward, but this motion was progressively reversed into a caudal and inward motion as lung volume increased. However, although the force exerted by the diaphragm on the ribs decreased with increasing volume, it continued to displace the ribs cranially and outward. These observations suggest that Hoover's sign is usually caused by the decrease in the zone of apposition and, thus, by the dominant effect of ∆Ppl on the lower ribs, rather than an inward pull from the diaphragm. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  4. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  5. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  6. Effects of Scirpusin B, a polyphenol in passion fruit seeds, on the coronary circulation of the isolated perfused rat heart

    Directory of Open Access Journals (Sweden)

    Yutaka Matsumoto, Nozomi Gotoh, Shoko Sano, Kenkichi Sugiyama, Tatsuhiko Ito, Yohei Abe, Yumi Katano, Akira Ishihata

    2014-07-01

    Full Text Available Objective: Piceatannol, a polyphenol which is contained in passion fruits seed, is a derivative of resveratrol and is known to have antioxidant, anti-inflammatory and vasorelaxing activities. Passion fruits seed also contains a dimer of Piceatannol, Scirpusin B. The aim of this study was to investigate the effect of Scirpusin B on the coronary circulation of the isolated rat heart. Methods: Hearts were isolated from male Fischer 344 rats (5 – 6 months old, and perfused with modified Krebs-Henseleit solution aerated with 95% O2 and 5% CO2 (37 °C at constant pressure (75 cmH2O by Langendorff’s method. Piceatannol or Scirpusin B (10, 30 and 100 μM was injected as a bolus into the aortic cannula and coronary flow (CF was continuously measured by the electromagnetic flow meter. In some experiments, rat hearts were pretreated with L-NAME (an inhibitor of nitric oxide synthase or Diclofenac (an inhibitor of cyclooxygenase to reveal the possible involvement of nitric oxide (NO and vasodilating prostanoids in the effect of Scirpusin B. Results: Scirpusin B increased CF up to 108.2 % of the initial value, while Piceatannol did not increase CF. In addition; Scirpusin B increased CF concentration-dependently. Pretreatment with L-NAME or Diclofenac significantly attenuated the Scirpusin B-induced coronary vasodilatation. Scirpusin B did not change the heart rate either left ventricular pressure. Conclusion: This study shows that Scirpusin B could increase CF via production of NO and vasodilating prostanoids.

  7. Decreased antimony uptake and overexpression of genes of thiol metabolism are associated with drug resistance in a canine isolate of Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Verónica Gómez Pérez

    2016-08-01

    Full Text Available Visceral leishmaniasis (VL caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin in Leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate (subcutaneous Glucantime®, 100 mg/kg/day for 28 days. After the therapeutic intervention, these parasites were significantly less susceptible to antimony than pretreatment isolate, presenting a resistance index of 6-fold to SbIII for promastigotes and >3-fold to SbIII and 3-fold to SbV for intracellular amastigotes. The susceptibility profile of this resistant L. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels. Additionally, other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism, such as ornithine decarboxylase, trypanothione reductase, mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase, could contribute to the resistance as antimony detoxification mechanisms. A major contribution of this study in a canine L. infantum isolate is to find an antimony-resistant mechanism similar to that previously described in other human clinical isolates.

  8. An automated multi-modal object analysis approach to coronary calcium scoring of adaptive heart isolated MSCT images

    Science.gov (United States)

    Wu, Jing; Ferns, Gordon; Giles, John; Lewis, Emma

    2012-02-01

    Inter- and intra- observer variability is a problem often faced when an expert or observer is tasked with assessing the severity of a disease. This issue is keenly felt in coronary calcium scoring of patients suffering from atherosclerosis where in clinical practice, the observer must identify firstly the presence, followed by the location of candidate calcified plaques found within the coronary arteries that may prevent oxygenated blood flow to the heart muscle. This can be challenging for a human observer as it is difficult to differentiate calcified plaques that are located in the coronary arteries from those found in surrounding anatomy such as the mitral valve or pericardium. The inclusion or exclusion of false positive or true positive calcified plaques respectively will alter the patient calcium score incorrectly, thus leading to the possibility of incorrect treatment prescription. In addition to the benefits to scoring accuracy, the use of fast, low dose multi-slice CT imaging to perform the cardiac scan is capable of acquiring the entire heart within a single breath hold. Thus exposing the patient to lower radiation dose, which for a progressive disease such as atherosclerosis where multiple scans may be required, is beneficial to their health. Presented here is a fully automated method for calcium scoring using both the traditional Agatston method, as well as the Volume scoring method. Elimination of the unwanted regions of the cardiac image slices such as lungs, ribs, and vertebrae is carried out using adaptive heart isolation. Such regions cannot contain calcified plaques but can be of a similar intensity and their removal will aid detection. Removal of both the ascending and descending aortas, as they contain clinical insignificant plaques, is necessary before the final calcium scores are calculated and examined against ground truth scores of three averaged expert observer results. The results presented here are intended to show the requirement and

  9. Lincosamide resistance is less frequent in Denmark in Staphylococcus pseudintermedius from first-time canine superficial pyoderma compared with skin isolates from clinical samples with unknown clinical background.

    Science.gov (United States)

    Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter

    2015-06-01

    Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.

  10. Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

    Science.gov (United States)

    Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

    2014-12-05

    Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  12. Rubidium-82 PET-CT for quantitative assessment of myocardial blood flow: validation in a canine model of coronary artery stenosis

    International Nuclear Information System (INIS)

    Lautamaeki, Riikka; Higuchi, Takahiro; Merrill, Jennifer; Voicu, Corina; Bengel, Frank M.; George, Richard T.; Kitagawa, Kakuya; DiPaula, Anthony; Lima, Joao A.C.; Nekolla, Stephan G.; Lardo, Albert C.

    2009-01-01

    Absolute quantification of myocardial blood flow expands the diagnostic potential of PET for assessment of coronary artery disease. 82 Rb has significantly contributed to increasing utilization of PET; however, clinical studies are still mostly analysed qualitatively. The aim of this study was to reevaluate the feasibility of 82 Rb for flow quantification, using hybrid PET-CT in an animal model of coronary stenosis. Nine dogs were prepared with experimental coronary artery stenosis. Dynamic PET was performed for 8 min after 82 Rb(1480-1850 MBq) injection during adenosine-induced vasodilation. Microspheres were injected simultaneously for reference flow measurements. CT angiography was used to determine the myocardial regions related to the stenotic vessel. Two methods for flow calculation were employed: a two-compartment model including a spill-over term, and a simplified retention index. The two-compartment model data were in good agreement with microsphere flow (y=0.84x+0.20; r=0.92, p 82 Rb. A simplified approach based on tracer retention is practicable in the physiological flow range. These results encourage further testing of the robustness and usefulness in the clinical context of cardiac hybrid imaging. (orig.)

  13. Isolation and sequence analysis of the complete NS1 and VP2 genes of canine parvovirus from domestic dogs in 2013 and 2014 in China.

    Science.gov (United States)

    Wang, Hualei; Jin, Hongli; Li, Qian; Zhao, Guoxing; Cheng, Nan; Feng, Na; Zheng, Xuexing; Wang, Jianzhong; Zhao, Yongkun; Li, Ling; Cao, Zengguo; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu

    2016-02-01

    Canine parvovirus (CPV) can cause severe disease in animals and continuously generates new variant and recombinant strains in dogs that have a strong impact on sanitation. It is therefore necessary to investigate epidemic CPV strains to improve our understanding of CPV transmission and epidemic behavior. However, most studies have focused on the analysis of VP2, and therefore, information about recombination and relationships between strains is still lacking. Here, 14 strains of CPV were isolated from domestic dogs suspected of hosting CPV between 2013 and 2014 in China. The complete NS1 and VP2 genes were sequenced and analyzed. The results suggest that the new CPV-2a and new CPV-2b types are the prevalent strains in China. In addition to a few mutations (residues 19, 544, 545, 572 and 583 of NS1 and residues 267, 370, 377 and 440 of VP2) that were preserved during transmission, new mutations (residues 60, 630 of NS1, and residues 21, 310 of VP2) were found in the isolated strains. A phylogenetic tree based on VP2 sequences illustrated that the new CPV-2a and new CPV-2b strains from China form single clusters that are distinct from lineages from other countries. Moreover, recombination between the new CPV-2a and new CPV-2b types was also identified in the isolated strains. Due to differences in selection pressures or recombination, there were a small number of inconsistencies between the phylogenetic trees for VP2 and NS1, which indicated that phylogenetic relationships based on VP2 might not be representative of those based on NS1. The data indicated that mutations and recombination are constantly occurring along with the spread of CPV in China.

  14. Prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia: study by 99mTc-sestamibi radionuclide scintigraphy.

    Science.gov (United States)

    Ismail, Ahmed M; Rayan, Mona; Adel, Amr; Demerdash, Salah; Atef, Mohamed; Abdallah, Mohamed; Nammas, Wail

    2014-02-01

    We explored the prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia (CAE), as demonstrated by (99m)Tc-sestamibi scintigraphy. Prospectively, we enrolled 35 patients with angiographically documented CAE and no significant coronary obstruction, who underwent elective coronary angiography. Patients underwent Stress-rest (99m)Tc-sestamibi scintigraphy within 4 days of coronary angiography. They were divided into 2 groups: group I: with normal perfusion scan; and group II: with reversible perfusion defects. The mean age was 49.6 ± 6.9 years; 34 (97.1 %) were males. Seventy-nine (75.2 %) arteries were affected by CAE. Among 79 arteries affected by CAE, affection was diffuse in 37 (46.8 %). Thirteen (37.1 %) patients had normal perfusion scan (group I), whereas 22 (62.9 %) had reversible perfusion defects (group II). Among 22 patients with reversible perfusion defects, 20 (90.9 %) had mild and 2 (9.1 %) had moderate ischemia. Among 49 myocardial segments with reversible perfusion defects, 22 (44.9 %) were basal, 18 (36.7 %) mid-, and 9 (18.4 %) apical segments. Diffuse CAE was significantly more prevalent in group II versus group I, in all 3 major coronary arteries (p < 0.05 for all). In patients with isolated CAE who underwent elective coronary angiography, reversible perfusion defects demonstrated by (99m)Tc-sestamibi scintigraphy were rather prevalent, mostly mild, more likely to affect the basal and mid-segments of the myocardium, and more frequently associated with diffuse ectasia.

  15. Amiodarona causa vasodilatação dependente do endotélio em artérias coronárias caninas Amiodarone causes endothelium-dependent vasodilation in canine coronary arteries

    Directory of Open Access Journals (Sweden)

    Alfredo José Rodrigues

    2005-03-01

    Full Text Available OBJETIVO: Avaliar os efeitos vasodilatadores da amiodarona em artérias coronárias caninas empregando soluções de amiodarona dissolvida em polisorbato 80 ou em água. MÉTODOS: Anéis de artéria coronária, com e sem o endotélio íntegro, foram imersos em solução de krebs e conectadas a um transdutor para aferição de força isométrica promovida por contração vascular. As artérias foram expostas a concentrações crescentes de polisorbato 80, amiodarona dissolvida em água, amiodarona dissolvida em polisorbato 80 e uma apresentação comercial da amiodarona (Cordarone®. Os experimentos foram conduzidos na presença e na ausência dos seguintes bloqueadores enzimáticos: apenas indometacina, Nômega-nitro-L-arginina associada à indometacina e apenas Nômega-nitro-L-arginina. RESULTADOS: O polisorbato 80 causou pequeno relaxamento não dependente do endotélio. O Cordarone®, a amiodarona dissolvida em água e em polisorbato 80 promoveram relaxamento dependente do endotélio, que foi de maior magnitude para a amiodarona dissolvida em polisorbato e para o Cordarone®. Apenas a associação de indometacina com a Nômega-nitro-L-arginina foi capaz de abolir o relaxamento dependente do endotélio provocado pela amiodarona dissolvida em polisorbato 80. CONCLUSÃO: Os resultados obtidos indicam que a vasodilatação promovida pela amiodarona em artérias coronárias caninas é causada principalmente pela estimulação da liberação de óxido nítrico e fatores endoteliais relaxantes dependentes das ciclo-oxigenases.OBJECTIVE: To assess the vasodilating effects of amiodarone on canine coronary arteries by using solutions of amiodarone dissolved in polysorbate 80 or water. METHODS: Rings of coronary arteries, with or without intact endothelium, were immersed in Krebs solution and connected to a transducer for measuring the isometric force promoted by a vascular contraction. The arteries were exposed to increasing concentrations of

  16. Preoperative Hematocrit Concentration and the Risk of Stroke in Patients Undergoing Isolated Coronary-Artery Bypass Grafting

    Directory of Open Access Journals (Sweden)

    Khaled M. Musallam

    2013-01-01

    Full Text Available Background. Identification and management of risk factors for stroke following isolated coronary artery bypass grafting (CABG could potentially lower the risk of such serious morbidity. Methods. We retrieved data for 30-day stroke incidence and perioperative variables for patients undergoing isolated CABG and used multivariate logistic regression to assess the adjusted effect of preoperative hematocrit concentration on stroke incidence. Results. In 2,313 patients (mean age 65.9 years, 73.6% men, 43 (1.9%, 95% CI: 1.4–2.5 developed stroke within 30 days following CABG (74.4% within 6 days. After adjustment for a priori defined potential confounders, each 1% drop in preoperative hematocrit concentration was associated with 1.07 (95% CI: 1.01–1.13 increased odds for stroke (men, OR: 1.08, 95% CI: 1.01–1.16; women, OR: 1.02, 95% CI: 0.91–1.16. The predicted probability of stroke for descending preoperative hematocrit concentration exceeded 2% for values <37% (<37% for men (adjusted OR: 2.39, 95% CI: 1.08–5.26 and <38% for women (adjusted OR: 2.52, 95% CI: 0.53–11.98, with a steeper probability increase noted in men. The association between lower preoperative hematocrit concentration and stroke was evident irrespective of intraoperative transfusion use. Conclusion. Screening and management of patients with low preoperative hematocrit concentration may alter postoperative stroke risk in patients undergoing isolated CABG.

  17. Coronary Artery Anomalies in Animals

    Directory of Open Access Journals (Sweden)

    Brian A. Scansen

    2017-04-01

    Full Text Available Coronary artery anomalies represent a disease spectrum from incidental to life-threatening. Anomalies of coronary artery origin and course are well-recognized in human medicine, but have received limited attention in veterinary medicine. Coronary artery anomalies are best described in the dog, hamster, and cow though reports also exist in the horse and pig. The most well-known anomaly in veterinary medicine is anomalous coronary artery origin with a prepulmonary course in dogs, which limits treatment of pulmonary valve stenosis. A categorization scheme for coronary artery anomalies in animals is suggested, dividing these anomalies into those of major or minor clinical significance. A review of coronary artery development, anatomy, and reported anomalies in domesticated species is provided and four novel canine examples of anomalous coronary artery origin are described: an English bulldog with single left coronary ostium and a retroaortic right coronary artery; an English bulldog with single right coronary ostium and transseptal left coronary artery; an English bulldog with single right coronary ostium and absent left coronary artery with a prepulmonary paraconal interventricular branch and an interarterial circumflex branch; and a mixed-breed dog with tetralogy of Fallot and anomalous origin of all coronary branches from the brachiocephalic trunk. Coronary arterial fistulae are also described including a coronary cameral fistula in a llama cria and an English bulldog with coronary artery aneurysm and anomalous shunting vessels from the right coronary artery to the pulmonary trunk. These examples are provided with the intent to raise awareness and improve understanding of such defects.

  18. Plasma protein concentration and control of coronary vascular resistance in isolated rat heart

    NARCIS (Netherlands)

    Avolio, A. P.; Spaan, J. A.; Laird, J. D.

    1980-01-01

    Isolated externally paced (300 beats/min) rat hearts were perfused at constant pressure (70 mmHg) using a modified Krebs-Henseleit solution with (n = 52) and without (n = 15) washed bovine red cells. Albumin concentration varied from 1 to 10 g/dl. With increasing albumin concentration in

  19. Rubidium-82 PET-CT for quantitative assessment of myocardial blood flow: validation in a canine model of coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Lautamaeki, Riikka; Higuchi, Takahiro; Merrill, Jennifer; Voicu, Corina; Bengel, Frank M. [Johns Hopkins Medical Institutions, Department of Radiology, Division of Nuclear Medicine, Baltimore, MD (United States); George, Richard T.; Kitagawa, Kakuya; DiPaula, Anthony; Lima, Joao A.C. [Johns Hopkins Medical Institutions, Department of Medicine, Division of Cardiology, Baltimore, MD (United States); Nekolla, Stephan G. [Technischen Universitaet Muenchen, Nuklearmedizinische Klinik und Poliklinik, Klinikum rechts der Isar, Munich (Germany); Lardo, Albert C. [Johns Hopkins Medical Institutions, Department of Medicine, Division of Cardiology, Baltimore, MD (United States); Johns Hopkins Medical Institutions, Department of Biomedical Engineering, Baltimore, MD (United States)

    2009-04-15

    Absolute quantification of myocardial blood flow expands the diagnostic potential of PET for assessment of coronary artery disease. {sup 82}Rb has significantly contributed to increasing utilization of PET; however, clinical studies are still mostly analysed qualitatively. The aim of this study was to reevaluate the feasibility of {sup 82}Rb for flow quantification, using hybrid PET-CT in an animal model of coronary stenosis. Nine dogs were prepared with experimental coronary artery stenosis. Dynamic PET was performed for 8 min after {sup 82}Rb(1480-1850 MBq) injection during adenosine-induced vasodilation. Microspheres were injected simultaneously for reference flow measurements. CT angiography was used to determine the myocardial regions related to the stenotic vessel. Two methods for flow calculation were employed: a two-compartment model including a spill-over term, and a simplified retention index. The two-compartment model data were in good agreement with microsphere flow (y=0.84x+0.20; r=0.92, p<0.0001), although there was variability in the physiological flow range <3 ml/g per minute (y=0.54x+0.53; r=0.53, p=0.042). Results from the retention index also correlated well with microsphere flow (y=0.47x+0.52; r=0.75, p=0.0004). Error increased with higher flow, but the correlation was good in the physiological range (y=0.62x+0.29; r=0.84, p=0.0001). Using current state-of-the-art PET-CT systems, quantification of myocardial blood flow is feasible with {sup 82}Rb. A simplified approach based on tracer retention is practicable in the physiological flow range. These results encourage further testing of the robustness and usefulness in the clinical context of cardiac hybrid imaging. (orig.)

  20. Continuing evolution of canine parvovirus in China: Isolation of novel variants with an Ala5Gly mutation in the VP2 protein.

    Science.gov (United States)

    Wang, Jianke; Lin, Peng; Zhao, Hang; Cheng, Yuening; Jiang, Zhong; Zhu, Hongwei; Wu, Hua; Cheng, Shipeng

    2016-03-01

    Canine parvovirus (CPV) type 2c is a new antigenic variant of CPV-2. Since the year 2000 it has spread to several countries, causing severe hemorrhagic enteritis in dogs. In 2014 and 2015, 58 fecal samples were collected from dogs in Beijing with suspected CPV infection. Regardless of the vaccination status of the dogs, 43 samples were found positive for CPV according to PCR results; i.e., 18, 7, and 18 respectively belonged to antigenic types new CPV-2a, new CPV-2b, and CPV-2c. A phylogenetic tree based on their VP2 gene sequences indicated that the Chinese CPV-2c strains form a separate cluster. In addition to synonymous mutations, the CPV-2c strains also contain a unique coding mutation in VP2 that leads to glycine at residue 5, instead of the highly conserved alanine at this position in all other CPV-2c strains sequenced to date. Using F81 cells, several novel isolates of CPV-2c, each with the Ala5Gly mutation, were obtained. One of these was used to infect experimentally beagle dogs, which subsequently developed the typical clinical symptoms of CPV infection. Hence, it appears that CPV-2c is still evolving in China, a finding that warrants continuous surveying and the eventual adaptation of current vaccines. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque.

    Science.gov (United States)

    Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen

    2014-08-01

    The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain

  2. Comparison of the virulence of three H3N2 canine influenza virus isolates from Korea and China in mouse and Guinea pig models.

    Science.gov (United States)

    Xie, Xing; Na, Woonsung; Kang, Aram; Yeom, Minjoo; Yuk, Heejun; Moon, Hyoungjoon; Kim, Sung-Jae; Kim, Hyun-Woo; Kim, Jeong-Ki; Pang, Maoda; Wang, Yongshan; Liu, Yongjie; Song, Daesub

    2018-05-02

    Avian-origin H3N2 canine influenza virus (CIV) has been the most common subtype in Korea and China since 2007. Here, we compared the pathogenicity and transmissibility of three H3N2 CIV strains [Chinese CIV (JS/10), Korean CIV (KR/07), and Korean recombinant CIV between the classic H3N2 CIV and the pandemic H1N1 virus (MV/12)] in BALB/c mouse and guinea pig models. The pandemic H1N1 (CA/09) strain served as the control. BALB/c mice infected with H1N1 had high mortality and obvious body weight loss, whereas no overt disease symptoms were observed in mice inoculated with H3N2 CIV strains. The viral titers were higher in the group MV/12 than those in groups JS/10 and KR/07, while the mice infected with JS/10 showed higher viral titers in all tissues (except for the lung) than the mice infected with KR/07. The data obtained in guinea pigs also demonstrated that group MV/12 presented the highest loads in most of the tissues, followed by group JS/10 and KR/07. Also, direct contact transmissions of all the three CIV strains could be observed in guinea pigs, and for the inoculated and the contact groups, the viral titer of group MV/12 and KR/07 was higher than that of group JS/10 in nasal swabs. These findings indicated that the matrix (M) gene obtained from the pandemic H1N1 may enhance viral replication of classic H3N2 CIV; JS/10 has stronger viral replication ability in tissues as compared to KR/07, whereas KR/07 infected guinea pigs have more viral shedding than JS/10 infected guinea pigs. There exists a discrepancy in pathobiology among CIV isolates. Reverse genetics regarding the genomes of CIV isolates will be helpful to further explain the virus characteristics.

  3. Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

    Science.gov (United States)

    Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

    2016-08-02

    In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

  4. HYPERTHERMIC ISOLATED REGIONAL PERFUSION WITH CISPLATIN IN THE LOCAL TREATMENT OF SPONTANEOUS CANINE OSTEOSARCOMA - ASSESSMENT OF SHORT-TERM EFFECTS

    NARCIS (Netherlands)

    VANGINKEL, RJ; HOEKSTRA, HJ; MEUTSTEGE, FJ; OOSTERHUIS, JW; UGES, DRA; KOOPS, HS

    To increase the effect of cisplatin on locoregional osteosarcoma, the short-term effect of hyperthermic isolated regional perfusion (HIRP) with cisplatin (30 mg/L extremity volume) was studied in 28 dogs with spontaneous osteogenic sarcoma, using clinical, radiological, and histological parameters.

  5. Does a similar procedure result in similar survival for women and men undergoing isolated coronary artery bypass grafting?

    Science.gov (United States)

    Attia, Tamer; Koch, Colleen G; Houghtaling, Penny L; Blackstone, Eugene H; Sabik, Ellen Mayer; Sabik, Joseph F

    2017-03-01

    To (1) identify sex-related differences in risk factors and revascularization strategies for patients undergoing coronary artery bypass grafting (CABG), (2) assess whether these differences influenced early and late survival, and (3) determine whether clinical effectiveness of the same revascularization strategy was influenced by sex. From January 1972 to January 2011, 57,943 adults-11,009 (19%) women-underwent primary isolated CABG. Separate models for long-term mortality were developed for men and women, followed by assessing sex-related differences in strength of risk factors (interaction terms). Incomplete revascularization was more common in men than women (26% vs 22%, P  .9) with lower survival in both sexes. Single ITA grafting was associated with equally (P = .3) better survival in women and men. Although bilateral ITA grafting was associated with better survival than single ITA grafting, it was less effective in women-11% lower late mortality (hazard ratio, 0.89 [0.77-1.022]) versus 27% lower in men (hazard ratio, 0.73 [0.69-0.77]; P = .01). Women on average have longer life expectancies than men but not after CABG. Every attempt should be made to use arterial grafting and complete revascularization, but for unexplained reasons, sex-related differences in effectiveness of bilateral arterial grafting were identified. Copyright © 2016. Published by Elsevier Inc.

  6. Ondas ultra-sônicas de alta freqüência causam disfunção endotelial em artérias coronárias caninas epicárdicas High-frequency ultrasonic waves cause endothelial dysfunction on canine epicardial coronary arteries

    Directory of Open Access Journals (Sweden)

    Berent Discigil

    2008-06-01

    investigations. METHODS: To determine whether ultrasound energy impairs the production of nitric oxide or damages vascular smooth muscle function, isolated canine epicardial coronary artery segments were exposed to either high (25 W or low (0-10 W ultrasonic energy outputs, for 15 seconds, using an endarterectomy device prototype. After exposure, segments of epicardial coronary artery were studied in organ chambers. The following drugs were used: adenosine diphosphate (ADP, acetylcholine (Ach and sodium fluoride (NaF to study endothelium-dependent relaxation and sodium nitroprusside (SNP and isoproterenol to evaluate endothelium-independent relaxation. RESULTS: Application of high ultrasonic energy power impaired endothelium-dependent relaxation to ADP (10-9 - 10-4 M, Ach (10-9 - 10-4 M and NaF (0.5 - 9.5 mM in epicardial coronary arteries. However, low ultrasound energy output at the tip of the probe did not alter the endothelium-dependent relaxation (either maximal relaxation or EC50 to the same agonists. Vascular smooth muscle relaxation to isoproterenol (10-9 - 10-5 M or SNP (10-9 - 10-6 M was unaltered following exposure to either low or high ultrasonic energy outputs. CONCLUSION: These experiments currently prove that ultrasonic energy changes endothelial function of epicardial coronary arteries at high power. However, ultrasound does not alter the ability of vascular smooth muscle of canine epicardial coronary arteries to relax.

  7. Dissociation between cardiomyocyte function and remodeling with beta-adrenergic receptor blockade in isolated canine mitral regurgitation.

    Science.gov (United States)

    Pat, Betty; Killingsworth, Cheryl; Denney, Thomas; Zheng, Junying; Powell, Pamela; Tillson, Michael; Dillon, A Ray; Dell'Italia, Louis J

    2008-12-01

    The low-pressure volume overload of isolated mitral regurgitation (MR) is associated with increased adrenergic drive, left ventricular (LV) dilatation, and loss of interstitial collagen. We tested the hypothesis that beta1-adrenergic receptor blockade (beta1-RB) would attenuate LV remodeling after 4 mo of MR in the dog. beta1-RB did not attenuate collagen loss or the increase in LV mass in MR dogs. Using MRI and three-dimensional (3-D) analysis, there was a 70% increase in the LV end-diastolic (LVED) volume-to-LV mass ratio, a 23% decrease in LVED midwall circumferential curvature, and a >50% increase in LVED 3-D radius/wall thickness in MR dogs that was not attenuated by beta1-RB. However, beta1-RB caused a significant increase in LVED length from the base to apex compared with untreated MR dogs. This was associated with an increase in isolated cardiomyocyte length (171+/-5 microm, P<0.05) compared with normal (156+/-3 microm) and MR (165+/-4 microm) dogs. Isolated cardiomyocyte fractional shortening was significantly depressed in MR dogs compared with normal dogs (3.73+/-0.31 vs. 5.02+/-0.26%, P<0.05) and normalized with beta1-RB (4.73+/-0.48%). In addition, stimulation with the beta-adrenergic receptor agonist isoproterenol (25 nM) increased cardiomyocyte fractional shortening by 215% (P<0.05) in beta1-RB dogs compared with normal (56%) and MR (50%) dogs. In summary, beta1-RB improved LV cardiomyocyte function and beta-adrenergic receptor responsiveness despite further cell elongation. The failure to attenuate LV remodeling associated with MR could be due to a failure to improve ultrastructural changes in extracellular matrix organization.

  8. A rare case of canine anomaly - a possible algorithm for treating it.

    Science.gov (United States)

    Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

    2014-01-01

    Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

  9. Effects of neuropeptide Y on regulation of blood flow rate in canine myocardium

    DEFF Research Database (Denmark)

    Svendsen, Jesper Hastrup; Sheikh, S P; Jørgensen, J

    1990-01-01

    The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY-like immunoreac......The effect of neuropeptide Y (NPY) on tension development was examined in isolated canine coronary arteries, and the effects on local myocardial blood flow rate were studied in open-chest anesthetized dogs by the local 133Xe washout technique. By immunohistochemistry, numerous NPY......+. In contrast, intracoronary NPY (0.01-10 micrograms) induced a considerable degree of vasoconstriction; the reduction of blood flow rate was dose related, with a maximum reduction to 52% of control values. The effect of intracoronary NPY (1 microgram) on maximally relaxed arterioles elicited by 30 s...... of ischemia was studied in separate experiments during reactive hyperemia. NPY induced a decrease in maximum blood flow during reactive hyperemia (166.6 vs. 214.6% of preocclusive blood flow rate, mean values; P = 0.05), an increase in the cumulative excess blood flow (61.0 vs. 35.3 ml/100 g; P = 0...

  10. Action of ouabain and an amino-cardenolide on Na+-pump function and contractility of isolated canine heart cells

    International Nuclear Information System (INIS)

    Porterfield, L.M.; Songu-Mize, E.; Chryssanthis, T.; Caldwell, R.W.

    1986-01-01

    Viable, rod-shaped, Ca ++ -tolerant cells were isolated from the cardiac ventricle of adult mongrel dogs, a digitalis-sensitive species. These cells do not contract spontaneously but contractions were driven by electrical field stimulation. Changes in contractile amplitude were assessed by computer-assisted analysis of recorded phase contrast images. Addition of a polar aminocardenolide (AC), ASI-222, produced a dose-related increase in contractility with a concentration producing a 50% maximal response (RC 50 ) of 4 x 10 -8 M. For ouabain (OB) the RC 50 was 7 x 10 -7 M. Cellular Na + -pump (NaP) function was determined as digitalis-sensitive 86 Rb + -uptake. Addition of AC and OB to these cells produced a dose-related decrease in 86 Rb + -uptake; concentrations which produced a 50% inhibition (IC 50 ) of NaP function were of 6 x 10 -8 M and 1.2 x 10 -6 M for AC and OB, respectively. Their data indicates that in isolated dog heart cells AC is both a more potent inotropic agent and an inhibitor of NaP function by 15-20 fold than OB. The RC 50 and IC 50 for these processes correlate for each glycoside

  11. Analysis of the influence of respiratory disorders observed in preoperative spirometry on the dynamics of early inflammatory response in patients undergoing isolated coronary artery bypass grafting.

    Science.gov (United States)

    Szylińska, Aleksandra; Listewnik, Mariusz J; Rotter, Iwona; Rył, Aleksandra; Biskupski, Andrzej; Brykczyński, Mirosław

    2017-01-01

    Preoperative spirometry provides measurable information about the occurrence of respiratory disorders. The aim of this study was to assess the association between preoperative spirometry abnormalities and the intensification of early inflammatory responses in patients following coronary artery bypass graft in extracorporeal circulation. The study involved 810 patients (625 men and 185 women) aged 65.4±7.9 years who were awaiting isolated coronary artery bypass surgery. On the basis of spirometry performed on the day of admittance to the hospital, the patients were divided into three groups. Patients without respiratory problems constituted 78.8% of the entire group. Restricted breathing was revealed by spirometry in 14.9% and obstructive breathing in 6.3% of patients. Inter-group analysis showed statistically significant differences in C-reactive protein (CRP) between patients with restrictive spirometry abnormalities and patients without any pulmonary dysfunction. CRP concentrations differed before surgery ( P =0.006) and on the second ( P spirometry results from restrictive respiratory disorders have an elevated level of generalized inflammatory response both before and after the isolated coronary artery bypass surgery. Therefore, this group of patients should be given special postoperative monitoring and, in particular, intensive respiratory rehabilitation immediately after reconstitution.

  12. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Directory of Open Access Journals (Sweden)

    Orison O Woolcott

    Full Text Available Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia.To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets.Dogs were fed a high-fat diet (n = 9 for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7.Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, P<0.01. In vivo insulin sensitivity decreased by 31.3±12.1% (P<0.05, concomitant with a decrease in plasma 2-arachidonoyl glycerol (from 39.1±5.2 to 15.7±2.0 nmol/L but not anandamide, oleoyl ethanolamide, linoleoyl ethanolamide, or palmitoyl ethanolamide. In control-diet animals (body weight: 28.8±1.0 kg, islets incubated with anandamide had a higher basal and glucose-stimulated insulin secretion as compared with no treatment. Islets from fat-fed animals (34.5±1.3 kg; P<0.05 versus control did not exhibit further potentiation of anandamide-induced insulin secretion as compared with control-diet animals. Glucagon but not somatostatin secretion in vitro was also increased in response to anandamide, but there was no difference between groups (P = 0.705. No differences in gene expression of CB1R or CB2R between groups were found.In canines, high-fat diet

  13. Brain Abscess Associated with Isolated Left Superior Vena Cava Draining into the Left Atrium in the Absence of Coronary Sinus and Atrial Septal Defect

    International Nuclear Information System (INIS)

    Erol, Ilknur; Cetin, I. Ilker; Alehan, Fuesun; Varan, Birguel; Ozkan, Sueleyman; Agildere, A. Muhtesem; Tokel, Kursad

    2006-01-01

    A previously healthy 12-year-old girl presented with severe headache for 2 weeks. On physical examination, there was finger clubbing without apparent cyanosis. Neurological examination revealed only papiledema without focal neurologic signs. Cerebral magnetic resonance imaging showed the characteristic features of brain abscess in the left frontal lobe. Cardiologic workup to exclude a right-to-left shunt showed an abnormality of the systemic venous drainage: presence of isolated left superior vena cava draining into the left atrium in the absence of coronary sinus and atrial septal defect. This anomaly is rare, because only a few other cases have been reported

  14. Rarity of isolated pulmonary embolism and acute aortic syndrome occurring outside of the field of view of dedicated coronary CT angiography

    International Nuclear Information System (INIS)

    Lee, Hwa Yeon; Song, In Sup; Yoo, Seung Min; Rho, Ji Young; Moon, Jae Youn; Kim, In Jai; Lim, Sang Wook; Sung, Jung Hoon; Cha, Dong Hun; White, Charles S.

    2011-01-01

    Background Although triple rule-out CT angiography (TRO) to simultaneously evaluate acute coronary syndrome (ACS), pulmonary embolism (PE), and acute aortic syndrome (AAS) is increasingly used in many institutions, TRO is inevitably associated with increased radiation exposure due to extended z-axis coverage compared with dedicated coronary CT angiography (DCTA). Purpose To determine the frequency of exclusion of findings of AAS, PE, and significant incidental non-cardiac pathology that may be the cause of acute chest pain when using a restricted DCTA field of view (FOV). Material and Methods We retrospectively reviewed CT images and charts of 103 patients with acute PE and 50 patients with AAS. Either non-ECG gated dedicated pulmonary or aortic CT angiography was performed using 16- or 64-slice multidetector CT (MDCT). We analyzed the incidence of isolated PE, AAS, or significant non-cardiac pathology outside of DCTA FOV (i.e. from tracheal carina to the base of heart). Results There were two cases of isolated PE (2/103, 1.9%) excluded from the FOV of DCTA. One case of PE was isolated to the subsegmental pulmonary artery in the posterior segment of the right upper lobe. In the second case, pulmonary embolism in the left main pulmonary artery was located out of the FOV of DCTA because the left main pulmonary artery was retracted upwardly by fibrotic scar in the left upper lobe due to prior tuberculosis. There was no case of AAS and significant non-cardiac pathology excluded from the FOV of DCTA. AAS (n = 50) consisted of penetrating atherosclerotic ulcer (n = 7), intramural hematoma (n = 5) and aortic dissection (n = 38). Conclusion As isolated PE, AAS, and significant non-cardiac pathology outside of the DCTA FOV rarely occur, DCTA may replace TRO in the evaluation of patients with non-specific acute chest pain and a low pre-test probability of PE or aortic dissection

  15. Rarity of isolated pulmonary embolism and acute aortic syndrome occurring outside of the field of view of dedicated coronary CT angiography

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hwa Yeon; Song, In Sup (Dept. of Diagnostic Radiology Chung-Ang Univ. College of Medicine, Seoul (Korea, Republic of)); Yoo, Seung Min; Rho, Ji Young (Dept. of Diagnostic Radiology CHA Medical Univ. Hospital, Bundang (Korea, Republic of)), email: smyoo68@hanmail.net; Moon, Jae Youn; Kim, In Jai; Lim, Sang Wook; Sung, Jung Hoon; Cha, Dong Hun (Dept. of Cardiology CHA Medical Univ. Hospital, Bundang (Korea, Republic of)); White, Charles S. (Dept. of Diagnostic Radiology Univ. of Maryland, Baltimore (United States))

    2011-05-15

    Background Although triple rule-out CT angiography (TRO) to simultaneously evaluate acute coronary syndrome (ACS), pulmonary embolism (PE), and acute aortic syndrome (AAS) is increasingly used in many institutions, TRO is inevitably associated with increased radiation exposure due to extended z-axis coverage compared with dedicated coronary CT angiography (DCTA). Purpose To determine the frequency of exclusion of findings of AAS, PE, and significant incidental non-cardiac pathology that may be the cause of acute chest pain when using a restricted DCTA field of view (FOV). Material and Methods We retrospectively reviewed CT images and charts of 103 patients with acute PE and 50 patients with AAS. Either non-ECG gated dedicated pulmonary or aortic CT angiography was performed using 16- or 64-slice multidetector CT (MDCT). We analyzed the incidence of isolated PE, AAS, or significant non-cardiac pathology outside of DCTA FOV (i.e. from tracheal carina to the base of heart). Results There were two cases of isolated PE (2/103, 1.9%) excluded from the FOV of DCTA. One case of PE was isolated to the subsegmental pulmonary artery in the posterior segment of the right upper lobe. In the second case, pulmonary embolism in the left main pulmonary artery was located out of the FOV of DCTA because the left main pulmonary artery was retracted upwardly by fibrotic scar in the left upper lobe due to prior tuberculosis. There was no case of AAS and significant non-cardiac pathology excluded from the FOV of DCTA. AAS (n = 50) consisted of penetrating atherosclerotic ulcer (n = 7), intramural hematoma (n = 5) and aortic dissection (n = 38). Conclusion As isolated PE, AAS, and significant non-cardiac pathology outside of the DCTA FOV rarely occur, DCTA may replace TRO in the evaluation of patients with non-specific acute chest pain and a low pre-test probability of PE or aortic dissection

  16. Deficiency of sex hormones does not affect 17-ß-estradiol-induced coronary vasodilation in the isolated rat heart.

    Science.gov (United States)

    Santos, R L; Lima, J T; Rouver, W N; Moysés, M R

    2016-01-01

    The relaxation of coronary arteries by estrogens in the coronary vascular beds of naive and hypertensive rats has been well described. However, little is known about this action in gonadectomized rats. We investigated the effect of 17-ß-estradiol (E2) in coronary arteries from gonadectomized rats, as well as the contributions of endothelium-derived factors and potassium channels. Eight-week-old female and male Wistar rats weighing 220-300 g were divided into sham-operated and gonadectomized groups (n=9-12 animals per group). The baseline coronary perfusion pressure (CPP) was determined, and the vasoactive effects of 10 μM E2 were assessed by bolus administration before and after endothelium denudation or by perfusion with NG-nitro-L-arginine methyl ester (L-NAME), indomethacin, clotrimazole, L-NAME plus indomethacin, L-NAME plus clotrimazole or tetraethylammonium (TEA). The CPP differed significantly between the female and sham-operated male animals. Gonadectomy reduced the CPP only in female rats. Differences in E2-induced relaxation were observed between the female and male animals, but male castration did not alter this response. For both sexes, the relaxation response to E2 was, at least partly, endothelium-dependent. The response to E2 was reduced only in the sham-operated female rats treated with L-NAME. However, in the presence of indomethacin, clotrimazole, L-NAME plus indomethacin or L-NAME plus clotrimazole, or TEA, the E2 response was significantly reduced in all groups. These results highlight the importance of prostacyclin, endothelium-derived hyperpolarizing factor, and potassium channels in the relaxation response of coronary arteries to E2 in all groups, whereas nitric oxide may have had an important role only in the sham-operated female group.

  17. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  18. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  19. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  20. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  1. Pomegranate Extract Enhances Endothelium-Dependent Coronary Relaxation in Isolated Perfused Hearts from Spontaneously Hypertensive Ovariectomized Rats

    Science.gov (United States)

    Delgado, Nathalie T. B.; Rouver, Wender do N.; Freitas-Lima, Leandro C.; de Paula, Tiago D.-C.; Duarte, Andressa; Silva, Josiane F.; Lemos, Virgínia S.; Santos, Alexandre M. C.; Mauad, Helder; Santos, Roger L.; Moysés, Margareth R.

    2017-01-01

    Decline in estrogen levels promotes endothelial dysfunction and, consequently, the most prevalent cardiovascular diseases in menopausal women. The use of natural therapies such as pomegranate can change these results. Pomegranate [Punica granatum L. (Punicaceae)] is widely used as a phytotherapeutic agent worldwide, including in Brazil. We hypothesized that treatment with pomegranate hydroalcoholic extract (PHE) would improve coronary vascular reactivity and cardiovascular parameters. At the beginning of treatment, spontaneously hypertensive female rats were divided into Sham and ovariectomized (OVX) groups, which received pomegranate extract (PHE) (250 mg/kg) or filtered water (V) for 30 days by gavage. Systolic blood pressure was measured by tail plethysmography. After euthanasia, the heart was removed and coronary vascular reactivity was assessed by Langendorff retrograde perfusion technique. A dose-response curve for bradykinin was performed, followed by L-NAME inhibition. The protein expression of p-eNOS Ser1177, p-eNOS Thr495, total eNOS, p-AKT Ser473, total AKT, SOD-2, and catalase was quantified by Western blotting. The detection of coronary superoxide was performed using the protocol of dihydroethidium (DHE) staining Plasma nitrite measurement was analyzed by Griess method. Systolic blood pressure increased in both Sham-V and OVX-V groups, whereas it was reduced after treatment in Sham-PHE and OVX-PHE groups. The baseline coronary perfusion pressure was reduced in the Sham-PHE group. The relaxation was significantly higher in the treated group, and L-NAME attenuated the relaxation in all groups. The treatment has not changed p-eNOS (Ser1177), total eNOS, p-AKT (Ser473) and total AKT in any groups. However, in Sham and OVX group the treatment reduced the p-eNOS (Thr495) and SOD-2. The ovariectomy promoted an increasing in the superoxide anion levels and the treatment was able to prevent this elevation and reducing oxidative stress. Moreover, the treatment

  2. Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

    Science.gov (United States)

    Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

    2017-09-29

    The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

  3. Large coronary intramural hematomas

    DEFF Research Database (Denmark)

    Antonsen, Lisbeth; Thayssen, Per; Jensen, Lisette Okkels

    2015-01-01

    Isolated spontaneous coronary intramural hematoma is a unique subset of spontaneous coronary artery dissection that is characterized by a hemorrhage limited to the medial-adventitial layers, causing subsequent hematoma formation without visible intimal flaps. It is an infrequent and serious...... diagnostics and treatment strategy. Coronary intramural hematomas can also occur iatrogenically, as a complication to percutaneous coronary intervention (PCI). Coronary angiography (CAG) has limited diagnostic value in the absence of intimal dissections, and lesions are often angiographically ambiguous....... Intravascular ultrasound (IVUS) is an important diagnostic tool in establishing the correct diagnosis, as it provides a complete vessel wall assessment, and enables morphometric information regarding the magnitude and severity of the underlying hematoma. Due to the rarity of this clinical scenario...

  4. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.

    1985-01-01

    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  5. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  6. Anatomy of Atrioventricular Node Artery and Pattern of Dominancy in Normal Coronary Subject: A Comparison between Individuals with and without Isolated Right Bundle Branch Block.

    Science.gov (United States)

    Kazemisaeid, Ali; Pakbaz, Marziyeh; Yaminisharif, Ahmad; Davoodi, Gholamreza; Lotfi Tokaldany, Masoumeh; Hakki Kazazi, Elham

    2012-11-01

    Isolated right bundle branch block (RBBB) is a common finding in the general population. The atrioventricular node (AVN) artery contributes to the blood supply of the right bundle branch. Our hypothesis was that the anatomy of the AVN artery and the pattern of dominancy differ between subjects with and without RBBB. We retrospectively studied the coronary angiography of 92 patients with RBBB and 184 age- and gender-matched controls without RBBB. All the subjects had angiographically proven normal coronary arteries. The dominant circulation and precise origin of the AVN artery were determined in each subject. Obtained data were compared between the two study groups. There was no significant difference between the two groups in terms of dominancy (p value = 0.200). Origination of the AVN artery from the right circulatory system was more common in both groups, but this pattern was more prevalent in the cases than in the controls (p value = 0.021). There was a great variation of the AVN artery origin. In the total study population, the AVN artery was more commonly separated from a non crux origin than from the crux area. The prevalence of the non-crux origination of the AVN artery was significantly higher in the cases than in the controls (p value AVN artery from the right circulatory system was more common in both groups, the prevalence of the right origin of the AVN artery was significantly higher in the cases than in the controls. We observed that the AVN artery most commonly originated from the dominant artery but not necessarily from the crux. The anatomy of the AVN artery but not the pattern of dominancy is somewhat different in subjects with RBBB compared with normal individuals.

  7. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  8. Ultrastructural study of the mycelial phase of clinical isolates of Sporothrix schenckii obtained from feline, canine and human cases of sporotrichosis

    Directory of Open Access Journals (Sweden)

    Isabel Martins Madrid

    2011-09-01

    Full Text Available Using transmission electron microscopy, we studied the presence of melanin and cell wall thickness of clinical isolates of Sporothrix schenckii obtained from cats, dogs and humans as compared to reference strains. We detected differences regarding presence of the melanin among the clinical isolates of S. schenckii and a correlation between presence of melanin and cell wall thickness.

  9. Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

    Science.gov (United States)

    Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

    2004-10-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

  10. Isolation and characterization of canine parvovirus type 2c circulating in Uruguay Isolamento e caracterização da cepa tipo 2c do parvovirus canino circulante no Uruguai

    Directory of Open Access Journals (Sweden)

    Andrea Blanc Pintos

    2011-08-01

    Full Text Available This research reports the first CPV-2c isolation in cell culture (canine fibroma cell line A-72 in Uruguay. The isolates were obtained from 13 rectal swabs of Uruguayan dogs with parvovirosis. Samples were submitted to PCR with two sets of primers, restriction fragment length polymorphism (RFLP, partial sequencing of the gene encoding for VP2 capsid protein and phylogenetic characterization. The strain isolated was confirmed as CPV-2c. These results contribute to a better knowledge of CPV strains circulating in Uruguay and promote an evaluation of the efficacy of heterologous vaccines used to protect against the circulating strains.Este trabalho relata o primeiro isolamento do CPV-2c em cultura de células (linhagem celular de fibroma canino A-72, no Uruguai. Os isolados foram obtidos a partir de 13 suabes retais de cães uruguaios com parvovirose. As amostras foram submetidas à reação em cadeia da polimerase (PCR com dois pares de primers, polimorfismo de comprimento de fragmentos de restrição (RFLP, sequenciamento parcial do gene que codifica a proteína capsidial VP2 e caracterização filogenética. A cepa isolada foi confirmada como CPV-2c. Os resultados contribuem para um melhor conhecimento das cepas do CPV circulantes no Uruguai e incitam uma maior investigação sobre a eficácia das vacinas produzidas com cepas heterólogas utilizadas atualmente para proteger contra cepas circulantes.

  11. Great heterogeneity of commercial fruit juices to induce endothelium-dependent relaxations in isolated porcine coronary arteries: role of the phenolic content and composition.

    Science.gov (United States)

    Auger, Cyril; Pollet, Brigitte; Arnold, Cécile; Marx, Céline; Schini-Kerth, Valérie B

    2015-01-01

    Since polyphenol-rich products such as red wine, grape juice, and grape extracts have been shown to induce potent endothelium-dependent relaxations, we have evaluated whether commercial fruit juices such as those from berries are also able to induce endothelium-dependent relaxations of isolated coronary arteries and, if so, to determine whether this effect is related to their phenolic content. Among the 51 fruit juices tested, 2/12 grape juices, 3/7 blackcurrant juices, 4/5 cranberry juices, 1/6 apple juices, 0/5 orange juices, 2/6 red fruit and berry juices, 3/6 blends of red fruit juices, and 0/4 non-red fruit juices were able to induce relaxations achieving more than 50% at a volume of 1%. The active fruit juices had phenolic contents ranging from 0.31 to 1.86 g GAE/L, which were similar to those of most of the less active juices with the exception of one active grape juice (2.14 g GAE/L) and one active blend of red fruit juices (3.48 g GAE/L). Altogether, these findings indicate that very few commercial fruit juices have the ability to induce potent endothelium-dependent relaxations, and that this effect is not related to their quantitative phenolic content, but rather to their qualitative phenolic composition.

  12. Is social isolation/alienation confounded with, and non-independent of, emotional distress in its association with early onset of coronary artery disease?

    Science.gov (United States)

    Ketterer, Mark; Rose, Benjamin; Knysz, Walter; Farha, Amjad; Deveshwar, Sangita; Schairer, John; Keteyian, Steven J

    2011-03-01

    Both emotional distress (ED) and social isolation/alienation (SI/A) have been found to prospectively predict adverse cardiac events, but few studies have tested the confounding/redundancy of these measures as correlates/predictors of outcomes. In this study, 163 patients with documented coronary artery disease (CAD) were interviewed for multiple indices of SI/A and administered the Symptom Checklist 90 - Revised (SCL90R). A spouse or friend provided an independent rating of ED using the spouse/friend version of the Ketterer Stress Symptom Frequency Checklist (KSSFC). The measures of ED and SI/A covaried. All three scales from the KSSFC (depression, anxiety, and "AIAI" - aggravation, irritation, anger, and impatience), and three scales from the SCL90R (anxiety, depression, and psychoticism), were associated with early Age at Initial Diagnosis (AAID) of CAD. Neither three scales derived from the SCL90R (shyness, feeling abused, and feeling lonely) nor the interview indices of SI/A (married, living alone, having a confidant, self description as a lone wolf, and self-description as lonely) were associated with early AAID. Thus, it is concluded that the present results indicate that ED and SI/A are confounded and that, even when tested head-to-head in a multivariate analysis, only ED is associated with AAID.

  13. Preoperative factors affecting cost and length of stay for isolated off-pump coronary artery bypass grafting: hierarchical linear model analysis.

    Science.gov (United States)

    Shinjo, Daisuke; Fushimi, Kiyohide

    2015-11-17

    To determine the effect of preoperative patient and hospital factors on resource use, cost and length of stay (LOS) among patients undergoing off-pump coronary artery bypass grafting (OPCAB). Observational retrospective study. Data from the Japanese Administrative Database. Patients who underwent isolated, elective OPCAB between April 2011 and March 2012. The primary outcomes of this study were inpatient cost and LOS associated with OPCAB. A two-level hierarchical linear model was used to examine the effects of patient and hospital characteristics on inpatient costs and LOS. The independent variables were patient and hospital factors. We identified 2491 patients who underwent OPCAB at 268 hospitals. The mean cost of OPCAB was $40 665 ±7774, and the mean LOS was 23.4±8.2 days. The study found that select patient factors and certain comorbidities were associated with a high cost and long LOS. A high hospital OPCAB volume was associated with a low cost (-6.6%; p=0.024) as well as a short LOS (-17.6%, pcost and LOS. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  14. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  15. SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

    Science.gov (United States)

    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

    2017-10-01

    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  16. Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

    Science.gov (United States)

    Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2005-01-01

    A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

  17. The minimum coronary artery diameter in which coronary spasm can be identified by synchrotron radiation coronary angiography

    International Nuclear Information System (INIS)

    Matsushita, Shonosuke; Hyodo, Kazuyuki; Imazuru, Tomohiro; Tokunaga, Chiho; Sato, Fujio; Enomoto, Yoshiharu; Hiramatsu, Yuji; Sakakibara, Yuzuru

    2008-01-01

    Background: Coronary vasospasm is defined as a temporary, intense narrowing of the coronary conduit artery. It brings about ischemic chest pain and becomes one of the causes of myocardial infarction. Coronary spasms are divided into two categories. One is the coronary spasm of the conduit artery and the other is the coronary microvascular spasm. Although coronary spasms are diagnosed with the images of coronary angiography, microvascular spasms cannot be diagnosed because of the limitations of conventional angiographic systems. However, synchrotron radiation coronary angiography (SRCA) can identify coronary arteries down to 100 μm in diameter in the beating heart and 50 μm in arrested heart. Aim: The purpose of this study was to confirm whether microvascular spasms could be identified or not using SRCA, and then down that size identification was possible. Methods: The Langendorff perfusion system with isolated rat hearts was employed. Krebs-Henseleit solution (KH solution) was used as a perfusate. 10 mM of 4-aminopyridine (4-AP: a voltage-gated potassium channel blocker; spasm inducer) was added to the KH solution and maintained for 5 min. SRCA was performed at pre-, during and 10 min after cessation of the KH solution with 4-AP. Coronary spasms were defined as a temporal 75% reduction of coronary arterial diameter. Results and conclusion: Multiple sizes of coronary arteries showed coronary spasms. The minimum stenosed coronary artery size was 100 μm. Since coronary microvascular spasms are seen in the arterioles (50-400 μm), coronary microvascular spasms may be diagnosed with the use of synchrotron radiation coronary angiography

  18. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  19. Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

    Directory of Open Access Journals (Sweden)

    Mehdi Mohebali

    2016-10-01

    Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

  20. Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology.

    Science.gov (United States)

    Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M

    2017-07-20

    We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

  1. High-fat diet-induced insulin resistance does not increase plasma anandamide levels or potentiate anandamide insulinotropic effect in isolated canine islets.

    Science.gov (United States)

    Woolcott, Orison O; Richey, Joyce M; Kabir, Morvarid; Chow, Robert H; Iyer, Malini S; Kirkman, Erlinda L; Stefanovski, Darko; Lottati, Maya; Kim, Stella P; Harrison, L Nicole; Ionut, Viorica; Zheng, Dan; Hsu, Isabel R; Catalano, Karyn J; Chiu, Jenny D; Bradshaw, Heather; Wu, Qiang; Kolka, Cathryn M; Bergman, Richard N

    2015-01-01

    Obesity has been associated with elevated plasma anandamide levels. In addition, anandamide has been shown to stimulate insulin secretion in vitro, suggesting that anandamide might be linked to hyperinsulinemia. To determine whether high-fat diet-induced insulin resistance increases anandamide levels and potentiates the insulinotropic effect of anandamide in isolated pancreatic islets. Dogs were fed a high-fat diet (n = 9) for 22 weeks. Abdominal fat depot was quantified by MRI. Insulin sensitivity was assessed by the euglycemic-hyperinsulinemic clamp. Fasting plasma endocannabinoid levels were analyzed by liquid chromatography-mass spectrometry. All metabolic assessments were performed before and after fat diet regimen. At the end of the study, pancreatic islets were isolated prior to euthanasia to test the in vitro effect of anandamide on islet hormones. mRNA expression of cannabinoid receptors was determined in intact islets. The findings in vitro were compared with those from animals fed a control diet (n = 7). Prolonged fat feeding increased abdominal fat content by 81.3±21.6% (mean±S.E.M, Pcanines, high-fat diet-induced insulin resistance does not alter plasma anandamide levels or further potentiate the insulinotropic effect of anandamide in vitro.

  2. Ultrasonographic evaluation of the canine shoulder.

    Science.gov (United States)

    Long, C D; Nyland, T G

    1999-01-01

    The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

  3. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  4. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  5. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  6. Compensatory canine angulation in angle Class II and III patients

    Directory of Open Access Journals (Sweden)

    Mauro Carlos Agner Busato

    2009-09-01

    Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

  7. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

    1996-01-01

    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  8. Molecular characterisation of canine parvovirus strains circulating in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...

  9. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  10. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  11. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  12. Ecology of genus Porphyromonas in canine periodontal disease.

    Science.gov (United States)

    Isogai, H; Kosako, Y; Benno, Y; Isogai, E

    1999-09-01

    Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

  13. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  14. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  15. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  16. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

  17. Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Cintia Xavier de Mello

    2014-12-01

    Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

  18. Single Coronary Artery with Aortic Regurgitation

    International Nuclear Information System (INIS)

    Katsetos, Manny C.; Toce, Dale T.

    2003-01-01

    An isolated single coronary artery can be associated with normal life expectancy; however, patients are at an increased risk of sudden death. A case is reported of a 54-year-old man with several months of chest pressure with activity. On exercise Sestamibi stress testing, the patient developed a hypotensive response with no symptoms and minimal electrocardiographic changes. Nuclear scanning demonstrated reversible septal and lateral perfusion defects consistent with severe ischemia. Coronary angiography revealed a single coronary artery with the right coronary artery arising from the left main. There were high-grade stenotic lesions in the left anterior descending and circumflex arteries with only moderate atherosclerotic disease in the right coronary artery. An aortogram showed 2-3+ aortic regurgitation, with an ejection fraction of 45% on ventriculography. The patient underwent four-vessel revascularization and aortic valve replacement and did well postoperatively

  19. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  20. Distinct fermentation and antibiotic sensitivity profiles exist in salmonellae of canine and human origin.

    Science.gov (United States)

    Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C

    2018-02-26

    Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.

  1. Purification and partial characterization of canine S100A12.

    Science.gov (United States)

    Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

    2010-12-01

    Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

  2. Clinical correlations, lactate extraction, coronary venous bloodflow and Thallium-201 myocardial imaging in patients with isolated left anterior descending muscle brigdes: Normal variant or obstruction

    International Nuclear Information System (INIS)

    Voss, H.; Kupper, W.; Hanrath, P.; Mathey, D.; Montz, R.; Buecking, J.; Hamburg Univ.; Hamburg Univ.

    1980-01-01

    In 848 coronary arteriograms performed in a two-years period 21 patients (2.5%) showed a myocardial bridging of the left anterior descending artery. Resting- and/or stress-ECG were abnormal in half of the patients. Regional lactate-metabolism measured in the great cardiac vein at rest and during maximal atrial pacing was normal (29 +- 12 resp. 24 +- 9%). Thermodilution of great cardiac vein bloodflow at rest and during atrial pacing also demonstrated normal values (94 +- 33 resp. 138 +- 30 ml/min). Biphasic 201-Thallium myocardial imaging revealed no case of reversible perfusion defect, but surprisingly frequent (5 of 16 patients) clearly irreversible defects limited to the interventricular septum. We conclude that muscle bridges do not cause myocardial ischemia at rest or during exercice. (orig.) [de

  3. Sleep disturbance and longitudinal risk of inflammation: Moderating influences of social integration and social isolation in the Coronary Artery Risk Development in Young Adults (CARDIA) study.

    Science.gov (United States)

    Cho, Hyong Jin; Seeman, Teresa E; Kiefe, Catarina I; Lauderdale, Diane S; Irwin, Michael R

    2015-05-01

    Both sleep disturbance and social isolation increase the risk for morbidity and mortality. Systemic inflammation is suspected as a potential mechanism of these associations. However, the complex relationships between sleep disturbance, social isolation, and inflammation have not been examined in a population-based longitudinal study. This study examined the longitudinal association between sleep disturbance and systemic inflammation, and the moderating effects of social isolation on this association. The CARDIA study is a population-based longitudinal study conducted in four US cities. Sleep disturbance - i.e., insomnia complaints and short sleep duration - was assessed in 2962 African-American and White adults at baseline (2000-2001, ages 33-45years). Circulating C-reactive protein (CRP) was measured at baseline and follow-up (2005-2006). Interleukin-6 (IL-6) and subjective and objective social isolation (i.e., feelings of social isolation and social network size) were measured at follow-up. Sleep disturbance was a significant predictor of inflammation five years later after full adjustment for covariates (adjusted betas: 0.048, P=0.012 for CRP; 0.047, P=0.017 for IL-6). Further adjustment for baseline CRP revealed that sleep disturbance also impacted the longitudinal change in CRP levels over five years (adjusted beta: 0.044, P=0.013). Subjective social isolation was a significant moderator of this association between sleep disturbance and CRP (adjusted beta 0.131, P=0.002). Sleep disturbance was associated with heightened systemic inflammation in a general population over a five-year follow-up, and this association was significantly stronger in those who reported feelings of social isolation. Clinical interventions targeting sleep disturbances may be a potential avenue for reducing inflammation, particularly in individuals who feel socially isolated. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. [Surgical angioplasty of the left main coronary artery].

    Science.gov (United States)

    Vranes, Mile; Velinović, Milos; Kocica, Mladen; Mikić, Aleksandar; Velimirović, Dusan; Djukić, Petar

    2010-01-01

    The conventional treatment for isolated stenosis of the left main coronary artery is bypass surgery (myocardial revascularization). However, the process of atherosclerosis is not arrested by myocardial revascularization and it will lead to the occlusion of the left main coronary artery. Revascularization will establish retrograde perfusion for 50-70% of the myocardium of the left ventricle. Direct surgical angioplasty of the left main coronary artery enables normal physiological perfusion of the whole myocardium and better myocardial function. The aim of our study is to point out a new surgical approach of treating left main coronary artery stenosis. Between October 2002 and October 2003, direct surgical angioplasty of the main left coronary artery was performed on three patients with isolated stenosis of the left main coronary artery using the anterior approach and the pericardium as a patch. The procedure was performed under total endotracheal anaesthesia and standard cardiopulmonary circulation, moderate hypothermia, anterograde St. Tomas cardioplegia and local cooling. Patients were followed clinically, echocardiographically and by load-tests. All three patients were without complications. In postoperative follow-up (54-68 months) neither angina pectoris nor electrocardiographically registered ischaemic changes were found. Load-tests performed every six months on all three patients were negative. Surgical angioplasty of isolated stenosis of the left main coronary artery is a preferred method for treating this type of coronary disease. Contraindications for this type of treatment are stenosis of the left main coronary artery with bifurcation and advanced calcification of the left main coronary artery.

  5. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  6. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  7. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  8. A randomized clinical study of two interceptive approaches to palatally displaced canines.

    Science.gov (United States)

    Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

    2008-08-01

    This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

  9. Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

    Science.gov (United States)

    Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

    2011-10-01

    The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

  10. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  11. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  12. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  13. Effect of Japanese Green Tea Extract on Canine Periodontal Diseases

    OpenAIRE

    Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.

    2011-01-01

    Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

  14. Posttraumatic Stress Disorder Disturbs Coronary Tone and Its Regulatory Mechanisms.

    Science.gov (United States)

    Lazuko, Svetlana S; Kuzhel, Olga P; Belyaeva, Lyudmila E; Manukhina, Eugenia B; Fred Downey, H; Tseilikman, Olga B; Komelkova, Maria V; Tseilikman, Vadim E

    2018-01-01

    Posttraumatic stress disorder (PTSD) is associated with myocardial injury, but changes in coronary regulatory mechanisms in PTSD have not been investigated. This study evaluated the effect of PTSD-inducing stress on coronary tone and its regulation by nitric oxide (NO) and voltage-gated K + channels. PTSD was induced by exposing rats to predator stress, 15 min daily for 10 days, followed by 14 stress-free days. Presence of PTSD was confirmed by the elevated plus-maze test. Coronary tone was evaluated from changes in coronary perfusion pressure of Langendorff isolated hearts. Predator stress induced significant decreases in coronary tone of isolated hearts and in blood pressure of intact rats. L-NAME, a non-selective NO synthase (NOS) inhibitor, but not S-MT, a selective iNOS inhibitor, and increased coronary tone of control rats. In PTSD rats, both L-NAME and S-MT increased coronary tone. Therefore, the stress-induced coronary vasodilation resulted from NO overproduction by both iNOS and eNOS. NOS induction was apparently due to systemic inflammation as evidenced by increased serum interleukin-1β and C-reactive protein in PTSD rats. Decreased corticosterone in PTSD rats may have contributed to inflammation and its effect on coronary tone. PTSD was also associated with voltage-gated K + channel dysfunction, which would have also reduced coronary tone.

  15. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  16. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  17. The morbidity and mortality outcomes of indigenous Australian peoples after isolated coronary artery bypass graft surgery: the influence of geographic remoteness.

    Science.gov (United States)

    Prabhu, Anil; Tully, Phillip J; Bennetts, Jayme S; Tuble, Sigrid C; Baker, Robert A

    2013-08-01

    Though Indigenous Australian peoples reportedly have poorer survival outcome after cardiac surgery, few studies have jointly documented the experience of major morbidity, and considered the influence of patient geographic remoteness. From January 1998 to September 2008, major morbidity events and survival were recorded for 2748 consecutive patients undergoing coronary artery bypass graft surgery. Morbidity and survival analyses adjusted for propensity deciles based on patient ethnicity and age, sex, left ventricular ejection fraction, recent myocardial infarction, tobacco smoking, diabetes, renal disease and history of stroke. Sensitivity analyses controlled for the patient accessibility/remoteness index of Australia (ARIA). The 297 Indigenous Australian patients (10.8% of total) had greater odds for total morbidity (adjusted odds ratio = 1.55; 95% confidence interval [CI] 1.04-2.30) and prolonged ventilation (adjusted odds ratio = 2.08; 95% confidence interval [CI] 1.25-3.44) in analyses adjusted for propensity deciles and geographic remoteness. With a median follow-up of 7.5 years (interquartile range 5.2-10.2), Indigenous Australian patients were found to experience 30% greater mortality risk (unadjusted hazard ratio = 1.30; 95% CI: 1.03-1.64, p = 0.03). The effect size strengthened after adjustment for propensity score (adjusted hazard ratio = 1.49; 95% CI: 1.13-1.96, p = .004). Adjustment for ARIA categorisation strengthened the effect size (adjusted HR = 1.54 (95% CI: 1.11-2.13, p = .009). Indigenous Australian peoples were at greater risk for prolonged ventilation and combined morbidity outcome, and experienced poorer survival in the longer term. Higher mortality risk among Indigenous Australians was evident even after controlling for remoteness and accessibility to services. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  18. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  19. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  20. Integral diagnosis of coronary atherosclerosis by coronary multidetector computed tomography and by invasive coronary angiography

    International Nuclear Information System (INIS)

    Llerena Rojas, Luis Roberto; Llerena Rojas, Lorenzo D; Mendoza Rodriguez, Vladimir

    2013-01-01

    Coronary angiography by multidetector computed tomography (CMDCT) visualizes the wall and lumen of coronary arteries. Invasive coronary angiography (INVCA) only visualizes the arterial lumen but with better resolution

  1. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  2. Two-dimensional aortographic coronary angiography with synchrotron radiation at aortic regurgitation state

    Science.gov (United States)

    Takeda, Tohoru; Umetani, Keiji; Doi, Toshiki; Itai, Yuji; Yu, Quanwen; Akatsuka, Takao

    1999-10-01

    At aortic regurgitation state, 2D synchrotron radiation (SR) coronary arteriography (CAG) with aortographic contrast injection was examined theoretically and animal experiments were performed to confirm its diagnostic ability. This system consisted of a silicon monocrystal, fluorescent plate, avalanche-type pickup tube camera, and image acquisition system. The experiment was performed at synchrotron sources in the Photon Factory of Tsukuba. The x- ray energy was adjusted to just above the iodine K-edge. Theoretical calculation described that the coronary arteries overlapping on left ventricle could not be demonstrated well with a high signal-to-noise ratio by using the aortographic CAG with SR. The canine coronary arteries without overlap over the left ventricle were demonstrated clearly, however, the image quality appear to be reduced. The coronary artery overlapping over left ventricle could not be demonstrated well, however the transient reduction of left ventricular wall motion was revealed by transient stenotic procedure of left anterior descending coronary artery.

  3. Safety of Perioperative Aprotinin Administration During Isolated Coronary Artery Bypass Graft Surgery: Insights From the ART (Arterial Revascularization Trial).

    Science.gov (United States)

    Benedetto, Umberto; Altman, Douglas G; Gerry, Stephen; Gray, Alastair; Lees, Belinda; Angelini, Gianni D; Flather, Marcus; Taggart, David P

    2018-03-03

    There is still uncertainty about the safety of aprotinin for coronary artery bypass graft surgery. The ART (Arterial Revascularization Trial) was designed to compare survival after bilateral versus single internal thoracic artery grafting. Many of the ART patients (≈30%) received perioperative aprotinin. We investigated the association between perioperative aprotinin administration and short-term (in-hospital) and long-term outcomes by performing a post hoc analysis of the ART. Among patients enrolled in the ART (n=3102) from 2004 to 2007, we excluded those who did not undergo surgery (n=18) and those with no information about use of perioperative aprotinin (n=9). Finally, 836 of 3076 patients (27%) received aprotinin. Propensity matching was used to select 536 pairs for final comparison. Aprotinin was also associated with an increased risk of hospital mortality (9 [1.7%] versus 1 [0.2%]; odds ratio, 9.12; 95% confidence interval [CI], 1.15-72.2; P =0.03), intra-aortic balloon pump insertion (37 [6.9%] versus 17 [3.2%]; odds ratio, 2.26; 95% CI, 1.26-4.07; P =0.006), and acute kidney injury (102 [19.0%] versus 76 [14.2%]; odds ratio, 1.42; 95% CI, 1.03-1.97; P =0.03). Aprotinin was not associated with a lower incidence of transfusion (37 [6.9%] versus 28 [5.2%]; odds ratio, 1.34; 95% CI, 0.81-2.23; P =0.25) and reexploration (26 [4.9%] versus 19 [3.5%]; hazard ratio, 1.39; 95% CI, 0.76-2.53; P =0.28). At 5 years, all-cause mortality was significantly increased in the aprotinin group (56 [10.6%] versus 38 [7.3%]; hazard ratio, 1.51; 95% CI, 1.0-2.28; P =0.045). In the present post hoc ART analysis, aprotinin was associated with a significantly increased risk of early and late mortality. URL: http://www.isrctn.com. Unique identifier: ISRCTN46552265. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  4. Special features of sleep disorders and depressive disturbances in patients with isolated gastroesophageal reflux disease and in conjunction with coronary artery disease

    Directory of Open Access Journals (Sweden)

    Галина Дмитриевна Фадеенко

    2015-10-01

    Full Text Available Aim – to study the special features of sleep disorders and depression intensity in patients with gastroesophageal reflux disease (GERD and GERD in conjunction with coronary artery disease (CAD by the method of questionnaire and to compare results with clinical and functional manifestations of comorbidity.Methods. There were examined 65 patients with GERD and CAD (group 1 and 29 patients with GERD (group 2. Sleep disorders and depression were studied using questionnaires: subjective sleep characteristics (SSC, (Epworth Sleepiness Scale (ESS,Beck scale for depression (BSD.Results. Sleep disorders took place in 41 (61,54 % patients from group 1 and 13 (44,83 % patients from group 2. The mean point of SSC was 17,75±1,98 in group 1 opposite to18,59±1,12 in group 2 (p= 0,043. The mean point of ESS was 9,75±1,59 in group 1opposite to 9,24±1,18 in group 2, p=0,103. The mean point of BDS was 11,89±4,38 in group 1opposite to 8,86±1,30 in group 2, p= 0,004. In the group 1 it was established a correlation between SSC and patient’s age (r=- 0320; p=0,0075, BSD and age (r=0,371; p=0,0024, ESS and body mass index(r=0,291; p=0,0188. There were established correlations between duration of CAD and SSC (r=-0,315; p=0,011, CAD and ESS (r=0,273; p=0,0280, CAD and BSD (r=0,379; p=0,0018, GERD heaviness and SSC (p=0,0498, BSD and SSC (r= - 0,676; p=0,000 and between BSD and ESS (r=0,583; p=0,000 in group 1. In group 2 ESS correlated with age (r=0,379; p=0,0426.Conclusions. The conjunction of GERD and CAD can be considered as two mutually potential pathological processes that have a negative effect on such indicators as sleep and psycho-emotional status of patient

  5. [Multiple coronary arteriovenous fistulae. Hazard or predetermination?].

    Science.gov (United States)

    Rangel, Alberto; Muñoz-Castellanos, Luis; Solorio, Sergio

    2003-01-01

    The authors present the clinical cases of three adult patients (49, 53 and 61 year-old), with rheumatic cardiac valvulopathy, and bilateral coronary arteriovenous fistulae draining in the main pulmonary artery. Based on documental investigation, the authors speculate about the predeterminate origin of coronary arteriovenous fistulae. At first glance, it seems obvious that congenital cardiopathies occur at random, i.e., embryonic development deviate or stops due to unknown reasons, originating the persistence of lacunar blood spaces prior to the development of coronary arteries cords. There are two factors involved in the genesis of congenital malformations: a genomic preexisting factor and the presence of an environmental precipitating factor, i.e., isolated pulmonary valve atresia or left ventricular hypoplastic syndrome, with mitral and aortic valve stenosis, can predispose development of coronary arteriovenous fistulae. Recently, the question has been raised whether there is a relation of coronary arteries fistulae with: ethnic groups, hereditary gigantism, autoimmune diseases, such as polymyositis, hereditary hemorrhagic telangiectasia, and apical hypertrophic myocardiopathy. Coronary arteriovenous fistulae, as well as some congenital cardiopathies, could be due to chromosome alterations or might be related to hereditary diseases, such as hemorrhagic telangiectasia, induced by a disturbed genetic program. Although, there is no concrete evidence that a genetic factor is related to the development of coronary arteriovenous fistulae, there are signs that suggest that such a possibility could be investigated.

  6. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    International Nuclear Information System (INIS)

    Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

    2011-01-01

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

  7. Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

    2011-03-30

    Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

  8. Canine oral melanoma.

    Science.gov (United States)

    Bergman, Philip J

    2007-05-01

    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  9. Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

    Directory of Open Access Journals (Sweden)

    Kinga Majchrzak

    Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

  10. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  11. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  12. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  13. Coronary heart disease

    Science.gov (United States)

    Heart disease, Coronary heart disease, Coronary artery disease; Arteriosclerotic heart disease; CHD; CAD ... buildup of plaque in the arteries to your heart. This may also be called hardening of the ...

  14. The Duration of Immunity to an Inactivated Adjuvanted Canine Parvovirus Vaccine. A 52 and 64 Week Postvaccination Challenge Study

    OpenAIRE

    Povey, R. C.; Carman, P. S.; Ewert, E.

    1983-01-01

    Dogs were successfully isolated for a period of either 52 or 64 weeks following vaccination with an inactivated, adjuvanted canine parvovirus-2 vaccine. Antibody persisted in all ten vaccinated dogs, although in one case by 52 weeks postvaccination only virus neutralizing antibody, and not hemagglutination-inhibiting antibody, could be detected. Sentinel unvaccinated dogs housed alongside the vaccinated dogs throughout the study remained free of canine parvovirus-2 antibody until challenged. ...

  15. Canine and feline colostrum.

    Science.gov (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H

    2017-04-01

    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  16. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  17. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  18. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  19. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  20. Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

    Science.gov (United States)

    Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

    1976-01-01

    Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

  1. First complete genome sequence of canine bocavirus 2 in mainland China

    Directory of Open Access Journals (Sweden)

    S.-L. Zhai

    2017-07-01

    Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

  2. Differential effects of the transient outward K(+) current activator NS5806 in the canine left ventricle

    DEFF Research Database (Denmark)

    Calloe, Kirstine; Soltysinska, Ewa; Jespersen, Thomas

    2009-01-01

    To examine the electrophysiological and molecular properties of the transient outward current (I(to)) in canine left ventricle using a novel I(to) activator, NS5806, I(to) was measured in isolated epicardial (Epi), midmyocardial (Mid) and endocardial (Endo) cells using whole-cell patch-clamp tech...

  3. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  4. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  5. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  6. First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh

    DEFF Research Database (Denmark)

    Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh

    2016-01-01

    AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...

  7. Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets

    Science.gov (United States)

    Kilham, L.; Habermann, R.T.; Herman, C.M.

    1956-01-01

    1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.

  8. Substrate use in ischemic and reperfused canine myocardium: quantitative considerations

    International Nuclear Information System (INIS)

    Myears, D.W.; Sobel, B.E.; Bergmann, S.R.

    1987-01-01

    The patterns of use of substrate in reperfused myocardium are not yet well elucidated, and their delineation is essential for adequate interpretation of results of analyses performed after positron emission tomography with labeled substrates to differentiate normal from abnormal heart muscle. Accordingly, in open-chest, anesthetized dogs the authors measured glucose and fatty acid utilization in normal, ischemic, and reperfused myocardium and assessed the contributions of metabolism of each substrate to overall oxidative metabolism. Intracoronary [ 3 H]glucose and [ 14 C]palmitate were administered in five control dogs, eight dogs subjected to 1 h of coronary occlusion, and nine dogs subjected to reperfusion after 1 h of ischemia. Regional coronary venous blood samples were assayed sequentially. In reperfused myocardium, utilization of glucose was 103% greater than that in ischemic and 273% greater than in normal myocardium. Utilization of fatty acid during reperfusion, although greater than that in ischemic myocardium, was significantly less than that in normal myocardium despite restoration of flow to 80% of control values. Despite diminished net uptake of fatty acid, oxidation of fatty acid accounted for 63% of total oxygen consumption in reperfused myocardium. These studies indicate that canine myocardium reperfused after 1 h of ischemia exhibits enhanced uptake of glucose and impaired utilization of palmitate. Nevertheless, palmitate continues to comprise the substrate primarily utilized for oxidative metabolism

  9. Cryopreservation of microencapsulated canine sperm.

    Science.gov (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

    2011-03-01

    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  11. A monograph proposing the use of canine mammary tumours as a model for the study of hereditary breast cancer susceptibility genes in humans.

    Science.gov (United States)

    Goebel, Katie; Merner, Nancy D

    2017-05-01

    Canines are excellent models for cancer studies due to their similar physiology and genomic sequence to humans, companion status and limited intra-breed heterogeneity. Due to their affliction to mammary cancers, canines can serve as powerful genetic models of hereditary breast cancers. Variants within known human breast cancer susceptibility genes only explain a fraction of familial cases. Thus, further discovery is necessary but such efforts have been thwarted by genetic heterogeneity. Reducing heterogeneity is key, and studying isolated human populations have helped in the endeavour. An alternative is to study dog pedigrees, since artificial selection has resulted in extreme homogeneity. Identifying the genetic predisposition to canine mammary tumours can translate to human discoveries - a strategy currently underutilized. To explore this potential, we reviewed published canine mammary tumour genetic studies and proposed benefits of next generation sequencing canine cohorts to facilitate moving beyond incremental advances.

  12. Molecular characterization of canine parvovirus in Vientiane, Laos.

    Science.gov (United States)

    Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn

    2017-05-01

    The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.

  13. Escherichia coli : host interactions in the pathogenesis of canine pyometra

    OpenAIRE

    Henriques, Sofia Correia Rosa de Barros

    2016-01-01

    Tese de Doutoramento em Ciências Veterinárias na Especialidade de Ciências Biológicas e Biomédicas Canine pyometra develops as a result of a complex interaction of etiological and physiopathological factors, such as the virulence and type of the bacteria and the individual host defence mechanisms. Since Escherichia coli is the most common bacterium isolated from uterus of bitches with pyometra, one main objective of this work was to characterize E. coli virulence potential, and...

  14. Coronary artery aneurysms

    Energy Technology Data Exchange (ETDEWEB)

    Koischwitz, D.; Harder, T.; Schuppan, U.; Thurn, P.

    1982-04-01

    Seven saccular coronary artery aneurysms have been demonstrated in the course of 1452 selective coronary artery angiograms. In six patients they were arterio-sclerotic; in one patient the aneurysm must have been congenital or of mycotic-embolic origin. The differential diagnosis between true aneurysms and other causes of vascular dilatation is discussed. Coronary artery aneurysms have a poor prognosis because of the possibility of rupture with resultant cardiac tamponade, or the development of thrombo-embolic myocardial infarction. These aneurysms can only be diagnosed by means of coronary angiography and require appropriate treatment.

  15. Indications for coronary angiography

    International Nuclear Information System (INIS)

    Kaltenbach, M.; Vallbracht, C.

    1985-01-01

    Today selective coronary angiography, introduced by Sones in 1957, is used as clinical routine for diagnosing morphological changes in the coronary arteries. Hitherto, more recent techniques such as digital subtraction angiography cannot provide comparable information. Strict criteria for its indication depending on possible therapeutic consequences, have to be applied, although the risk is low with a letality of 0.01 to 0.05 percent. Radionuclear investigations can be used as additional tool in selected cases. The careful indication for coronary angiography usually implies the possible need for coronary bypass graft surgery of balloon angioplasty. (orig./MG) [de

  16. Experimental tumor growth of canine osteosarcoma cell line on chick embryo chorioallantoic membrane (in vivo studies).

    Science.gov (United States)

    Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna

    2017-05-12

    The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.

  17. The administration of a single dose of a multivalent (DHPPiL4R) vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

    OpenAIRE

    Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture

    2014-01-01

    Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...

  18. Molecular epidemiology of canine parvovirus in southern India

    Directory of Open Access Journals (Sweden)

    V. M. Vivek Srinivas,

    2013-08-01

    Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.

  19. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  20. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  1. Proton nuclear magnetic resonance imaging of regionally ischemic canine hearts: effects of paramagnetic proton signal enhancement

    International Nuclear Information System (INIS)

    Brady, T.J.; Goldman, M.R.; Pykett, I.L.; Buonanno, F.S.; Kistler, J.P.; Newhouse, J.H.; Burt, C.T.; Hinshaw, W.S.; Pohost, G.M.

    1982-01-01

    In a study to evaluate the potential of proton nuclear magnetic resonance (NMR) imaging with and without manganese contrast enhancement for detecting acute myocardial infarction, 12 dogs underwent 90-minute occlusion of the left circumflex coronary artery. Transverse-section NMR images of the excised, nonbeating heart were obtained at 1-cm intervals using the steady-state-free-precession (SSFP) technique. All NMR images revealed detailed structure of the heart. The three hearts without manganese showed no difference in intensity between the normal and the ischemic posterior regions, whereas those with manganese demonstrated a clearly demarcated zone of reduced signal intensity consistent with the ischemic zone. It is concluded that high-resolution tomograms of the excised canine myocardium can be obtained using proton NMR imaging. With the SSFP imaging technique, proton signal enhancement with manganese infusion is necessary to differentiate between ischemic and nonischemic myocardium after 90 minutes of coronary occlusion

  2. Spontaneous bacterial coronary sinus septic thrombophlebitis treated successfully medically.

    Science.gov (United States)

    Fournet, Maxime; Behaghel, Albin; Pavy, Carine; Flecher, Erwan; Thebault, Christophe

    2014-03-01

    A 38-year-old farmer was hospitalized for fever, chills, cough, and chest pain lasting for 7 days. Due to persistent symptoms, patient was referred to hospital. Blood cultures identified oxacillin-sensitive Staphylococcus aureus (OSSA). Transthoracic echocardiography (TTE) showed large pericardial effusion, a mobile heterogeneous mass originating from the coronary sinus ostium, no sign of valvular endocarditis. Pericardiocentesis was done carrying out purulent fluid, microbiological culture isolating an OSSA. Parenteral penicillin M was administered for 6 weeks. At the end of this antibiotherapy regimen, TTE showed no coronary sinus mass with complete vacuity of the coronary sinus vein and no pericardial effusion.

  3. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC

    2017-10-01

    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  4. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  5. Canine sporotrichosis: report of 15 advanced cases

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    Full Text Available ABSTRACT: Sporotrichosis is a chronic, granulomatous and usually lymphocutaneous infection of animals and humans, caused by a dimorphic fungus, Sporothrix schenckii complex. The disease in dogs is considered rare, however, in the last years a crescent registration of cases was observed in Brazil, especially in the city of Rio de Janeiro. Fifteen dogs with ulcerated cutaneous lesions were seen at the Dermatology Service in the Small Animal’s Hospital at Universidade Federal Rural do Rio de Janeiro, between January 2014 and October 2015. Most lesions were located on the head, mainly the nose. Lesions were even seen on the chest, disseminated on the body and on the limbs. Three dogs (20% exhibited the cutaneous-lymphatic form, with lesions initially on the distal aspect of one leg and ascending via lymphatics up the leg to the trunk and head. It was not ruled out the disseminated form in at least 3 dogs (20%. They had consistent signs of generalized or disseminated disease exhibiting respiratory symptoms (nasal discharge, sneezing, stertorous breathing, anorexia and weight loss. Draining tracts and cellulitis were very common. Some had large areas of skin necrosis with exposure of muscle and bone. Definitive diagnosis was obtained by cytological examination of exudates, histological examination, and/or isolation of S. schenckii complex by fungal culture. Because of the severity of the lesions that mimic other disorders like neoplasms or autoimmune skin diseases, and due to the difficulties of getting an accurate diagnosis, this study describes 15 advanced cases of canine sporotrichosis.

  6. Cryopreservation of canine ovarian and testicular fibroblasts.

    Science.gov (United States)

    Yu, Il-Jeoung; Leibo, S P; Songsasen, Nucharin; Dresser, Betsy L; Kim, In-Shik

    2009-01-01

    To derive a practical procedure to store canine somatic cells, fibroblasts isolated from testicular or ovarian tissues were cryopreserved in 1.2 M ethylene glycol or in 1.2 M dimethylsulfoxide prepared in Dulbecco's Modified Eagle Medium as cryoprotectants, and were frozen either in plastic straws or vials. Thawed cells were cultured for 24 hr at 38.5 degree C in a humidified atmosphere of 5 percent CO2 95 percent air, and then their membrane integrity was assayed with a double fluorescent stain, Fertilight. In addition, frozen-thawed fibroblasts were cultured for 4 days, and then their functional survival was measured after staining small colonies with trypan blue. After freezing and thawing, membrane integrity of testicular fibroblasts was 55-70 percent and functional survival ranged from 20-40 percent. With frozen-thawed ovarian cells, the average membrane integrity was 55-75 percent and the average functional survival was 35-40 percent. When frozen in ethylene glycol, functional survival of ovarian fibroblasts was significantly higher than that of testicular cells (P less than 0.05). These methods should prove useful to preserve cells collected from canids in the wild.

  7. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  8. Intravascular photoacoustic imaging of human coronary atherosclerosis

    Science.gov (United States)

    Jansen, Krista; van der Steen, Antonius F. W.; Springeling, Geert; van Beusekom, Heleen M. M.; Oosterhuis, J. Wolter; van Soest, Gijs

    2011-03-01

    We demonstrate intravascular photoacoustic imaging of human coronary atherosclerotic plaque. We specifically imaged lipid content, a key factor in vulnerable plaques that may lead to myocardial infarction. An integrated intravascular photoacoustics (IVPA) and ultrasound (IVUS) catheter with an outer diameter of 1.25 mm was developed. The catheter comprises an angle-polished optical fiber adjacent to a 30 MHz single-element transducer. The ultrasonic transducer was optically isolated to eliminate artifacts in the PA image. We performed measurements on a cylindrical vessel phantom and isolated point targets to demonstrate its imaging performance. Axial and lateral point spread function widths were 110 μm and 550 μm, respectively, for PA and 89 μm and 420 μm for US. We imaged two fresh human coronary arteries, showing different stages of disease, ex vivo. Specific photoacoustic imaging of lipid content, is achieved by spectroscopic imaging at different wavelengths between 1180 and 1230 nm.

  9. [Endarterectomy of the coronary arteries].

    Science.gov (United States)

    Fischer, V; Simkovic, I; Holoman, M; Verchvodko, P; Janotík, P; Galbánek, J; Hulman, M; Kostelnicák, J; Jurco, R; Slezák, J

    1992-02-01

    The authors analyze 50 patients with endarterectomy of the coronary arteries during the periods of 1972-1974 and 1988-1990. The results of endarterectomy of the right and left coronary artery provide evidence of its justification in indicated cases whereby contrary to some departments the results of endarterectomy of the left coronary artery are comparable with endarterectomy of the right coronary artery.

  10. Epizootic canine distemper virus infection among wild mammals.

    Science.gov (United States)

    Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken

    2012-01-27

    In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy: A 3-year retrospective investigation

    DEFF Research Database (Denmark)

    Ventrella, G.; Moodley, A.; Grandolfo, E.

    2017-01-01

    In the last decade there has been a rapid global spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) clones displaying multidrug resistance in dogs. We investigated prevalence, antimicrobial susceptibility and clonal distribution of MRSP isolated from clinical canine samples be...

  12. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  13. Selective coronary scintigraphy

    International Nuclear Information System (INIS)

    Gambini, D.-J.

    1975-01-01

    Isotopic techniques occupy a leading place amongst examinations practicable on coronary patients because of their reliability and the safety and simplicity of their use. The present work reviews the possible applications of selective coronary scintigraphy in pathology. After a brief discussion on scintigraphy, isotopic techniques for myocardium research, coronarography and other methods to study local myocardium perfusion the theoretical bases for the use of the exploration are studied, the techniques and methods employed are reported and the results discussed. Coronary scintigraphy consists of selective injection in the two coronary arteries previously catheterized during a coronarography, of two different populations of microspheres labelled with two physically short-lived indicators: 15μ 99m Tc-labelled serumalbumin microspheres, 10 to 15μ In-labelled siderophiline microspheres. Various studies have shown the complete harmlessness of the exploration when certain precautions are taken regarding the size and number of the spheres. The microspheres disperse into the downstream arterial territory proportionally to the number of capillaries present in the different parts of the irrigated region, and are temporarily stopped in the precapillaries. The preparation of the different images needed to interpret the Face and OAG examination for the left coronary, then for the right coronary, is carried out at the end of the coronarography and lasts about 45 minutes. It is also possible by selective injection in the aorta-coronary bridges to judge their functional condition by observation of the regions they irrigate. 56 patients of the Necker hospital cardiological clinic have been examined [fr

  14. Congenital coronary artery fistula

    International Nuclear Information System (INIS)

    Oh, Yeon Hee; Kim, Hong; Zeon, Seoc Kil; Suh, Soo Jhi

    1986-01-01

    Congenital coronary artery fistula (CCAF) is communication of a coronary artery or its main branch with one of the atria or ventricles, the coronary sinus, the superior vena cava, or the pulmonary artery. In Korean peoples, only 4 cases of the CCAF were reported as rare as worldwide and authors want to report another case of CCAF, confirmed by operation. 10-year-old girl shows a fistula between sinus node artery of the right coronary artery and right atrium on root aortogram with left-to-right shunt and Qp/Qs=1.58, in which simple ligation of the sinus node artery from right coronary artery was performed. All of the 5 Korean CCAF (4 were previously reported and 1 of authors) were originated from right coronary artery, and of which 4 were opening into right ventricle and 1 of authors were into right atrium. Associated cardiac anomaly was noted in only 1 case as single coronary artery. Ages were from 9 months of age to 10 years old and no adult left case were found. 3 were female and 2 were male patients.

  15. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  16. Military veterans and canine assistance for post-traumatic stress disorder: A narrative review of the literature.

    Science.gov (United States)

    Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni

    2016-12-01

    Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi

  17. Coronary CT angiography

    Energy Technology Data Exchange (ETDEWEB)

    Dewey, Marc [Charite - Universitaetsmedizin Berlin (Germany). Inst. fuer Radiologie

    2009-07-01

    Coronary CT angiography has attained increasing scientific attention at academic institutions and has become a highly accurate diagnostic modality. Extending this knowledge into a practice setting is the purpose of 'Coronary CT Angiography'. This book will assist you in integrating cardiac CT into your daily practice, while also giving an overview of the current technical status and applications. The specific features of scanners from all four main vendors are also presented providing an objective overview of noninvasive coronary angiography using CT. (orig.)

  18. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.

    1981-01-01

    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  19. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He

    2008-01-01

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  20. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

    Science.gov (United States)

    Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

    2004-10-13

    Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

  1. Acute Coronary Syndrome

    Science.gov (United States)

    ... heart cells are dying. An electrocardiogram (ECG or EKG) can diagnose an acute coronary syndrome by measuring ... Privacy Policy Popular Articles 1 Understanding Blood Pressure Readings 2 Sodium and Salt 3 Heart Attack Symptoms ...

  2. Coronary artery fistula

    Science.gov (United States)

    ... PA: Elsevier Saunders; 2015:chap 84. Friedman AH, Silverman NH. Congenital anomalies of the coronary arteries. In: ... provided by VeriMed Healthcare Network. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the ...

  3. Coronary Artery Disease

    DEFF Research Database (Denmark)

    Christiansen, Morten Krogh

    2017-01-01

    A family history of coronary artery disease (CAD) is an important risk factor for adverse coronary events, in particular if the disease has an early onset. The risk of CAD is influenced by genetic and environmental factors with a greater genetic contribution earlier in life. Through recent years......), and to characterize and quantify subclinical atherosclerosis in their relatives. Furthermore, the aim was to explore the impact of common genetic risk variants on the age of onset, familial clustering and disease severity. In study I, 143 patients with early- onset CAD were recruited from the Western Denmark Heart...... Registry and risk factor control was evaluated. The study revealed that risk factors are common in early-onset CAD and that a large room for risk factor improvement remains. In study II, we used coronary computed tomography angiography to compare the coronary plaque burden and characteristics between 88...

  4. Auxetic coronary stent endoprosthesis

    DEFF Research Database (Denmark)

    Amin, Faisal; Ali, Murtaza Najabat; Ansari, Umar

    2014-01-01

    BACKGROUND: Cardiovascular heart disease is one of the leading health issues in the present era and requires considerable health care resources to prevent it. The present study was focused on the development of a new coronary stent based on novel auxetic geometry which enables the stent to exhibit...... a negative Poisson's ratio. Commercially available coronary stents have isotropic properties, whereas the vascular system of the body shows anisotropic characteristics. This results in a mismatch between anisotropic-isotropic properties of the stent and arterial wall, and this in turn is not favorable...... for mechanical adhesion of the commercially available coronary stents with the arterial wall. It is believed that an auxetic coronary stent with inherent anisotropic mechanical properties and negative Poisson's ratio will have good mechanical adhesion with the arterial wall. METHODS: The auxetic design...

  5. Acute coronary syndrome

    Science.gov (United States)

    ... Have plenty of fruits, veggies, whole grains, and lean meats. Try to limit foods high in cholesterol ... et al. 2014 AHA/ACC guideline for the management of patients with non-ST-elevation acute coronary ...

  6. Coronary hemodynamics in vasospastic angina

    International Nuclear Information System (INIS)

    Matsumura, Kentaro; Kubota, Shinobu; Serizawa, Takashi; Nakase, Emiko; Kawai, Ichiro; Saito, Takayuki

    1991-01-01

    To evaluate the coronary circulation and myocardial perfusion dynamics, we performed left coronary digital subtraction angiography (DSA) in 35 patients with vasospastic angina. The left coronary circulation time (CCT) measured from the proximal left coronary artery to the coronary sinus was 5.77±0.86 sec, and the left epicardial conducting artery transmission time (CAT) measured from the proximal left coronary artery to the apical area was 2.65±0.82 sec in normal controls. The CCT and CAT were significantly prolonged in patients with vasospastic angina, indicating that the coronary peripheral vascular resistance is probably greater after the cessation of nitrates and Ca ++ -antagonists. After the intracoronary injection of ergonovine malate, the CCT was slightly shortened, but the apical T 1/2 was significantly prolonged in patients with vasospastic angina. This suggested that coronary vasospasm is present not only in the epicardial arteries but also in coronary arteries with peripheral resistance. These phenomena were not observed in normal controls. We performed left coronary DSA after conventional left coronary cineangiography. When the CCT exceeded 6.7 sec, we considered that the coronary circulation was significantly impaired. We concluded that the coronary DSA is very useful for evaluating abnormal coronary circulation in patients with vasospastic angina during myocardial perfusion. (author)

  7. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

    Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

  8. Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

    International Nuclear Information System (INIS)

    Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.

    1986-01-01

    Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

  9. Coronary tortuosity: a long and winding road.

    NARCIS (Netherlands)

    Zegers, E.S.; Meursing, B.T.J.; Oude Ophuis, A.J.M.

    2007-01-01

    Coronary tortuosity is a phenomenon often encountered by cardiologists performing coronary angiography. The aetiology and clinical importance of coronary tortuosity are still unclear. Coronary tortuosity without fixed atherosclerotic stenosis in patients with angina pectoris and an abnormal exercise

  10. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta

    2015-01-01

    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

  11. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  12. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  13. Treatment modalities of palatal impacted canines

    OpenAIRE

    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

    2012-01-01

    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  14. Orthodontic Traction of Impacted Canine Using Cantilever

    OpenAIRE

    Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

    2016-01-01

    The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

  15. Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

    Science.gov (United States)

    Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

    2016-02-01

    To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  17. Platelets Inhibit Migration of Canine Osteosarcoma Cells.

    Science.gov (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

    2017-01-01

    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  18. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  19. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  20. Ultrasonography of the canine pancreas

    Directory of Open Access Journals (Sweden)

    Michelle L Avante

    2018-01-01

    Full Text Available This study describes the ultrasonographic techniques currently used in the evaluation of the canine pancreas. Ultrasonography was the first method to enable direct visualization of the pancreas in humans and it has been subsequently applied to animals. Currently, it is the method of choice for pancreatic evaluation and is essential as a diagnostic tool in the detection of abnormalities, especially tumors. Innovative equipment technology has led to the emergence of techniques complementary to B-mode ultrasound; such as Doppler, elastography, and contrast-enhanced ultrasonography, which have enabled more accurate diagnosis. Doppler provides information on vascular architecture and the hemodynamic aspect of blood vessels in multiple organs. ARFI elastography provides detailed images of the alterations detected by conventional examination (qualitative method and assists in differentiating between benign and malignant processes (quantitative method. Microbubble contrast agents determine parameters related to homogeneous and heterogeneous filling of organs with microbubbles, mainly nodular areas, thus defining high and low intensity patterns.

  1. Irradiation inhibits vascular anastomotic stenosis in a canine model

    International Nuclear Information System (INIS)

    Saito, Takeshi; Iguchi, Atsushi; Tabayashi, Koichi

    2009-01-01

    The graft patency rate after coronary artery bypass grafting (CABG) correlates with anastomotic stenosis. Intracoronary radiation therapy is effective for preventing restenosis after percutaneous coronary intervention (PCI). We postulated that intracoronary radiation therapy could prevent anastomotic stenosis and tested this hypothesis in an animal model. Femoral arteries and veins of beagle dogs were harvested, and composite arterioarterial and arteriovenous grafts were prepared. After external irradiation of the anastomotic sites, these composite grafts were transplanted into femoral arteries. Histomorphometric and immunohistological analyses of the anastomotic sites were performed. The study groups consisted of controls and animals exposed to 10 Gy, 20 Gy, and 30 Gy (n=5, in each group). In the artery graft model, the ratio of negative remodeling was significantly increased in all groups exposed to ≥10 Gy. The ratio of neointimal hyperplasia was significantly decreased in all groups exposed to ≥10 Gy. Cell density of anti-α-actin antibody-positive cells and anti-proliferating cell nuclear antigen (PCNA) antibody-positive cells was highest in the adventitial layer, and the density decreased as the dosage increased. Experimental results were almost the same in the vein graft models as in the artery graft models. With double immunohistostaining, the anti-PCNA antibody-positive cells expressed α-actin. Irradiation can inhibit anastomotic stenosis in a canine model. Adventitia is a factor in the creation of stenosis, and irradiation appears to target the adventitia. We speculate that there might be a possible role for intracoronary irradiation in the future to prevent anastomotic stenosis. (author)

  2. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

    OpenAIRE

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-01-01

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

  3. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    OpenAIRE

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Ara?jo, Maria Jos? Abigail Mendes; B?falo, Michelle Cristiane; Sforcin, Jos? Maur?cio

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

  4. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  5. Calcified Plaque of Coronary Artery: Factors Influencing Overestimation of Coronary Artery Stenosis on Coronary CT Angiography

    International Nuclear Information System (INIS)

    Kim, Mok Hee; Kim, Yun Hyeon; Choi, Song; Seon, Hyun Ju; Jeong, Gwang Woo; Park, Jin Gyoon; Kang, Heoung Keun; Ko, Joon Seok

    2010-01-01

    To assess the influence of calcified plaque characteristics on the overestimation of coronary arterial stenosis on a coronary CT angiography (CCTA). The study included 271 coronary arteries with calcified plaques identified by CCTA, and based on 928 coronary arteries from 232 patients who underwent both CCTA and invasive coronary angiography (ICA). Individual coronary arteries were classified into two groups by agreement based on the degree of stenosis from each CCTA and ICA: 1) group A includes patients with concordant CCTA and ICA results and, 2) group B includes patients with an overestimation of CCTA compared to ICA. Parameters including total calcium score, calcium score of an individual coronary artery, calcium burden number of an individual coronary artery, and the density of each calcified plaque (calcium score / number of calcium burden) for each individual coronary artery were compared between the two groups. Of the 271 coronary arteries, 164 (60.5%) were overestimated on CCTA. The left anterior descending artery (LAD) had a significantly low rate of overestimation (47.1%) compared to the other coronary arteries (p=0.001). No significant differences for total calcium score, calcium score of individual coronary artery, and the density of each calcified plaque from individual coronary arteries between two groups was observed. However, a decreasing tendency for the rate of overestimation on CCTA was observed with an increase in calcium burden of individual coronary arteries (p<0.05). The evaluation of coronary arteries suggests that the degree of coronary arterial stenosis had a tendency to be overestimated by calcified plaques on CCTA. However, the rate of overestimation for the degree of coronary arterial stenosis by calcified plaques was not significantly influenced by total calcium score, calcium score of individual coronary artery, and density of each calcified plaque

  6. Myogenic potential of canine craniofacial satellite cells

    Directory of Open Access Journals (Sweden)

    Rita Maria Laura La Rovere

    2014-05-01

    Full Text Available The skeletal fibres have different embryological origin; the extraocular and jaw-closer muscles develop from prechordal mesoderm while the limb and trunk muscles from somites. These different origins characterise also the adult muscle stem cells, known as satellite cells (SCs and responsible for the fibre growth and regeneration. The physiological properties of presomitic SCs and their epigenetics are poorly studied despite their peculiar characteristics to preserve muscle integrity during chronic muscle degeneration. Here we isolated SCs from canine somitic (SDM: vastus lateralis, rectus abdominus, gluteus superficialis, biceps femoris, psoas and presomitic (PSDM: lateral rectus, temporalis and retractor bulbi muscles as myogenic progenitor cells from young and old animals. In addition, SDM and PSDM satellite cells were obtained also from Golden retrievers affected by muscular dystrophy (GRMD. We characterised the lifespan, the myogenic potential and functions and oxidative stress of both somitic and presomitic SCs with the aim to reveal differences with ageing and between healthy and dystrophic animals. The different proliferation rate was consistent with higher telomerase activity in PSDM-SCs compared to SDM-SCs, although restricted at early passages. SDM-SCs express early (Pax7, MyoD and late (MyHC, Myogenin myogenic markers differently from PSDM-SCs resulting in a more efficient and faster cell differentiation. Taken together our results showed that PSDM-SCs elicit a stronger stem cell phenotype compared to SDM ones. Finally, myomiR expression profile reveals a unique epigenetic signature in GRMD satellite cells and miR-206, highly expressed in dystrophic SCs, seems to play a critical role in muscle degeneration. Thus, miR-206 could represent a potential target for novel therapeutic approaches.

  7. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  8. Distal coronary hemoperfusion during percutaneous transluminal coronary angioplasty

    NARCIS (Netherlands)

    Muinck, Ebo Derk de

    1994-01-01

    In this thesis several aspects of passive and active coronary perfusion during coronary angioplasty are investigated. The autoperfusion balloon catheters that were evaluated are the Stack® and the RX-60® catheters (Advanced Cardiovascular Systems, inc., Santa Clara, California, U.S.A). The coronary

  9. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  10. Canine osteosarcoma cell lines contain stem-like cancer cells: biological and pharmacological characterization.

    Science.gov (United States)

    Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio

    2016-05-01

    Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.

  11. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

    Science.gov (United States)

    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

    2009-12-10

    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  12. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)

    SERVER

    2007-08-20

    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  13. Ascorbic acid: Nonradioactive extracellular space marker in canine heart

    International Nuclear Information System (INIS)

    Reil, G.H.; Frombach, R.; Kownatzki, R.; Quante, W.; Lichtlen, P.R.

    1987-01-01

    The distribution pattern of ascorbic acid and L-[ 14 C]ascorbic acid in myocardial tissue was compared with those of the classical radioactive extracellular space markers [ 3 H]-inulin, [ 3 H]sucrose, and Na 82 Br. A new polarographic techniques was developed for analogue registration of ascorbic acid concentration in coronary venous blood. The kinetic data of the markers were studied in an open-chest canine heart preparation during a constant tracer infusion of up to 9 min. Distribution volumes were calculated based on the mean transit time method of Zierler. The distribution volume of ascorbic acid as well as of L-[ 14 C]ascorbic acid in myocardial tissue agreed closely with those of [ 3 H]inulin and [ 3 H]sucrose as well as 82 Br. The obtained kinetic data confirmed that ascorbic acid exhibits the physicochemical properties of an extracellular space marker, though this compound was shown to leak slowly into myocardial cells. Favorable attributes of this indicator are its low molecular weight, high diffusibility in interstitial fluid, low binding affinity to macromolecules, and high transcapillary as well as low transplasmalemmal penetration rate. Therefore, this nonradioactive marker can be applied in a safe and simple fashion, and without untoward side effects in experimental animals as well as in patients

  14. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  15. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  16. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  17. Nuclear cardiology and coronary surgery

    DEFF Research Database (Denmark)

    Eckardt, R.; Andersen, L.I.; Hesse, B.

    2008-01-01

    Rising age, repeated percutaneous coronary revascularizations, and co-morbidity such as overweight, diabetes, and hypertension, characterize a change over the last 20-30 years in coronary patients referred to coronary artery bypass grafting (CABG). This patient group represents a great part of to...

  18. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

  19. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  20. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

    1993-01-01

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  1. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Boretti, Felicitos; Reusch, C.E.

    2010-01-01

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  2. Leishmania spp. Epidemiology of Canine Leishmaniasis in the Yucatan Peninsula

    Directory of Open Access Journals (Sweden)

    A. López-Céspedes

    2012-01-01

    Full Text Available Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico. A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  3. The first reported case of canine subcutaneous Cryptococcus flavescens infection.

    Science.gov (United States)

    Kano, Rui; Ishida, Rinei; Nakane, Shinsuke; Sekiguchi, Maiko; Hasegawa, Atsuhiko; Kamata, Hiroshi

    2012-03-01

    This report describes the first documented case of subcutaneous infection due to Cryptococcus flavescens in a dog. The chief symptoms of the patient dog were abscessed lesions on the dorsal muzzle, right eyelid, and lower jaw. Biopsy specimens from the lesions on the dorsal muzzle and lower jaw showed pyogranulomatous inflammation with numerous yeast cells. The patient dog was diagnosed with a subcutaneous fungal infection and orally received 5 mg/kg itraconazole once a day for 2 months, the abscesses disappeared. After 1 month at the end of treatment, the skin lesions did not redevelop. Isolates from the biopsy specimens were identified as C. flavescens by molecular analysis as well as morphologic and biochemical examination, indicating that C. flavescens is a potential canine pathogen.

  4. Leishmania spp. epidemiology of canine leishmaniasis in the Yucatan Peninsula.

    Science.gov (United States)

    López-Céspedes, A; Longoni, S S; Sauri-Arceo, C H; Sánchez-Moreno, M; Rodríguez-Vivas, R I; Escobedo-Ortegón, F J; Barrera-Pérez, M A; Bolio-González, M E; Marín, C

    2012-01-01

    Canine Leishmaniasis is widespread in various Mexican states, where different species of Leishmania have been isolated from dogs. In the present study, we describe the detection of L. braziliensis, L. infantum, and L. mexicana in serum of dogs from the states of Yucatan and Quintana Roo in the Yucatan Peninsula (Mexico). A total of 412 sera were analyzed by ELISA using the total extract of the parasite and the iron superoxide dismutase excreted by different trypanosomatids as antigens. We found the prevalence of L. braziliensis to be 7.52%, L. infantum to be 6.07%, and L. mexicana to be 20.63%, in the dog population studied. The results obtained with ELISA using iron superoxide dismutase as the antigen were confirmed by western blot analysis with its greater sensitivity, and the agreement between the two techniques was very high.

  5. CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).

    Science.gov (United States)

    Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen

    2017-12-01

    A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.

  6. Anomalous origin of right coronary artery from left coronary sinus.

    Science.gov (United States)

    Hamzeh, Gadah; Crespo, Alex; Estarán, Rafael; Rodríguez, Miguel A; Voces, Roberto; Aramendi, José I

    2008-08-01

    Anomalous aortic origin of the coronary arteries is uncommon but clinically significant. Manifestations vary from asymptomatic patients to those who present with angina pectoris, myocardial infarction, heart failure, syncope, arrhythmias, and sudden death. We describe 4 patients, aged 34 to 59 years, who were diagnosed with right coronary artery arising from the left sinus of Valsalva, confirmed by coronary angiography, which was surgically repaired. Three patients presented dyspnea and angina, and one with acute myocardial infarction. At operation, the right coronary artery was dissected at the take-off from the intramural course, and reimplanted into the right sinus of Valsalva. There was no mortality. One patient had associated coronary artery disease that required stent placement postoperatively. This reimplantation technique provides a good physiological and anatomical repair, eliminates a slit-like ostium, avoids compression of the coronary artery between the aorta and the pulmonary artery, and gives superior results to coronary artery bypass grafting or the unroofing technique.

  7. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  8. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

    2012-08-01

    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  9. Orthodontic Traction of Impacted Canine Using Cantilever

    Directory of Open Access Journals (Sweden)

    Cláudia Nakandakari

    2016-01-01

    Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

  10. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

    2014-01-01

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  11. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Percutaneous coronary intervention versus coronary-artery bypass grafting for severe coronary artery disease

    NARCIS (Netherlands)

    P.W.J.C. Serruys (Patrick); M-C. Morice (Marie-Claude); A.P. Kappetein (Arie Pieter); A. Colombo (Antonio); D.R. Holmes Jr (David); M.J. Mack (Michael); E. Stahle (Elisabeth); T.E. Feldman (Ted); M.J.B.M. van den Brand (Marcel); E.J. Bass (Eric); N. van Dyck (Nic); K. Leadly (Katrin); K.D. Dawkins (Keith); F.W. Mohr (Friedrich)

    2009-01-01

    textabstractBACKGROUND Percutaneous coronary intervention (PCI) involving drug-eluting stents is increasingly used to treat complex coronary artery disease, although coronary-artery bypass grafting (CABG) has been the treatment of choice historically. Our trial compared PCI and CABG for treating

  13. Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

    Science.gov (United States)

    Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2006-01-01

    Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

  14. Ultrasonographic description of canine mastitis.

    Science.gov (United States)

    Trasch, Katja; Wehrend, Axel; Bostedt, Hartwig

    2007-01-01

    Ultrasonographic images were acquired of the mammary glands of 40 bitches with physiologically lactating (n = 20) or inflamed glands (n = 20). Echogenicity, structure, homogeneity, thickness, and distinguishability of each tissue layer were assessed. Additionally, overall echogenicity was noted. In the normal lactating gland, different tissues could be differentiated easily. The parenchyma was, without exception, separated from adjacent tissues and was visible as medium echogenic tissue with a coarse-grained structure. The tissue always had some echogenic lines and anechoic areas and was slightly heterogeneous. The loss of distinct layering of the tissue was characteristic of an inflamed mammary gland and inflamed regions had reduced echogenicity. Additionally in five bitches with mastitis, the ultrasound examination was repeated five times for documentation of the progress of the illness and associated changes, supplemented with a color Doppler sonogram to assess changes in blood vessel density. Information from the examinations carried out via B-mode did not allow treatment success to be predicted. Two bitches with reduced blood vessel density centrally had a poor outcome whereas three bitches with increased blood vessel density had a good outcome. Thus, Doppler sonography might be a useful tool to obtain information of the prognosis in acute canine mastitis.

  15. Canine Intracranial Meningioma: Case report

    Directory of Open Access Journals (Sweden)

    José Ricardo Gomes de Carvalho

    2016-11-01

    Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

  16. Early canine plaque biofilms: characterization of key bacterial interactions involved in initial colonization of enamel.

    Directory of Open Access Journals (Sweden)

    Lucy J Holcombe

    Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.

  17. Coronary artery anatomy and variants

    Energy Technology Data Exchange (ETDEWEB)

    Malago, Roberto; Pezzato, Andrea; Barbiani, Camilla; Alfonsi, Ugolino; Nicoli, Lisa; Caliari, Giuliana; Pozzi Mucelli, Roberto [Policlinico G.B. Rossi, University of Verona, Department of Radiology, Verona (Italy)

    2011-12-15

    Variants and congenital anomalies of the coronary arteries are usually asymptomatic, but may present with severe chest pain or cardiac arrest. The introduction of multidetector CT coronary angiography (MDCT-CA) allows the detection of significant coronary artery stenosis. Improved performance with isotropic spatial resolution and higher temporal resolution provides a valid alternative to conventional coronary angiography (CCA) in many patients. MDCT-CA is now considered the ideal tool for three-dimensional visualization of the complex and tortuous anatomy of the coronary arteries. With multiplanar and volume-rendered reconstructions, MDCT-CA may even outperform CCA in determining the relative position of vessels, thus providing a better view of the coronary vascular anatomy. The purpose of this review is to describe the normal anatomy of the coronary arteries and their main variants based on MDCT-CA with appropriate reconstructions. (orig.)

  18. [Pregnancy and coronary artery dissection].

    Science.gov (United States)

    Martínez-Quintana, Efrén; Rodríguez-González, Fayna

    2015-01-01

    Acute myocardial infarction during pregnancy is associated with high maternal and fetal mortality. Coronary atherosclerosis is the most common cause due to an increase in the age of the patients and the association with cardiovascular risk factors such as smoking, hypertension, diabetes mellitus, preeclampsia, and the existence of family history of coronary disease. However, thrombosis, coronary dissection or coronary vasospasms are other causes that may justify it. We report the case of a 33 weeks pregnant first-time mother, without cardiovascular risk factors, who presented an acute coronary event in the context of atherosclerotic disease and coronary dissection after percutaneous coronary intervention. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

  19. Coronary MR angiography: current status

    International Nuclear Information System (INIS)

    Danias, P.G.; Manning, W.J.

    2000-01-01

    Since first described in the early 1990s, coronary magnetic resonance angiography (MRA) has evolved as a promising noninvasive modality for imaging of the coronary arteries and evaluation of coronary artery disease. Despite technical limitations, coronary MRA has established value for imaging of anomalous coronary arteries and assessment of bypass graft patency. Current research focuses on the development of optimal respiratory compensation strategies, improved spatial and temporal resolution and faster acquisition of image data. The accurate detection of stenoses and assessment of the severity of coronary atherosclerosis is presently being evaluated with large multi-center studies. With further technique enhancements and more clinical experience, coronary MRA is likely to become the dominant noninvasive modality in clinical cardiology. (orig.) [de

  20. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F

    2011-01-01

    Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  1. Studies on manifestations of canine distemper virus infection in an urban dog population.

    Science.gov (United States)

    Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

    1993-10-01

    An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

  2. Epidemiology of canine distemper virus in wild raccoon dogs (Nyctereutes procyonoides) from South Korea.

    Science.gov (United States)

    Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan

    2012-09-01

    Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Genetics of Human and Canine Dilated Cardiomyopathy

    OpenAIRE

    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  4. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.

    2001-01-01

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  5. Reliability of mandibular canines as indicators for sexual dichotomy.

    Science.gov (United States)

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

    2013-02-01

    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  6. Serial thallium-201 imaging after dipyridamole for coronary disease detection: quantitative analysis using myocardial clearance

    International Nuclear Information System (INIS)

    Okada, R.D.; Dai, Y.H.; Boucher, C.A.; Pohost, G.M.

    1984-01-01

    After dipyridamole, canine studies have demonstrated a slower rate of myocardial thallium-201 clearance from zones distal to a coronary artery stenosis compared to normal zones. To determine if criteria based on canine myocardial thallium-201 clearance rates could be applied clinically, 40 patients with and 26 patients without coronary artery disease (CAD) had serial thallium-201 images obtained for 2 to 5 hours after dipyridamole. Regions of interest were manually placed over six left ventricular segments in two projections for each of three imaging times. The myocardial thallium-201 clearance rate was calculated for each of the six segments and, using the clearance rate criterion found in canine studies, was considered abnormal if less than 6.5%/hr. Using this criterion alone, 22 of 26 patients (85%) without CAD had normal and 30 of 40 patients (75%) with CAD had abnormal myocardial thallium-201 clearance rates. A quantitative analysis of regional inhomogeneity in tracer distribution (normal was greater than or equal to 25% difference between segments) was negative in 24 of 26 patients (92%) without CAD and positive in 20 of 40 patients (50%) with CAD. When both clearance rate and regional inhomogeneity were considered, 21 of 26 patients (81%) without CAD had negative and 36 of 40 patients (90%) with CAD had positive results. Thus, post-dipyridamole myocardial clearance rate criteria derived from canine studies can be applied to clinical thallium imaging. Quantitative analysis of serial thallium-201 images after dipyridamole is optimized by using myocardial thallium-201 clearance rates. Such an approach is independent of regional inhomogeneities in tracer distribution

  7. CT coronary angiography vs. invasive coronary angiography in CHD

    Directory of Open Access Journals (Sweden)

    Anja Hagen

    2012-04-01

    Full Text Available Scientific background: Various diagnostic tests including conventional invasive coronary angiography and non-invasive computed tomography (CT coronary angiography are used in the diagnosis of coronary heart disease (CHD. Research questions: The present report aims to evaluate the clinical efficacy, diagnostic accuracy, prognostic value cost-effectiveness as well as the ethical, social and legal implications of CT coronary angiography versus invasive coronary angiography in the diagnosis of CHD. Methods: A systematic literature search was conducted in electronic data bases (MEDLINE, EMBASE etc. in October 2010 and was completed with a manual search. The literature search was restricted to articles published from 2006 in German or English. Two independent reviewers were involved in the selection of the relevant publications. The medical evaluation was based on systematic reviews of diagnostic studies with invasive coronary angiography as the reference standard and on diagnostic studies with intracoronary pressure measurement as the reference standard. Study results were combined in a meta-analysis with 95 % confidence intervals (CI. Additionally, data on radiation doses from current non-systematic reviews were taken into account. A health economic evaluation was performed by modelling from the social perspective with clinical assumptions derived from the meta-analysis and economic assumptions derived from contemporary German sources. Data on special indications (bypass or in-stent-restenosis were not included in the evaluation. Only data obtained using CT scanners with at least 64 slices were considered. Results: No studies were found regarding the clinical efficacy or prognostic value of CT coronary angiography versus conventional invasive coronary angiography in the diagnosis of CHD. Overall, 15 systematic reviews with data from 44 diagnostic studies using invasive coronary angiography as the reference standard (identification of obstructive

  8. Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

    Directory of Open Access Journals (Sweden)

    Nicola Decaro

    Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

  9. In vitro evaluation of three different biomaterials as scaffolds for canine mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    Oduvaldo Câmara Marques Pereira-Junior

    2013-05-01

    Full Text Available PURPOSE: To evaluate in vitro ability the of three different biomaterials - purified hydroxyapatite, demineralized bone matrix and castor oil-based polyurethane - as biocompatible 3D scaffolds for canine bone marrow mesenchymal stem cell (MSC intending bone tissue engineering. METHODS: MSCs were isolated from canine bone marrow, characterized and cultivated for seven days with the biomaterials. Cell proliferation and adhesion to the biomaterial surface were evaluated by scanning electron microscopy while differentiation into osteogenic lineage was evaluated by Alizarin Red staining and Sp7/Osterix surface antibody marker. RESULTS: The biomaterials allowed cellular growth, attachment and proliferation. Osteogenic differentiation occurred in the presence of hydroxyapatite, and matrix deposition commenced in the presence of the castor oil-based polyurethane. CONCLUSION: All the tested biomaterials may be used as mesenchymal stem cell scaffolds in cell-based orthopedic reconstructive therapy.

  10. Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

    Science.gov (United States)

    Pang, Lisa Y; Gatenby, Emma L; Kamida, Ayako; Whitelaw, Bruce A; Hupp, Ted R; Argyle, David J

    2014-01-01

    Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs), which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05), and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

  11. Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

    Directory of Open Access Journals (Sweden)

    Lisa Y Pang

    Full Text Available Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs, which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05, and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

  12. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    Science.gov (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  13. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

    Science.gov (United States)

    1981-06-05

    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  14. Quantitative angiography of the left anterior descending coronary artery: correlations with pressure gradient and results of exercise thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); C.J. Kooijman; K. Balakumaran (Kulasekaram); P.G. Hugenholtz (Paul)

    1985-01-01

    textabstractTo evaluate, during cardiac catheterization, what constitutes a physiologically significant obstruction to blood flow in the human coronary system, computer-based quantitative analysis of coronary angiograms was performed on the angiograms of 31 patients with isolated disease of the

  15. Evaluation of mRNA expression levels and electrophysiological function of neuron-like cells derived from canine bone marrow stromal cells.

    Science.gov (United States)

    Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro

    2013-10-01

    To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.

  16. Coronary CT Angiography in the Quantitative Assessment of Coronary Plaques

    Directory of Open Access Journals (Sweden)

    Zhonghua Sun

    2014-01-01

    Full Text Available Coronary computed tomography angiography (CCTA has been recently evaluated for its ability to assess coronary plaque characteristics, including plaque composition. Identification of the relationship between plaque composition by CCTA and patient clinical presentations may provide insight into the pathophysiology of coronary artery plaque, thus assisting identification of vulnerable plaques which are associated with the development of acute coronary syndrome. CCTA-generated 3D visualizations allow evaluation of both coronary lesions and lumen changes, which are considered to enhance the diagnostic performance of CCTA. The purpose of this review is to discuss the recent developments that have occurred in the field of CCTA with regard to its diagnostic accuracy in the quantitative assessment of coronary plaques, with a focus on the characterization of plaque components and identification of vulnerable plaques.

  17. An experimental in-vivo canine model for adult shunt infection

    Directory of Open Access Journals (Sweden)

    Procop Gary

    2008-10-01

    Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.

  18. The anomalous origin of coronary arteries causing sudden death and its clinical significance

    International Nuclear Information System (INIS)

    Zhu Jiemin; Fan Lijuan; Sun Fengwei; Wu Xuesheng; Ying Yuanning; Dong Zhi; Li Xu

    2010-01-01

    Objective: To investigate the morbidity of anomalous coronary origin from the opposite coronary sinus, which may cause sudden death of young athletes in Chinese population. And to identify the imaging characteristics of this anomaly and its clinical significance combined with literature review. Methods: The computed tomographic coronary angiography (CTCA) database at TEDA International Cardiovascular Hospital was reviewed. All of the patients diagnosed with isolated anomalous origin of a coronary artery from the opposite sinus of valsalva (anomalous origin of coronary artery, AOCA) and subsequent coursing between the pulmonary artery and the aorta were collected from 14343 Chinese individuals. The location of anomalous coronary origin, the shape and course of the proximal ectopic arterial segments were identified. The nonatherosclerostic stenotic caliber of the segments and the angle between the ectopic coronary artery and the adjacent aortic wall were assessed. Results: Seventy-four patients of AOCA (including the left or right single coronary artery) were diagnosed using CTCA. Among the 74 cases, the potentially serious course of the ectopic coronary artery between the pulmonary artery and the aorta were identified in 59 individuals. Fifty-six cases of ectopic right coronary with interarterial course (anomalous origin of right coronary artery, AORCA) and three patients with anomalous origin of the left coronary artery (AOLCA) were found, including two cases judged as potentially serious origin of either single left coronary artery (n=1) or single right coronary artery (n=1). The morbidity of the potentially serious anomalous origin of coronary artery in Chinese population was established as 4.1% (59/14343). In the subgroup of AORCA, the lumen of initial ectopic segment was frequently compressed and stenotic. In 29 cases (52.7%) the stenosis of the lumen were more than 50%, and in 3 cases (5.4%) the stenosis of the ectopic coronary artery were more than 70%. The

  19. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2005-06-01

    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  20. Canine distemper outbreak in rhesus monkeys, China.

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-08-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  1. Canine trypanosomosis: Clinical observations and morphological ...

    African Journals Online (AJOL)

    Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

  2. Molecular Epidemiology of Canine Parvovirus, Europe

    Science.gov (United States)

    Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio

    2007-01-01

    Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

  3. Prostate histotripsy for BPH: initial canine results

    Science.gov (United States)

    Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

    2009-02-01

    Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

  4. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  5. Canine Distemper Outbreak in Rhesus Monkeys, China

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  6. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  7. Percutaneous transluminal coronary angioplasty

    International Nuclear Information System (INIS)

    Przybojewski, J.Z.; Weich, H.F.H.

    1984-01-01

    The purpose of this article is to review PTCA, percutaneous transluminal coronary angioplasty, which can be considered to be a truly revolutionary and fairly simple invasive form of intervention to atherosclerotic obstruction. The 'epidemic' of IHD, ischaemic heart disease, in the Republic of South Africa calls for the employment of this technique, which has already been carried out in a few teaching hospitals in this country. Very recently, modified balloon dilatation catheters have been used percutaneously in the non-operative transluminal correction of congenital coarctation of the aorta in infants and children, congenital pulmonary value stenosis, and hypoplasia and stenosis of the pulmonary arteries. It has also been employed for PTCA and for the simultaneous occlusion of coronary-bronchial artery anastomosis using a detachable balloon. The isotopes thallium 201 and technetium 99 were also used in scintiscanning

  8. Meniscotibial (coronary) ligament tears

    International Nuclear Information System (INIS)

    El-Khoury, G.Y.; Usta, H.Y.; Berger, R.A.

    1984-01-01

    Preservation of the meniscus whenever possible is essential in maintaining knee stability and preventing premature osteoarthritis. Peripheral meniscal tears are the most amenable to surgical repair. This study evaluates the peripheral attachments of the medial meniscus and focuses on a specific tear limited to the meniscotibial ligament (coronary ligament). The diagnosis is made arthrographically when the medial meniscus floats above the tibial plateau without separating completely from the capsule. The lateral meniscus is rarely involved in this type of injury. (orig.)

  9. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  10. BACTERIAL PROFILE OF NECROTIC PULPS IN CHEETAH (ACINONYX JUBATUS) CANINE TEETH.

    Science.gov (United States)

    Almansa Ruiz, José C; Bosman, Anna-Mari; Steenkamp, Gerhard

    2016-03-01

    The role of microbes and their antimicrobial susceptibilities in both acute and chronic infections of the dental pulp in humans has been well studied. Presently, no data are available on endodontic pathogens in cheetahs (Acinonyx jubatus). The aim of this study was to isolate and identify the bacteria found in the canine teeth of cheetahs, where the pulp was necrotic and exposed due to a complicated crown fracture. Thirty-six microbiologic samples were taken from root canals (RCs) of the canine teeth of 19 cheetahs: one pulp sample was taken from 10 cheetahs, four samples from 2 cheetahs, two samples from 3 cheetahs, and three samples from 4 cheetahs. Exposed pulps were cultured for aerobic and anaerobic bacteria; an additional screening with a 16S rRNA-specific polymerase chain reaction (PCR) was used for the last six samples. Antimicrobial susceptibility of isolates was determined by use of the Kirby-Bauer diffusion test. In total, 59 cultivable isolates belonging to 19 microbial species and 13 genera were recovered from the 36 RCs sampled. Only two samples yielded no cultivable bacteria. Thirty-two (54.49%) of the cultivable isolates were Gram positive and 27 (45.71%) were Gram negative. The maximum number of isolates cultivated from an individual RC was six. Facultative anaerobes (62.72%) were the most common bacteria of the RCs that yielded cultivable bacteria. Of the isolates, 28.81% were aerobic and 8.47% were strict anaerobes. The antimicrobials that showed the greatest efficacy in vitro against the different bacteria isolates were amikacin and gentamicin. The more common bacterial species isolated by PCR were anaerobes (60.8%), facultative anaerobes (30.2%), and aerobes (8.6%).

  11. Molecular identification of bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David

    2011-06-02

    Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Coronary artery bypass grafting versus percutaneous intervention in coronary revascularization: a historical perspective and review

    Directory of Open Access Journals (Sweden)

    Burgess SN

    2015-06-01

    Full Text Available Sonya N Burgess,1 John J Edmond,2 Craig P Juergens,1 John K French11Department of Cardiology, Liverpool Hospital and South Western Sydney Clinical School, The University of New South Wales, Sydney, NSW, Australia; 2Department of Cardiology, Dunedin Public Hospital, Dunedin, New Zealand Background: Coronary artery bypass graft surgery is arguably the most intensively studied surgical procedure, and percutaneous coronary intervention (PCI has been subjected to more randomized clinical trials than any other interventional procedure. Changes seen in revascularization techniques have been numerous. The rapid evolution of evidence-based revascularization procedures has occurred as a result of many pivotal large randomized clinical trials. Objective: This review compares and contrasts outcomes from two coronary revascularization techniques, coronary artery bypass grafting (CABG and PCI, with particular reference to the landmark trials that inform practice guidelines. Methods: We undertook a comprehensive review of published literature addressing trials in this field performed to address current knowledge both in the predrug-eluting stent and postdrug-eluting stent era. Results and discussion: Surgical and percutaneous revascularization strategies have different strengths and weaknesses, and neither strategy is superior in all patients, clinical presentations, or anatomical subgroups. Current data support the use of percutaneous intervention in ST elevation myocardial infarction and in single-vessel disease. In noncomplex multivessel disease and isolated left main stem PCI, the data support non-inferiority of PCI compared to CABG as reflected in the 2014 European Society of Cardiology guidelines. Landmark revascularization trials of multivessel disease comparing CABG to PCI found no survival benefit to CABG over PCI, except in patients with complex disease. In these trials, revascularization drove differences in primary endpoints and in all but the

  13. Establishment and characterization of canine parvovirus-specific murine CD4+ T cell clones and their use for the delineation of T cell epitopes.

    NARCIS (Netherlands)

    G.F. Rimmelzwaan (Guus); R.W.J. van der Heijden (Roger); E.J. Tijhaar (Edwin); M.C.M. Poelen (Martien); J. Carlson; A.D.M.E. Osterhaus (Albert); F.G.C.M. Uytdehaag (Fons)

    1990-01-01

    textabstractCanine parvovirus (CPV)-specific T cell clones were generated by culturing lymph node cells from CPV-immunized BALB/c mice at limiting dilutions in the presence of CPV antigen and interleukin-2 (IL-2). All isolated T cell clones exhibited the cell surface phenotype Thy1+, CD4+, CD8- and

  14. Myocardial temperature variation: effect on regional function and coronary flow in dogs

    International Nuclear Information System (INIS)

    D'Ambra, M.N.; Magrassi, P.; Lowenstein, E.; Kyo, S.; Austen, W.G.; Buckley, M.J.; LaRaia, P.J.

    1987-01-01

    Incremental changes in the temperature (28-42.5 0 C) of the anterior left ventricular wall in a canine, working, beating right heart bypass preparation (constant preload, afterload, and heart rate) were produced to measure the effect of regional temperature on myocardial function and blood flow. Circumferential-axis segment lengths were measured with sonomicrometry in both the temperature-varied, left-anterior descending coronary artery (LAD)-supplied myocardium and the normothermic (38 0 C) circumflex-supplied myocardium. Fast thermistors (time constant 0 C), regional systolic shortening decreased 42.2 +/- 10% at 41 0 C and increased 23.3 +/- 6% at 31 0 C. There was no significant change in coronary blood flow or distribution at the three temperatures. Pressure-length areas varied inversely with myocardial temperature. These data demonstrate that there is a reversible inverse relationship between midwall T and ventricular function when heart rate, preload, and afterload are controlled

  15. Coronary artery bypass grafting-related bleeding complications in patients treated with dual antiplatelet treatment

    NARCIS (Netherlands)

    Tomšič, Anton; Schotborgh, Mark A.; Manshanden, Johan S. J.; Li, Wilson W. L.; de Mol, Bas A. J. M.

    2016-01-01

    To evaluate the relationship between the timing of either ticagrelor or clopidogrel discontinuation and bleeding-related complications in patients undergoing isolated on-pump coronary artery bypass grafting (CABG). Between January 2012 and December 2014, 705 consecutive patients underwent isolated

  16. Effects of continuous administration of clopidogrel before off-pump coronary artery bypass grafting in patients with acute coronary syndrome. A propensity score analysis

    International Nuclear Information System (INIS)

    Song, Suk-Won; Youn, Young-Nam; Yi, Gijong; Lee, Sak; Yoo, Kyung-Jong

    2008-01-01

    Clopidogrel has become standard treatment after urgent percutaneous coronary revascularization. Due to its enhanced and irreversible platelet inhibition, patients undergoing urgent surgical revascularization have a higher risk of bleeding complications and transfusions. Therefore, the effect of preoperative continuous administration of clopidogrel on the incidence of hemorrhagic complications in patients undergoing off-pump coronary artery bypass surgery with acute coronary syndrome was evaluated. From March 2004 to September 2006, 172 patients with acute coronary syndrome underwent isolated off-pump coronary artery bypass surgery; 70 (40.7%) and 102 (59.3%) of these patients did or did not take clopidogrel before surgery respectively. Seventy patients in each group were matched using propensity scores and associations between preoperative continuous administration of clopidogrel and postoperative bleeding, hemostatic reoperation, blood products received, the need for multiple transfusions and early graft patency by coronary computed tomography were assessed. Univariate analysis showed the continuous clopidogrel group had similar levels of postoperative bleeding for 24 h (601.4±312.6 ml vs 637.2±452.4 ml, p=0.616) and rates of reexploration (1.4% vs 1.4%), perioperative blood transfusion (33.3% vs 34.3%, p>0.05) and platelet transfusion (2.9% vs 7.1%, p=0.44) compared with the non-continuous group. Preoperative continuous administration of clopidogrel did not increase the risk of hemorrhagic complications in patients with acute coronary syndrome undergoing isolated off-pump coronary artery bypass surgery. These findings indicate that surgery after clopidogrel treatment in patients with acute coronary syndrome should not be delayed until platelet function returns to normal because they may have a higher risk of recurrent myocardial ischemic events. (author)

  17. Coffee consumption and coronary calcification - The Rotterdam Coronary Calcification Study

    NARCIS (Netherlands)

    van Woudenbergh, Geertruida J.; Vliegenthart, Rozemarijn; van Rooij, Frank J. A.; Hofman, Albert; Oudkerk, Matthijs; Witteman, Jacqueline C. M.; Geleijnse, Johanna M.

    Background-The role of coffee in the cardiovascular system is not yet clear. We examined the relation of coffee intake with coronary calcification in a population-based cohort. Methods and Results-The study involved 1570 older men and women without coronary heart disease who participated in the

  18. Coffee consumption and coronary calcification: The Rotterdam coronary calcification study

    NARCIS (Netherlands)

    G.J. van Woudenbergh (Geertruida); R. Vliegenthart (Rozemarijn); F.J.A. van Rooij (Frank); A. Hofman (Albert); M. Oudkerk (Matthijs); J.C.M. Witteman (Jacqueline); J.M. Geleijnse (Marianne)

    2008-01-01

    textabstractBACKGROUND - The role of coffee in the cardiovascular system is not yet clear. We examined the relation of coffee intake with coronary calcification in a population-based cohort. METHODS AND RESULTS - The study involved 1570 older men and women without coronary heart disease who

  19. Coffee Consumption and Coronary Calcification: The Rotterdam Coronary Calcification Study

    NARCIS (Netherlands)

    Woudenbergh, van G.J.; Vliegenthart, R.; Rooij, van F.J.A.; Hofman, A.; Oudkerk, M.; Witteman, J.C.M.; Geleijnse, J.M.

    2008-01-01

    Background¿ The role of coffee in the cardiovascular system is not yet clear. We examined the relation of coffee intake with coronary calcification in a population-based cohort. Methods and Results¿ The study involved 1570 older men and women without coronary heart disease who participated in the

  20. Fatal canine distemper virus infection of giant pandas in China.

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-06-16

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.

  1. Fatal canine distemper virus infection of giant pandas in China

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

  2. Canine Distemper Virus in Wild Felids of Costa Rica.

    Science.gov (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

    2016-04-28

    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  3. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  4. Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

    Science.gov (United States)

    Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

    2016-06-01

    Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

  5. [Developments in percutaneous coronary intervention and coronary stents].

    Science.gov (United States)

    Simsek, C; Daemen, J; Zijlstra, F

    2014-01-01

    In The Netherlands, more than 30.000 patients undergo a percutaneous coronary intervention every year, during which a coronary stent implantation will be performed in 90% of the cases. It is estimated that more than 5 million coronary stent implantations will be performed worldwide this year. While these numbers are impressive, however, coronary stents still have as a limitation the possibility of stent thrombosis. This has been and is an important stimulus for the development of both coronary stents, from a bare metal stent via a drug eluting stent to the present-day development of bio-absorbable stents, and anti-platelet drugs,from acenocoumarol to thieropyridines. The possibility of shortening the period of use of this powerful medication by developing new kinds of non-thrombogenic stents would, for example, make it possible to achieve significant reductions in subsequent bleeding during (dental) procedures.

  6. Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

    Directory of Open Access Journals (Sweden)

    Grassi Rici Rose

    2012-02-01

    Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

  7. Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.

    Science.gov (United States)

    Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto

    2012-02-22

    The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great

  8. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma

    2010-01-01

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  9. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    Directory of Open Access Journals (Sweden)

    Naiara Costa Cinegaglia

    2013-01-01

    Full Text Available Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent, and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

  10. Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.

    Science.gov (United States)

    Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio

    2018-04-01

    Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.

  11. Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.

    Science.gov (United States)

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

  12. European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

    Science.gov (United States)

    Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

    2017-09-01

    Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  13. Cross-reacting antibacterial auto-antibodies are produced within coronary atherosclerotic plaques of acute coronary syndrome patients.

    Directory of Open Access Journals (Sweden)

    Filippo Canducci

    Full Text Available Coronary atherosclerosis, the main condition predisposing to acute myocardial infarction, has an inflammatory component caused by stimuli that are yet unknown. We molecularly investigated the nature of the immune response within human coronary lesion in four coronary plaques obtained by endoluminal atherectomy from four patients. We constructed phage-display libraries containing the IgG1/kappa antibody fragments produced by B-lymphocytes present in each plaque. By immunoaffinity, we selected from these libraries a monoclonal antibody, arbitrarily named Fab7816, able to react both with coronary and carotid atherosclerotic tissue samples. We also demonstrated by confocal microscopy that this monoclonal antibody recognized human transgelin type 1, a cytoskeleton protein involved in atherogenesis, and that it co-localized with fibrocyte-like cells transgelin+, CD68+, CD45+ in human sections of coronary and carotid plaques. In vitro fibrocytes obtained by differentiating CD14+ cells isolated from peripheral blood mononuclear cells also interacted with Fab7816, thus supporting the hypothesis of a specific recognition of fibrocytes into the atherosclerotic lesions. Interestingly, the same antibody, cross-reacted with the outer membrane proteins of Proteus mirabilis and Klebsiella pneumoniae (and possibly with homologous proteins of other enterobacteriaceae present in the microbiota. From all the other three libraries, we were able to clone, by immunoaffinity selection, human monoclonal antibodies cross-reacting with bacterial outer membrane proteins and with transgelin. These findings demonstrated that in human atherosclerotic plaques a local cross-reactive immune response takes place.

  14. Canine Detection of Illict Drugs: Sensory Apparatus Technology

    National Research Council Canada - National Science Library

    Morrison, Edward

    2000-01-01

    This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

  15. Right sided single coronary artery origin: surgical interventions without clinical consequences.

    Science.gov (United States)

    Hamid, Tahir; Rose, Samman; Horner, Simon

    2011-11-01

    Congenital coronary anomalies are uncommon and are usually diagnosed incidentally during coronary angiogram or autopsy. Isolated coronary artery anomalies and the anomalous origin of left main stem (LMS) from the proximal portion of the right coronary artery or from the right sinus of valsalva are extremely rare. A 68 years old woman with atypical chest pains was referred for risk assessment for the general anaesthesia. A stress exercise treadmill test and myocardial perfusion scan revealed evidence of mild myocardial ischemia. Her coronary angiography revealed her left coronary artery to have a single origin with the right coronary artery. There were no flowlimiting lesions. A CT aortography confirmed a retro-aortic course of the left coronary artery. She successfully underwent multiple surgical procedures under general anaesthesia including total abdominal hysterectomy, Burch colposuspension (twice) for stress incontinence, intravesical botox injection for urge incontinence and haemorrhoidectomy for recurrent rectal mucosal prolapse. Various anaesthetic agents including halothane, thiopentone, suxamethonium, pancuronium, enflurane, fentanyl, propofol and isoflurane were used without any adverse clinical consequences. She remained well on 48 months follow-up.

  16. Nonsurgical, nonextraction management of impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Jasneet Singh

    2018-01-01

    Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

  17. Impacted canines: Etiology, diagnosis, and orthodontic management

    Directory of Open Access Journals (Sweden)

    Ranjit Manne

    2012-01-01

    Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

  18. A new experimental carotid siphon aneurysm model in canine based on the MR angiography and rapid prototyping technology

    International Nuclear Information System (INIS)

    Xie Jian; Li Minghua; Tan Huaqiao; Zhu Yueqi; Hu Dingjun; Qiao Ruihua; Fan Chunhua

    2009-01-01

    Objective: The aim of the experiment is to make an intracranial aneurysm model in canine. Methods: A digital tube was made based on raw magnetic resonance images of the human intracranial carotid artery. Then 6 tubes were made in the 3D rapid prototyping machine and coated with silicone. Finally we isolated the common carotid arteries of 6 canines and made them go through the tubes and anastomosed them end-to-side to get the aneurysm model. Six stents were implanted after one week. Results: Six aneurysm models were successfully made in canines. The parent artery had similar geometry of the human carotid siphon. All the aneurysms and parent arteries were patent in one week's follow-up. One canine died of excessive anesthesia after stenting. Two vascular models kept patent in one month without stenosis. The other 3 had some stenosis on the bends of the vessel. Conclusions: The aneurysm model in the experiment has high flexibility and reliability. The model provides an effective tool for research and testing neurovascular devices. It's also a useful device to train the neuroradiologists and interventional physicians. (authors)

  19. Anomalous origin of the coronary artery from the wrong coronary sinus evaluated with computed tomography: ''High-risk'' anatomy and its clinical relevance

    International Nuclear Information System (INIS)

    Krupinski, Maciej; Urbanczyk-Zawadzka, Malgorzata; Laskowicz, Bartosz; Irzyk, Malgorzata; Banys, Robert; Klimeczek, Piotr; Gruszczynska, Katarzyna; Baron, Jan

    2014-01-01

    The aim of the study was to assess coronary arteries arising from the wrong coronary sinus, including CT-evaluated high-risk anatomic features, clinical symptoms and cardiac events during follow-up. A total of 7,115 patients scheduled for 64-slice or dual-source cardiac CT were screened for the presence of isolated anomalous origin of the coronary artery from the wrong coronary sinus. Anomalous origin of the coronary artery was found in 54 (0.76 %) patients (29 men, 25 women, mean age 60.9 ± 11.6 years). Sixteen (30 %) patients with abnormal right coronary origin (ARCA) more commonly had a slit-like orifice (15 vs. 3; p < 0.001), intramural course (15 vs. 3; p < 0.001) and interarterial course (11 vs. 0; p < 0.001) than 22 (41 %) and 13 (24 %) individuals with abnormal circumflex artery (ALCx) and left coronary artery (ALCA) origin, respectively. Patients with ALCA presented less frequently with chest pain than subjects with ARCA and ALCx (25 vs. 3; p = 0.03). Patients with ARCA tended to show higher occurrence of cardiac events in the follow-up than individuals with ALCA and ALCx (5 vs. 4; p = NS). High-risk anatomy features are most common in patients with ARCA and these patients also have higher prevalence of chest pain and cardiac events in the follow-up than individuals with ALCA and ALCx. (orig.)

  20. Expression of nociceptive ligands in canine osteosarcoma.

    Science.gov (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

    2015-01-01

    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  1. Radiation, chemotherapy and surgery for canine osteosarcoma

    International Nuclear Information System (INIS)

    Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.

    1987-01-01

    Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given

  2. Leishmania (infantum) chagasi in canine urinary sediment

    OpenAIRE

    Mendonça, Ivete Lopes de; Batista, Joilson Ferreira; Alves, Leucio Camara

    2015-01-01

    Canine visceral leishmaniasis (CVL) is difficult to diagnosis, mainly due to the presence of asymptomatic animals, the diversity of clinical symptoms and the difficulty in obtaining diagnostic evidence of high sensitivity and specificity. The purpose of this study was to diagnose CVL in urinary sediment of 70 dogs of different breeds, sexes and ages from the veterinary hospital of the Federal University of Piauí and Zoonosis Control Center of Teresina, Brazil. The serological tests were TR DP...

  3. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Smith, J.C.

    1983-03-01

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  4. Percutaneous coronary intervention versus coronary artery bypass grafting: where are we after NOBLE and EXCEL?

    Science.gov (United States)

    Fortier, Jacqueline H; Shaw, Richard E; Glineur, David; Grau, Juan B

    2017-11-01

    The publication of the NOBLE and EXCEL trials, with seemingly conflicting results, brought into question whether percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG) is better for low-risk patients with left main coronary artery stenosis (LMCAS). This review appraises the methods and results of NOBLE and EXCEL, contextualizes them within the literature, and determines how they may affect clinical practice. We appraised the trials and describe differences in methodology and results. NOBLE recruited primarily isolated LMCAS, and found that CABG was superior to PCI. EXCEL's population included patients LMCAS in the context of multivessel CAD, and found PCI and CABG were comparable. Both trials enrolled young patients with few comorbidities, and there was more protocol-mandated consistency in the procedural techniques and medical therapy of patients receiving PCI. The generalizability of these trials is limited by the use of young, healthy patients at highly skilled centres that rarely reflect typical clinical practice. If these studies are to maintain relevance, trialists must address the lack of protocolization of surgical interventions and inconsistent medical therapies. Unfortunately, the limitations of NOBLE and EXCEL mean that we are no closer to answering the question of what is the optimal treatment for patients with LMCAS.

  5. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major

    2014-07-01

    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  6. Laparoscopic radical prostatectomy in the canine model.

    Science.gov (United States)

    Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

    1996-12-01

    The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

  7. Molecular characterization of the canine HMGB1.

    Science.gov (United States)

    Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

    2003-01-01

    Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

  8. Prevalence and zoonotic potential of canine hookworms in Malaysia

    Directory of Open Access Journals (Sweden)

    Mahdy Mohammed AK

    2012-05-01

    Full Text Available Abstract Background Canine hookworm infection is endemic in Southeast Asian countries with a prevalence ranging from 70% to 100%, with zoonotic transmission representing a potentially significant public health concern. However, there are limited data available on the prevalence of canine hookworms in Malaysia. This study was conducted to determine the prevalence of hookworm and Ancylostoma species among dogs in Malaysia. Methods Faecal samples were collected from 221 dogs living in urban areas, rural areas and animal shelters in Selangor. Faecal samples were processed using the formal-ether concentration technique followed by wet mount preparation and iodine staining for the detection of hookworm eggs. Samples positive for hookworm eggs were examined using PCR, targeting ITS2 and 28 s rRNA region, and subsequently sequenced in both directions. The sequences were phylogenetically analysed using MrBayes for Bayesian Inference. Results The overall prevalence of hookworm among dogs was 48% (95%CI; 41.41–54.95. Rural stray dogs had the highest prevalence 71.4% (95%CI; 61.13–81.49 followed by urban stray dogs, recording 48% (95%CI; 34.15–61.85 and lastly dogs in shelters with 28.7% (95%CI; 19.56–37.84. Logistic regression identified rural stray dogs as a high risk group (OR = 4.55, 95%; 2.50–8.31 and keeping dogs in shelters as a protective factor (OR = 0.24, 95%; 0.14–0.43. Molecular methods identified both Ancylostoma ceylanicum and Ancylostoma caninum with A. ceylanicum being predominant among urban stray dogs. Rural dogs had a higher prevalence of A. caninum than A. ceylanicum, while both species showed equal distribution among dogs in shelters. Phylogenetic analysis placed A. ceylanicum isolated from dogs in one group with A. ceylanicum human isolates. Conclusion This study indicates that dogs have the potential to act as reservoir hosts of human hookworm infection in Malaysia. This finding necessitates the inclusion of dogs

  9. Canine study on myocardial ischemic memory with 18F-FDG PET/CT imaging

    International Nuclear Information System (INIS)

    Xie Boqia; Yang Minfu; Dou Kefei; Han Chunlei; Tian Yi; Zhang Ping; Yang Zihe; Yin Jiye; Wang Hao

    2012-01-01

    Objective: To explore whether the existence and duration of ischemia measured by dynamic 18 F-FDG PET/CT imaging correlated with the extent of myocardial ischemia in a canine model of myocardial ischemia-reperfusion. Methods: Canine coronary artery occlusion was carried out for 20 min (n=4) and for 40 min (n=4) followed by 24 h of open-artery reperfusion. All dogs underwent dynamic 18 F-FDG PET/CT and 99 Tc m -MIBI SPECT imaging at baseline and 1 h and 24 h after reperfusion.Quantitative analysis of myocardial 18 F-FDG uptake was performed using Carimas Core software,and the extraction ratio of 18 F-FDG (K) was calculated by the ratio of 18 F-FDG uptake rate in the ischemic area (k ischemia ) and normoperfused region (k normoperfused ). Echocardiographic data were also acquired between each PET/CT imaging study to detect the wall motion in the ischemic and normoperfused myocardium. Paired t test and non-parametric statistical tests, measured by SPSS 19.0, were used to analyze the data. Results: Coronary occlusion produced sustained, abnormal wall motion in the ischemic region for more than 1 h. Similar K values were demonstrated between the 20 min and 40 min groups at baseline (1.02 ±0.06 and 1.03 ±0.05, Z=-0.29, P>0.05). At 1 h after reperfusion, the reperfusion regions showed normal perfusion but with increased 18 F-FDG uptake, which was higher in the 40 min ischemic group than in the 20 min ischemic group (2.31 ±0.13 and 1.87 ±0.09, Z=-2.31, P<0.05). At 24 h after reperfusion, however, only the 40 min ischemic group showed slightly higher 18 F-FDG uptake than baseline (1.15 ± 0.02 and 1.03 ±0.05, t=4.32, P<0.05), whereas no significant difference was found in the 20 min ischemic group (1.05 ± 0.04 and 1.02 ± 0.06, t=0.87, P>0.05). Histological examination of the ischemic myocardium from both groups revealed neatly arranged cells without interstitial edema, hemorrhage nor inflammatory response. Conclusions: Myocardial 'ischemic memory' was

  10. A rare anomaly: Double right coronary artery

    Directory of Open Access Journals (Sweden)

    Dursun Çayan Akkoyun

    2013-01-01

    Full Text Available Coronary artery anomalies are rare anomalies. Theseare usually asymptomatic and are discovered incidentally.Double right coronary artery (RCA is a rare coronaryartery anomaly. Although there is controversy aboutidentification and classification of double RCA, it is oftena benign condition, but it can be complicated by atherosclerosisand can lead to serious conditions such asmyocardial infarction (MI and may be accompanied byother anomalies. In our case, double RCA were detectedin coronary angiography for acute anterior MI, and in thenext session successful percutaneous coronary interventionwas performed.Key words: Coronary anomaly, coronary angiography,coronary stenosis

  11. Current status of hybrid coronary revascularization.

    Science.gov (United States)

    Jaik, Nikhil P; Umakanthan, Ramanan; Leacche, Marzia; Solenkova, Natalia; Balaguer, Jorge M; Hoff, Steven J; Ball, Stephen K; Zhao, David X; Byrne, John G

    2011-10-01

    Hybrid coronary revascularization combines coronary artery bypass surgery with percutaneous coronary intervention techniques to treat coronary artery disease. The potential benefits of such a technique are to offer the patients the best available treatments for coronary artery disease while minimizing the risks of the surgery. Hybrid coronary revascularization has resulted in the establishment of new 'hybrid operating suites', which incorporate and integrate the capabilities of a cardiac surgery operating room with that of an interventional cardiology laboratory. Hybrid coronary revascularization has greatly augmented teamwork and cooperation between both fields and has demonstrated encouraging as well as good initial outcomes.

  12. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2006-01-01

    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  13. Non-invasive assessment of coronary calcification

    International Nuclear Information System (INIS)

    Vliegenthart, Rozemarijn; Oei, Hok-Hay S.; Hofman, Albert; Oudkerk, Matthijs; Witteman, Jackqueline C. M.

    2004-01-01

    Electron-beam tomography (EBT) and multi-detector computed tomography (MDCT) enable the noninvasive assessment of coronary calcification. The amount of coronary calcification, as detected by EBT, has a close relation with the amount of coronary atherosclerosis, which is the substrate for the occurrence of myocardial infarction and sudden cardiac death. Calcification of the coronary arteries can be seen as a cumulative measure of life-time exposure to cardiovascular risk factors. Several studies have shown that the amount of coronary calcification is associated with the risk of coronary heart disease. Therefore, coronary calcification is a promising method for non-invasive detection of asymptomatic subjects at high risk of developing coronary heart disease. Whether measurement of coronary calcification also increases the predictive power of coronary events based on cardiovascular risk factors is topic of current research

  14. Adaptação de um sistema de ensaio biológico para detecção de fatores relaxantes endoteliais derivados do endocárdio atrial canino Adaptation of bioassay to detect endothelium-derived relaxing factors from the canine atrial endocardium

    Directory of Open Access Journals (Sweden)

    Yeow Leng Chua

    2009-06-01

    Full Text Available OBJETIVO: Estudar a liberação de fatores relaxantes derivados do endotélio (EDRF pelo endocárdio de aurículas de corações caninos. MÉTODOS: Aurículas atriais caninas foram suturadas em forma de tubos e o efluente desses tubos foram submetidos a ensaios biológicos (sistema de perfusão isolada em câmaras de órgãos utilizando artéria coronária canina, para a detecção de EDRFs. RESULTADOS: O efluente da aurícula direita promoveu relaxamento de 58,4 + 10,1% e da aurícula esquerda 74,9 + 8,5% da contração inicial obtida pela ação da prostagladina F2α em artéria coronária. Não houve diferença estatística no relaxamento da artéria coronária induzido pelos efluentes das aurículas direita e esquerda. O relaxamento induzido pelos efluentes das aurículas direita e esquerda foi abolido pelo tratamento das mesmas com Triton X-100. O tratamento das aurículas com L-NMMA, um inibidor competitivo da síntese de óxido nítrico, e com indometacina, um inibidor da via da ciclooxigenase, promoveu redução no relaxamento da artéria coronária induzido pelo efluente auricular, indicando que o endotélio endocárdico libera óxido nítrico e prostanóides. CONCLUSÕES: Esse estudo demonstra, pela primeira vez, a liberação luminal in vitro de EDRF e prostaciclina pelo átrio de coração canino. A habilidade do endotélio endocárdico em produzir esses fatores pode ter um papel importante na prevenção da formação de trombos nas câmaras cardíacas.OBJECTIVE: The aim of this study was to assess the release of endothelium-derived relaxing factors from the endocardium of canine atrial appendage. METHODS: To study the release of endothelium-derived relaxing factor (EDRF from intact atrial endocardial endothelium, tube-shaped sutures of canine atrial appendages were performed and effluents from these tubes were bioassayed (isolated perfused organ chamber system for detection of EDRF in canine coronary artery. RESULTS: Effluent from

  15. Multiple coronary stenting negatively affects myocardial recovery after coronary bypass grafting.

    Science.gov (United States)

    Yajima, Shin; Yoshioka, Daisuke; Fukushima, Satsuki; Toda, Koichi; Miyagawa, Shigeru; Yoshikawa, Yasushi; Hata, Hiroki; Saito, Shunsuke; Domae, Keitaro; Sawa, Yoshiki

    2018-05-14

    We aimed to elucidate the relationship between the magnitude of myocardial recovery after coronary artery bypass grafting (CABG) and the prognosis and to explore the predictors of myocardial non-recovery. Eighty-one patients with a preoperative left ventricular ejection fraction (LVEF) ≤ 40% who underwent isolated CABG between 2002 and 2015 and had undergone echocardiographic follow-up (median follow-up, 3.1 years; interquartile range 1.2-6.0 years) were analyzed. The Recovery group comprised patients with LVEF improvement ≥ 10%, whereas the Non-recovery group comprised those with an LVEF improvement events (MACEs), and readmission due to heart failure were evaluated. In addition, the risk factors for LVEF non-recovery were evaluated in a multivariate analysis. A total of 39 patients (48%) were in the Recovery group, whereas 42 patients (52%) were in the Non-recovery group. Although the survival and freedom from MACE rates were comparable, the rate of freedom from heart failure requiring hospitalization at 1, 5, and 8 years of follow-up was significantly lower in the Non-recovery group than in the Recovery group (p = 0.012). A history of percutaneous coronary intervention (PCI) was an exclusive independent risk factor for post-CABG myocardial non-recovery (odds ratio, 16.0; 95% confidence interval, 3.44-125). Furthermore, the number of coronary stents was negatively correlated with LVEF recovery (r = - 0.460, p = 0.024). Great consideration should be taken when performing CABG in patients with left ventricular dysfunction and a history of PCI, particularly in those with multiple coronary stents.

  16. Spinal cord activation differentially modulates ischaemic electrical responses to different stressors in canine ventricles.

    Science.gov (United States)

    Cardinal, René; Ardell, Jeffrey L; Linderoth, Bengt; Vermeulen, Michel; Foreman, Robert D; Armour, J Andrew

    2004-03-31

    Spinal cord stimulation (SCS) represents an acceptable treatment modality for patients with chronic angina pectoris refractory to standard therapy, but its mechanism of action remains unclear. To develop an experimental paradigm to study this issue, ameroid (AM) constrictors were implanted around the left circumflex coronary artery (LCx) in canines. Six weeks later, unipolar electrograms were recorded from 191 sites in the LCx territory in the open-chest, anesthetized state under basal pacing at 150 beats/min. We investigated the effect of SCS on ST segment displacements induced in the collateral-dependent myocardium in response to two stressors: (i) transient bouts of rapid ventricular pacing (TRP: 240/min for 1 min) and (ii) angiotensin II administered to right atrial neurons via their coronary artery blood supply. ST segment responses to TRP consisted of ST segment elevation in central areas of the LCx territory and ST depression at more peripheral areas. Such responses were unchanged when TRP was applied under SCS. Shortening of repolarization intervals in the metabolically compromised myocardium in response to TRP was also unaffected by SCS. In contrast, ST segment responses to intracoronary angiotensin II, which consisted of increased ST elevation, were attenuated by SCS in 6/8 preparations. The modulator effects of SCS were greatest at sites at which the greatest responses to angiotensin II occurred in the absence of SCS. These data indicate that spinal cord stimulation may attenuate the deleterious effects that stressors exert on the myocardium with reduced coronary reserve, particularly stressors associated with chemical activation of the intrinsic cardiac nervous system. Copyright 2004 Elsevier B.V.

  17. Beneficial hemodynamic effects of nicorandil in a canine model of acute congestive heart failure: comparison with nitroglycerin and cromakalim.

    Science.gov (United States)

    Noguchi, K; Matsuzaki, T; Ojiri, Y; Koyama, T; Nakasone, J; Sakanashi, M

    1998-01-01

    Comparative hemodynamic effects of nicorandil (NCR), nitroglycerin (NTG) and cromakalim (CRM) were examined in a canine model of acute congestive heart failure (CHF). CHF was produced by injections of saponin into coronary arteries of anesthetized dogs followed by volume loading and continuous i.v. infusion of methoxamine. After the treatment, aortic blood flow (AoF), left ventricular dP/dt and myocardial segment shortening (SS) markedly decreased, while the left ventricular end-diastolic pressure (LVEDP), the right atrial pressure (RAP) and the systemic vascular resistance (SVR) increased. NCR (n = 6), NTG (n = 6) and CRM (n = 8), which were administered i.v. after production of CHF, caused a comparable reduction in LVEDP. NCR and CRM profoundly increased AoF and SS but NTG did only slightly. On the other hand, NTG and NCR but not CRM significantly reduced RAP. Intracoronary NCR (n = 8) exerted no or similar effects on SS as well as systemic hemodynamic indices to those observed with i.v. NCR despite distinct coronary vasodilation. These results indicate that NCR may exert beneficial hemodynamic effects in an experimental CHF mainly due to lessening both afterload and preload rather than the coronary vasodilating effect.

  18. Diagnosing coronary artery disease after a positive coronary computed tomography angiography

    DEFF Research Database (Denmark)

    Nissen, L; Winther, S; Westra, J

    2018-01-01

    Aims: Perfusion scans after coronary computed tomography angiography (CCTA) in patients with suspected coronary artery disease (CAD) may reduce unnecessary invasive coronary angiographies (ICAs). However, the diagnostic accuracy of perfusion scans after primary CCTA is unknown. The aim...

  19. Novel lineages of Giardia intestinalis identified by genetic analysis of organisms isolated from dogs in Australia.

    Science.gov (United States)

    Monis, P T; Andrews, R H; Mayrhofer, G; Mackrill, J; Kulda, J; Isaac-Renton, J L; Ey, P L

    1998-01-01

    Infection of suckling mice with Giardia trophozoites recovered from the intestines of 11 dogs autopsied in Central and Southern Australia in each case produced an established isolate. In contrast, only 1 isolate was obtained by inoculation of faecal cysts. The organisms grew poorly in comparison with isolates from humans or non-canine animal hosts. Light microscopy revealed that the trophozoites had median bodies with the 'claw hammer' appearance typical of G. intestinalis (syn. G. duodenalis, G. lamblia) but that they differed in shape and nuclear morphology from axenic isolates of human or canine origin. Allozymic analysis of electrophoretic data representing 26 loci and phylogenetic analysis of nucleotide sequences obtained from DNA amplified from the glutamate dehydrogenase locus showed that the 11 isolates examined from Australian dogs were genetically distinct from all isolates of G. intestinalis that have been established previously from humans and animals, and also from G. muris. Both analytical methods placed 10 of the Australian canine isolates into a unique genetic lineage (designated Assemblage C) and the eleventh into a deep-rooted second branch (designated Assemblage D), each well separated from the 2 lineages (Assemblages A and B) of G. intestinalis that encompass all the genotypes known to infect humans. In contrast, 4 axenic isolates derived from dogs in Canada and Europe (the only other isolates to have been established from dogs) have genotypes characteristic of genetic Assemblages A or B. The findings indicate that the novel Giardia identified in these rural Australian dogs have a restricted host range, possibly confined to canine species. The poor success rate in establishing Giardia from dogs in vitro suggests, further, that similar genotypes may predominate as canine parasites world-wide. The absence of such organisms among isolates of Giardia that have been established from humans by propagation in suckling mice indicates that they are

  20. Vessel dilatation in coronary angiograms

    International Nuclear Information System (INIS)

    Hinterauer, L.; Goebel, N.

    1983-01-01

    Amongst 166 patients with aneurysms, ectasia or megaloarteries shown on coronary angiograms, 86.1% had dilated vessels as part of generalised coronary sclerosis (usually in patients with three-vessel disease). In 9%, dilatation was of iatrogenic origin and in 4.8% it was idiopathic. One patient had Marfan's syndrome. Amongst 9 000 patients, there were eight with megalo-arteries without stenosis; six of these had atypical angina and three suffered an infarct. Patients with definite dilatation of the coronary artery and stagnation of contrast flow required treatment. (orig.) [de

  1. Vessel dilatation in coronary angiograms

    Energy Technology Data Exchange (ETDEWEB)

    Hinterauer, L.; Goebel, N.

    1983-11-01

    Amongst 166 patients with aneurysms, ectasia or megaloarteries shown on coronary angiograms, 86.1% had dilated vessels as part of generalised coronary sclerosis (usually in patients with three-vessel disease). In 9%, dilatation was of iatrogenic origin and in 4.8% it was idiopathic. One patient had Marfan's syndrome. Amongst 9 000 patients, there were eight with megalo-arteries without stenosis; six of these had atypical angina and three suffered an infarct. Patients with definite dilatation of the coronary artery and stagnation of contrast flow required treatment.

  2. Management of coronary artery disease

    Science.gov (United States)

    Safri, Z.

    2018-03-01

    Coronary Artery Disease (CAD) is associated with significant morbidity and mortality, therefore it’s important to early and accurate detection and appropriate management. Diagnosis of CAD include clinical examination, noninvasive techniques such as biochemical testing, a resting ECG, possibly ambulatory ECG monitoring, resting echocardiography, chest X-ray in selected patients; and catheterization. Managements of CAD patients include lifestyle modification, control of CAD risk factors, pharmacologic therapy, and patient education. Revascularization consists of percutaneous coronary angioplasty and coronary artery bypass grafting. Cardiac rehabilitation should be considered in all patients with CAD. This comprehensive review highlights strategies of management in patients with CAD.

  3. PLACENTAL GROWTH FACTOR AND CORONARY NEOANGIOGENESIS IN CORONARY HEART DISEASE

    Directory of Open Access Journals (Sweden)

    M. V. Tulikov

    2013-01-01

    Full Text Available Neoangiogenesis in coronary heart disease is a protective reaction aimed to improve ischemic myocardial perfusion, by increasing the number and size of arterial collaterals. Placental growth factor (PlGF is one of the key peptides regulating angiogenic processes in atherosclerosis. In particular, a number of investigators have shown that injection of recombinant PlGF into the system or regional blood flow can stimulate neoangiogenesis. On the other hand, there is evidence confirming the involvement of PlGF in the progression of atherosclerosis and in the development of acute coronary syndrome. In this connection, the problem of investigating the efficiency and safety of possible use of PlGF preparations, as well as its place in the diagnosis of coronary heart disease and acute coronary syndrome remains urgent

  4. Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

    Science.gov (United States)

    Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

    2008-07-01

    Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

  5. Glucosamine and chondroitin use in canines for osteoarthritis: A ...

    African Journals Online (AJOL)

    Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

  6. Management of an impacted and transposed maxillary canine

    Directory of Open Access Journals (Sweden)

    Deepti A

    2010-03-01

    Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

  7. Surgical considerations and management of bilateral labially impacted canines

    Directory of Open Access Journals (Sweden)

    Yu-Shan Huang

    2016-06-01

    Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

  8. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

    Science.gov (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

    2016-11-01

    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  10. Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

    Directory of Open Access Journals (Sweden)

    Parviz Torkzaban

    2016-09-01

    Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

  11. Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

    Science.gov (United States)

    Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

    2016-07-01

    Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

  12. A survey of canine haemoprotozoan parasites from Turkey, including molecular evidence of an unnamed Babesia.

    Science.gov (United States)

    Aktas, Munir; Ozubek, Sezayi

    2017-06-01

    Canine tick-borne apicomplexan parasites have emerged in recent years, showing a wider geographic distribution and increased global prevalence. A reverse line blot assay was performed on 219 blood samples collected from domestic dogs for simultaneous detection of all named canine piroplasm species as well as Hepatozoon canis. Ten samples hybridized to the Theileria/Babesia and Babesia catch all probes but did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed 91.5%, 91.9%, 92.4%, 92.4%, and 89.2% similarity to B. canis, B. vogeli, B. rossi, B. gibsoni, and B. conradae, respectively. The highest homology (98.1-98.5%) observed was with unnamed Babesia sp. isolates (Ludhiana and Malbazar) described in dogs, Babesia sp. of buffalo origin, Babesia sp. Kashi 2, and Babesia orientalis, along with Babesia occultans of cattle origin. The partial cox1 sequence indicated that this isolate was most similar to Babesia sp. 1 HG-2012, with an identity of 86.5%. The survey revealed high prevalence of haemoprotozoans in domestic dogs (57.5%, CI 50.7-64.2), with Hepatozoon canis the most prevalent (54.3%, CI 47.5-61.117%), followed by Babesia sp. (4.6%, CI 2.2-8.2), B. vogeli (1.4%; CI 0.3-3.9), and B. canis (0.4%, CI 0-2.5). Combined infection of Hepatozoon canis and Babesia sp. was detected in five (2.3%, CI 0.7-5.2) samples and of H. canis and B. vogeli in two (0.9%, CI 0.1-3.2) dogs. The study contributes insight into the distribution and phylogenetic diversity of canine piroplasms in Turkey. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

    OpenAIRE

    Headley,Selwyn Arlington; Saito,Taís Berelli

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  14. Molecular typing of canine parvovirus strains circulating from 2008 to 2012 in an organized kennel in India reveals the possibility of vaccination failure.

    Science.gov (United States)

    Mittal, Mitesh; Chakravarti, Soumendu; Mohapatra, J K; Chug, P K; Dubey, Rahul; Upmanuyu, Vikramaditya; Narwal, P S; Kumar, Anil; Churamani, C P; Kanwar, N S

    2014-04-01

    Canine parvovirus-2 (CPV-2), which emerged in 1978, is considered as the major viral enteric pathogen of the canine population. With the emergence of new antigenic variants and incidences of vaccine failure, CPV has become one of the dreaded diseases of the canines worldwide. The present study was undertaken in an organized kennel from North India to ascertain the molecular basis of the CPV outbreaks in the vaccinated dogs. 415 samples were collected over a 5year period (2008-2012). The outbreak of the disease was more severe in 2012 with high incidence of mortality in pups with pronounced clinical symptoms. Molecular typing based on the VP2 gene was carried out with the 11 isolates from different years and compared with the CPV prototype and the vaccine strains. All the isolates in the study were either new CPV-2a (2012 isolates) or new CPV-2b (2008 and 2011 isolates). There were amino acid mutations at the Tyr324Ile and at the Thr440Ala position in five isolates from 2012 indicating new CPV mutants spreading in India. The CPV vaccines used in the present study failed to generate protective antibody titer against heterogeneous CPV antigenic types. The findings were confirmed when the affected pups were treated with hyper-immune heterogeneous purified immunoglobulin's against CPV in dogs of different antigenic types. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Coronary angiography using synchrotron radiation

    International Nuclear Information System (INIS)

    Akatsuka, Takao; Hiranaka, Yukio; Takeda, Tohru; Hyodo, Kazuyuki.

    1990-01-01

    Invasive coronary angiography is the imaging technique of choice for diagnosis of ischemic heart disease. Recently, the application of synchrotron radiation in coronary angiography has been investigated in the world, with the aim of developing the noninvasive technique for visualizing the heart. In this article, backgrounds and present situation of coronary angiography using synchrotron radiation are reviewed. Firstly, visual imaging techniques of the cardiovascular system are discussed in terms of angiography and digital subtraction angiography (DSA). Conventional temporal, energy, and hybrid subtraction modes used in DSA are referred to. Secondly, the application of synchrotron radiation is presented, focusing on the property of synchrotron radiation and K-edge subtraction angiography. Two kinds of synchrotron radiation beam methods are outlined. Interpretation of image data and various subtraction procedures remain unestablished. There is much to be done before coronary angiography using synchrotron radiation comes into a clinical practice. (N.K.)

  16. Depression following acute coronary syndrome

    DEFF Research Database (Denmark)

    Joergensen, Terese Sara Hoej; Maartensson, Solvej; Ibfelt, Else Helene

    2016-01-01

    PURPOSE: Depression is common following acute coronary syndrome, and thus, it is important to provide knowledge to improve prevention and detection of depression in this patient group. The objectives of this study were to examine: (1) whether indicators of stressors and coping resources were risk...... factors for developing depression early and later after an acute coronary syndrome and (2) whether prior depression modified these associations. METHODS: The study was a register-based cohort study, which includes 87,118 patients with a first time diagnosis of acute coronary syndrome during the period...... 2001-2009 in Denmark. Cox regression models were used to analyse hazard ratios (HRs) for depression. RESULTS: 1.5 and 9.5 % develop early (≤30 days) and later (31 days-2 years) depression after the acute coronary syndrome. Among all patients with depression, 69.2 % had first onset depression, while 30...

  17. Coronary Computed Tomography Angiography (CTA)

    Science.gov (United States)

    ... coronary arteries, may also be administered as a tablet or spray underneath your tongue. While lying on ... the scanner at one time such as with MRI. If an intravenous contrast material is used, you ...

  18. Pronounced Coronary Arteriosclerosis in Cirrhosis

    DEFF Research Database (Denmark)

    Danielsen, Karen V; Wiese, Signe; Hove, Jens

    2018-01-01

    factors including smoking, type 2 diabetes, hypertension, gender, or hypercholesterolemia. Coronary artery calcium-score was associated with diastolic dysfunction, lateral e´ (p = 0.025), but not with other markers of cardiac dysfunction. During a median follow-up of 25 months 12 patients (21%) died......BACKGROUND: The relation between excessive alcohol consumption and coronary arteriosclerosis has remained controversial. The etiology of cirrhosis has been considered a substantial risk factor for development of arteriosclerotic lesions. The coronary artery calcium-score derived from coronary CT...... and women: 136 vs. 0 HU; p alcohol-related cirrhosis was significantly higher than in nonalcohol-related cirrhosis (362 vs. 46 HU, p 

  19. Canine parvovirus in vaccinated dogs: a field study.

    Science.gov (United States)

    Miranda, C; Thompson, G

    2016-04-16

    The authors report a field study that investigated the canine parvovirus (CPV) strains present in dogs that developed the disease after being vaccinated. Faecal samples of 78 dogs that have been vaccinated against CPV and later presented with clinical signs suspected of parvovirus infection were used. Fifty (64.1 per cent) samples tested positive by PCR for CPV. No CPV vaccine type was detected. The disease by CPV-2b occurred in older and female dogs when compared with that by CPV-2c. The clinical signs presented by infected dogs were similar when any of both variants were involved. In most cases of disease, the resulting infection by field variants occurred shortly after CPV vaccination. Two dogs that had been subjected to a complete vaccination schedule and presented with clinical signs after 10 days of vaccination, had the CPV-2c variant associated. The phylogenetic studies showed a close relationship of the isolates in vaccinated dogs to European field strains. Despite the limited sample size in this study, the findings point to the significance of the continuous molecular typing of the virus as a tool to monitor the prevalent circulating CPV strains and access the efficacy of current vaccines. Adjustments on the vaccine types to be used may have to be evaluated again according to each epidemiological situation in order to achieve the dog's optimal immune protection against CPV.

  20. Genetic analysis of canine parvovirus from dogs in Australia.

    Science.gov (United States)

    Meers, J; Kyaw-Tanner, M; Bensink, Z; Zwijnenberg, R

    2007-10-01

    To determine the genetic variants of canine parvovirus-2 (CPV) present in domestic dogs in Australia and to investigate 26 cases of apparent vaccine failure. Thirty-three samples of faeces or intestinal tissues and 16 cell culture virus isolates collected over a period from 1980 to 2005 from five Australian states were analysed. Procedure DNA was extracted from the samples and a 1975 bp fragment of the VP1/2 gene of CPV was amplified by polymerase chain reaction (PCR) and sequenced. Sequences were compared to published strains of CPV-2, CPV-2a, CPV-2b and CPV-2c. Forty-one of 43 PCR-positive samples contained CPV-2a viruses. One sample collected in 2002 from a pup in northern NSW contained a CPV-2b virus. One sample that had been included in the study as a CPV-antigen negative control sample contained a CPV-2 virus. CPV-2a remains the predominant genetic variant of CPV in dogs in Australia and has not been replaced by CPV-2b or CPV-2c as in many other countries. The vaccine failures investigated in the study were likely caused not by genetic variation of field viruses but by maternal antibody interference in the response of pups to vaccination.

  1. Physiologic assessment of coronary artery fistula

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, N.C.; Beauvais, J. (Creighton Univ., Omaha, NE (USA))

    1991-01-01

    Coronary artery fistula is an uncommon clinical entity. The most common coronary artery fistula is from the right coronary artery to the right side of the heart, and it is less frequent to the pulmonary artery. The effect of a coronary artery fistula may be physiologically significant because of the steal phenomenon resulting in coronary ischemia. Based on published reports, it is recommended that patients with congenital coronary artery fistulas be considered candidates for elective surgical correction to prevent complications including development of congestive heart failure, angina, subacute bacterial endocarditis, myocardial infarction, and coronary aneurysm formation with rupture or embolization. A patient is presented in whom treadmill-exercise thallium imaging was effective in determining the degree of coronary steal from a coronary artery fistula, leading to successful corrective surgery.

  2. Physiologic assessment of coronary artery fistula

    International Nuclear Information System (INIS)

    Gupta, N.C.; Beauvais, J.

    1991-01-01

    Coronary artery fistula is an uncommon clinical entity. The most common coronary artery fistula is from the right coronary artery to the right side of the heart, and it is less frequent to the pulmonary artery. The effect of a coronary artery fistula may be physiologically significant because of the steal phenomenon resulting in coronary ischemia. Based on published reports, it is recommended that patients with congenital coronary artery fistulas be considered candidates for elective surgical correction to prevent complications including development of congestive heart failure, angina, subacute bacterial endocarditis, myocardial infarction, and coronary aneurysm formation with rupture or embolization. A patient is presented in whom treadmill-exercise thallium imaging was effective in determining the degree of coronary steal from a coronary artery fistula, leading to successful corrective surgery

  3. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

    2014-01-01

    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  4. Extraglandular and intraglandular vascularization of canine prostate.

    Science.gov (United States)

    Stefanov, Miroslav

    2004-03-01

    The literature on the vascularization of the canine prostate is reviewed and the clinical significance of prostate morphology is described. Scanning Electron Microscopy (SEM), combined with improved corrosion casting methods, reveal new morphological details that promise better diagnostics and treatment but also require expansion of clinical nomenclature. A proposal is made for including two previously unnamed veins in Nomina Anatomica Veterinaria (NAV). The canine prostate has two lobes with independent vascularization. Each lobe is supplied through the left and right a. prostatica, respectively. The a. prostatica sprouts three small vessels (cranial, middle, and caudal) towards the prostate gland. A. prostatica is a small-size artery whose wall structure is similar to the arteries of the muscular type. V. prostatica is a small-size valved vein. The canine prostate has capsular, parenchymal, and urethral vascular zones. The surface vessels of the capsule are predominantly veins and the diameter of arterial vessels is larger than that of the veins. The trabecular vessels are of two types: direct and branched. The prostate parenchyma is supplied by branches of the trabecular vessels. The periacinary capillaries are fenestrated and form a net in a circular pattern. The processes of the myoepithelial cells embrace both the acins and the periacinar capillaries. In the prostate ductal system. there are spermatozoa. The prostatic part of the urethra is supplied by an independent branch of a. prostatica. The prostatic urethral part is drained by v. prostatica, the vein of the urethral bulb and the ventral prostate veins. M. urethralis begins as early as the urethral prostatic part. The greater part of the white muscle fibers in m. urethralis suggest an enhanced anaerobic metabolism. Copyright 2004 Wiley-Liss, Inc.

  5. Single Coronary Artery Anomaly: A Case Report and Review of Literature.

    Science.gov (United States)

    Elbadawi, Ayman; Baig, Basarat; Elgendy, Islam Y; Alotaki, Erfan; Mohamed, Ahmed H; Barssoum, Kirolos; Fries, David; Khan, Muhammad; Khouzam, Rami N

    2018-02-06

    Single coronary artery is a rare anomaly, which is usually associated with other cardiac congenital abnormalities. A 56-year-old female presented with unstable angina. The patient reported complaints of typical chest pain on exertion few months prior to presentation, which progressed to become at rest. The pain was associated palpitations and dizziness. Past medical history was significant for hypertension and hyperlipidemia. Vital signs were stable. Physical examination was non-remarkable. Electrocardiogram showed normal sinus rhythm, with intermittent episodes of sinus bradycardia, and non-specific T-wave changes. Trans-thoracic echocardiogram showed normal left ventricular function and no segmental wall-motion abnormalities. Selective coronary angiography showed a normal left main coronary artery arising from left coronary cusp. The left main branched to a normal left anterior descending artery and to the left circumflex artery; a large vessel which supplied also the territory of the right coronary artery (RCA) through its terminal extension. Aortography showed absence of RCA with no other vessels arising from the right or non-coronary cusps. The patient was managed conservatively and discharged home with resolution of symptoms. We report a rare case of isolated single coronary artery with absent RCA. The patient presented with unstable angina, and was managed conservatively. Cardiologists should be aware of this rare condition, which carries a potential risk of sudden cardiac death.

  6. Correlation between coronary computed tomographic angiography and fractional flow reserve

    DEFF Research Database (Denmark)

    Kristensen, Thomas Skaarup; Engstrøm, Thomas; Kelbæk, Henning

    2010-01-01

    Coronary CT angiography (CCTA) has become an important modality to evaluate the presence of coronary artery disease. Coronary artery stenosis of intermediate severity remains a therapeutic dilemma. Measurement of fractional flow reserve (FFR) during coronary angiography is the most established...

  7. Coronary angiography in Qatar: the first ten years.

    Science.gov (United States)

    Chaikhouni, A; Gehani, A A; Horak, J; Hajar, H A

    1998-08-01

    Cardiac catheterization in Qatar was initiated in July 1982. In ten years, a total of 3900 procedures were performed at Hamad General Hospital. Computerized data registry has been maintained since 1982. Isolated coronary angiography was done in 2911 patients; of these, 2635 (90.5%) were men, and 276 (9.5%) were women, the average age of the patients was 47+/-9.2 years (range, twenty-five to eighty-eight). Patients' nationality was Qatari in 492 (17%), and other Arabs in 610 (21%), and 1512 (52%) were from the Asian subcontinent. Myocardial infarction was the most common indication (43%). Single-vessel disease was found in 638 (22%), two-vessel disease in 630 (22%), three-vessel disease in 950 (33%), and nonsignificant coronary artery disease in 693 (24%) patients. Morbidity related to the coronary angiography was reported in 147 (5%) patients, but there was no mortality related to the procedure. In 822 (28%) patients, the age was forty years or younger. The angiographic findings of these younger patients were compared with those of the older ones. Younger patients were usually men of Asian subcontinental origin with a recent myocardial infarction (MI). Often, they had normal coronary arteries or single-vessel disease. Patients of Asian subcontinent origin were usually young male patients with a recent MI, who receive streptokinase, and have single-vessel disease.

  8. Typing of Canine Parvovirus Strains Circulating in North-East China.

    Science.gov (United States)

    Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

    2017-04-01

    Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

  9. Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.

    Science.gov (United States)

    Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa

    2013-08-29

    Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.

  10. Environmental Factors and Ecosystems Associated with Canine Visceral Leishmaniasis in Northeastern Brazil.

    Science.gov (United States)

    da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; de Carvalho Araújo, Andreina; da Silva Ferreira, Juliana Isabel Giuli; Tonhosolo, Renata; Dias, Ricardo Augusto; Gennari, Solange Maria; Marcili, Arlei

    2015-12-01

    Environment influences the composition, distribution, and behavior of the vectors and mammalian hosts involved in the transmission of visceral leishmaniasis (VL), affecting the epidemiology of the disease. In Brazil, the urbanization process and canine cases of VL are indicators for local health authorities. This study aimed to investigate the occurrence of the canine visceral leishmaniasis (CVL) in Maranhão State, Brazil. Blood samples collected from 960 dogs from six municipalities and six different ecosystems (Baixada Maranhense, Mangue, Mata dos Cocais, Amazônia, Cerrado, and Restinga) to serological tests (enzyme-linked immunosorbent assay [ELISA], indirect fluorescence antibody test [IFAT], and chromatographic immunoassay methods [Dual Path Platform technology, DPP(®)]) and parasitological diagnosis. From serological tests, 11.14% (107) of the dogs were positive for CVL, with 59.16% (568), 14.5% (148), and 131% (126) positives to ELISA, DPP, and IFAT tests, respectively. Only seven animals (0.73%) were positive in a parasitological test. We also performed parasite isolation and phylogenetic characterization. All isolates of dogs obtained from Maranhão were grouped in a single branch with Leishmania infantum chagasi from Brazil. The ecosystem Amazonia presented the highest positivity rates to CVL in serological and parasitological tests. Brazilian biomes/ecosystems suffer large degradation and may favor, depending on climatic conditions, the installation of new diseases. In the case of VL, dogs are reservoirs of parasites and sentinels for human infection.

  11. Normal blood supply of the canine patella

    International Nuclear Information System (INIS)

    Howard, P.E.; Wilson, J.W.; Robbins, T.A.; Ribble, G.A.

    1986-01-01

    The normal blood supply of the canine patella was evaluated, using microangiography and correlated histology. Arterioles entered the cortex of the patella at multiple sites along the medial, lateral, and dorsal aspects. The body of the patella was vascularized uniformly, with many arterioles that branched and anastomosed extensively throughout the patella. The patella was not dependent on a single nutrient artery for its afferent supply, but had an extensive interior vascular network. These factors should ensure rapid revascularization and healing of patellar fractures, provided appropriate fracture fixation is achieved

  12. Definition, Classification, and Pathophysiology of Canine Glaucoma.

    Science.gov (United States)

    Pizzirani, Stefano

    2015-11-01

    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Canine distemper virus-associated hypocalcemia.

    Science.gov (United States)

    Weisbrode, S E; Krakowka, S

    1979-01-01

    A retrospective study was done to correlate serum calcium concentrations and parathyroid gland ultrastructure to clinical, immunologic, and pathologic changes experimentally induced in gnotobiotic dogs by canine distemper virus (CDV). Dogs infected with CDV had significantly reduced serum calcium concentrations associated with ultrastructural evidence of parathyroid gland inactivity, degeneration, and viral inclusions. Although CDV-infected dogs exhibited neurologic signs, minimal lesions were present in the central nervous system. It is suggested that viral-induced parathyroid dysfunction may contribute to neutrologic disturbance of CDV infection.

  14. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1990-01-01

    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were given...... intravenously to mark the bone level at these times, respectively. Oxytetracycline, which defined the baseline of bone at implantation of HA, was detectable in 42% of animals that were irradiated and in no animal of the nonirradiated control group. The marker DCAF, designating levels of bone at the start...

  15. Embolus radiolabelling in a new canine model

    International Nuclear Information System (INIS)

    Kaufman, H.H.; Huchton, J.D.; Woo, J.; Cannon, D.C.; Anderson, J.H.

    1980-01-01

    Embolus radiolabelling with 131 I fibrinogen was studied in a canine model of internal carotid artery embolization. The dog was chosen as the experimental animal because of its maxillocarotid artery which permits collateral flow round the occlusion and helps to prevent strokes. Clot was prepared by incubating blood at room temperature to inactivate plasminogen activators and then refrigerating it to promote clot retraction. Emboli persisting 48 hours were seen in 80% of animals. Major strokes were not seen when 0.25 to 0.30 cm 3 were used. Autoradiography and well counting revealed uptake of isotope. The test, when refined, should provide a tool for the investigation of thromboemboli. (author)

  16. Functional Characterization of Canine Interferon-Lambda

    Science.gov (United States)

    Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

    2014-01-01

    In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

  17. Esthetic orthodontic correction of a canine crossbite.

    Science.gov (United States)

    Park, Jae Hyun; Kim, Tae Weon

    2010-01-01

    Serial Aligners are fabricated from the working cast at certain intervals during treatment. It offers flexibility to change the treatment plan at any stage throughout the course of treatment. The tooth movement is very efficient and the patient feels comfortable because Clear Aligner comes in three different thicknesses of plastic sheets. It enables the patient to receive necessary dental treatments during the aligner treatment. The treatment can also be restarted easily even when the patient has not worn the aligners for a period of time. This article reports a patient with canine crossbite combined with moderate crowding that was successfully treated using Serial Aligners.

  18. The Genetics of Canine Skull Shape Variation

    Science.gov (United States)

    Schoenebeck, Jeffrey J.; Ostrander, Elaine A.

    2013-01-01

    A dog’s craniofacial diversity is the result of continual human intervention in natural selection, a process that began tens of thousands of years ago. To date, we know little of the genetic underpinnings and developmental mechanisms that make dog skulls so morphologically plastic. In this Perspectives, we discuss the origins of dog skull shapes in terms of history and biology and highlight recent advances in understanding the genetics of canine skull shapes. Of particular interest are those molecular genetic changes that are associated with the development of distinct breeds. PMID:23396475

  19. Early and long-term outcomes of coronary artery bypass grafting in patients with acute coronary syndrome versus stable angina pectoris.

    Science.gov (United States)

    Fukui, Toshihiro; Tabata, Minoru; Morita, Satoshi; Takanashi, Shuichiro

    2013-06-01

    The aim of the present study was to determine the early and long-term outcomes of coronary artery bypass grafting in patients with acute coronary syndrome and stable angina pectoris. From September 2004 to September 2011, 382 patients with acute coronary syndrome (unstable angina pectoris and non-ST-segment elevation myocardial infarction) and 851 patients with stable angina pectoris underwent first-time isolated coronary artery bypass grafting at our institute. The early and long-term outcomes were compared between the 2 groups. Patients with acute coronary syndrome were older, were more likely to be women, had a smaller body surface area, and were more likely to have left main coronary artery disease. In both groups, bilateral internal thoracic artery grafts were used in approximately 89% of the patients, and off-pump techniques in approximately 97% of the patients. The acute coronary syndrome group had a greater operative death rate (2.6% vs 0.1%) and a greater incidence of low output syndrome (3.1% vs 1.2%) and hemodialysis requirement (2.9% vs 1.1%). Multivariate regression analysis demonstrated that age, acute coronary syndrome, lower ejection fraction, and higher creatinine level before surgery were independent predictors of operative death. However, among the hospital survivors, no differences were seen in freedom from all death (85.4% ± 2.5% vs 87.7% ± 2.0%), cardiac death (97.4% ± 0.9% vs 96.5% ± 0.9%), or major adverse cardiac and cerebrovascular events (78.0% ± 2.9% vs 78.1% ± 2.3%) at 7 years between the patients with acute coronary syndrome and stable angina pectoris. Although acute coronary syndrome is an independent predictor of early mortality in patients undergoing coronary artery bypass grafting, the long-term outcomes after surgery were similar between patients with acute coronary syndrome and stable angina pectoris who survived the early postoperative period. Copyright © 2013 The American Association for Thoracic Surgery. Published by

  20. Macrophage cholesterol efflux correlates with lipoprotein subclass distribution and risk of obstructive coronary artery disease in patients undergoing coronary angiography

    Directory of Open Access Journals (Sweden)

    Kremer Werner

    2009-04-01

    Full Text Available Abstract Background Studies in patients with low HDL have suggested that impaired cellular cholesterol efflux is a heritable phenotype increasing atherosclerosis risk. Less is known about the association of macrophage cholesterol efflux with lipid profiles and CAD risk in normolipidemic subjects. We have therefore measured macrophage cholesterol efflux in142 normolipidemic subjects undergoing coronary angiography. Methods Monocytes isolated from blood samples of patients scheduled for cardiac catheterization were differentiated into macrophages over seven days. Isotopic cholesterol efflux to exogenously added apolipoprotein A-I and HDL2 was measured. Quantitative cholesterol efflux from macrophages was correlated with lipoprotein subclass distribution in plasma from the same individuals measured by NMR-spectroscopy of lipids and with the extent of coronary artery disease seen on coronary angiography. Results Macrophage cholesterol efflux was positively correlated with particle concentration of smaller HDL and LDL particles but not with total plasma concentrations of HDL or LDL-cholesterol. We observed an inverse relationship between macrophage cholesterol efflux and the concntration of larger and triglyceride rich particles (VLDL, chylomicrons. Subjects with significant stenosis on coronary angiography had lower cholesterol efflux from macrophages compared to individuals without significant stenosis (adjusted p = 0.02. Conclusion Macrophage cholesterol efflux is inversely correlated with lipoprotein particle size and risk of CAD.

  1. Diastolic coronary artery pressure-flow velocity relationships in conscious man.

    Science.gov (United States)

    Dole, W P; Richards, K L; Hartley, C J; Alexander, G M; Campbell, A B; Bishop, V S

    1984-09-01

    We characterised the diastolic pressure-flow velocity relationship in the normal left coronary artery of conscious man before and after vasodilatation with angiographic contrast medium. Phasic coronary artery pressure and flow velocity were measured in ten patients during individual diastoles (0.5 to 1.0 s) using a 20 MHz catheter-tipped, pulsed Doppler transducer. All pressure-flow velocity curves were linear over the diastolic pressure range of 110 +/- 15 (SD) mmHg to 71 +/- 7 mmHg (r = 0.97 +/- 0.01). In the basal state, values for slope and extrapolated zero flow pressure intercept averaged 0.35 +/- 0.12 cm X s-1 X mmHg-1 and 51.7 +/- 8.6 mmHg, respectively. Vasodilatation resulted in a 2.5 +/- 0.5 fold increase in mean flow velocity. The diastolic pressure-flow velocity relationship obtained during peak vasodilatation compared to that during basal conditions was characterised by a steeper slope (0.80 +/- 0.48 cm X s-1 X mmHg-1, p less than 0.001) and lower extrapolated zero flow pressure intercept (37.9 +/- 9.8 mmHg, p less than 0.05). Mean right atrial pressure for the group averaged 4.4 +/- 1.7 mmHg, while left ventricular end-diastolic pressure averaged 8.7 +/- 2.8 mmHg. These observations in man are similar to data reported in the canine coronary circulation which are consistent with a vascular waterfall model of diastolic flow regulation. In this model, coronary blood flow may be regulated by changes in diastolic zero flow pressure as well as in coronary resistance.

  2. Skeletal maturity assessment using mandibular canine calcification stages

    Directory of Open Access Journals (Sweden)

    Vildana Džemidžić

    2016-11-01

    Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

  3. Stem Cell-Associated Marker Expression in Canine Hair Follicles.

    Science.gov (United States)

    Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

    2016-03-01

    Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

  4. Cone beam computed tomography findings of impacted upper canines

    Energy Technology Data Exchange (ETDEWEB)

    Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

    2014-12-15

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  5. Evaluation of P16 expression in canine appendicular osteosarcoma.

    Science.gov (United States)

    Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

    2017-06-20

    Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

  6. Upper canine inclination influences the aesthetics of a smile.

    Science.gov (United States)

    Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

    2015-02-01

    This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

  7. Cone beam computed tomography findings of impacted upper canines

    International Nuclear Information System (INIS)

    Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

    2014-01-01

    To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

  8. Coronary artery anomalies in Turner Syndrome.

    Science.gov (United States)

    Viuff, Mette H; Trolle, Christian; Wen, Jan; Jensen, Jesper M; Nørgaard, Bjarne L; Gutmark, Ephraim J; Gutmark-Little, Iris; Mortensen, Kristian H; Gravholt, Claus Højbjerg; Andersen, Niels H

    Congenital heart disease, primarily involving the left-sided structures, is often seen in patients with Turner Syndrome. Moreover, a few case reports have indicated that coronary anomalies may be more prevalent in Turner Syndrome than in the normal population. We therefore set out to systematically investigate coronary arterial anatomy by computed tomographic coronary angiography (coronary CTA) in Turner Syndrome patients. Fifty consecutive women with Turner Syndrome (mean age 47 years [17-71]) underwent coronary CTA. Patients were compared with 25 gender-matched controls. Coronary anomaly was more frequent in patients with Turner Syndrome than in healthy controls [20% vs. 4% (p = 0.043)]. Nine out of ten abnormal cases had an anomalous left coronary artery anatomy (absent left main trunk, n = 7; circumflex artery originating from the right aortic sinus, n = 2). One case had a tubular origin of the right coronary artery above the aortic sinus. There was no correlation between the presence of coronary arterial anomalies and karyotype, bicuspid aortic valve, or other congenital heart defects. Coronary anomalies are highly prevalent in Turner Syndrome. The left coronary artery is predominantly affected, with an absent left main coronary artery being the most common anomaly. No hemodynamically relevant coronary anomalies were found. Copyright © 2016 Society of Cardiovascular Computed Tomography. All rights reserved.

  9. Rate of retraction of anterior teeth after canine distraction

    Directory of Open Access Journals (Sweden)

    Litesh Singla

    2017-01-01

    Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

  10. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  11. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-10-01

    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  12. Intracellular Route of Canine Parvovirus Entry

    Science.gov (United States)

    Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti

    1998-01-01

    The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290

  13. Expression of Bcl-2 in canine osteosarcoma

    Science.gov (United States)

    Piro, F.; Leonardi, L.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359

  14. Expression of Bcl-2 in canine osteosarcoma

    Directory of Open Access Journals (Sweden)

    F. Piro

    2015-03-01

    Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.

  15. First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.

    Science.gov (United States)

    Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep

    2016-09-01

    The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.

  16. Orthodontic treatment of a complete transposed impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Pi-Huei Liu

    2015-03-01

    Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

  17. Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

    Science.gov (United States)

    Glickman, L T; Appel, M J

    1981-08-01

    Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

  18. Models of experimental saccular aneurysms of carotid arteries in canine

    International Nuclear Information System (INIS)

    Zhang Haixia; Cheng Yingsheng; Li Minghua

    2006-01-01

    Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

  19. Early results of coronary artery bypass grafting with coronary endarterectomy for severe coronary artery disease

    Directory of Open Access Journals (Sweden)

    Toischer Karl

    2009-09-01

    Full Text Available Abstract Background Despite the existence of controversial debates on the efficiency of coronary endarterectomy (CE, it is still used as an adjunct to coronary artery bypass grafting (CABG. This is particularly true in patients with endstage coronary artery disease. Given the improvements in cardiac surgery and postoperative care, as well as the rising number of elderly patient with numerous co-morbidities, re-evaluating the pros and cons of this technique is needed. Methods Patient demographic information, operative details and outcome data of 104 patients with diffuse calcified coronary artery disease were retrospectively analyzed with respect to functional capacity (NYHA, angina pectoris (CCS and mortality. Actuarial survival was reported using a Kaplan-Meyer analysis. Results Between August 2001 and March 2005, 104 patients underwent coronary artery bypass grafting (CABG with adjunctive coronary endarterectomy (CE in the Department of Thoracic-, Cardiac- and Vascular Surgery, University of Goettingen. Four patients were lost during follow-up. Data were gained from 88 male and 12 female patients; mean age was 65.5 ± 9 years. A total of 396 vessels were bypassed (4 ± 0.9 vessels per patient. In 98% left internal thoracic artery (LITA was used as arterial bypass graft and a total of 114 vessels were endarterectomized. CE was performed on right coronary artery (RCA (n = 55, on left anterior descending artery (LAD (n = 52 and circumflex artery (RCX (n = 7. Ninety-five patients suffered from 3-vessel-disease, 3 from 2-vessel- and 2 from 1-vessel-disease. Closed technique was used in 18%, open technique in 79% and in 3% a combination of both. The most frequent endarterectomized localization was right coronary artery (RCA = 55%. Despite the severity of endstage atherosclerosis, hospital mortality was only 5% (n = 5. During follow-up (24.5 ± 13.4 months, which is 96% complete (4 patients were lost caused by unknown address 8 patients died (cardiac

  20. Pattern and predictors of dual antiplatelet use after coronary artery bypass graft surgery.

    Science.gov (United States)

    Mori, Makoto; Shioda, Kayoko; Yun, James J; Mangi, Abeel A; Darr, Umer; Geirsson, Arnar

    2018-02-01

    Resumption of dual antiplatelet therapy after coronary artery bypass grafting in patients presenting with acute coronary syndrome is recommended, but the current practice pattern in the United States remains unknown. We aimed to investigate the current pattern of dual antiplatelet therapy use after coronary artery bypass grafting at the Yale-New Haven Hospital. We conducted a single-center retrospective review of patients who presented with acute coronary syndrome and underwent coronary artery bypass grafting between 2014 and 2016. The primary outcome was hospital discharge with dual antiplatelet therapy. Mixed-effect multivariate logistic regression was used to evaluate predictors of dual antiplatelet therapy use or nonuse, accounting for surgeon-specific preference. The discriminatory ability of the model was evaluated with receiver operating characteristics analysis. Of 572 patients included, only 29% were discharged with dual antiplatelet therapy. In the mixed-effect multivariate model isolating surgeon preferences, increase in age (odds ratio, 0.95; 95% confidence interval, 0.92-0.98; P dual antiplatelet therapy use. Off-pump coronary artery bypass grafting compared with on-pump coronary artery bypass grafting was associated with increased odds of dual antiplatelet therapy use (odds ratio, 31.5; 95% confidence interval, 12.8-77.2; P dual antiplatelet therapy use in patients with acute coronary syndrome who underwent coronary artery bypass grafting was low and variable among surgeons. The use or nonuse was guided by previously established risk factors of recurrent ischemia and bleeding, along with surgeon preference. Published by Elsevier Inc.

  1. Does grafting coronary arteries with only moderate stenosis affect long-term mortality?

    Science.gov (United States)

    Sabik, Joseph F.; Olivares, Gabriel; Raza, Sajjad; Lytle, Bruce W.; Houghtaling, Penny L.; Blackstone, Eugene H.

    2016-01-01

    Objective Stenting coronary arteries with non–ischemia-producing moderate stenosis leads to worse outcomes than leaving them unstented. We sought to determine whether grafting coronary arteries with angiographically moderate stenosis is associated with worse long-term survival than leaving them ungrafted. Methods From 1972 to 2011, 55,567 patients underwent primary isolated coronary artery bypass grafting (CABG); 8531 had a single coronary artery with moderate (50%-69%) stenosis, bypassed in 6598 (77%) and not bypassed in 1933 (23%). These arteries were grafted with internal thoracic arteries (ITAs) in 1806 patients (27%) and with saphenous veins (SVs) in 4625 (70%). Mean follow-up for all-cause mortality was 13.0 ± 9.7 years. Results Survival was similar for patients with and without a graft to the moderately stenosed coronary artery (P = .3): 97%, 76%, 43%, and 18% at 1, 10, 20, and 30 years among patients receiving no graft; 97%, 74%, 41%, and 18% among those receiving an SV graft; and 98%, 82%, 51%, and 23% among those receiving an ITA graft. After adjusting for patient characteristics, SV grafting versus nongrafting of moderately stenosed coronary arteries was associated with similar long-term mortality (P = .2), whereas ITA grafting was associated with 22% lower long-term mortality (hazard ratio 0.78; 68% confidence interval 0.75–0.82; P<.0001). Conclusions Grafting coronary arteries with angiographically moderate stenosis is not harmful. Instead, ITA grafting of such coronary arteries is associated with lower long-term mortality. Thus, after placing the first ITA to the left anterior descending, the second ITA should be placed to the second most important coronary artery, even if it is moderately stenosed. PMID:26611750

  2. Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

    Science.gov (United States)

    Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

    2014-07-01

    This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Coronary ostium occlusion by coronary cusp displacement in Williams syndrome.

    Science.gov (United States)

    Shiohama, Tadashi; Fujii, Katsunori; Ebata, Ryota; Funabashi, Nobusada; Matsumiya, Goro; Saito, Yuko Kazato; Takechi, Fumie; Yonemori, Yoko; Nakatani, Yukio; Shimojo, Naoki

    2016-06-01

    Williams syndrome is a contiguous gene deletion syndrome resulting from a heterozygous deletion on chromosome 7q11.23, and is characterized by distinctive facial features and supravalvular aortic stenosis (SVAS). This syndrome rarely presents unpredictable cardiac death, and yet, as illustrated in the present case, it is still not possible to predict it, even on close monitoring. We herein describe the case of a 6-year-old Japanese girl with Williams syndrome, who had sudden cardiac collapse due to cardiac infarction after pharyngitis. Cardiac failure followed a critical course that did not respond to catecholamine support or heart rest with extracardiac mechanical support. Although marked coronary stenosis was not present, the left coronary cusp abnormally adhered to the aortic wall, which may synergistically cause coronary ostium occlusion with SVAS. Altered hemodynamic state, even that caused by the common cold, may lead to critical myocardial events in Williams syndrome with SVAS. © 2015 Japan Pediatric Society.

  4. NEUROTICISM PROFILE IN CORONARY HEART DISEASE

    OpenAIRE

    Bhargava, S. C.; Sharma, S. N.; Agarwal, B. V.

    1980-01-01

    SUMMARY Thirty seven cases of coronary heart disease and 30 normal healthy controls were administered Hindi version of MHQ. The coronary heart disease patients scored significantly higher on total neuroticism, free-floating anxiety and somatic anxiety subscales of MHQ.

  5. Coronary artery with aberrant origin malignant right

    International Nuclear Information System (INIS)

    Ozcan, E.; Bozlar, U.; Demirkol, S.; Saglam, M.

    2012-01-01

    Full text: Introduction: Congenital anomalies of the coronary arteries is a major cause of sudden death, especially in young patients. Objectives and tasks: In this study we aim to present a young patient with chest pain who had malignant right coronary artery (RCA) with aberrant origin. Materials and methods: 24-year-old man who applied cardiology clinic for chest pain and palpitations especially after exercise, was referred to our clinic for coronary computed tomography (CT) angiography to evaluate coronary artery anomalies. Results: In CT angiography; we detected aberrant RCA with origin of tubularly part of ascendant aorta with a malignant course between aorta and pulmonary artery. Left main coronary artery, left anterior descending and circumflex artery had normal origin and course. Conclusion: Coronary artery with malignant course may cause sudden death especially after exercise. Coronary CT angiography has an important role in diagnosis of congenital coronary artery anomalies, with high resolution multiplanner reformatted images

  6. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden

    2002-07-01

    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  7. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

    Science.gov (United States)

    van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

    2002-03-01

    Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  8. Upregulation of endothelin ETB receptor-mediated vasoconstriction in rat coronary artery after organ culture

    DEFF Research Database (Denmark)

    Eskesen, Karen; Edvinsson, Lars

    2006-01-01

    The aim of this study was to examine if endothelin ET(B) receptor-mediated contraction occurred in isolated segments of rat coronary arteries during organ culture. Presence of contractile endothelin ET(B) receptors was studied by measuring the change in isometric tension in rings of left anterior......(+)-solution was not modified after 1 day in culture medium. The experiments indicate that organ culture of rat coronary arteries upregulate endothelin ET(B) receptor-mediated contraction by inducing synthesis of new protein....... descending coronary arteries isolated from hearts of rats as response to application of the selective endothelin ET(B) receptor agonist, Sarafotoxin 6c and endothelin-1. In segments cultured 1 day in serum free Dulbecco's Modified Eagle's Medium, Sarafotoxin 6c induced a concentration dependent contraction...

  9. Coronary spasm induced by dipyridamole

    International Nuclear Information System (INIS)

    Wartski, M.; Caussin, C.; Lancelin, B.

    2001-01-01

    A 59 years old man was admitted at hospital for recurrent instable angina 1 month after coronary artery bypass surgery. Coronary artery disease started with a transmural antero-septo-apical myocardial infarction without thrombolysis and a percutaneous angioplasty with endo-prothesis on proximal left anterior descendant artery (LAD) is performed Because of recurrent rest angina and subacute stent thrombosis, a coronary artery bypass surgery (CABG) is performed with anastomosis of the left internal thoracic artery on LAD. The patient is admitted for recurrent rest angina one month after CABG. On ECG performed during chest pain, a ST-T segment elevation occurred on inferior leads. Coronary angiography showed no significant stenosis on endo-prothesis and no bypass graft dysfunction. Dipyridamole scintigraphy was realized. 2 minutes after the beginning of Dipyridamole infusion, a ST-T elevation occurred on inferior leads and two marked antero-septal and inferior defects were noticed on myocardial scintigraphy. Images at rest showed a clear improvement in the anterior wall and the inferior wall became normally perfused Patient was treated with anti-spastic drugs and a new coronarography with methyl-ergotamine test was performed inducing chest pain, ST-T elevation on inferior leads and tri-truncular coronary spasm. Patient's treatment was then modified with introduction of Nifedipine. The patient did not experienced new recurrent chest pain and remained totally asymptomatic few months later. (authors)

  10. The effect of percutaneous transcatheter occlusion of left atrial appendage on left atrium and adjacent anatomic structure in canine

    International Nuclear Information System (INIS)

    Yang Zhihong; Wu Hong; Qin Yongwen; Hu Jianqiang; Ding Zhongru; Liu Zongjun; Liu Biao; Zheng Xing

    2009-01-01

    Objective: To observe the effect of percutaneous transcatheter occlusion of left atrial appendage (LAA) with a new self-manufactured LAA occluder on left atrium and adjacent anatomic structure in canine. Methods: A new self-manufactured LAA occluder was implanted into the LAA through a transseptal catheter in 20 dogs. Before and after the procedure, the experimental dogs were anaesthetized and examined by transthoracic echocardiography (TTE) to measure the diameter and the volume of the left atrium, the left superior pulmonary vein flow velocity and the left atrioventricular valve flow velocity separately. The contrast radiography of the LAA and the left coronary arteriography were performed. Results: The new LAA occluder was implanted successfully in 14 dogs. No obvious changes in the diameter and the volume of the left atrium, in left superior pulmonary vein flow velocity and in left atrioventricular valve flow velocity were found. On arteriography, left circumflex artery was normally displayed after the procedure. No migration of the occluder was seen on TTE and angiography after procedure. Conclusion: Percutaneous transcatheter occlusion of left atrial appendage with a new self-manufactured LAA occluder has no obvious effect on left atrium and adjacent anatomic structure in experimental canine, which indicates that the new-type device is a safe and feasible occluder for LAA. (authors)

  11. Immunophenotypical characterization of canine mesenchymal stem cells from perivisceral and subcutaneous adipose tissue by a species-specific panel of antibodies.

    Science.gov (United States)

    Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio

    2017-10-01

    Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. SEROLOGIC RESPONSE TO CANINE DISTEMPER VACCINATION IN CAPTIVE LINNAEUS'S TWO-TOED SLOTHS ( CHOLOEPUS DIDACTYLUS) AFTER A FATAL CANINE DISTEMPER VIRUS OUTBREAK.

    Science.gov (United States)

    Sheldon, Julie D; Cushing, Andrew C; Wilkes, Rebecca P; Anis, Eman; Dubovi, Edward J

    2017-12-01

    Canine distemper virus (CDV) affects many wild and captive, nondomestic species worldwide but has not been previously reported in Xenarthra. Paucity of information on vaccination safety and efficacy presents challenges for disease prevention in captive collections. CDV infections and subsequent mortalities in five captive Linnaeus's two-toed sloths ( Choloepus didactylus) in eastern Tennessee are reported. Clinical signs included oculonasal discharge, oral ulcerations, and diarrhea, and the diagnosis was confirmed by necropsy, histopathology, immunohistochemistry, virus isolation, and polymerase chain reaction. Viral sequencing identified the strain to be consistent with a new CDV lineage currently affecting domestic dogs and wildlife in Tennessee. Seven sloths were examined and vaccinated using a recombinant CDV vaccine on days 0 and 21. Subsequent blood samples showed increased titers in 3/4 sloths. Based on the outbreak and serologic findings postvaccination without adverse effects, the authors recommend recombinant CDV vaccination in sloths exposed to known carriers of CDV.

  13. Imaging experimental coronary artery thrombosis with indium-111 platelets

    International Nuclear Information System (INIS)

    Riba, A.L.; Thakur, M.L.; Gottschalk, A.; Zaret, B.L.

    1979-01-01

    The ability of cardiac scintigraphy with indium-111 ( 111 In)-labeled platelets to detect coronary artery thrombosis (CAT) was assessed in a canine model. Cardiac imaging and tissue distribution studies were performed shortly after administering 111 In-labeled platelets to 12 dogs (group 1) with acute CAT. Four dogs (group 2) with acute CAT were studied 2 and 22 hours after administering 111 In platelets. In addition, four dogs (group 3) with 24-hour-old CAT were similarly evaluated. In all group 1 animals, in vivo imaging 1 to 2 hours after 111 In platelet administration revealed intense uptake in the region of thrombus-containing left anterior descending arteries that was readily discernible from background blood pool activity. Sequential imaging of the four group 2 animals over a 22-hour period revealed no change in the scintigraphic pattern of the thrombosed arteries. In contrast, 111 In platelet imaging in the four group 3 animals with 24-hour-old CAT failed to reveal enhanced activity within the region of the thrombus-containing coronary artery. In the 12 group 1 animals, the CAT accumulated 69 +- 10 (mean +- SEM) times greater activity than present in blood and 651 +- 135 times greater activity than normal left ventricular myocardium. There was 24 +- 7 times greater 111 In activity in the damaged left anterior descending arteries compared with normal circumflex arteries. Similar uptake ratios were seen in group 2 animals. The 24-hour old thrombi from group 3 animals showed no enhanced 111 In uptake. This study demonstrates that experimental acute CAT can be detected readily with 111 In platelet cardiac scintigraphy

  14. Detection of coronary calcification in ultrafast CT compared to coronary angiography

    International Nuclear Information System (INIS)

    Koesling, S.; Hoffmann, U.; Rother, T.; Lieberenz, S.; Heywang-Koebrunner, S.H.; Schulz, H.G.

    1994-01-01

    The angiographical findings of 24 patients with coronary artery disease were compared with qualitative and quantitative detection of coronary calcification by ultrafast CT. Doubts concerning the capabilities of the ultrafast CT for a screening of coronary artery disease arise when the results of one third false positive and fase negative findings are considered. Variations in the quantification of coronary calcification were too great to allow a realistic assessment of the degree of stenosis of the coronary arteries. (orig.) [de

  15. HUMAN CORONARY ARTERIES- A STUDY BASED ON GROSS ANATOMY AND CORONARY CAST

    Directory of Open Access Journals (Sweden)

    Vijayamma K. N

    2018-01-01

    Full Text Available BACKGROUND Present study is an attempt to throw light upon the coronary arterial pattern, variations in arterial distribution and extent of intercoronary anastomosis and arterial preponderance in different age groups. MATERIALS AND METHODS Total of 115 hearts were made use for this study. Ninety hearts were dissected for the gross anatomical study of coronary arteries and 25 hearts including three fetal hearts were used for the coronary cast study. The right and left coronary arteries were traced from aortic sinus along the atrioventricular groove to the area of its termination. The atrial ventricular and septal branches were traced and looked for anastomosis. Coronary casts were prepared by injecting coloured liquid latex through the coronary ostia and the branching pattern and anastomosis were studied. The coronary arterial pattern, extent of distribution of its branches, arterial preponderance and variations were observed. RESULTS It was found that 73 % cases of SA nodal branch arise from right coronary artery and 27 % from circumflex branch of left coronary artery. SA node has dual blood supply from both coronary arteries in 4% cases. Right coronary preponderance was observed in 83% of cases and left coronary preponderance in 11 % cases, and balanced supply in 6% cases. Coronary cast was helpful to understand the branching pattern of vessels, and the anastomosis of small capillaries. It was also seen that all 11 % of left preponderance were seen in male hearts and all of the 31 female hearts dissected were right preponderant. CONCLUSION Coronary arteries are called end arteries functionally. Right coronary artery originates from anterior aortic sinus in all cases except one which takes origin from posterior left aortic sinus along with left coronary artery. Right coronary preponderance is observed in 83% cases. Left coronary artery branching pattern shows variability. Left coronary preponderance was observed in 11% and all cases are male

  16. Liposome kinetics in infarcted canine myocardium

    International Nuclear Information System (INIS)

    Caride, V.J.; Twickler, J.; Zaret, B.L.

    1984-01-01

    To study the mechanisms and kinetics of liposome deposition in the region of the experimental myocardial infarction, the myocardial distribution of positive and negative liposomes was determined as a function of regional myocardial blood flow and time after administration. The study was performed in dogs at 1 and 24 h following experimental myocardial infarction. Twenty-four hours after coronary artery occlusion, the initial myocardial distribution of positive and negative liposomes (2 min) is directly proportional to regional myocardial blood flow. With time, there is reduction of the radiotracer associated with negative liposomes from all myocardial regions (p less than 0.01). In contrast, in areas of moderate and severe blood flow reduction, there is progressive accumulation of tracers entrapped or incorporated in positive liposomes. This increment becomes significant in 120 min (p less than 0.005). Similar findings are observed in studies performed 1 h after coronary artery occlusion. Dual-label liposomes [( 3 H]cholesterol and [99mTc]diethylenetriamine pentaacetic acid) were used to study the integrity of liposomes in normal and ischemic myocardium. Significant dissociation of the aqueous and lipid labels of positive liposomes is observed 1 h following coronary artery occlusion. In the 24-h myocardial infarction model, dissociation of the aqueous and lipid labels in ischemic myocardium is also observed. This phenomenon is more pronounced with positive than with negative liposomes (p less than 0.02)

  17. Progress in genetics of coronary artery disease

    African Journals Online (AJOL)

    Radwa Gamal

    To the Editor. Coronary Heart Disease (CHD) is the leading cause of mortality and morbidity worldwide [1] and it is a result of coronary artery disease (CAD). Coronary artery disease refers to the build-up of atherosclerotic plaque in the blood vessels that supply oxygen and nutrients to the heart. Progressive infiltration of the ...

  18. Coronary CT in Acute Cardiac Care

    NARCIS (Netherlands)

    A. Dedic (Admir)

    2016-01-01

    markdownabstractCoronary CT angiography is a well-established diagnostic modality for stable angina pectoris. It provides an angiographic, non-invasive alternative for the diagnosis of coronary artery disease, exceeding in the ability to exclude important coronary artery disease. Having the ability

  19. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  20. Management of an Unusual Ectopic Eruption of Maxillary Canine.

    Science.gov (United States)

    Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

    2017-05-01

    Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

  1. The Comparative Diagnostic Features of Canine and Human Lymphoma

    Directory of Open Access Journals (Sweden)

    Davis M. Seelig

    2016-06-01

    Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  2. Death of a wild wolf from canine parvovirus enteritis

    Science.gov (United States)

    Mech, L.D.; Kurtz, H.J.; Goyal, S.

    1997-01-01

    A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

  3. Canine index – A tool for sex determination

    Directory of Open Access Journals (Sweden)

    Shankar M. Bakkannavar

    2015-12-01

    Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

  4. The Comparative Diagnostic Features of Canine and Human Lymphoma.

    Science.gov (United States)

    Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

    2016-06-01

    The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  5. Difficulties in estimating the human burden of canine rabies.

    Science.gov (United States)

    Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

    2017-01-01

    Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Dentigerous Cyst Associated with Ectopic Canine and a ...

    African Journals Online (AJOL)

    ankylosis, cystic or neoplastic lesion or trauma may be the local factors ... After clinical and radiographic examination, a provisional diagnosis of ... bone along with the impacted teeth (permanent ectopic canine ... [7] Panoramic radiograph and ...

  7. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  8. Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

    Science.gov (United States)

    Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

    2015-07-01

    In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.

  9. High prevalence of small Babesia species in canines of Kerala, South India.

    Science.gov (United States)

    Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil

    2017-11-01

    Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni , in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni . Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni . Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni , Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

  10. High prevalence of small Babesia species in canines of Kerala, South India

    Directory of Open Access Journals (Sweden)

    Kollannur Jose Jain

    2017-11-01

    Full Text Available Aim: Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni, in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. Materials and Methods: A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni. Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. Results: A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/ BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni, Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. Conclusion: A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

  11. Venous coronary artery bypass surgery. A 15-year follow-up study

    NARCIS (Netherlands)

    van Brussel, B. L.; Plokker, H. W.; Ernst, S. M.; Ernst, N. M.; Knaepen, P. J.; Koomen, E. M.; Tijssen, J. G.; Vermeulen, F. E.; Voors, A. A.

    1993-01-01

    BACKGROUND: Although the long-term results of isolated venous coronary artery bypass surgery are well known, there are few multivariate statistical data on such patient groups. METHODS AND RESULTS: We report on 428 consecutive patients, 383 men and 45 women with a mean age of 52.6 years, who

  12. Coronary artery bypass grafting-related bleeding complications in patients treated with dual antiplatelet treatment.

    NARCIS (Netherlands)

    Tomsic, A.; Schotborgh, M.A.; Manshanden, J.S.; Li, W.W.L.; Mol, B.A. de

    2016-01-01

    OBJECTIVES: To evaluate the relationship between the timing of either ticagrelor or clopidogrel discontinuation and bleeding-related complications in patients undergoing isolated on-pump coronary artery bypass grafting (CABG). METHODS: Between January 2012 and December 2014, 705 consecutive patients

  13. Evaluation of a vectored equine herpesvirus type 1 (EHV-1) vaccine expressing H3 haemagglutinin in the protection of dogs against canine influenza.

    Science.gov (United States)

    Rosas, Cristina; Van de Walle, Gerlinde R; Metzger, Stephan M; Hoelzer, Karin; Dubovi, Edward J; Kim, Sung G; Parrish, Colin R; Osterrieder, Nikolaus

    2008-05-02

    In 2004, canine influenza virus (CIV) was identified as a respiratory pathogen of dogs for the first time and found to be closely related to H3N8 equine influenza virus (EIV). We generated a recombinant vectored vaccine that expresses H3 of a recent isolate of EIV using equine herpesvirus type 1 (EHV-1) as the delivery vehicle. This EHV-1 vectored vaccine exhibited robust and stable EIV H3 expression and induced a strong influenza virus-specific response in both mice and dogs upon intranasal or subcutaneous administration. Furthermore, upon challenge with the recent CIV isolate A/canine/PA/10915-07, protection of vaccinated dogs could be demonstrated by a significant reduction in clinical sings, and, more importantly, by a significant reduction in virus shedding. We concluded that the EHV-1/H3 recombinant vector can be a valuable alternative for protection of dogs against clinical disease induced by CIV and can significantly reduce virus spread.

  14. Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

    Directory of Open Access Journals (Sweden)

    Gaurav Sharma

    2011-01-01

    Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

  15. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  16. Asymmetry in development (mineralisation of permanent mandibular canine roots

    Directory of Open Access Journals (Sweden)

    Burić Mirjana V.

    2012-01-01

    Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

  17. Successful experimental challenge of dogs with canine parvovirus-2.

    OpenAIRE

    Carman, S; Povey, C

    1982-01-01

    Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...

  18. Orthodontic-surgical treatment of bilateral maxillary canine impaction

    OpenAIRE

    Sumitra

    2012-01-01

    A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

  19. Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.

    Science.gov (United States)

    Kemoli, Arthur Musakulu; Junior, Thomas Munyao

    2017-01-01

    Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

  20. Bilateral second premolars agenesia together with a unilateral canine radiculomegaly

    Directory of Open Access Journals (Sweden)

    Arthur Musakulu Kemoli

    2017-01-01

    Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

  1. Coronary Artery Bypass in Octogenarians

    Directory of Open Access Journals (Sweden)

    Chen-Yen Chien

    2012-09-01

    Full Text Available Prevalence of coronary artery disease (CAD has increased with the expansion of life span among the elderly population in the world. Hence, the issue of the coronary artery bypass in octogenarians has attracted more attention. Recent literature about the topic revealed nearly the same excellent results as those in the younger population under the newly developed operative techniques and improving concept in perioperative management and postoperative care. In this article, we review the current status of the procedure that was thought to be dangerous in the earlier era, including its risk factors, result, and benefit.

  2. Homocysteine and coronary heart disease

    DEFF Research Database (Denmark)

    Clarke, Robert; Bennett, Derrick A; Parish, Sarah

    2012-01-01

    Moderately elevated blood levels of homocysteine are weakly correlated with coronary heart disease (CHD) risk, but causality remains uncertain. When folate levels are low, the TT genotype of the common C677T polymorphism (rs1801133) of the methylene tetrahydrofolate reductase gene (MTHFR) appreci......Moderately elevated blood levels of homocysteine are weakly correlated with coronary heart disease (CHD) risk, but causality remains uncertain. When folate levels are low, the TT genotype of the common C677T polymorphism (rs1801133) of the methylene tetrahydrofolate reductase gene (MTHFR...

  3. Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

    Science.gov (United States)

    Larson, L J; Schultz, R D

    2007-01-01

    A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

  4. Effects of dipyridamole and aminophylline on hemodynamics, regional myocardial blood flow and thallium-201 washout in the setting of a critical coronary stenosis

    International Nuclear Information System (INIS)

    Granato, J.E.; Watson, D.D.; Belardinelli, L.; Cannon, J.M.; Beller, G.A.

    1990-01-01

    Experiments were performed to characterize the interaction of intravenous dipyridamole and aminophylline on thallium-201 transport kinetics, regional myocardial blood flow and systemic hemodynamics in the presence of a critical coronary artery stenosis. In 12 dogs with a critical left anterior descending coronary artery stenosis, arterial pressure decreased from a mean value (+/- SEM) of 107 +/- 6 to 94 +/- 3 mm Hg and distal left anterior descending artery pressure decreased from 70 +/- 7 to 55 +/- 4 mm Hg after intravenous administration of dipyridamole. In the left anterior descending perfusion zone, the endocardial/epicardial flow ratio decreased from 0.70 to 0.36 and the intrinsic thallium washout rate was significantly prolonged. Intravenous aminophylline reversed the dipyridamole-induced systemic hypotension and transmural coronary steal and restored the thallium washout rate to baseline values. In six other dogs, aminophylline alone resulted in no alterations in systemic and coronary hemodynamics or regional myocardial blood flow. As expected, dipyridamole-induced vasodilation and coronary steal were prevented by aminophylline pretreatment. These data show that in a canine model of partial coronary stenosis, systemic hypotension, adverse regional flow effects and prolonged thallium-201 washout consequent to intravenously administered dipyridamole are promptly reversed by intravenous aminophylline administration. Aminophylline alone had no significant hemodynamic and coronary flow effects. This study provides further insight into the altered thallium kinetics occurring as a consequence of dipyridamole-induced vasodilation and suggests that the prompt reversal of symptoms and signs of ischemia with aminophylline in patients receiving intravenous dipyridamole for clinical imaging studies probably reflects the reversal of transmural coronary steal

  5. Impact of smoking on early clinical outcomes in patients undergoing coronary artery bypass grafting surgery

    OpenAIRE

    Ji, Qiang; Zhao, Hang; Mei, YunQing; Shi, YunQing; Ma, RunHua; Ding, WenJun

    2015-01-01

    Background To evaluate the impact of persistent smoking versus smoking cessation over one month prior to surgery on early clinical outcomes in Chinese patients undergoing isolated coronary artery bypass grafting (CABG) surgery in a retrospective study. Methods The peri-operative data of consecutive well-documented patients undergoing isolated CABG surgery from January 2007 to December 2013 were investigated and retrospectively analyzed. All included patients were divided into either a non-smo...

  6. Canine caliciviruses of four serotypes from military and research dogs recovered in 1963-1978 belong to two phylogenetic clades in the Vesivirus genus.

    Science.gov (United States)

    Binn, Leonard N; Norby, Erica A; Marchwicki, Ruth H; Jarman, Richard G; Keiser, Paul B; Hang, Jun

    2018-02-23

    Vesiviruses (family Caliciviridae) had been shown capable of invading a variety of host species, raising concern of their zoonotic potential. Since the 1980's, several canine caliciviruses (CaCV) isolates have been reported and are phylogenetically related to the vesiviruses with features distinct from both Vesicular exanthema of swine virus (VESV) and Feline calicivirus (FCV) species in phylogeny, serology and cell culture specificities. Etiological studies of canine diseases in dogs used for military services and laboratory studies were conducted in 1963-1978 at the Walter Reed Army Institute of Research. Multiple known and unknown viral pathogens including caliciviruses were recovered. Four unidentified isolates were recovered in Walter Reed Canine Cells (WRCC) from respiratory, fecal and penile specimens. Physicochemical tests, electron microscopy, viral cultivation in human and animal cells, antibody neutralization assays, and recently the genome sequencing were used to characterize the isolates. Sera from these dogs and their cohorts were tested with the isolates to determine origin and prevalence of the infections. The viral isolates were small non-enveloped spherical RNA virions, 27 to 42 nm in diameter with cup-like structures, indicating they are caliciviruses. They propagated in WRCC and MDCK cells, not in either other canine cells or human and other animal cells. Each isolate is antigenically distinct and react with dog sera in respective cohorts. The genomes have nucleotide identities ranging from 70.3% to 90.7% and encode the non-structural polyprotein (1810 amino acids), major capsid protein (691 amino acids) and minor structural protein (134 amino acids). They belong to two different phylogenetic clades in Vesivirus genus with close relation with canine calicivirus (CaCV). These CaCV isolates have restricted cell tropism, antigenic diversity and genetic variation. Further investigation will shed light on antigenic relation to other vesiviruses, and

  7. Perioperative outcomes in minimally invasive direct coronary artery bypass versus off-pump coronary artery bypass with sternotomy.

    Science.gov (United States)

    Tekin, Ali İhsan; Arslan, Ümit

    2017-09-01

    Surgical treatment of isolated left anterior descending coronary artery disease can be performed with either minimally invasive direct coronary artery bypass via a left anterior thoracotomy (MIDCAB) or off-pump coronary artery bypass via a median sternotomy (OPCAB). To compare the perioperative outcomes of patients undergoing MIDCAB or OPCAB surgery. Patients who underwent either MIDCAB or OPCAB for isolated left anterior descending (LAD) coronary artery disease between October 2013 and December 2015 were retrospectively evaluated. Operations were carried out by the same surgical team. Preoperative, intraoperative and postoperative data of the patients were recorded for analyses. Twenty-three patients (7 females, 16 males) underwent MIDCAB surgery, and 24 patients (4 female, 20 males) underwent OPCAB surgery. The two groups were comparable regarding preoperative patient characteristics. Duration of mechanical ventilation (5.1 ±0.7 h vs. 6.6 ±0.9 h), intensive care unit stay (19.4 ±2.5 h vs. 45.8 ±5.4 h) and hospital stay (4.3 ±0.4 days vs. 5.6 ±0.8 days) were significantly shorter in the MIDCAB group (p < 0.01). Patients in the OPCAB group required significantly more blood transfusions (1.83 ±0.38 units vs. 0.17 ±0.38 units) and fresh frozen plasma use (2.33 ±0.96 units vs. 0.69 ±0.76 units) (p < 0.01). Conversion to sternotomy was not required in the MIDCAB group. There was no mortality, conversion to cardiopulmonary bypass or serious complication in either group. We believe that the MIDCAB technique is more advantageous than the OPCAB technique in the treatment of patients with a critical LAD lesion.

  8. Consequences of crown shortening canine teeth in Greenland sled dogs

    DEFF Research Database (Denmark)

    Kortegaard, H E; Anthony Knudsen, T; Dahl, S

    2015-01-01

    OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

  9. Current practices and research updates on diabetes mellitus in canine

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar

    2014-11-01

    Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

  10. Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

    Science.gov (United States)

    von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

    2008-05-01

    Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

  11. Eruption of the maxillary canines in relation to skeletal maturity.

    Science.gov (United States)

    Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

    2008-05-01

    Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

  12. Canine distemper in endangered Ethiopian wolves.

    Science.gov (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio

    2015-05-01

    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore.

  13. Canine vector-borne diseases in Brazil

    Science.gov (United States)

    Dantas-Torres, Filipe

    2008-01-01

    Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408

  14. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2008-08-01

    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  15. European Surveillance for Pantropic Canine Coronavirus

    Science.gov (United States)

    Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J.; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio

    2013-01-01

    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5′ end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  16. Relationship between analytic values and canine obesity.

    Science.gov (United States)

    Peña, C; Suárez, L; Bautista, I; Montoya, J A; Juste, M C

    2008-06-01

    The objective of this study was to assess the relationship between canine body condition and metabolic parameters like serum lipids, blood glucose and alanine aminotransferase (ALT) concentrations. We selected 127 dogs (42 males and 85 females) that were taken to our veterinary medicine service during routine visits. The mean age was 6.67 +/- 5.24 years. Body condition (BC) was measured by Laflamme scale and dogs were considered as obese when BC score was over 6. The following variables were collected: total cholesterol, high-density lipoprotein cholesterol, triglycerides, basal glucose and ALT. 66.1% of the dog cohort were obese. Total cholesterol and triglycerides were found to be higher (p obese dogs with respect to normal weight dogs. In conclusion, obesity in dogs is associated with higher serum lipid levels.

  17. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

    Science.gov (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

    2004-01-01

    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  18. Genetic diversity of canine olfactory receptors

    Directory of Open Access Journals (Sweden)

    Hitte Christophe

    2009-01-01

    Full Text Available Abstract Background Evolution has resulted in large repertoires of olfactory receptor (OR genes, forming the largest gene families in mammalian genomes. Knowledge of the genetic diversity of olfactory receptors is essential if we are to understand the differences in olfactory sensory capability between individuals. Canine breeds constitute an attractive model system for such investigations. Results We sequenced 109 OR genes considered representative of the whole OR canine repertoire, which consists of more than 800 genes, in a cohort of 48 dogs of six different breeds. SNP frequency showed the overall level of polymorphism to be high. However, the distribution of SNP was highly heterogeneous among OR genes. More than 50% of OR genes were found to harbour a large number of SNP, whereas the rest were devoid of SNP or only slightly polymorphic. Heterogeneity was also observed across breeds, with 25% of the SNP breed-specific. Linkage disequilibrium within OR genes and OR clusters suggested a gene conversion process, consistent with a mean level of polymorphism higher than that observed for introns and intergenic sequences. A large proportion (47% of SNP induced amino-acid changes and the Ka/Ks ratio calculated for all alleles with a complete ORF indicated a low selective constraint with respect to the high level of redundancy of the olfactory combinatory code and an ongoing pseudogenisation process, which affects dog breeds differently. Conclusion Our demonstration of a high overall level of polymorphism, likely to modify the ligand-binding capacity of receptors distributed differently within the six breeds tested, is the first step towards understanding why Labrador Retrievers and German Shepherd Dogs have a much greater potential for use as sniffer dogs than Pekingese dogs or Greyhounds. Furthermore, the heterogeneity in OR polymorphism observed raises questions as to why, in a context in which most OR genes are highly polymorphic, a subset of

  19. Osteocalcin and Osteonectin Expression in Canine Osteosarcoma.

    Science.gov (United States)

    Wehrle-Martinez, A S; Dittmer, K E; Aberdein, D; Thompson, K G

    2016-07-01

    Osteosarcoma (OSA) is a malignant heterogeneous primary bone tumor responsible for up to 90% of all primary bone tumors in dogs. In this study, osteocalcin (OC) and osteonectin (ON) immunoreactivity was evaluated in 23 canine OSAs, 4 chondrosarcomas, 4 fibrosarcomas, 2 hemangiosarcomas, and 4 histiocytic sarcomas. The effects of three different decalcification agents (ethylenediaminetetraetic acid [EDTA], formic acid and hydrochloric acid [HCl]) on the immunoreactivity for OC and ON was also assessed. Immunoreactivity to OC was present in 19/23 (83%) cases of OSA and all cases of chondrosarcoma. In three OSAs the extracellular matrix showed immunoreactivity to OC. None of the fibrosarcomas, histiocytic sarcomas or hemangiosarcomas showed immunoreactivity to OC. The sensitivity and specificity for OC in canine OSA in this study was 83% and 71% respectively. For ON, 100% of both OSAs (23/23) and non-OSAs (14/14) showed cytoplasmic immunoreactivity to this antibody, giving a sensitivity of 100% but a complete lack of specificity. There were no significant differences in immunoreactivity for OC and ON between the different decalcification agents used. In conclusion, OC showed high sensitivity for identifying OSA but it failed to distinguish between OSA and chondrosarcoma, and the osteoid produced by neoplastic cells in most cases did not show immunoreactivity to OC. These factors may limit the practical utility of OC in the diagnosis of OSA in dogs when chondrosarcoma is a differential diagnosis. ON showed no specificity in detecting OSA and has little practical application for the diagnosis of OSA in dogs. © The Author(s) 2016.

  20. Nuclear Glycogen Inclusions in Canine Parietal Cells.

    Science.gov (United States)

    Silvestri, S; Lepri, E; Dall'Aglio, C; Marchesi, M C; Vitellozzi, G

    2017-05-01

    Nuclear glycogen inclusions occur infrequently in pathologic conditions but also in normal human and animal tissues. Their function or significance is unclear. To the best of the authors' knowledge, no reports of nuclear glycogen inclusions in canine parietal cells exist. After initial observations of nuclear inclusions/pseudoinclusions during routine histopathology, the authors retrospectively examined samples of gastric mucosa from dogs presenting with gastrointestinal signs for the presence of intranuclear inclusions/pseudoinclusions and determined their composition using histologic and electron-microscopic methods. In 24 of 108 cases (22%), the authors observed various numbers of intranuclear inclusions/pseudoinclusions within scattered parietal cells. Nuclei were characterized by marked karyomegaly and chromatin margination around a central optically empty or slightly eosinophilic area. The intranuclear inclusions/pseudoinclusions stained positive with periodic acid-Schiff (PAS) and were diastase sensitive, consistent with glycogen. Several PAS-positive/diastase-sensitive sections were further examined by transmission electron microscopy, also using periodic acid-thiocarbohydrazide-silver proteinate (PA-TCH-SP) staining to identify polysaccharides. Ultrastructurally, the nuclear inclusions were composed of electron-dense particles that were not membrane bound, without evidence of nuclear membrane invaginations or cytoplasmic organelles in the nuclei, and positive staining with PA-TCH-SP, confirming a glycogen composition. No cytoplasmic glycogen deposits were observed, suggesting that the intranuclear glycogen inclusions were probably synthesized in loco. Nuclear glycogen inclusions were not associated with gastritis or colonization by Helicobacter-like organisms ( P > .05). Our findings suggest that nuclear glycogen inclusions in canine parietal cells could be an incidental finding. Nevertheless, since nuclear glycogen is present in several pathologic