The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney

Science.gov (United States)

Larsen, L. E.; Jacobi, J. H.

1980-06-01

A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.

A rare case of canine anomaly - a possible algorithm for treating it.

Science.gov (United States)

Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

2014-01-01

Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

The experimental study of 32P and diallyl trisulfide coating stent for inhibiting neointimal hyperplasia in a canine model of coronary restenosis

International Nuclear Information System (INIS)

Xu Shanghua; Jiang Hong; Li Gengshan; Jiang Xuejun; Li Xiaoyan; Chen Yuanxiu; Wang Hairong; Wu Kegui; Nie Xiaomin

2004-01-01

Objective: To assesses the efficiency of 32 P and diallyl trisulfide (DT)-coated coronary stents on neointimal proliferation in a canine model of restenosis. Methods: 32 P (740 kBq/stent), DT (210 μg/stent) alone and jointly coated stents were deployed with mild oversizing in both the left circumflex coronary artery (LCX) and the left anterior descending coronary artery (LAD) of 10 dogs. The implantation of protein-coated stents was used as the control. The therapeutic effect was assessed 6 months after the intervention. The dogs were sacrificed and the vessels were excised. For morphologic examinations the tissue sections were stained with HE and Van Gieson. Results: Compared with the control stents, the neointimal area reduced in stents coated with 32 P, DT alone and 32 P+DT [ 32 P: (2.63±0.48) mm 2 , DT: (2.50±0.49) mm 2 , 32 P+DT: (1.42±0.41) mm 2 vs control group: (4.87±0. 80) mm 2 , P=0.001]. 32 P+DT was more effective than either of them alone for reducing the neointimal area (P≤0.005). Both jointly and alone coated stents of 32 P, DT decreased the percent area stenosis [ 32 P: (32.48±4.79)%, DT: (30.04±5.43)%, 32 P+DT: (17.21±4.05)% vs control group: (54.62±6.82)%, P 32 P+DT group compared with 32 P or DT-coated stents group (P≤0.001). Angiographic restenosis (diameter stenosis) was lighter in stents coated with 32 P, DT and 32 P+DT compared with control stents (P 32 P+DT was more effective than 32 P or DT alone for reducing diameter stenosis (P≤0.005). No evidence of 'edge effect' was seen in adjacent, nonstented coronary segments. Conclusion: Coronary stents coated with 32 P plus DT produced a significantly reduced neointimal hyperplasia and restenosis rate in the canine LCX and LAD 6 months after stents implantation

Isolation and identification of Helicobacter spp, from canine and feline gastric mucosa

DEFF Research Database (Denmark)

Jalava, K.; On, Stephen L.W.; VanDamme, P.A.R.

1998-01-01

It is known that virtually all healthy adult dogs and cats harbor spiral helicobacters in their gastric mucosa, Three species, Helicobacter felis, Helicobacter bizzozeronii, and Helicobacter salomonis have been isolated in vitro from the gastric mucosa of these animals. The aims of this study were...... conventional phenotypic tests, whole-cell protein profiling, and ultrastructural analysis in identifying the different species isolated from canine and feline gastric mucose. We cultured 95 and 22 gastric mucosal biopsies from dogs and cats, respectively. Twenty-one H. bizzozeronii strains, 8 H. felis strains......, 8 H. salomonis strains, 3 mixed cultures, 2 "Flexispira rappini"-like organisms, and 3 as get uncharacterized strains were isolated from the dogs, and 3 H. felis strains were isolated from the cats. The methods used here yielded Helicobacter isolation rates of 51% from dogs and 13.6% from cats...

The isolation of canine parvovirus and pathological changes of infected dogs

Directory of Open Access Journals (Sweden)

Indrawati Sendow

2004-03-01

Full Text Available The aims of this study are to isolate canine parvovirus (CPV from the field case and to evaluate its histological aspects in CPV infected dogs. Samples were collected from intestine, intestine contained and mucose, as well as dogs feses from diarrhoea and blood diarrhoea. The suspension of those specimen was inoculated into Feline Kidney cells and observed for cythopathic effect (CPE. The presence of CPE indicated that there was viral isolate and continued to further identification using Haemaglutination (HA test with pig red blood cells. Samples with positif in HA test were further identification using Haemaglutination Inhibition (HI test against reference CPV antisera. Isolation result showed that from 81 samples processed, 10 samples indicated CPE in cell cultures, and had agglutinated in pig red blood cells and neutralised reference CPV antisera as the same titer of reference CPV antisera. Nine isolates were obtained from feces and 1 isolate was obtained from Mucose intestine from bloody diarrhoea dogs. Those isolates were also obtained from 1 to 2 days post blood diarrhea clinical signs. Two from 10 cadavers examined showed histological changes to CPV infection. Isolate of CPV, originally from feces, was also obtained from one of the two cadavers. Based on the results it was concluded that more CPV viral isolates can be obtained from bloody diarrhea feces.

Preliminary development of a live attenuated canine parvovirus vaccine from an isolate of British origin.

Science.gov (United States)

Churchill, A E

1987-04-04

Canine parvovirus isolated from a case of haemorrhagic enteritis in a breeding kennel in England was passaged and cloned in cultured feline and canine cells. No significant evidence of pathogenicity was found during six serial passages of the modified virus back through young dogs. The attenuated virus was excreted by inoculated animals and spread rapidly to uninoculated animals held in contact. When high titre attenuated virus was given to the six-week-old offspring of a seropositive dam a prompt seroconversion was observed. When the attenuated virus was used as an experimental vaccine in 108 pups in an infected breeding colony a highly significant improvement was obtained in the accumulated morbidity and mortality compared with a parallel group vaccinated with modified live feline panleucopenia virus.

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

Science.gov (United States)

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

Science.gov (United States)

Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

2000-12-01

To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

The Effects Of L-Arginine And L-Name On Coronary Flow And Oxidative Stress In Isolated Rat Hearts

Directory of Open Access Journals (Sweden)

Sobot Tanja

2015-12-01

Full Text Available The aim of this experimental study was to assess the effects of the acute administration of L-arginine alone and in combination with L-NAME (a non-selective NO synthase inhibitor on the coronary flow and oxidative stress markers in isolated rat hearts. The experimental study was performed on hearts isolated from Wistar albino rats (n=12, male, 8 weeks old, body mass of 180-200 g. Retrograde perfusion of the isolated preparations was performed using a modified method according to the Langendorff technique with a gradual increase in the perfusion pressure (40–120 cmH2O. The following values were measured in the collected coronary effluents: coronary flow, released nitrites (NO production marker, superoxide anion radical and the index of lipid peroxidation (measured as thiobarbiturate reactive substances. The experimental protocol was performed under controlled conditions, followed by the administration of L-arginine alone (1 mmol and L-arginine (1 mmol + L-NAME (30 μmol. The results indicated that L-arginine did not significantly increase the coronary flow or the release of NO, TBARS and the superoxide anion radical. These effects were partially blocked by the joint administration of L-arginine + L-NAME, which indicated their competitive effect. Hence, the results of our study do not demonstrate significant effects of L-arginine administration on the coronary flow and oxidative stress markers in isolated rat hearts.

Isolation and phylogenetic characterization of Canine distemper virus from India.

Science.gov (United States)

Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

2015-09-01

Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

The influence of hyperthyroidism on vasoconstrictor and vasodilator responses in isolated coronary and renal resistance arteries

NARCIS (Netherlands)

Zwaveling, J.; Pfaffendorf, M.; van Zwieten, P. A.

1997-01-01

The influence of hyperthyroidism on the functional vascular responsiveness of isolated coronary and renal resistance vessels was investigated. Hyperthyroidism was established by feeding rats for 1 and 4 weeks with 5 mg/kg L-thyroxine (T4)-containing rat chow. Preparations of either coronary or renal

Canine gastritis.

Science.gov (United States)

Webb, Craig; Twedt, David C

2003-09-01

Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

Genome Sequence of Canine Parvovirus Strain SC02/2011, Isolated from a Puppy with Severe Diarrhea in South China

Science.gov (United States)

Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin

2012-01-01

A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228

Peroxynitrite-induced relaxation in isolated canine cerebral arteries and mechanisms of action

International Nuclear Information System (INIS)

Li Jianfeng; Li Wenyan; Altura, Bella T.; Altura, Burton M.

2004-01-01

The present study was undertaken to determine the vascular actions of peroxynitrite (ONOO - ), the product of superoxide and nitric oxide (NO), in isolated canine cerebral arteries and to gain insight into its potential mechanisms of action. In the absence of any vasoactive agent, ONOO - (from 10 -7 to 10 -6 M) was able to reduce the basal tension. In prostaglandin F2α-precontracted canine basilar arterial rings, ONOO - elicited concentration-dependent relaxation at concentrations from 10 -8 to 10 -5 M. The effective concentrations producing approximately 50% maximal relaxation (EC 50 ) to ONOO - were 4.06 x 10 -6 and 4.12 x 10 -6 M in intact and denuded rings, respectively (P > 0.05). No significant differences in relaxation responses were found in ring preparations with or without endothelium (P > 0.05). The presence of either 5 μM methylene blue (MB) or 5 μM 1H-[1,2,4]oxadiazolo-[4,3-α]quinoxalin-1-one (ODQ) significantly inhibited the relaxations induced by ONOO - . Tetraethylammonium chloride (T-2265) significantly decreased the ONOO - -induced relaxations in a concentration-dependent manner. However, ONOO - had no effect on rings precontracted by high KCL (P > 0.05). Addition of low concentrations of calyculin A (50 nM) was able to abolish the ONOO - -induced relaxation. Furthermore, ONOO - significantly inhibited calcium-induced contractions of K + -depolarized canine cerebral rings in a concentration-related manner. Lastly, a variety of pharmacological agents and antagonists including L-NMMA, L-arginine, indomethacin, atropine, naloxone, diphenhydramine, cimetine, glibenclamide, haloperidol, etc., did not influence the relaxant effects of ONOO - on the rings. Our new results suggest that ONOO - -triggered relaxation, on canine cerebral arteries, is mediated by elevation of cyclic guanosine monophosphate (cGMP) levels, membrane hyperpolarization via K+ channel activation, activation of myosin light chain phosphatase activity, and interference with

Electrical neuromodulation for disabling angina pectoris related to isolated stenoses of small epicardial coronary arteries.

Science.gov (United States)

Jessurun, G A; Hautvast, R W; DeJongste, M J; Meyler, W J; van Boven AJ; Crijns, H J

1999-07-01

Patients with symptomatic small vessel coronary artery disease may be inadequate candidates for revascularization procedures. They may suffer from refractory angina, which does not respond to maximal anti-anginal drug therapy. In addition to patients with end stage coronary artery disease and syndrome X, this newly defined group of subjects with an isolated stenosis of a small coronary artery may benefit from electrical neurostimulation. We describe two patients with intractable angina caused by a significant narrowing of a diagonal branch. This treatment modality should be considered as an alternative method for unsatisfactory revascularization procedures.

Isolation, culture, characterization, and osteogenic differentiation of canine endometrial mesenchymal stem cell

Directory of Open Access Journals (Sweden)

A. K. Sahoo

2017-12-01

Full Text Available Aim: In this study, the canine endometrium tissue is characterized for its stem cell properties such as adherence to tissue culture plate (plasticity, short population doubling time, serial clonal passaging, long-term culturing properties, stem cell marker expression, and multilineage differentiation potential. Materials and Methods: The present work describes a novel isolation protocol for obtaining mesenchymal stem cells from the uterine endometrium and is compared with cells derived from umbilical cord matrix as a positive control. These cells are clonogenic, can undergo several population doublings in vitro, and can be differentiated to the osteocytes in mature mesenchymal tissues when grown in osteogenic differentiation media as detected by Alizarin Red-S staining. Results: It is reported for the first time that the cells derived from the canine endometrium (e-multipotent stem cells [MSCs] were able to differentiate into a heterologous cell type: Osteocytes, thus demonstrating the presence of MSCs. Thus, the endometrium may be told as a potential source of MSCs which can be used for various therapeutic purposes. Conclusion: The endometrium can be used as a potential source of MSCs, which can be used for various therapeutic purposes.

Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

Science.gov (United States)

Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

2017-01-20

Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

Compartment analysis of 125I-labelled albumin washout from coronary vessels of isolated perfused hearts

International Nuclear Information System (INIS)

Cheng Eap Ng; Seh-Hoon Song

1978-01-01

Albumin labelled with 125 I was used as a tracer to investigate the washout kinetics of plasma from the coronary circulation of isolated perfused feline hearts. Compartmentalization with experimental results showed at least two compartments. The model was compared with a three-compartment model found previously for red blood cells. The results indicate that there is a separation of plasma and RBC in the coronary microcirculation. (author)

Coronary Artery Anomalies in Animals

Directory of Open Access Journals (Sweden)

Brian A. Scansen

2017-04-01

Full Text Available Coronary artery anomalies represent a disease spectrum from incidental to life-threatening. Anomalies of coronary artery origin and course are well-recognized in human medicine, but have received limited attention in veterinary medicine. Coronary artery anomalies are best described in the dog, hamster, and cow though reports also exist in the horse and pig. The most well-known anomaly in veterinary medicine is anomalous coronary artery origin with a prepulmonary course in dogs, which limits treatment of pulmonary valve stenosis. A categorization scheme for coronary artery anomalies in animals is suggested, dividing these anomalies into those of major or minor clinical significance. A review of coronary artery development, anatomy, and reported anomalies in domesticated species is provided and four novel canine examples of anomalous coronary artery origin are described: an English bulldog with single left coronary ostium and a retroaortic right coronary artery; an English bulldog with single right coronary ostium and transseptal left coronary artery; an English bulldog with single right coronary ostium and absent left coronary artery with a prepulmonary paraconal interventricular branch and an interarterial circumflex branch; and a mixed-breed dog with tetralogy of Fallot and anomalous origin of all coronary branches from the brachiocephalic trunk. Coronary arterial fistulae are also described including a coronary cameral fistula in a llama cria and an English bulldog with coronary artery aneurysm and anomalous shunting vessels from the right coronary artery to the pulmonary trunk. These examples are provided with the intent to raise awareness and improve understanding of such defects.

Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain

OpenAIRE

Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

2012-01-01

Purpose In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. Materials and Methods We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. Result...

Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

Science.gov (United States)

Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2005-01-01

A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

Characterisation of canine parvovirus strains isolated from cats with feline panleukopenia.

Science.gov (United States)

Decaro, Nicola; Buonavoglia, Domenico; Desario, Costantina; Amorisco, Francesca; Colaianni, Maria Loredana; Parisi, Antonio; Terio, Valentina; Elia, Gabriella; Lucente, Maria Stella; Cavalli, Alessandra; Martella, Vito; Buonavoglia, Canio

2010-10-01

Unlike the original canine parvovirus type 2 (CPV-2), CPV-2 variants have gained the ability to replicate in vivo in cats but there is limited information on the disease patterns induced by these variants in the feline host. During 2008, two distinct cases of parvoviral infection were diagnosed in our laboratories. A CPV-2a variant was identified in a 3-month-old Persian kitten displaying clinical sign of feline panleukopenia (FPL) (acute gastroenteritis and marked leukopenia) and oral ulcerations, that died eight days after the onset of the disease. Two pups living in the same pet shop as the cat were found to shed a CPV-2a strain genetically identical to the feline virus and were likely the source of infection. Also, non-fatal infection by a CPV-2c strain occurred in a 2.5-month-old European shorthair kitten displaying non-haemorrhagic diarrhoea and normal white blood cell counts. By sequence analysis of the major capsid protein (VP2) gene, the feline CPV-2c strain showed 100% identity to a recent canine type-2c isolate. Both kittens had been administered multivalent vaccines against common feline pathogens including FPL virus. Whether and to which extent the FPL vaccines can protect cats adequately from the antigenic variants of CPV-2 should be assessed. 2010 Elsevier Ltd. All rights reserved.

Isolated single coronary artery (RII-B type presenting as an inferior wall myocardial infarction: A rare clinical entity

Directory of Open Access Journals (Sweden)

Ankur C. Thummar

2014-09-01

Full Text Available Isolated single coronary artery without other congenital cardiac anomalies is very rare among the different variations of anomalous coronary patterns. The prognosis in patients with single coronary varies according to the anatomic distribution and associated coronary atherosclerosis. If the left main coronary artery travels between the aorta and pulmonary arteries, it may be a cause of sudden cardiac death. We present multimodality images of a single coronary artery, in which the whole coronary system originated by a single trunk from the right sinus of Valsalva with inter-arterial course of left main coronary artery. This rare type of single coronary artery was classified as RII-B type according to Lipton's scheme of classification. A significant flow-limiting lesions were found in the right coronary artery that was successfully treated with percutaneous coronary intervention.

Characterization of a new dog isolate of canine distemper virus from China.

Science.gov (United States)

Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H

2011-01-01

Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.

Distinct fermentation and antibiotic sensitivity profiles exist in salmonellae of canine and human origin.

Science.gov (United States)

Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C

2018-02-26

Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.

Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

Science.gov (United States)

Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

2014-12-01

A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

The Ondersteport Canine distemper virus strain and measles ...

African Journals Online (AJOL)

Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

Directory of Open Access Journals (Sweden)

Yamaguchi Ryoji

2009-10-01

Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures.

Science.gov (United States)

Mochizuki, Masami; Ohshima, Takahisa; Une, Yumi; Yachi, Akiko

2008-12-01

Canine parvovirus type 2 (CPV) is a pathogen that causes severe hemorrhagic gastroenteritis with a high fatality rate in pups worldwide. Since CPV emerged in the late 1970s, its origin has been explored with the conclusion that CPV originated from feline panleukopenia virus or a closely related virus. Both high mutation rate and recombination are assumed to be key factors in the evolution of parvoviruses. Here we provide evidence for natural recombination in CPV isolated from dogs in cell culture. Antigenic and genetic properties of isolates from 10 diseased pups were elucidated. Six pups had been vaccinated beforehand with live combined vaccine containing original antigenic type CPV (CPV-2). Six isolates recovered from 4 vaccinated pups in cell cultures were found to contain either CPV-2 or CPV-2-like viruses. The other isolates, including all those from non-vaccinated pups, were CPV-2b viruses. Antigenic typing of two CPV-2-like isolates, 03-029/M and 1887/f, with a monoclonal antibody panel suggested they were a mixture of CPV-2 and CPV-2a (03-029/M) and a recombinant of CPV-2 and CPV-2b (1887/f). Genetic analysis of the VP1 gene indicated that isolate 03-029/M was a mixture of CPV-2, CPV-2a and a recombinant of CPV-2 and CPV-2a viruses, while isolate 1887/f was composed of a recombinant of CPV-2 and CPV-2b viruses. This is the first demonstration of natural CPV recombination in the field and suggests that recombination in the evolution of CPV is a more frequent and important process than previously believed.

Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

Science.gov (United States)

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S

2015-01-01

The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

Compensatory canine angulation in angle Class II and III patients

Directory of Open Access Journals (Sweden)

Mauro Carlos Agner Busato

2009-09-01

Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

Activation patterns of Purkinje fibers during long-duration ventricular fibrillation in an isolated canine heart model.

Science.gov (United States)

Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E

2007-09-04

The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.

Vaccine-induced canine distemper in a lesser panda.

Science.gov (United States)

Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

1976-11-01

A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

International Nuclear Information System (INIS)

Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

1974-01-01

Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

Distribution of extracellular potassium and electrophysiologic changes during two-stage coronary ligation in the isolated, perfused canine heart

NARCIS (Netherlands)

Coronel, R.; Fiolet, J. W.; Wilms-Schopman, J. G.; Opthof, T.; Schaapherder, A. F.; Janse, M. J.

1989-01-01

We studied the relation between [K+]o and the electrophysiologic changes during a "Harris two-stage ligation," which is an occlusion of a coronary artery, preceded by a 30-minute period of 50% reduction of flow through the artery. This two-stage ligation has been reported to be antiarrhythmic. Local

Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

Directory of Open Access Journals (Sweden)

Tan Bin

2011-11-01

Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

Science.gov (United States)

Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

2011-11-16

A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

Science.gov (United States)

Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

2017-06-01

Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

Development of a novel vaccine against canine parvovirus infection with a clinical isolate of the type 2b strain.

Science.gov (United States)

Park, Seon Ah; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Kim, Hwi Yool; Lee, Joong-Bok; Lee, Nak-Hyung

2012-07-01

In spite of an extensive vaccination program, parvoviral infections still pose a major threat to the health of dogs. We isolated a novel canine parvovirus (CPV) strain from a dog with enteritis. Nucleotide and amino acid sequence analysis of the isolate showed that it is a novel type 2b CPV with asparagine at the 426th position and valine at the 555th position in VP2. To develop a vaccine against CPV infection, we passaged the isolate 4 times in A72 cells. The attenuated isolate conferred complete protection against lethal homologous CPV infection in dogs such that they did not develop any clinical symptoms, and their antibody titers against CPV were significantly high at 7-11 days post infection. These results suggest that the virus isolate obtained after passaging can be developed as a novel vaccine against paroviral infection.

Ultrasonographic evaluation of the canine shoulder.

Science.gov (United States)

Long, C D; Nyland, T G

1999-01-01

The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

Age-dependent trends in postoperative mortality and preoperative comorbidity in isolated coronary artery bypass surgery

DEFF Research Database (Denmark)

Thorsteinsson, Kristinn; Fonager, Kirsten; Mérie, Charlotte

2016-01-01

OBJECTIVES: An increasing number of octogenarians are being subjected to coronary artery bypass grafting (CABG). The purpose of this study was to examine age-dependent trends in postoperative mortality and preoperative comorbidity over time following CABG. METHODS: All patients who underwent isol...

Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

Directory of Open Access Journals (Sweden)

Gurpreet Kaur

2015-01-01

Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

Effect of atrial systole on canine and porcine coronary blood flow.

Science.gov (United States)

Bellamy, R F

1981-09-01

A feature of phasic coronary flow patterns recorded in conscious chronically instrumented dogs is the atrial cove--a transient depression of arterial flow that occurs during atrial systole. The association between the hemodynamic effects of atrial systole and the atrial cove was studied in anesthetized dogs and pigs with complete heart block. Many atrial coves are available for study in these preparations because atrial activity continues unabated during the diastolic ventricular arrest that follows cessation of electrical pacing. The effect of atrial systole is to translate the pressure-flow relation found during diastole to a higher intercept pressure without change in slope. The increase in the intercept pressure equals the increase in intramyocardial pressure measured with microtransducers embedded in the left ventricular wall. The decrement in flow during the atrial cove is a direct function of the change in intramyocardial pressure and an inverse function of coronary vascular resistance. Each atrial systole is associated with a forward flow transient in the coronary veins, the peak of which occurs at the same instant as does the nadir of atrial flow. These data suggest that the coronary vessels are acting as collapsible tubes and that the waterfall model of the coronary circulation is applicable. The following sequence is proposed to account for the atrial cove. Atrial systole ejects a bolus of blood into the left ventricle increasing both ventricular cavity and intramyocardial pressures. The increase in intramyocardial pressure raises the back pressure opposing coronary flow, reducing the arterial perfusion pressure gradient and causing flow to fall.

Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

Science.gov (United States)

Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

2015-02-01

Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

Efficacy of an inactivated feline panleucopenia virus vaccine against a canine parvovirus isolated from a domestic cat.

Science.gov (United States)

Gamoh, K; Senda, M; Inoue, Y; Itoh, O

2005-09-03

Canine parvovirus type 2a (CPV-2a) and type 2b (CPV-2b) have recently been isolated from cats throughout the world, and CPV-2b strain FP84 has been reported to be virulent in domestic cats. Although live feline panleucopenia virus (FPLV) vaccines protect domestic cats from CPV infection, the efficacy of inactivated FPLV vaccines has not been established. In this study, two domestic cats were vaccinated with a commercial inactivated FPLV vaccine and challenged with CPV-2b strain FP84 isolated from a domestic cat. The cats were protected against CPV-2b strain FP84 infection and their clinical signs were suppressed, although the two unvaccinated cats showed the typical clinical signs of parvovirus infection.

Isolated persistent left-sided superior vena cava, giant coronary sinus, atrial tachycardia and heart failure in a child

Directory of Open Access Journals (Sweden)

Nagaraja Moorthy

2013-09-01

Full Text Available Persistence of a left-sided superior vena cava (PLSVC with absent right superior vena cava (isolated PLSVC is a very rare venous malformation and commonly associated with congenital heart disease or alterations of the cardiac situs. We describe an unusual case of a young boy presenting with persistent atrial tachycardia and congestive heart failure. He was detected to have unexplained grossly dilated right atrium, right ventricle with systolic dysfunction and a giant coronary sinus (CS. The dilated CS closely mimicked a pseudo cor-triatriatum on echocardiography. Contrast echocardiography from both arms revealed opacification of the CS before the right atrium. Bilateral upper limb venography confirmed the presence of absent right SVC and isolated persistent left SVC draining into the giant coronary sinus.

Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

Directory of Open Access Journals (Sweden)

Mehdi Mohebali

2016-10-01

Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

Coryneform bacteria associated with canine otitis externa

DEFF Research Database (Denmark)

Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

2010-01-01

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

Science.gov (United States)

Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

2015-10-01

Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

Chronological analysis of canine parvovirus type 2 isolates in Japan.

Science.gov (United States)

Ohshima, Takahisa; Hisaka, Mitsuaki; Kawakami, Kazuo; Kishi, Masahiko; Tohya, Yukinobu; Mochizuki, Masami

2008-08-01

Fifty-five canine parvovirus type 2 (CPV) samples, 12 fecal specimens and 43 cell culture isolates, were examined for their genetic characteristics of VP2 gene. They were collected from the diseased dogs at various districts of Japan during 27 years from 1980 to 2006. A fragment of VP2 gene was analyzed by restriction fragment length polymorphism assay and DNA sequencing. The original antigenic type 2 of CPV (CPV-2) was no longer found in the samples since 1984, and two antigenic variants CPV-2a and CPV-2b replaced CPV-2 as predominant types for about 5 years from 1982. A new genetic variant of prototype CPV-2a with non-synonymous substitution at the VP2 amino acid residue 297 from Ser to Ala was first detected in 1987. New CPV-2b with the same amino acid substitution at position 297 as new CPV-2a was also detected from the samples collected in 1997. Since then new CPV-2b has been the predominant CPV over the field of Japan. Several additional amino acid substitutions were detected in the VP2 gene of some recent CPV strains. Neither CPV-2c(a), CPV-2c(b), nor "Glu-426" of the antigenic variants previously found outside the country was detected in any samples tested. Reactivity of new CPV-2a and 2b variants against antibodies produced by the current vaccine products was determined by a cross hemagglutination-inhibition test. The recent field CPV isolates reacted more efficiently to the antibodies produced in dogs vaccinated with the new CPV-2b vaccine strain than the conventional CPV-2 vaccine strain.

Isolated Unilateral Absent Branch Pulmonary Artery with Peripheral Pulmonary Stenosis and Coronary Artery Disease

Directory of Open Access Journals (Sweden)

Sunil Abhishek B

2017-09-01

Full Text Available Isolated Unilateral Absent Pulmonary Artery (UAPA is a rare congenital anomaly. It is usually associated with congenital heart defects. A 45 year old male patient presented with complaints of fever with cough and expectoration for 15 days and retrosternal chest discomfort for the previous 2 days. ECG showed diffuse ST segment depression with T wave inversion in the inferior and lateral leads. Coronary Angiogram done through the right femoral approach revealed diffusely diseased Left Anterior Descending (LAD artery that was totally cut off at the mid segment. The Left Circumflex (LCx artery was providing blood supply to the right middle and lower lung areas. There was another collateral arising from the Left Subclavian Artery supplying the right middle and lower lung areas. The left pulmonary artery was normal, but branches supplying the middle and lower lobes of the right lung were absent and the upper lobe branch had pulmonary stenosis. UAPA is a rare clinical entity; collaterals from coronaries are extremely rare in this condition and till now there has not been any case report of unilateral absent branch pulmonary artery with peripheral stenosis of other branches, on the affected side and associated coronary artery disease.

Phylogenetic analysis of VP2 gene of canine parvovirus and comparison with Indian and world isolates.

Science.gov (United States)

Kaur, G; Chandra, M; Dwivedi, P N

2016-03-01

Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.

The minimum coronary artery diameter in which coronary spasm can be identified by synchrotron radiation coronary angiography

International Nuclear Information System (INIS)

Matsushita, Shonosuke; Hyodo, Kazuyuki; Imazuru, Tomohiro; Tokunaga, Chiho; Sato, Fujio; Enomoto, Yoshiharu; Hiramatsu, Yuji; Sakakibara, Yuzuru

2008-01-01

Background: Coronary vasospasm is defined as a temporary, intense narrowing of the coronary conduit artery. It brings about ischemic chest pain and becomes one of the causes of myocardial infarction. Coronary spasms are divided into two categories. One is the coronary spasm of the conduit artery and the other is the coronary microvascular spasm. Although coronary spasms are diagnosed with the images of coronary angiography, microvascular spasms cannot be diagnosed because of the limitations of conventional angiographic systems. However, synchrotron radiation coronary angiography (SRCA) can identify coronary arteries down to 100 μm in diameter in the beating heart and 50 μm in arrested heart. Aim: The purpose of this study was to confirm whether microvascular spasms could be identified or not using SRCA, and then down that size identification was possible. Methods: The Langendorff perfusion system with isolated rat hearts was employed. Krebs-Henseleit solution (KH solution) was used as a perfusate. 10 mM of 4-aminopyridine (4-AP: a voltage-gated potassium channel blocker; spasm inducer) was added to the KH solution and maintained for 5 min. SRCA was performed at pre-, during and 10 min after cessation of the KH solution with 4-AP. Coronary spasms were defined as a temporal 75% reduction of coronary arterial diameter. Results and conclusion: Multiple sizes of coronary arteries showed coronary spasms. The minimum stenosed coronary artery size was 100 μm. Since coronary microvascular spasms are seen in the arterioles (50-400 μm), coronary microvascular spasms may be diagnosed with the use of synchrotron radiation coronary angiography

Prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia: study by 99mTc-sestamibi radionuclide scintigraphy.

Science.gov (United States)

Ismail, Ahmed M; Rayan, Mona; Adel, Amr; Demerdash, Salah; Atef, Mohamed; Abdallah, Mohamed; Nammas, Wail

2014-02-01

We explored the prevalence and pattern of abnormal myocardial perfusion in patients with isolated coronary artery ectasia (CAE), as demonstrated by (99m)Tc-sestamibi scintigraphy. Prospectively, we enrolled 35 patients with angiographically documented CAE and no significant coronary obstruction, who underwent elective coronary angiography. Patients underwent Stress-rest (99m)Tc-sestamibi scintigraphy within 4 days of coronary angiography. They were divided into 2 groups: group I: with normal perfusion scan; and group II: with reversible perfusion defects. The mean age was 49.6 ± 6.9 years; 34 (97.1 %) were males. Seventy-nine (75.2 %) arteries were affected by CAE. Among 79 arteries affected by CAE, affection was diffuse in 37 (46.8 %). Thirteen (37.1 %) patients had normal perfusion scan (group I), whereas 22 (62.9 %) had reversible perfusion defects (group II). Among 22 patients with reversible perfusion defects, 20 (90.9 %) had mild and 2 (9.1 %) had moderate ischemia. Among 49 myocardial segments with reversible perfusion defects, 22 (44.9 %) were basal, 18 (36.7 %) mid-, and 9 (18.4 %) apical segments. Diffuse CAE was significantly more prevalent in group II versus group I, in all 3 major coronary arteries (p < 0.05 for all). In patients with isolated CAE who underwent elective coronary angiography, reversible perfusion defects demonstrated by (99m)Tc-sestamibi scintigraphy were rather prevalent, mostly mild, more likely to affect the basal and mid-segments of the myocardium, and more frequently associated with diffuse ectasia.

SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

Science.gov (United States)

Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

2017-10-01

Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

Two-dimensional aortographic coronary angiography with synchrotron radiation at aortic regurgitation state

Science.gov (United States)

Takeda, Tohoru; Umetani, Keiji; Doi, Toshiki; Itai, Yuji; Yu, Quanwen; Akatsuka, Takao

1999-10-01

At aortic regurgitation state, 2D synchrotron radiation (SR) coronary arteriography (CAG) with aortographic contrast injection was examined theoretically and animal experiments were performed to confirm its diagnostic ability. This system consisted of a silicon monocrystal, fluorescent plate, avalanche-type pickup tube camera, and image acquisition system. The experiment was performed at synchrotron sources in the Photon Factory of Tsukuba. The x- ray energy was adjusted to just above the iodine K-edge. Theoretical calculation described that the coronary arteries overlapping on left ventricle could not be demonstrated well with a high signal-to-noise ratio by using the aortographic CAG with SR. The canine coronary arteries without overlap over the left ventricle were demonstrated clearly, however, the image quality appear to be reduced. The coronary artery overlapping over left ventricle could not be demonstrated well, however the transient reduction of left ventricular wall motion was revealed by transient stenotic procedure of left anterior descending coronary artery.

Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

Science.gov (United States)

Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2006-01-01

Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

Science.gov (United States)

Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

2004-10-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

Directory of Open Access Journals (Sweden)

Zhijun Zhong

2014-07-01

Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

Science.gov (United States)

Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

2014-01-01

Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818

Extremely Small Pseudoparamagnetic Iron Oxide Nanoparticle as a Novel Blood Pool T1 Magnetic Resonance Contrast Agent for 3 T Whole-Heart Coronary Angiography in Canines: Comparison With Gadoterate Meglumine.

Science.gov (United States)

Park, Eun-Ah; Lee, Whal; So, Young Ho; Lee, Yun-Sang; Jeon, Bong-Sik; Choi, Kyu Sung; Kim, Eung-Gyu; Myeong, Wan-Jae

2017-02-01

The aim of this study was to evaluate an extremely small pseudoparamagnetic iron oxide nanoparticle (ESPIO), KEG3, as a potential blood pool agent in 3 T coronary magnetic resonance angiography (MRA) in canine models and compare its efficacy to that of a gadolinium-based contrast agent. Nine mongrel dogs were subjected to whole-heart coronary MRA in 2 separate sessions at 7-day intervals with a 3 T scanner using the FLASH sequence with either gadoterate meglumine (Gd-DOTA) or the ESPIO (KEG3). Coronary MRA was performed twice at each MR examination: the first scan during the administration of the contrast agent and the subsequent second scan at 15 minutes after contrast injection. Objective measurements of the Gd-DOTA and ESPIO images, including the signal-to-noise ratios (SNRs) for the coronary arteries and cardiac veins, contrast-to-noise ratios (CNRs) between the vessels and fat (CNRfat) and the vessels and the myocardium (CNRmyocardium), and subjective image quality scores on a 4-point scale were evaluated and compared. The mean SNRs and CNRs of all vascular regions in the ESPIO images were similar to those of the corresponding regions in the Gd-DOTA images in the first scan (98.1 ± 32.5 vs 79.1 ± 38.4 for SNR of coronary arteries, P = 0.3; 74.2 ± 30.1 vs 61.4 ± 38.5 for CNR, P = 0.7) and more than 2 times higher than the latter in the second scan (95.2 ± 31.3 vs 32.1 ± 8.1 for SNR of coronary arteries, P = 0.008; 76.1 ± 35.8 vs 17.6 ± 19.2 for CNR, P 0.008). Similarly, the mean values of the subjective measurements of the ESPIO images were similar to those of the Gd-DOTA images (3.9 ± 0.3 vs 3.3 ± 0.8 for coronary arteries, P = 0.1) in the first scan and significantly better than the latter in the second scan (3.9 ± 0.2 vs 2.1 ± 0.6 for coronary arteries, P = 0.007). The experimental blood pool agent KEG3 offers equivalent image quality for whole-heart coronary MRA at 3 T upon contrast administration and persistent better quality in the subsequent

Risk factors for prolonged hospital stay after isolated coronary artery bypass grafting

Directory of Open Access Journals (Sweden)

Elayne Kelen de Oliveira

2013-09-01

Full Text Available INTRODUCTION: Characteristics of the patient and the coronary artery bypass grafting may predispose individuals to prolonged hospitalization, increasing costs and morbidity and mortality. OBJECTIVE: The objective of this study was to evaluate individual and perioperative risk factors of prolonged hospitalization in intensive care units and wards. METHODS: We conducted a case-control study of 104 patients undergoing isolated coronary artery bypass grafting with cardiopulmonary bypass. Patients hospitalized >3 days in the intensive care unit or >7 days in the ward were considered for the study. The association between variables was estimated by the chi-square test, odds ratio and logistic regression; P 3 days in the intensive care unit occurred for 22.1% of patients and >7 days in the ward for 27.9%. Among preoperative factors, diabetes (OR=3.17 and smoking (OR=4.07 were predictors of prolonged intensive care unit stay. Combining the pre-, intra-and postoperative variables, only mechanical ventilation for more than 24 hours (OR=6.10 was predictive of intensive care unit outcome. For the ward outcome, the preoperative predictor was left ventricular ejection fraction 24 hours for the intensive care unit and presence of infection for the ward.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

Science.gov (United States)

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

[Surgical angioplasty of the left main coronary artery].

Science.gov (United States)

Vranes, Mile; Velinović, Milos; Kocica, Mladen; Mikić, Aleksandar; Velimirović, Dusan; Djukić, Petar

2010-01-01

The conventional treatment for isolated stenosis of the left main coronary artery is bypass surgery (myocardial revascularization). However, the process of atherosclerosis is not arrested by myocardial revascularization and it will lead to the occlusion of the left main coronary artery. Revascularization will establish retrograde perfusion for 50-70% of the myocardium of the left ventricle. Direct surgical angioplasty of the left main coronary artery enables normal physiological perfusion of the whole myocardium and better myocardial function. The aim of our study is to point out a new surgical approach of treating left main coronary artery stenosis. Between October 2002 and October 2003, direct surgical angioplasty of the main left coronary artery was performed on three patients with isolated stenosis of the left main coronary artery using the anterior approach and the pericardium as a patch. The procedure was performed under total endotracheal anaesthesia and standard cardiopulmonary circulation, moderate hypothermia, anterograde St. Tomas cardioplegia and local cooling. Patients were followed clinically, echocardiographically and by load-tests. All three patients were without complications. In postoperative follow-up (54-68 months) neither angina pectoris nor electrocardiographically registered ischaemic changes were found. Load-tests performed every six months on all three patients were negative. Surgical angioplasty of isolated stenosis of the left main coronary artery is a preferred method for treating this type of coronary disease. Contraindications for this type of treatment are stenosis of the left main coronary artery with bifurcation and advanced calcification of the left main coronary artery.

Molecular characterization of canine parvovirus in Vientiane, Laos.

Science.gov (United States)

Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn

2017-05-01

The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.

Large coronary intramural hematomas

DEFF Research Database (Denmark)

Antonsen, Lisbeth; Thayssen, Per; Jensen, Lisette Okkels

2015-01-01

Isolated spontaneous coronary intramural hematoma is a unique subset of spontaneous coronary artery dissection that is characterized by a hemorrhage limited to the medial-adventitial layers, causing subsequent hematoma formation without visible intimal flaps. It is an infrequent and serious...... diagnostics and treatment strategy. Coronary intramural hematomas can also occur iatrogenically, as a complication to percutaneous coronary intervention (PCI). Coronary angiography (CAG) has limited diagnostic value in the absence of intimal dissections, and lesions are often angiographically ambiguous....... Intravascular ultrasound (IVUS) is an important diagnostic tool in establishing the correct diagnosis, as it provides a complete vessel wall assessment, and enables morphometric information regarding the magnitude and severity of the underlying hematoma. Due to the rarity of this clinical scenario...

Molecular characterisation of canine parvovirus strains circulating in ...

African Journals Online (AJOL)

STORAGESEVER

2010-07-19

Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...

Serial thallium-201 imaging after dipyridamole for coronary disease detection: quantitative analysis using myocardial clearance

International Nuclear Information System (INIS)

Okada, R.D.; Dai, Y.H.; Boucher, C.A.; Pohost, G.M.

1984-01-01

After dipyridamole, canine studies have demonstrated a slower rate of myocardial thallium-201 clearance from zones distal to a coronary artery stenosis compared to normal zones. To determine if criteria based on canine myocardial thallium-201 clearance rates could be applied clinically, 40 patients with and 26 patients without coronary artery disease (CAD) had serial thallium-201 images obtained for 2 to 5 hours after dipyridamole. Regions of interest were manually placed over six left ventricular segments in two projections for each of three imaging times. The myocardial thallium-201 clearance rate was calculated for each of the six segments and, using the clearance rate criterion found in canine studies, was considered abnormal if less than 6.5%/hr. Using this criterion alone, 22 of 26 patients (85%) without CAD had normal and 30 of 40 patients (75%) with CAD had abnormal myocardial thallium-201 clearance rates. A quantitative analysis of regional inhomogeneity in tracer distribution (normal was greater than or equal to 25% difference between segments) was negative in 24 of 26 patients (92%) without CAD and positive in 20 of 40 patients (50%) with CAD. When both clearance rate and regional inhomogeneity were considered, 21 of 26 patients (81%) without CAD had negative and 36 of 40 patients (90%) with CAD had positive results. Thus, post-dipyridamole myocardial clearance rate criteria derived from canine studies can be applied to clinical thallium imaging. Quantitative analysis of serial thallium-201 images after dipyridamole is optimized by using myocardial thallium-201 clearance rates. Such an approach is independent of regional inhomogeneities in tracer distribution

Molecular characterization of canine distemper vi- rus circulating in ...

African Journals Online (AJOL)

2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

Science.gov (United States)

Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

2011-10-01

The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

Clinical manifestations of canine distemper in Nigerian dogs ...

African Journals Online (AJOL)

Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

Canine distemper associated with generalized oedema in Nigerian ...

African Journals Online (AJOL)

Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

Ecology of genus Porphyromonas in canine periodontal disease.

Science.gov (United States)

Isogai, H; Kosako, Y; Benno, Y; Isogai, E

1999-09-01

Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

Effects of ioxaglic acid on cardiac functions during coronary arteriography in canines

Energy Technology Data Exchange (ETDEWEB)

Traegaardh, B. (Malmoe Allmaenna Sjukhus, Malmoe, Sweden); Lynch, P.R. (Temple Univ., Philadelphia, PA (USA). School of Medicine)

1983-01-01

The new monoacid dimer ioxaglic acid (P286), the non-ionic metrizamide (Amipaque) and diatrizoate (Renografin 76) were compared regarding their effects on left ventricular pressure, the first derivative of left ventricular pressure, aortic pressures and on ECG changes during left and right coronary angiography in dogs. Ioxaglate was found to affect most of these parameters less than diatrizoate probably due to its lower osmolality. Ioxaglate should be regarded suitable for coronary angiography. However, ioxaglate was found to have greater effects on the cardiac function than the equiosmolar metrizamide. This is probably due to the chemotoxicity of the anion or possibly to the sodium content of the ioxaglic acid solution.

Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

Science.gov (United States)

Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

2014-08-01

Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

Canine distemper virus in Lake Baikal seals (Phoca sibirica).

NARCIS (Netherlands)

L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

1996-01-01

textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Cintia Xavier de Mello

2014-12-01

Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

Science.gov (United States)

Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

2009-12-10

Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

Directory of Open Access Journals (Sweden)

Mostfa Shahabi

2017-09-01

Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

A randomized clinical study of two interceptive approaches to palatally displaced canines.

Science.gov (United States)

Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

2008-08-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology.

Science.gov (United States)

Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M

2017-07-20

We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.

Science.gov (United States)

Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing

2018-02-01

A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.

Longevity and admission to nursing home according to age after isolated coronary artery bypass surgery

DEFF Research Database (Denmark)

Thorsteinsson, Kristinn; Andreasen, Jan; Mortensen, Rikke N

2016-01-01

OBJECTIVES: Data on nursing home admission in patient's ≥80 years after isolated coronary artery bypass grafting (CABG) are scarce. The purpose of this study was to evaluate longevity and subsequent admission to a nursing home stratified by age in a nationwide CABG cohort. METHODS: All patients who...... underwent isolated CABG from 1996 to 2012 in Denmark were identified through nationwide registers. The cumulative incidence of admission to a nursing home after CABG was estimated. A Cox regression model was constructed to identify predictors for living in a nursing home 1 year after CABG. Kaplan.......1% of patients ≥80 years had received home care. The proportion of patients admitted to a nursing home at 1, 5 and 10 years after CABG was 0.1, 0.4 and 1.0% (nursing home 1 year postoperatively were: age ≥80 years...

Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

DEFF Research Database (Denmark)

Martella, V.; Cirone, F.; Elia, G.

2006-01-01

Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Identification of canine coronary resistance and intramyocardial compliance on the basis of the waterfall model.

Science.gov (United States)

Burattini, R; Sipkema, P; van Huis, G A; Westerhof, N

1985-01-01

This study was performed to elucidate the effects of cardiac contraction on coronary pressure-flow relations. On the basis of the waterfall mechanism, a lumped model of the coronary arterial system is presented consisting of a proximal (epicardial) compliance, a coronary resistance, and an intramyocardial compliance. A "back"-pressure, assumed to be proportional (constant k) to left ventricular pressure, impedes flow. From steady-state measurements of circumflex coronary artery flow and inflow pressure, together with left ventricular pressure, the values of the three model parameters and the constant k have been estimated. In the control condition proximal compliance is found to be 1.7 X 10(-12) m4s2kg-1, intramyocardial compliance 110 X 10(-12)m4s2kg-1, and resistance 7.5 X 10(9) kgm-4s-1. The proportionality constant k is close to unity. Effects of changes in left ventricular pressure and inflow pressure and the effect of vasoactive drugs on the parameters are also investigated. Changes in coronary resistance are always opposite to changes in intramyocardial compliance. Sensitivity analysis showed that epicardial compliance plays its major role during isovolumic contraction and relaxation; resistance plays a role throughout the cardiac cycle but is more important in diastole than in systole, whereas intramyocardial compliance plays a role in systole and in early diastole.

Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

DEFF Research Database (Denmark)

Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

Epidemiology of canine distemper virus in wild raccoon dogs (Nyctereutes procyonoides) from South Korea.

Science.gov (United States)

Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan

2012-09-01

Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.

Presence of infectious RD-114 virus in a proportion of canine parvovirus isolates.

Science.gov (United States)

Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

2012-03-01

We recently found that certain canine live attenuated vaccines produced using `non-feline' cell lines were contaminated with an infectious feline endogenous retrovirus, termed RD-114 virus. We suspected that RD-114 virus may have contaminated the seed stock of canine parvovirus (CPV) during the production of the contaminated vaccines. In this study, we collected stock viruses of CPVs propagated in a feline cell line, and checked the presence of infectious RD-114 virus. Consequently, we found that RD-114 viral RNA was present in all stock viruses, and 7 out of 18 stock viruses were contaminated with infectious RD-114 virus. We also found that RD-114 virus was stable physically and is capable of retaining its infectivity for a long period at -80°C.

Optical measurement of isolated canine lung filtration coefficients at normal hematocrits.

Science.gov (United States)

Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

1997-12-01

In this study, lung filtration coefficient (Kfc) values were measured in eight isolated canine lung preparations at normal hematocrit values using three methods: gravimetric, blood-corrected gravimetric, and optical. The lungs were kept in zone 3 conditions and subjected to an average venous pressure increase of 10.24 +/- 0.27 (SE) cmH2O. The resulting Kfc (ml . min-1 . cmH2O-1 . 100 g dry lung wt-1) measured with the gravimetric technique was 0.420 +/- 0.017, which was statistically different from the Kfc measured by the blood-corrected gravimetric method (0.273 +/- 0.018) or the product of the reflection coefficient (sigmaf) and Kfc measured optically (0. 272 +/- 0.018). The optical method involved the use of a Cellco filter cartridge to separate red blood cells from plasma, which allowed measurement of the concentration of the tracer in plasma at normal hematocrits (34 +/- 1.5). The permeability-surface area product was measured using radioactive multiple indicator-dilution methods before, during, and after venous pressure elevations. Results showed that the surface area of the lung did not change significantly during the measurement of Kfc. These studies suggest that sigmafKfc can be measured optically at normal hematocrits, that this measurement is not influenced by blood volume changes that occur during the measurement, and that the optical sigmafKfc agrees with the Kfc obtained via the blood-corrected gravimetric method.

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

2011-01-01

INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

An experimental in-vivo canine model for adult shunt infection

Directory of Open Access Journals (Sweden)

Procop Gary

2008-10-01

Full Text Available Abstract Background Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional "human" shunts, and that a shunt infection could be established so that further studies could then be planned. Methods Hydrocephalus was induced in seven dogs (Canis familiaris by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison. Results All the dogs remained well after shunting. Examination of removed shunt components revealed S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three "negative" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source. Conclusion Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection.

Posttraumatic Stress Disorder Disturbs Coronary Tone and Its Regulatory Mechanisms.

Science.gov (United States)

Lazuko, Svetlana S; Kuzhel, Olga P; Belyaeva, Lyudmila E; Manukhina, Eugenia B; Fred Downey, H; Tseilikman, Olga B; Komelkova, Maria V; Tseilikman, Vadim E

2018-01-01

Posttraumatic stress disorder (PTSD) is associated with myocardial injury, but changes in coronary regulatory mechanisms in PTSD have not been investigated. This study evaluated the effect of PTSD-inducing stress on coronary tone and its regulation by nitric oxide (NO) and voltage-gated K + channels. PTSD was induced by exposing rats to predator stress, 15 min daily for 10 days, followed by 14 stress-free days. Presence of PTSD was confirmed by the elevated plus-maze test. Coronary tone was evaluated from changes in coronary perfusion pressure of Langendorff isolated hearts. Predator stress induced significant decreases in coronary tone of isolated hearts and in blood pressure of intact rats. L-NAME, a non-selective NO synthase (NOS) inhibitor, but not S-MT, a selective iNOS inhibitor, and increased coronary tone of control rats. In PTSD rats, both L-NAME and S-MT increased coronary tone. Therefore, the stress-induced coronary vasodilation resulted from NO overproduction by both iNOS and eNOS. NOS induction was apparently due to systemic inflammation as evidenced by increased serum interleukin-1β and C-reactive protein in PTSD rats. Decreased corticosterone in PTSD rats may have contributed to inflammation and its effect on coronary tone. PTSD was also associated with voltage-gated K + channel dysfunction, which would have also reduced coronary tone.

Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

Science.gov (United States)

Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

2016-02-01

To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Single Coronary Artery with Aortic Regurgitation

International Nuclear Information System (INIS)

Katsetos, Manny C.; Toce, Dale T.

2003-01-01

An isolated single coronary artery can be associated with normal life expectancy; however, patients are at an increased risk of sudden death. A case is reported of a 54-year-old man with several months of chest pressure with activity. On exercise Sestamibi stress testing, the patient developed a hypotensive response with no symptoms and minimal electrocardiographic changes. Nuclear scanning demonstrated reversible septal and lateral perfusion defects consistent with severe ischemia. Coronary angiography revealed a single coronary artery with the right coronary artery arising from the left main. There were high-grade stenotic lesions in the left anterior descending and circumflex arteries with only moderate atherosclerotic disease in the right coronary artery. An aortogram showed 2-3+ aortic regurgitation, with an ejection fraction of 45% on ventriculography. The patient underwent four-vessel revascularization and aortic valve replacement and did well postoperatively

Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets

Science.gov (United States)

Kilham, L.; Habermann, R.T.; Herman, C.M.

1956-01-01

1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.

Effects of Scirpusin B, a polyphenol in passion fruit seeds, on the coronary circulation of the isolated perfused rat heart

Directory of Open Access Journals (Sweden)

Yutaka Matsumoto, Nozomi Gotoh, Shoko Sano, Kenkichi Sugiyama, Tatsuhiko Ito, Yohei Abe, Yumi Katano, Akira Ishihata

2014-07-01

Full Text Available Objective: Piceatannol, a polyphenol which is contained in passion fruits seed, is a derivative of resveratrol and is known to have antioxidant, anti-inflammatory and vasorelaxing activities. Passion fruits seed also contains a dimer of Piceatannol, Scirpusin B. The aim of this study was to investigate the effect of Scirpusin B on the coronary circulation of the isolated rat heart. Methods: Hearts were isolated from male Fischer 344 rats (5 – 6 months old, and perfused with modified Krebs-Henseleit solution aerated with 95% O2 and 5% CO2 (37 °C at constant pressure (75 cmH2O by Langendorff’s method. Piceatannol or Scirpusin B (10, 30 and 100 μM was injected as a bolus into the aortic cannula and coronary flow (CF was continuously measured by the electromagnetic flow meter. In some experiments, rat hearts were pretreated with L-NAME (an inhibitor of nitric oxide synthase or Diclofenac (an inhibitor of cyclooxygenase to reveal the possible involvement of nitric oxide (NO and vasodilating prostanoids in the effect of Scirpusin B. Results: Scirpusin B increased CF up to 108.2 % of the initial value, while Piceatannol did not increase CF. In addition; Scirpusin B increased CF concentration-dependently. Pretreatment with L-NAME or Diclofenac significantly attenuated the Scirpusin B-induced coronary vasodilatation. Scirpusin B did not change the heart rate either left ventricular pressure. Conclusion: This study shows that Scirpusin B could increase CF via production of NO and vasodilating prostanoids.

Genetic variant of canine distemper virus from clinical cases in ...

African Journals Online (AJOL)

Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

Studies on manifestations of canine distemper virus infection in an urban dog population.

Science.gov (United States)

Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

1993-10-01

An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

Science.gov (United States)

Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

2004-10-13

Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

Ondas ultra-sônicas de alta freqüência causam disfunção endotelial em artérias coronárias caninas epicárdicas High-frequency ultrasonic waves cause endothelial dysfunction on canine epicardial coronary arteries

Directory of Open Access Journals (Sweden)

Berent Discigil

2008-06-01

investigations. METHODS: To determine whether ultrasound energy impairs the production of nitric oxide or damages vascular smooth muscle function, isolated canine epicardial coronary artery segments were exposed to either high (25 W or low (0-10 W ultrasonic energy outputs, for 15 seconds, using an endarterectomy device prototype. After exposure, segments of epicardial coronary artery were studied in organ chambers. The following drugs were used: adenosine diphosphate (ADP, acetylcholine (Ach and sodium fluoride (NaF to study endothelium-dependent relaxation and sodium nitroprusside (SNP and isoproterenol to evaluate endothelium-independent relaxation. RESULTS: Application of high ultrasonic energy power impaired endothelium-dependent relaxation to ADP (10-9 - 10-4 M, Ach (10-9 - 10-4 M and NaF (0.5 - 9.5 mM in epicardial coronary arteries. However, low ultrasound energy output at the tip of the probe did not alter the endothelium-dependent relaxation (either maximal relaxation or EC50 to the same agonists. Vascular smooth muscle relaxation to isoproterenol (10-9 - 10-5 M or SNP (10-9 - 10-6 M was unaltered following exposure to either low or high ultrasonic energy outputs. CONCLUSION: These experiments currently prove that ultrasonic energy changes endothelial function of epicardial coronary arteries at high power. However, ultrasound does not alter the ability of vascular smooth muscle of canine epicardial coronary arteries to relax.

Canine caliciviruses of four serotypes from military and research dogs recovered in 1963-1978 belong to two phylogenetic clades in the Vesivirus genus.

Science.gov (United States)

Binn, Leonard N; Norby, Erica A; Marchwicki, Ruth H; Jarman, Richard G; Keiser, Paul B; Hang, Jun

2018-02-23

Vesiviruses (family Caliciviridae) had been shown capable of invading a variety of host species, raising concern of their zoonotic potential. Since the 1980's, several canine caliciviruses (CaCV) isolates have been reported and are phylogenetically related to the vesiviruses with features distinct from both Vesicular exanthema of swine virus (VESV) and Feline calicivirus (FCV) species in phylogeny, serology and cell culture specificities. Etiological studies of canine diseases in dogs used for military services and laboratory studies were conducted in 1963-1978 at the Walter Reed Army Institute of Research. Multiple known and unknown viral pathogens including caliciviruses were recovered. Four unidentified isolates were recovered in Walter Reed Canine Cells (WRCC) from respiratory, fecal and penile specimens. Physicochemical tests, electron microscopy, viral cultivation in human and animal cells, antibody neutralization assays, and recently the genome sequencing were used to characterize the isolates. Sera from these dogs and their cohorts were tested with the isolates to determine origin and prevalence of the infections. The viral isolates were small non-enveloped spherical RNA virions, 27 to 42 nm in diameter with cup-like structures, indicating they are caliciviruses. They propagated in WRCC and MDCK cells, not in either other canine cells or human and other animal cells. Each isolate is antigenically distinct and react with dog sera in respective cohorts. The genomes have nucleotide identities ranging from 70.3% to 90.7% and encode the non-structural polyprotein (1810 amino acids), major capsid protein (691 amino acids) and minor structural protein (134 amino acids). They belong to two different phylogenetic clades in Vesivirus genus with close relation with canine calicivirus (CaCV). These CaCV isolates have restricted cell tropism, antigenic diversity and genetic variation. Further investigation will shed light on antigenic relation to other vesiviruses, and

BACTERIAL PROFILE OF NECROTIC PULPS IN CHEETAH (ACINONYX JUBATUS) CANINE TEETH.

Science.gov (United States)

Almansa Ruiz, José C; Bosman, Anna-Mari; Steenkamp, Gerhard

2016-03-01

The role of microbes and their antimicrobial susceptibilities in both acute and chronic infections of the dental pulp in humans has been well studied. Presently, no data are available on endodontic pathogens in cheetahs (Acinonyx jubatus). The aim of this study was to isolate and identify the bacteria found in the canine teeth of cheetahs, where the pulp was necrotic and exposed due to a complicated crown fracture. Thirty-six microbiologic samples were taken from root canals (RCs) of the canine teeth of 19 cheetahs: one pulp sample was taken from 10 cheetahs, four samples from 2 cheetahs, two samples from 3 cheetahs, and three samples from 4 cheetahs. Exposed pulps were cultured for aerobic and anaerobic bacteria; an additional screening with a 16S rRNA-specific polymerase chain reaction (PCR) was used for the last six samples. Antimicrobial susceptibility of isolates was determined by use of the Kirby-Bauer diffusion test. In total, 59 cultivable isolates belonging to 19 microbial species and 13 genera were recovered from the 36 RCs sampled. Only two samples yielded no cultivable bacteria. Thirty-two (54.49%) of the cultivable isolates were Gram positive and 27 (45.71%) were Gram negative. The maximum number of isolates cultivated from an individual RC was six. Facultative anaerobes (62.72%) were the most common bacteria of the RCs that yielded cultivable bacteria. Of the isolates, 28.81% were aerobic and 8.47% were strict anaerobes. The antimicrobials that showed the greatest efficacy in vitro against the different bacteria isolates were amikacin and gentamicin. The more common bacterial species isolated by PCR were anaerobes (60.8%), facultative anaerobes (30.2%), and aerobes (8.6%).

The administration of a single dose of a multivalent (DHPPiL4R) vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

OpenAIRE

Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture

2014-01-01

Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...

Canine Distemper in an isolated population of fishers (Martes pennanti) from California

Science.gov (United States)

Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson

2012-01-01

Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

OpenAIRE

Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

2017-01-01

Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

Science.gov (United States)

Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

2015-01-01

Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

Analysis of the influence of respiratory disorders observed in preoperative spirometry on the dynamics of early inflammatory response in patients undergoing isolated coronary artery bypass grafting.

Science.gov (United States)

Szylińska, Aleksandra; Listewnik, Mariusz J; Rotter, Iwona; Rył, Aleksandra; Biskupski, Andrzej; Brykczyński, Mirosław

2017-01-01

Preoperative spirometry provides measurable information about the occurrence of respiratory disorders. The aim of this study was to assess the association between preoperative spirometry abnormalities and the intensification of early inflammatory responses in patients following coronary artery bypass graft in extracorporeal circulation. The study involved 810 patients (625 men and 185 women) aged 65.4±7.9 years who were awaiting isolated coronary artery bypass surgery. On the basis of spirometry performed on the day of admittance to the hospital, the patients were divided into three groups. Patients without respiratory problems constituted 78.8% of the entire group. Restricted breathing was revealed by spirometry in 14.9% and obstructive breathing in 6.3% of patients. Inter-group analysis showed statistically significant differences in C-reactive protein (CRP) between patients with restrictive spirometry abnormalities and patients without any pulmonary dysfunction. CRP concentrations differed before surgery ( P =0.006) and on the second ( P spirometry results from restrictive respiratory disorders have an elevated level of generalized inflammatory response both before and after the isolated coronary artery bypass surgery. Therefore, this group of patients should be given special postoperative monitoring and, in particular, intensive respiratory rehabilitation immediately after reconstitution.

Typing of Canine Parvovirus Strains Circulating in North-East China.

Science.gov (United States)

Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

2017-04-01

Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

Amiodarona causa vasodilatação dependente do endotélio em artérias coronárias caninas Amiodarone causes endothelium-dependent vasodilation in canine coronary arteries

Directory of Open Access Journals (Sweden)

Alfredo José Rodrigues

2005-03-01

Full Text Available OBJETIVO: Avaliar os efeitos vasodilatadores da amiodarona em artérias coronárias caninas empregando soluções de amiodarona dissolvida em polisorbato 80 ou em água. MÉTODOS: Anéis de artéria coronária, com e sem o endotélio íntegro, foram imersos em solução de krebs e conectadas a um transdutor para aferição de força isométrica promovida por contração vascular. As artérias foram expostas a concentrações crescentes de polisorbato 80, amiodarona dissolvida em água, amiodarona dissolvida em polisorbato 80 e uma apresentação comercial da amiodarona (Cordarone®. Os experimentos foram conduzidos na presença e na ausência dos seguintes bloqueadores enzimáticos: apenas indometacina, Nômega-nitro-L-arginina associada à indometacina e apenas Nômega-nitro-L-arginina. RESULTADOS: O polisorbato 80 causou pequeno relaxamento não dependente do endotélio. O Cordarone®, a amiodarona dissolvida em água e em polisorbato 80 promoveram relaxamento dependente do endotélio, que foi de maior magnitude para a amiodarona dissolvida em polisorbato e para o Cordarone®. Apenas a associação de indometacina com a Nômega-nitro-L-arginina foi capaz de abolir o relaxamento dependente do endotélio provocado pela amiodarona dissolvida em polisorbato 80. CONCLUSÃO: Os resultados obtidos indicam que a vasodilatação promovida pela amiodarona em artérias coronárias caninas é causada principalmente pela estimulação da liberação de óxido nítrico e fatores endoteliais relaxantes dependentes das ciclo-oxigenases.OBJECTIVE: To assess the vasodilating effects of amiodarone on canine coronary arteries by using solutions of amiodarone dissolved in polysorbate 80 or water. METHODS: Rings of coronary arteries, with or without intact endothelium, were immersed in Krebs solution and connected to a transducer for measuring the isometric force promoted by a vascular contraction. The arteries were exposed to increasing concentrations of

Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

Science.gov (United States)

Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

1976-01-01

Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

Effects of continuous administration of clopidogrel before off-pump coronary artery bypass grafting in patients with acute coronary syndrome. A propensity score analysis

International Nuclear Information System (INIS)

Song, Suk-Won; Youn, Young-Nam; Yi, Gijong; Lee, Sak; Yoo, Kyung-Jong

2008-01-01

Clopidogrel has become standard treatment after urgent percutaneous coronary revascularization. Due to its enhanced and irreversible platelet inhibition, patients undergoing urgent surgical revascularization have a higher risk of bleeding complications and transfusions. Therefore, the effect of preoperative continuous administration of clopidogrel on the incidence of hemorrhagic complications in patients undergoing off-pump coronary artery bypass surgery with acute coronary syndrome was evaluated. From March 2004 to September 2006, 172 patients with acute coronary syndrome underwent isolated off-pump coronary artery bypass surgery; 70 (40.7%) and 102 (59.3%) of these patients did or did not take clopidogrel before surgery respectively. Seventy patients in each group were matched using propensity scores and associations between preoperative continuous administration of clopidogrel and postoperative bleeding, hemostatic reoperation, blood products received, the need for multiple transfusions and early graft patency by coronary computed tomography were assessed. Univariate analysis showed the continuous clopidogrel group had similar levels of postoperative bleeding for 24 h (601.4±312.6 ml vs 637.2±452.4 ml, p=0.616) and rates of reexploration (1.4% vs 1.4%), perioperative blood transfusion (33.3% vs 34.3%, p>0.05) and platelet transfusion (2.9% vs 7.1%, p=0.44) compared with the non-continuous group. Preoperative continuous administration of clopidogrel did not increase the risk of hemorrhagic complications in patients with acute coronary syndrome undergoing isolated off-pump coronary artery bypass surgery. These findings indicate that surgery after clopidogrel treatment in patients with acute coronary syndrome should not be delayed until platelet function returns to normal because they may have a higher risk of recurrent myocardial ischemic events. (author)

Epizootic canine distemper virus infection among wild mammals.

Science.gov (United States)

Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken

2012-01-27

In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

Diastolic coronary artery pressure-flow velocity relationships in conscious man.

Science.gov (United States)

Dole, W P; Richards, K L; Hartley, C J; Alexander, G M; Campbell, A B; Bishop, V S

1984-09-01

We characterised the diastolic pressure-flow velocity relationship in the normal left coronary artery of conscious man before and after vasodilatation with angiographic contrast medium. Phasic coronary artery pressure and flow velocity were measured in ten patients during individual diastoles (0.5 to 1.0 s) using a 20 MHz catheter-tipped, pulsed Doppler transducer. All pressure-flow velocity curves were linear over the diastolic pressure range of 110 +/- 15 (SD) mmHg to 71 +/- 7 mmHg (r = 0.97 +/- 0.01). In the basal state, values for slope and extrapolated zero flow pressure intercept averaged 0.35 +/- 0.12 cm X s-1 X mmHg-1 and 51.7 +/- 8.6 mmHg, respectively. Vasodilatation resulted in a 2.5 +/- 0.5 fold increase in mean flow velocity. The diastolic pressure-flow velocity relationship obtained during peak vasodilatation compared to that during basal conditions was characterised by a steeper slope (0.80 +/- 0.48 cm X s-1 X mmHg-1, p less than 0.001) and lower extrapolated zero flow pressure intercept (37.9 +/- 9.8 mmHg, p less than 0.05). Mean right atrial pressure for the group averaged 4.4 +/- 1.7 mmHg, while left ventricular end-diastolic pressure averaged 8.7 +/- 2.8 mmHg. These observations in man are similar to data reported in the canine coronary circulation which are consistent with a vascular waterfall model of diastolic flow regulation. In this model, coronary blood flow may be regulated by changes in diastolic zero flow pressure as well as in coronary resistance.

Aprotinin vs. tranexamic acid in isolated coronary artery bypass surgery: A multicentre observational study.

Science.gov (United States)

Deloge, Elsa; Amour, Julien; Provenchère, Sophie; Rozec, Bertrand; Scherrer, Bruno; Ouattara, Alexandre

2017-05-01

Aprotinin appears to be more efficacious than lysine analogues to reduce bleeding and transfusion of blood products in high-transfusion-risk cardiac surgical patients. However, in isolated coronary artery bypass graft (CABG) surgery, the results from head-to-head trials remain less conclusive. Our objective was to compare the efficacies and safety of aprotinin and tranexamic acid (TXA) in patients undergoing isolated on-pump CABG. A multicentre before-and-after study pooling individual data from published trials and unpublished data from three other databases. Four tertiary care teaching hospitals (Haut-Lévêque Hospital in Bordeaux, Pitié-Salpêtrière Hospital and Bichat-Claude Bernard Hospital in Paris, and Laennec Hospital in Nantes). We included data of 2496 isolated on-pump CABG surgery patients who received either aprotinin between November 2003 and May 2008 (n = 1267) or TXA between November 2007 and November 2013 (n = 1229). The primary outcome was total blood loss within 24 h after operation. Secondary outcomes were transfusion of blood products, reoperation for bleeding, renal replacement therapy, ICU length of stay and in-hospital mortality. Adjusted mean (SEM) 24-h blood loss after surgery [483 (11) vs. 634 (11) ml, P < 0.0001] and the proportion of patients requiring intraoperative blood product transfusion (32.7 vs. 46.5%, P = 0.01) were lower in aprotinin-treated patients. No difference was observed with regard to reoperations for bleeding, renal replacement therapy and in-hospital mortality. However, patients receiving aprotinin had a significantly shorter adjusted ICU length of stay. In patients undergoing isolated CABG, aprotinin was more effective than TXA in reducing postoperative blood loss, and no safety concerns were identified. The benefits of aprotinin should be considered when evaluating the risk of major blood loss and transfusion in patients scheduled for isolated CABG surgery.

Assessment of hemodynamic significance of isolated stenoses of the left anterior descending coronary artery using thallium-201 myocardial scintigraphy

International Nuclear Information System (INIS)

Kalff, V.; Kelly, M.J.; Soward, A.; Harper, R.W.; Currie, P.J.; Lim, Y.L.; Pitt, A.

1985-01-01

This study tests the hypothesis that the results of stress thallium-201 myocardial perfusion scans (TI-201) are related to the mean transstenotic pressure gradient of coronary stenoses independent of the percent luminal diameter narrowing seen at angiography. The 22 study patients (20 men, 2 women, mean age 47 years, range 30 to 62) had no previous myocardial infarction. Each underwent a symptom-limited, erect bicycle TI-201 test off antianginal therapy, shortly before percutaneous transluminal coronary angioplasty for isolated left anterior descending coronary artery stenosis. The percent narrowing, mean gradient at percutaneous transluminal coronary angioplasty and presence of a visually apparent TI-201 defect were independently evaluated and results compared. All 4 patients with 90% or greater diameter narrowing had positive TI-201 responses, and the mean gradient was 72 +/- 11 mm Hg. Among the 18 patients with less than 90% diameter narrowing, the mean gradient was higher (p less than 0.001) in the 11 with a positive TI-201 (63 +/- 15 mm Hg) than in the 7 with a negative TI-201 (33 +/- 20 mm Hg), but their percent narrowing did not differ significantly (72 +/- 14% vs 66 +/- 19%). Multiple regression analysis showed that the presence of a TI-201 defect was a strong (p . 0.003) and percent narrowing (p . 0.048) a weak independent predictor for gradient. When the mean gradient was normalized for the prestenotic pressure, both percent narrowing (p . 0.003) and TI-201 defects (p . 0.006) were significant independent predictors

Purification and partial characterization of canine S100A12.

Science.gov (United States)

Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

2010-12-01

Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

Novel lineages of Giardia intestinalis identified by genetic analysis of organisms isolated from dogs in Australia.

Science.gov (United States)

Monis, P T; Andrews, R H; Mayrhofer, G; Mackrill, J; Kulda, J; Isaac-Renton, J L; Ey, P L

1998-01-01

Infection of suckling mice with Giardia trophozoites recovered from the intestines of 11 dogs autopsied in Central and Southern Australia in each case produced an established isolate. In contrast, only 1 isolate was obtained by inoculation of faecal cysts. The organisms grew poorly in comparison with isolates from humans or non-canine animal hosts. Light microscopy revealed that the trophozoites had median bodies with the 'claw hammer' appearance typical of G. intestinalis (syn. G. duodenalis, G. lamblia) but that they differed in shape and nuclear morphology from axenic isolates of human or canine origin. Allozymic analysis of electrophoretic data representing 26 loci and phylogenetic analysis of nucleotide sequences obtained from DNA amplified from the glutamate dehydrogenase locus showed that the 11 isolates examined from Australian dogs were genetically distinct from all isolates of G. intestinalis that have been established previously from humans and animals, and also from G. muris. Both analytical methods placed 10 of the Australian canine isolates into a unique genetic lineage (designated Assemblage C) and the eleventh into a deep-rooted second branch (designated Assemblage D), each well separated from the 2 lineages (Assemblages A and B) of G. intestinalis that encompass all the genotypes known to infect humans. In contrast, 4 axenic isolates derived from dogs in Canada and Europe (the only other isolates to have been established from dogs) have genotypes characteristic of genetic Assemblages A or B. The findings indicate that the novel Giardia identified in these rural Australian dogs have a restricted host range, possibly confined to canine species. The poor success rate in establishing Giardia from dogs in vitro suggests, further, that similar genotypes may predominate as canine parasites world-wide. The absence of such organisms among isolates of Giardia that have been established from humans by propagation in suckling mice indicates that they are

Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

Science.gov (United States)

Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

2013-08-01

Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

Science.gov (United States)

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Decreased antimony uptake and overexpression of genes of thiol metabolism are associated with drug resistance in a canine isolate of Leishmania infantum

Directory of Open Access Journals (Sweden)

Verónica Gómez Pérez

2016-08-01

Full Text Available Visceral leishmaniasis (VL caused by the protozoan parasite Leishmania infantum, is one of the most important zoonotic diseases affecting dogs and humans in the Mediterranean area. The presence of infected dogs as the main reservoir host of L. infantum is regarded as the most significant risk for potential human infection. We have studied the susceptibility profile to antimony and other anti-leishmania drugs (amphotericin B, miltefosine, paromomycin in Leishmania infantum isolates extracted from a dog before and after two therapeutic interventions with meglumine antimoniate (subcutaneous Glucantime®, 100 mg/kg/day for 28 days. After the therapeutic intervention, these parasites were significantly less susceptible to antimony than pretreatment isolate, presenting a resistance index of 6-fold to SbIII for promastigotes and >3-fold to SbIII and 3-fold to SbV for intracellular amastigotes. The susceptibility profile of this resistant L. infantum line is related to a decreased antimony uptake due to lower aquaglyceroporin-1 expression levels. Additionally, other mechanisms including an increase in thiols and overexpression of enzymes involved in thiol metabolism, such as ornithine decarboxylase, trypanothione reductase, mitochondrial tryparedoxin and mitochondrial tryparedoxin peroxidase, could contribute to the resistance as antimony detoxification mechanisms. A major contribution of this study in a canine L. infantum isolate is to find an antimony-resistant mechanism similar to that previously described in other human clinical isolates.

Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

DEFF Research Database (Denmark)

Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

2014-01-01

BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

First complete genome sequence of canine bocavirus 2 in mainland China

Directory of Open Access Journals (Sweden)

S.-L. Zhai

2017-07-01

Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

The Duration of Immunity to an Inactivated Adjuvanted Canine Parvovirus Vaccine. A 52 and 64 Week Postvaccination Challenge Study

OpenAIRE

Povey, R. C.; Carman, P. S.; Ewert, E.

1983-01-01

Dogs were successfully isolated for a period of either 52 or 64 weeks following vaccination with an inactivated, adjuvanted canine parvovirus-2 vaccine. Antibody persisted in all ten vaccinated dogs, although in one case by 52 weeks postvaccination only virus neutralizing antibody, and not hemagglutination-inhibiting antibody, could be detected. Sentinel unvaccinated dogs housed alongside the vaccinated dogs throughout the study remained free of canine parvovirus-2 antibody until challenged. ...

First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh

DEFF Research Database (Denmark)

Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh

2016-01-01

AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...

Optical measurement of isolated canine lung filtration coefficients after alloxan infusion.

Science.gov (United States)

Klaesner, J W; Pou, N A; Parker, R E; Finney, C; Roselli, R J

1998-04-01

In this study, lung filtration coefficient (Kfc) was measured in eight isolated canine lung preparations by using three methods: standard gravimetric (Std), blood-corrected gravimetric (BC), and optical. The lungs were held in zone III conditions and were subjected to an average venous pressure increase of 8.79 +/- 0.93 (mean +/- SD) cmH2O. The permeability of the lungs was increased with an infusion of alloxan (75 mg/kg). The resulting Kfc values (in milliliters . min-1 . cmH2O-1 . 100 g dry lung weight-1) measured by using Std and BC gravimetric techniques before vs. after alloxan infusion were statistically different: Std, 0.527 +/- 0.290 vs. 1. 966 +/- 0.283; BC, 0.313 +/- 0.290 vs. 1.384 +/- 0.290. However, the optical technique did not show any statistical difference between pre- and postinjury with alloxan, 0.280 +/- 0.305 vs. 0.483 +/- 0. 297, respectively. The alloxan injury, quantified by using multiple-indicator techniques, showed an increase in permeability and a corresponding decrease in reflection coefficient for albumin (sigmaf). Because the optical method measures the product of Kfc and sigmaf, this study shows that albumin should not be used as an intravascular optical filtration marker when permeability is elevated. However, the optical technique, along with another means of measuring Kfc (such as BC), can be used to calculate the sigmaf of a tracer (in this study, sigmaf of 0.894 at baseline and 0.348 after injury). Another important finding of this study was that the ratio of baseline-to-injury Kfc values was not statistically different for Std and BC techniques, indicating that the percent contribution of slow blood-volume increases does not change because of injury.

Proton nuclear magnetic resonance imaging of regionally ischemic canine hearts: effects of paramagnetic proton signal enhancement

International Nuclear Information System (INIS)

Brady, T.J.; Goldman, M.R.; Pykett, I.L.; Buonanno, F.S.; Kistler, J.P.; Newhouse, J.H.; Burt, C.T.; Hinshaw, W.S.; Pohost, G.M.

1982-01-01

In a study to evaluate the potential of proton nuclear magnetic resonance (NMR) imaging with and without manganese contrast enhancement for detecting acute myocardial infarction, 12 dogs underwent 90-minute occlusion of the left circumflex coronary artery. Transverse-section NMR images of the excised, nonbeating heart were obtained at 1-cm intervals using the steady-state-free-precession (SSFP) technique. All NMR images revealed detailed structure of the heart. The three hearts without manganese showed no difference in intensity between the normal and the ischemic posterior regions, whereas those with manganese demonstrated a clearly demarcated zone of reduced signal intensity consistent with the ischemic zone. It is concluded that high-resolution tomograms of the excised canine myocardium can be obtained using proton NMR imaging. With the SSFP imaging technique, proton signal enhancement with manganese infusion is necessary to differentiate between ischemic and nonischemic myocardium after 90 minutes of coronary occlusion

Myocardial temperature variation: effect on regional function and coronary flow in dogs

International Nuclear Information System (INIS)

D'Ambra, M.N.; Magrassi, P.; Lowenstein, E.; Kyo, S.; Austen, W.G.; Buckley, M.J.; LaRaia, P.J.

1987-01-01

Incremental changes in the temperature (28-42.5 0 C) of the anterior left ventricular wall in a canine, working, beating right heart bypass preparation (constant preload, afterload, and heart rate) were produced to measure the effect of regional temperature on myocardial function and blood flow. Circumferential-axis segment lengths were measured with sonomicrometry in both the temperature-varied, left-anterior descending coronary artery (LAD)-supplied myocardium and the normothermic (38 0 C) circumflex-supplied myocardium. Fast thermistors (time constant 0 C), regional systolic shortening decreased 42.2 +/- 10% at 41 0 C and increased 23.3 +/- 6% at 31 0 C. There was no significant change in coronary blood flow or distribution at the three temperatures. Pressure-length areas varied inversely with myocardial temperature. These data demonstrate that there is a reversible inverse relationship between midwall T and ventricular function when heart rate, preload, and afterload are controlled

Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

Science.gov (United States)

Larson, L J; Schultz, R D

2007-01-01

A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

Directory of Open Access Journals (Sweden)

Anna McRee

2014-09-01

Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

Science.gov (United States)

McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

2014-09-05

Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Varied clinico-radiological presentations of transmigrated canines

Directory of Open Access Journals (Sweden)

Ishita Gupta

2015-01-01

Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

International Nuclear Information System (INIS)

Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

2011-01-01

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

Energy Technology Data Exchange (ETDEWEB)

Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

2011-03-30

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

Development of the canine tooth in the beagle

International Nuclear Information System (INIS)

Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

1993-01-01

The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

Effect of Japanese Green Tea Extract on Canine Periodontal Diseases

OpenAIRE

Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.

2011-01-01

Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

Ontogeny of canine dimorphism in extant hominoids.

Science.gov (United States)

Schwartz, G T; Dean, C

2001-07-01

Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

Surgical construction of a novel simulated carotid siphon in canines

International Nuclear Information System (INIS)

Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He

2008-01-01

Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

2012-08-01

Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Spontaneous bacterial coronary sinus septic thrombophlebitis treated successfully medically.

Science.gov (United States)

Fournet, Maxime; Behaghel, Albin; Pavy, Carine; Flecher, Erwan; Thebault, Christophe

2014-03-01

A 38-year-old farmer was hospitalized for fever, chills, cough, and chest pain lasting for 7 days. Due to persistent symptoms, patient was referred to hospital. Blood cultures identified oxacillin-sensitive Staphylococcus aureus (OSSA). Transthoracic echocardiography (TTE) showed large pericardial effusion, a mobile heterogeneous mass originating from the coronary sinus ostium, no sign of valvular endocarditis. Pericardiocentesis was done carrying out purulent fluid, microbiological culture isolating an OSSA. Parenteral penicillin M was administered for 6 weeks. At the end of this antibiotherapy regimen, TTE showed no coronary sinus mass with complete vacuity of the coronary sinus vein and no pericardial effusion.

Canine osteosarcoma cell lines contain stem-like cancer cells: biological and pharmacological characterization.

Science.gov (United States)

Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio

2016-05-01

Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.

Bilateral supernumerary primary maxillary canines

Directory of Open Access Journals (Sweden)

Santanu Mukhopadhyay

2018-01-01

Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

9 CFR 113.306 - Canine Distemper Vaccine.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

OpenAIRE

J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

2002-01-01

Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

Characterization of the canine urinary proteome.

Science.gov (United States)

Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

2014-06-01

Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

[Multiple coronary arteriovenous fistulae. Hazard or predetermination?].

Science.gov (United States)

Rangel, Alberto; Muñoz-Castellanos, Luis; Solorio, Sergio

2003-01-01

The authors present the clinical cases of three adult patients (49, 53 and 61 year-old), with rheumatic cardiac valvulopathy, and bilateral coronary arteriovenous fistulae draining in the main pulmonary artery. Based on documental investigation, the authors speculate about the predeterminate origin of coronary arteriovenous fistulae. At first glance, it seems obvious that congenital cardiopathies occur at random, i.e., embryonic development deviate or stops due to unknown reasons, originating the persistence of lacunar blood spaces prior to the development of coronary arteries cords. There are two factors involved in the genesis of congenital malformations: a genomic preexisting factor and the presence of an environmental precipitating factor, i.e., isolated pulmonary valve atresia or left ventricular hypoplastic syndrome, with mitral and aortic valve stenosis, can predispose development of coronary arteriovenous fistulae. Recently, the question has been raised whether there is a relation of coronary arteries fistulae with: ethnic groups, hereditary gigantism, autoimmune diseases, such as polymyositis, hereditary hemorrhagic telangiectasia, and apical hypertrophic myocardiopathy. Coronary arteriovenous fistulae, as well as some congenital cardiopathies, could be due to chromosome alterations or might be related to hereditary diseases, such as hemorrhagic telangiectasia, induced by a disturbed genetic program. Although, there is no concrete evidence that a genetic factor is related to the development of coronary arteriovenous fistulae, there are signs that suggest that such a possibility could be investigated.

Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

Science.gov (United States)

Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

2012-12-01

To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

Science.gov (United States)

Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

2014-12-05

Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

2011-09-01

Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

A monograph proposing the use of canine mammary tumours as a model for the study of hereditary breast cancer susceptibility genes in humans.

Science.gov (United States)

Goebel, Katie; Merner, Nancy D

2017-05-01

Canines are excellent models for cancer studies due to their similar physiology and genomic sequence to humans, companion status and limited intra-breed heterogeneity. Due to their affliction to mammary cancers, canines can serve as powerful genetic models of hereditary breast cancers. Variants within known human breast cancer susceptibility genes only explain a fraction of familial cases. Thus, further discovery is necessary but such efforts have been thwarted by genetic heterogeneity. Reducing heterogeneity is key, and studying isolated human populations have helped in the endeavour. An alternative is to study dog pedigrees, since artificial selection has resulted in extreme homogeneity. Identifying the genetic predisposition to canine mammary tumours can translate to human discoveries - a strategy currently underutilized. To explore this potential, we reviewed published canine mammary tumour genetic studies and proposed benefits of next generation sequencing canine cohorts to facilitate moving beyond incremental advances.

Canine parvovirus in asymptomatic feline carriers.

Science.gov (United States)

Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

2012-05-25

Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

Rarity of isolated pulmonary embolism and acute aortic syndrome occurring outside of the field of view of dedicated coronary CT angiography

International Nuclear Information System (INIS)

Lee, Hwa Yeon; Song, In Sup; Yoo, Seung Min; Rho, Ji Young; Moon, Jae Youn; Kim, In Jai; Lim, Sang Wook; Sung, Jung Hoon; Cha, Dong Hun; White, Charles S.

2011-01-01

Background Although triple rule-out CT angiography (TRO) to simultaneously evaluate acute coronary syndrome (ACS), pulmonary embolism (PE), and acute aortic syndrome (AAS) is increasingly used in many institutions, TRO is inevitably associated with increased radiation exposure due to extended z-axis coverage compared with dedicated coronary CT angiography (DCTA). Purpose To determine the frequency of exclusion of findings of AAS, PE, and significant incidental non-cardiac pathology that may be the cause of acute chest pain when using a restricted DCTA field of view (FOV). Material and Methods We retrospectively reviewed CT images and charts of 103 patients with acute PE and 50 patients with AAS. Either non-ECG gated dedicated pulmonary or aortic CT angiography was performed using 16- or 64-slice multidetector CT (MDCT). We analyzed the incidence of isolated PE, AAS, or significant non-cardiac pathology outside of DCTA FOV (i.e. from tracheal carina to the base of heart). Results There were two cases of isolated PE (2/103, 1.9%) excluded from the FOV of DCTA. One case of PE was isolated to the subsegmental pulmonary artery in the posterior segment of the right upper lobe. In the second case, pulmonary embolism in the left main pulmonary artery was located out of the FOV of DCTA because the left main pulmonary artery was retracted upwardly by fibrotic scar in the left upper lobe due to prior tuberculosis. There was no case of AAS and significant non-cardiac pathology excluded from the FOV of DCTA. AAS (n = 50) consisted of penetrating atherosclerotic ulcer (n = 7), intramural hematoma (n = 5) and aortic dissection (n = 38). Conclusion As isolated PE, AAS, and significant non-cardiac pathology outside of the DCTA FOV rarely occur, DCTA may replace TRO in the evaluation of patients with non-specific acute chest pain and a low pre-test probability of PE or aortic dissection

Rarity of isolated pulmonary embolism and acute aortic syndrome occurring outside of the field of view of dedicated coronary CT angiography

Energy Technology Data Exchange (ETDEWEB)

Lee, Hwa Yeon; Song, In Sup (Dept. of Diagnostic Radiology Chung-Ang Univ. College of Medicine, Seoul (Korea, Republic of)); Yoo, Seung Min; Rho, Ji Young (Dept. of Diagnostic Radiology CHA Medical Univ. Hospital, Bundang (Korea, Republic of)), email: smyoo68@hanmail.net; Moon, Jae Youn; Kim, In Jai; Lim, Sang Wook; Sung, Jung Hoon; Cha, Dong Hun (Dept. of Cardiology CHA Medical Univ. Hospital, Bundang (Korea, Republic of)); White, Charles S. (Dept. of Diagnostic Radiology Univ. of Maryland, Baltimore (United States))

2011-05-15

Background Although triple rule-out CT angiography (TRO) to simultaneously evaluate acute coronary syndrome (ACS), pulmonary embolism (PE), and acute aortic syndrome (AAS) is increasingly used in many institutions, TRO is inevitably associated with increased radiation exposure due to extended z-axis coverage compared with dedicated coronary CT angiography (DCTA). Purpose To determine the frequency of exclusion of findings of AAS, PE, and significant incidental non-cardiac pathology that may be the cause of acute chest pain when using a restricted DCTA field of view (FOV). Material and Methods We retrospectively reviewed CT images and charts of 103 patients with acute PE and 50 patients with AAS. Either non-ECG gated dedicated pulmonary or aortic CT angiography was performed using 16- or 64-slice multidetector CT (MDCT). We analyzed the incidence of isolated PE, AAS, or significant non-cardiac pathology outside of DCTA FOV (i.e. from tracheal carina to the base of heart). Results There were two cases of isolated PE (2/103, 1.9%) excluded from the FOV of DCTA. One case of PE was isolated to the subsegmental pulmonary artery in the posterior segment of the right upper lobe. In the second case, pulmonary embolism in the left main pulmonary artery was located out of the FOV of DCTA because the left main pulmonary artery was retracted upwardly by fibrotic scar in the left upper lobe due to prior tuberculosis. There was no case of AAS and significant non-cardiac pathology excluded from the FOV of DCTA. AAS (n = 50) consisted of penetrating atherosclerotic ulcer (n = 7), intramural hematoma (n = 5) and aortic dissection (n = 38). Conclusion As isolated PE, AAS, and significant non-cardiac pathology outside of the DCTA FOV rarely occur, DCTA may replace TRO in the evaluation of patients with non-specific acute chest pain and a low pre-test probability of PE or aortic dissection

Molecular typing of canine parvovirus strains circulating from 2008 to 2012 in an organized kennel in India reveals the possibility of vaccination failure.

Science.gov (United States)

Mittal, Mitesh; Chakravarti, Soumendu; Mohapatra, J K; Chug, P K; Dubey, Rahul; Upmanuyu, Vikramaditya; Narwal, P S; Kumar, Anil; Churamani, C P; Kanwar, N S

2014-04-01

Canine parvovirus-2 (CPV-2), which emerged in 1978, is considered as the major viral enteric pathogen of the canine population. With the emergence of new antigenic variants and incidences of vaccine failure, CPV has become one of the dreaded diseases of the canines worldwide. The present study was undertaken in an organized kennel from North India to ascertain the molecular basis of the CPV outbreaks in the vaccinated dogs. 415 samples were collected over a 5year period (2008-2012). The outbreak of the disease was more severe in 2012 with high incidence of mortality in pups with pronounced clinical symptoms. Molecular typing based on the VP2 gene was carried out with the 11 isolates from different years and compared with the CPV prototype and the vaccine strains. All the isolates in the study were either new CPV-2a (2012 isolates) or new CPV-2b (2008 and 2011 isolates). There were amino acid mutations at the Tyr324Ile and at the Thr440Ala position in five isolates from 2012 indicating new CPV mutants spreading in India. The CPV vaccines used in the present study failed to generate protective antibody titer against heterogeneous CPV antigenic types. The findings were confirmed when the affected pups were treated with hyper-immune heterogeneous purified immunoglobulin's against CPV in dogs of different antigenic types. Copyright © 2014 Elsevier B.V. All rights reserved.

Right sided single coronary artery origin: surgical interventions without clinical consequences.

Science.gov (United States)

Hamid, Tahir; Rose, Samman; Horner, Simon

2011-11-01

Congenital coronary anomalies are uncommon and are usually diagnosed incidentally during coronary angiogram or autopsy. Isolated coronary artery anomalies and the anomalous origin of left main stem (LMS) from the proximal portion of the right coronary artery or from the right sinus of valsalva are extremely rare. A 68 years old woman with atypical chest pains was referred for risk assessment for the general anaesthesia. A stress exercise treadmill test and myocardial perfusion scan revealed evidence of mild myocardial ischemia. Her coronary angiography revealed her left coronary artery to have a single origin with the right coronary artery. There were no flowlimiting lesions. A CT aortography confirmed a retro-aortic course of the left coronary artery. She successfully underwent multiple surgical procedures under general anaesthesia including total abdominal hysterectomy, Burch colposuspension (twice) for stress incontinence, intravesical botox injection for urge incontinence and haemorrhoidectomy for recurrent rectal mucosal prolapse. Various anaesthetic agents including halothane, thiopentone, suxamethonium, pancuronium, enflurane, fentanyl, propofol and isoflurane were used without any adverse clinical consequences. She remained well on 48 months follow-up.

Preoperative Hematocrit Concentration and the Risk of Stroke in Patients Undergoing Isolated Coronary-Artery Bypass Grafting

Directory of Open Access Journals (Sweden)

Khaled M. Musallam

2013-01-01

Full Text Available Background. Identification and management of risk factors for stroke following isolated coronary artery bypass grafting (CABG could potentially lower the risk of such serious morbidity. Methods. We retrieved data for 30-day stroke incidence and perioperative variables for patients undergoing isolated CABG and used multivariate logistic regression to assess the adjusted effect of preoperative hematocrit concentration on stroke incidence. Results. In 2,313 patients (mean age 65.9 years, 73.6% men, 43 (1.9%, 95% CI: 1.4–2.5 developed stroke within 30 days following CABG (74.4% within 6 days. After adjustment for a priori defined potential confounders, each 1% drop in preoperative hematocrit concentration was associated with 1.07 (95% CI: 1.01–1.13 increased odds for stroke (men, OR: 1.08, 95% CI: 1.01–1.16; women, OR: 1.02, 95% CI: 0.91–1.16. The predicted probability of stroke for descending preoperative hematocrit concentration exceeded 2% for values <37% (<37% for men (adjusted OR: 2.39, 95% CI: 1.08–5.26 and <38% for women (adjusted OR: 2.52, 95% CI: 0.53–11.98, with a steeper probability increase noted in men. The association between lower preoperative hematocrit concentration and stroke was evident irrespective of intraoperative transfusion use. Conclusion. Screening and management of patients with low preoperative hematocrit concentration may alter postoperative stroke risk in patients undergoing isolated CABG.

Canine parvovirus effect on wolf population change and pup survival

Science.gov (United States)

Mech, L.D.; Goyal, S.M.

1993-01-01

Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

Perioperative outcomes in minimally invasive direct coronary artery bypass versus off-pump coronary artery bypass with sternotomy.

Science.gov (United States)

Tekin, Ali İhsan; Arslan, Ümit

2017-09-01

Surgical treatment of isolated left anterior descending coronary artery disease can be performed with either minimally invasive direct coronary artery bypass via a left anterior thoracotomy (MIDCAB) or off-pump coronary artery bypass via a median sternotomy (OPCAB). To compare the perioperative outcomes of patients undergoing MIDCAB or OPCAB surgery. Patients who underwent either MIDCAB or OPCAB for isolated left anterior descending (LAD) coronary artery disease between October 2013 and December 2015 were retrospectively evaluated. Operations were carried out by the same surgical team. Preoperative, intraoperative and postoperative data of the patients were recorded for analyses. Twenty-three patients (7 females, 16 males) underwent MIDCAB surgery, and 24 patients (4 female, 20 males) underwent OPCAB surgery. The two groups were comparable regarding preoperative patient characteristics. Duration of mechanical ventilation (5.1 ±0.7 h vs. 6.6 ±0.9 h), intensive care unit stay (19.4 ±2.5 h vs. 45.8 ±5.4 h) and hospital stay (4.3 ±0.4 days vs. 5.6 ±0.8 days) were significantly shorter in the MIDCAB group (p < 0.01). Patients in the OPCAB group required significantly more blood transfusions (1.83 ±0.38 units vs. 0.17 ±0.38 units) and fresh frozen plasma use (2.33 ±0.96 units vs. 0.69 ±0.76 units) (p < 0.01). Conversion to sternotomy was not required in the MIDCAB group. There was no mortality, conversion to cardiopulmonary bypass or serious complication in either group. We believe that the MIDCAB technique is more advantageous than the OPCAB technique in the treatment of patients with a critical LAD lesion.

Beneficial hemodynamic effects of nicorandil in a canine model of acute congestive heart failure: comparison with nitroglycerin and cromakalim.

Science.gov (United States)

Noguchi, K; Matsuzaki, T; Ojiri, Y; Koyama, T; Nakasone, J; Sakanashi, M

1998-01-01

Comparative hemodynamic effects of nicorandil (NCR), nitroglycerin (NTG) and cromakalim (CRM) were examined in a canine model of acute congestive heart failure (CHF). CHF was produced by injections of saponin into coronary arteries of anesthetized dogs followed by volume loading and continuous i.v. infusion of methoxamine. After the treatment, aortic blood flow (AoF), left ventricular dP/dt and myocardial segment shortening (SS) markedly decreased, while the left ventricular end-diastolic pressure (LVEDP), the right atrial pressure (RAP) and the systemic vascular resistance (SVR) increased. NCR (n = 6), NTG (n = 6) and CRM (n = 8), which were administered i.v. after production of CHF, caused a comparable reduction in LVEDP. NCR and CRM profoundly increased AoF and SS but NTG did only slightly. On the other hand, NTG and NCR but not CRM significantly reduced RAP. Intracoronary NCR (n = 8) exerted no or similar effects on SS as well as systemic hemodynamic indices to those observed with i.v. NCR despite distinct coronary vasodilation. These results indicate that NCR may exert beneficial hemodynamic effects in an experimental CHF mainly due to lessening both afterload and preload rather than the coronary vasodilating effect.

Molecular epidemiology of canine parvovirus in southern India

Directory of Open Access Journals (Sweden)

V. M. Vivek Srinivas,

2013-08-01

Full Text Available Aim: The present study was conducted to isolate and characterize canine parvovirus circulating in Southern India by genetic analysis of VP2 capsid protein gene.Materials and Methods: In this study, 128 samples were collected from nine different locations covering five Southern Indian states (Pondicherry, Tamil Nadu, Kerala, Andhra Pradesh and Karnataka . Out of 128 samples, 69 samples were found to be positive by PCR assay. Out of 69 positive samples, 36 were randomly selected and processed for virus isolation. Twenty viruses could be isolated successfully and 18 randomly selected isolate were subjected to VP2 gene sequence analysis along with 6 random clinical samples.Result: Seventeen isolates and 5 clinical samples were characterized as New CPV-2a (CPV2a with 297-Ser→Ala. But one isolate and one clinical sample had amino acids variations which were characteristics of New CPV-2b. The phylogenetic analysis revealed that one of the field isolates was found to be phylogenetically closely related to New CPV-2b strains of India; rest other sequences was found to share ancestral origins with New CPV-2a reference strains of Japan, China, Thailand and India.Conclusion: The present study revealed that the predominant CPV strain circulating in Southern India is New CPV-2a. There is also enough indication of New CPV-2b strain from different states of Southern India.

Differential effects of the transient outward K(+) current activator NS5806 in the canine left ventricle

DEFF Research Database (Denmark)

Calloe, Kirstine; Soltysinska, Ewa; Jespersen, Thomas

2009-01-01

To examine the electrophysiological and molecular properties of the transient outward current (I(to)) in canine left ventricle using a novel I(to) activator, NS5806, I(to) was measured in isolated epicardial (Epi), midmyocardial (Mid) and endocardial (Endo) cells using whole-cell patch-clamp tech...

Substrate use in ischemic and reperfused canine myocardium: quantitative considerations

International Nuclear Information System (INIS)

Myears, D.W.; Sobel, B.E.; Bergmann, S.R.

1987-01-01

The patterns of use of substrate in reperfused myocardium are not yet well elucidated, and their delineation is essential for adequate interpretation of results of analyses performed after positron emission tomography with labeled substrates to differentiate normal from abnormal heart muscle. Accordingly, in open-chest, anesthetized dogs the authors measured glucose and fatty acid utilization in normal, ischemic, and reperfused myocardium and assessed the contributions of metabolism of each substrate to overall oxidative metabolism. Intracoronary [ 3 H]glucose and [ 14 C]palmitate were administered in five control dogs, eight dogs subjected to 1 h of coronary occlusion, and nine dogs subjected to reperfusion after 1 h of ischemia. Regional coronary venous blood samples were assayed sequentially. In reperfused myocardium, utilization of glucose was 103% greater than that in ischemic and 273% greater than in normal myocardium. Utilization of fatty acid during reperfusion, although greater than that in ischemic myocardium, was significantly less than that in normal myocardium despite restoration of flow to 80% of control values. Despite diminished net uptake of fatty acid, oxidation of fatty acid accounted for 63% of total oxygen consumption in reperfused myocardium. These studies indicate that canine myocardium reperfused after 1 h of ischemia exhibits enhanced uptake of glucose and impaired utilization of palmitate. Nevertheless, palmitate continues to comprise the substrate primarily utilized for oxidative metabolism

Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

Directory of Open Access Journals (Sweden)

Kinga Majchrzak

Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

New and emerging pathogens in canine infectious respiratory disease.

Science.gov (United States)

Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

2014-03-01

Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

Anomalous Origin of the Right Coronary Artery from the Left Anterior Descending Coronary Artery in a Patient with Ascending Aortic Aneurysm

Directory of Open Access Journals (Sweden)

Ufuk Gürkan

2012-04-01

Full Text Available The incidence of coronary artery anomalies has been reported between 0.6 to 1.3% in angiographic series and 0.3% in autopsy series. An isolated single coronary artery (SCA is even a rarer congenital anomaly occurring in approximately 0.02% of the population. The ectopic origin of the right coronary artery (RCA from the left anterior descending (LAD artery is relatively rare and more benign than other types of anomalous origin of the RCAs. We report a case of an adult male patient with SCA anomaly in which the RCA takes off from the mid LAD. To the best of our knowledge, SCA anomaly coinciding with ascending aortic aneurysm which was treated with Bentall operation has never been described before.

Canine study on myocardial ischemic memory with 18F-FDG PET/CT imaging

International Nuclear Information System (INIS)

Xie Boqia; Yang Minfu; Dou Kefei; Han Chunlei; Tian Yi; Zhang Ping; Yang Zihe; Yin Jiye; Wang Hao

2012-01-01

Objective: To explore whether the existence and duration of ischemia measured by dynamic 18 F-FDG PET/CT imaging correlated with the extent of myocardial ischemia in a canine model of myocardial ischemia-reperfusion. Methods: Canine coronary artery occlusion was carried out for 20 min (n=4) and for 40 min (n=4) followed by 24 h of open-artery reperfusion. All dogs underwent dynamic 18 F-FDG PET/CT and 99 Tc m -MIBI SPECT imaging at baseline and 1 h and 24 h after reperfusion.Quantitative analysis of myocardial 18 F-FDG uptake was performed using Carimas Core software,and the extraction ratio of 18 F-FDG (K) was calculated by the ratio of 18 F-FDG uptake rate in the ischemic area (k ischemia ) and normoperfused region (k normoperfused ). Echocardiographic data were also acquired between each PET/CT imaging study to detect the wall motion in the ischemic and normoperfused myocardium. Paired t test and non-parametric statistical tests, measured by SPSS 19.0, were used to analyze the data. Results: Coronary occlusion produced sustained, abnormal wall motion in the ischemic region for more than 1 h. Similar K values were demonstrated between the 20 min and 40 min groups at baseline (1.02 ±0.06 and 1.03 ±0.05, Z=-0.29, P>0.05). At 1 h after reperfusion, the reperfusion regions showed normal perfusion but with increased 18 F-FDG uptake, which was higher in the 40 min ischemic group than in the 20 min ischemic group (2.31 ±0.13 and 1.87 ±0.09, Z=-2.31, P<0.05). At 24 h after reperfusion, however, only the 40 min ischemic group showed slightly higher 18 F-FDG uptake than baseline (1.15 ± 0.02 and 1.03 ±0.05, t=4.32, P<0.05), whereas no significant difference was found in the 20 min ischemic group (1.05 ± 0.04 and 1.02 ± 0.06, t=0.87, P>0.05). Histological examination of the ischemic myocardium from both groups revealed neatly arranged cells without interstitial edema, hemorrhage nor inflammatory response. Conclusions: Myocardial 'ischemic memory' was

Upregulation of endothelin ETB receptor-mediated vasoconstriction in rat coronary artery after organ culture

DEFF Research Database (Denmark)

Eskesen, Karen; Edvinsson, Lars

2006-01-01

The aim of this study was to examine if endothelin ET(B) receptor-mediated contraction occurred in isolated segments of rat coronary arteries during organ culture. Presence of contractile endothelin ET(B) receptors was studied by measuring the change in isometric tension in rings of left anterior......(+)-solution was not modified after 1 day in culture medium. The experiments indicate that organ culture of rat coronary arteries upregulate endothelin ET(B) receptor-mediated contraction by inducing synthesis of new protein....... descending coronary arteries isolated from hearts of rats as response to application of the selective endothelin ET(B) receptor agonist, Sarafotoxin 6c and endothelin-1. In segments cultured 1 day in serum free Dulbecco's Modified Eagle's Medium, Sarafotoxin 6c induced a concentration dependent contraction...

Genetics of Human and Canine Dilated Cardiomyopathy.

Science.gov (United States)

Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.

Science.gov (United States)

Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício

2013-01-01

Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

Directory of Open Access Journals (Sweden)

Naiara Costa Cinegaglia

2013-01-01

Full Text Available Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent, and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

Escherichia coli : host interactions in the pathogenesis of canine pyometra

OpenAIRE

Henriques, Sofia Correia Rosa de Barros

2016-01-01

Tese de Doutoramento em Ciências Veterinárias na Especialidade de Ciências Biológicas e Biomédicas Canine pyometra develops as a result of a complex interaction of etiological and physiopathological factors, such as the virulence and type of the bacteria and the individual host defence mechanisms. Since Escherichia coli is the most common bacterium isolated from uterus of bitches with pyometra, one main objective of this work was to characterize E. coli virulence potential, and...

Canine distemper virus detection in asymptomatic and non vaccinated dogs

Directory of Open Access Journals (Sweden)

Helen L. Del Puerto

2010-02-01

Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

Directory of Open Access Journals (Sweden)

J. Van Heerden

2002-07-01

Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

Science.gov (United States)

van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

2002-03-01

Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

Experimental tumor growth of canine osteosarcoma cell line on chick embryo chorioallantoic membrane (in vivo studies).

Science.gov (United States)

Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna

2017-05-12

The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.

9 CFR 113.317 - Parvovirus Vaccine (Canine).

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

Intravascular photoacoustic imaging of human coronary atherosclerosis

Science.gov (United States)

Jansen, Krista; van der Steen, Antonius F. W.; Springeling, Geert; van Beusekom, Heleen M. M.; Oosterhuis, J. Wolter; van Soest, Gijs

2011-03-01

We demonstrate intravascular photoacoustic imaging of human coronary atherosclerotic plaque. We specifically imaged lipid content, a key factor in vulnerable plaques that may lead to myocardial infarction. An integrated intravascular photoacoustics (IVPA) and ultrasound (IVUS) catheter with an outer diameter of 1.25 mm was developed. The catheter comprises an angle-polished optical fiber adjacent to a 30 MHz single-element transducer. The ultrasonic transducer was optically isolated to eliminate artifacts in the PA image. We performed measurements on a cylindrical vessel phantom and isolated point targets to demonstrate its imaging performance. Axial and lateral point spread function widths were 110 μm and 550 μm, respectively, for PA and 89 μm and 420 μm for US. We imaged two fresh human coronary arteries, showing different stages of disease, ex vivo. Specific photoacoustic imaging of lipid content, is achieved by spectroscopic imaging at different wavelengths between 1180 and 1230 nm.

Early and long-term outcomes of coronary artery bypass grafting in patients with acute coronary syndrome versus stable angina pectoris.

Science.gov (United States)

Fukui, Toshihiro; Tabata, Minoru; Morita, Satoshi; Takanashi, Shuichiro

2013-06-01

The aim of the present study was to determine the early and long-term outcomes of coronary artery bypass grafting in patients with acute coronary syndrome and stable angina pectoris. From September 2004 to September 2011, 382 patients with acute coronary syndrome (unstable angina pectoris and non-ST-segment elevation myocardial infarction) and 851 patients with stable angina pectoris underwent first-time isolated coronary artery bypass grafting at our institute. The early and long-term outcomes were compared between the 2 groups. Patients with acute coronary syndrome were older, were more likely to be women, had a smaller body surface area, and were more likely to have left main coronary artery disease. In both groups, bilateral internal thoracic artery grafts were used in approximately 89% of the patients, and off-pump techniques in approximately 97% of the patients. The acute coronary syndrome group had a greater operative death rate (2.6% vs 0.1%) and a greater incidence of low output syndrome (3.1% vs 1.2%) and hemodialysis requirement (2.9% vs 1.1%). Multivariate regression analysis demonstrated that age, acute coronary syndrome, lower ejection fraction, and higher creatinine level before surgery were independent predictors of operative death. However, among the hospital survivors, no differences were seen in freedom from all death (85.4% ± 2.5% vs 87.7% ± 2.0%), cardiac death (97.4% ± 0.9% vs 96.5% ± 0.9%), or major adverse cardiac and cerebrovascular events (78.0% ± 2.9% vs 78.1% ± 2.3%) at 7 years between the patients with acute coronary syndrome and stable angina pectoris. Although acute coronary syndrome is an independent predictor of early mortality in patients undergoing coronary artery bypass grafting, the long-term outcomes after surgery were similar between patients with acute coronary syndrome and stable angina pectoris who survived the early postoperative period. Copyright © 2013 The American Association for Thoracic Surgery. Published by

Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

Science.gov (United States)

Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

2016-11-01

The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

Genetics of Human and Canine Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Siobhan Simpson

2015-01-01

Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

Science.gov (United States)

Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

2014-07-01

This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Military veterans and canine assistance for post-traumatic stress disorder: A narrative review of the literature.

Science.gov (United States)

Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni

2016-12-01

Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi

Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

Science.gov (United States)

Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

2017-06-03

Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

Electrical neuromodulation for disabling angina pectoris related to isolated stenoses of small epicardial coronary arteries

NARCIS (Netherlands)

Jessurun, GAJ; Hautvast, RWM; DeJongste, MJL; Meyler, WJ; van Boven, AJ; Crijns, HJGM

Patients with symptomatic small vessel coronary artery disease may be inadequate candidates for revascularization procedures. They may suffer from refractory angina, which does not respond to maximal anti-anginal drug therapy. In addition to patients with end stage coronary artery disease and

Reliability of mandibular canines as indicators for sexual dichotomy.

Science.gov (United States)

Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

2013-02-01

Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

Cross-reacting antibacterial auto-antibodies are produced within coronary atherosclerotic plaques of acute coronary syndrome patients.

Directory of Open Access Journals (Sweden)

Filippo Canducci

Full Text Available Coronary atherosclerosis, the main condition predisposing to acute myocardial infarction, has an inflammatory component caused by stimuli that are yet unknown. We molecularly investigated the nature of the immune response within human coronary lesion in four coronary plaques obtained by endoluminal atherectomy from four patients. We constructed phage-display libraries containing the IgG1/kappa antibody fragments produced by B-lymphocytes present in each plaque. By immunoaffinity, we selected from these libraries a monoclonal antibody, arbitrarily named Fab7816, able to react both with coronary and carotid atherosclerotic tissue samples. We also demonstrated by confocal microscopy that this monoclonal antibody recognized human transgelin type 1, a cytoskeleton protein involved in atherogenesis, and that it co-localized with fibrocyte-like cells transgelin+, CD68+, CD45+ in human sections of coronary and carotid plaques. In vitro fibrocytes obtained by differentiating CD14+ cells isolated from peripheral blood mononuclear cells also interacted with Fab7816, thus supporting the hypothesis of a specific recognition of fibrocytes into the atherosclerotic lesions. Interestingly, the same antibody, cross-reacted with the outer membrane proteins of Proteus mirabilis and Klebsiella pneumoniae (and possibly with homologous proteins of other enterobacteriaceae present in the microbiota. From all the other three libraries, we were able to clone, by immunoaffinity selection, human monoclonal antibodies cross-reacting with bacterial outer membrane proteins and with transgelin. These findings demonstrated that in human atherosclerotic plaques a local cross-reactive immune response takes place.

Approaches to canine health surveillance.

Science.gov (United States)

O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

2014-01-01

Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

Anomalous origin of the coronary artery from the wrong coronary sinus evaluated with computed tomography: ''High-risk'' anatomy and its clinical relevance

International Nuclear Information System (INIS)

Krupinski, Maciej; Urbanczyk-Zawadzka, Malgorzata; Laskowicz, Bartosz; Irzyk, Malgorzata; Banys, Robert; Klimeczek, Piotr; Gruszczynska, Katarzyna; Baron, Jan

2014-01-01

The aim of the study was to assess coronary arteries arising from the wrong coronary sinus, including CT-evaluated high-risk anatomic features, clinical symptoms and cardiac events during follow-up. A total of 7,115 patients scheduled for 64-slice or dual-source cardiac CT were screened for the presence of isolated anomalous origin of the coronary artery from the wrong coronary sinus. Anomalous origin of the coronary artery was found in 54 (0.76 %) patients (29 men, 25 women, mean age 60.9 ± 11.6 years). Sixteen (30 %) patients with abnormal right coronary origin (ARCA) more commonly had a slit-like orifice (15 vs. 3; p < 0.001), intramural course (15 vs. 3; p < 0.001) and interarterial course (11 vs. 0; p < 0.001) than 22 (41 %) and 13 (24 %) individuals with abnormal circumflex artery (ALCx) and left coronary artery (ALCA) origin, respectively. Patients with ALCA presented less frequently with chest pain than subjects with ARCA and ALCx (25 vs. 3; p = 0.03). Patients with ARCA tended to show higher occurrence of cardiac events in the follow-up than individuals with ALCA and ALCx (5 vs. 4; p = NS). High-risk anatomy features are most common in patients with ARCA and these patients also have higher prevalence of chest pain and cardiac events in the follow-up than individuals with ALCA and ALCx. (orig.)

The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

2016-01-01

New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

Directory of Open Access Journals (Sweden)

Ivaylo Gentschev

Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

An automated multi-modal object analysis approach to coronary calcium scoring of adaptive heart isolated MSCT images

Science.gov (United States)

Wu, Jing; Ferns, Gordon; Giles, John; Lewis, Emma

2012-02-01

Inter- and intra- observer variability is a problem often faced when an expert or observer is tasked with assessing the severity of a disease. This issue is keenly felt in coronary calcium scoring of patients suffering from atherosclerosis where in clinical practice, the observer must identify firstly the presence, followed by the location of candidate calcified plaques found within the coronary arteries that may prevent oxygenated blood flow to the heart muscle. This can be challenging for a human observer as it is difficult to differentiate calcified plaques that are located in the coronary arteries from those found in surrounding anatomy such as the mitral valve or pericardium. The inclusion or exclusion of false positive or true positive calcified plaques respectively will alter the patient calcium score incorrectly, thus leading to the possibility of incorrect treatment prescription. In addition to the benefits to scoring accuracy, the use of fast, low dose multi-slice CT imaging to perform the cardiac scan is capable of acquiring the entire heart within a single breath hold. Thus exposing the patient to lower radiation dose, which for a progressive disease such as atherosclerosis where multiple scans may be required, is beneficial to their health. Presented here is a fully automated method for calcium scoring using both the traditional Agatston method, as well as the Volume scoring method. Elimination of the unwanted regions of the cardiac image slices such as lungs, ribs, and vertebrae is carried out using adaptive heart isolation. Such regions cannot contain calcified plaques but can be of a similar intensity and their removal will aid detection. Removal of both the ascending and descending aortas, as they contain clinical insignificant plaques, is necessary before the final calcium scores are calculated and examined against ground truth scores of three averaged expert observer results. The results presented here are intended to show the requirement and

Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

Science.gov (United States)

Pang, Lisa Y; Gatenby, Emma L; Kamida, Ayako; Whitelaw, Bruce A; Hupp, Ted R; Argyle, David J

2014-01-01

Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs), which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05), and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

Global gene expression analysis of canine osteosarcoma stem cells reveals a novel role for COX-2 in tumour initiation.

Directory of Open Access Journals (Sweden)

Lisa Y Pang

Full Text Available Osteosarcoma is the most common primary bone tumour of both children and dogs. It is an aggressive tumour in both species with a rapid clinical course leading ultimately to metastasis. In dogs and children distant metastasis occurs in >80% of individuals treated by surgery alone. Both canine and human osteosarcoma has been shown to contain a sub-population of cancer stem cells (CSCs, which may drive tumour growth, recurrence and metastasis, suggesting that naturally occurring canine osteosarcoma could act as a preclinical model for the human disease. Here we report the successful isolation of CSCs from primary canine osteosarcoma, as well as established cell lines. We show that these cells can form tumourspheres, and demonstrate relative resistance to chemotherapy. We demonstrate similar results for the human osteosarcma cell lines, U2OS and SAOS2. Utilizing the Affymetrix canine microarray, we are able to definitively show that there are significant differences in global gene expression profiles of isolated osteosarcoma stem cells and the daughter adherent cells. We identified 13,221 significant differences (p = 0.05, and significantly, COX-2 was expressed 141-fold more in CSC spheres than daughter adherent cells. To study the role of COX-2 expression in CSCs we utilized the COX-2 inhibitors meloxicam and mavacoxib. We found that COX-2 inhibition had no effect on CSC growth, or resistance to chemotherapy. However inhibition of COX-2 in daughter cells prevented sphere formation, indicating a potential significant role for COX-2 in tumour initiation.

The effects of baicalein on canine osteosarcoma cell proliferation and death.

Science.gov (United States)

Helmerick, E C; Loftus, J P; Wakshlag, J J

2014-12-01

Flavonoids are a group of modified triphenolic compounds from plants with medicinal properties. Baicalein, a specific flavone primarily isolated from plant roots (Scutellaria baicalensis), is commonly used in Eastern medicine for its anti-inflammatory and antineoplastic properties. Previous research shows greater efficacy for baicalein than most flavonoids; however, there has been little work examining their effects on sarcoma cells, let alone canine cells. Three canine osteosarcoma cell lines (HMPOS, D17 and OS 2.4) were treated with baicalein to examine cell viability, cell cycle kinetics, anchorage-independent growth and apoptosis. Results showed that osteosarcoma cells were sensitive to baicalein at concentrations from approximately 1 to 25 μM. Modest cell cycle changes were observed in one cell line. Baicalein was effective in inducing apoptosis and did not prevent doxorubicin cell proliferation inhibition in all the cell lines. The mechanism for induction of apoptosis has not been fully elucidated; however, changes in mitochondrial permeability supersede the apoptotic response. © 2012 Blackwell Publishing Ltd.

Multiple coronary stenting negatively affects myocardial recovery after coronary bypass grafting.

Science.gov (United States)

Yajima, Shin; Yoshioka, Daisuke; Fukushima, Satsuki; Toda, Koichi; Miyagawa, Shigeru; Yoshikawa, Yasushi; Hata, Hiroki; Saito, Shunsuke; Domae, Keitaro; Sawa, Yoshiki

2018-05-14

We aimed to elucidate the relationship between the magnitude of myocardial recovery after coronary artery bypass grafting (CABG) and the prognosis and to explore the predictors of myocardial non-recovery. Eighty-one patients with a preoperative left ventricular ejection fraction (LVEF) ≤ 40% who underwent isolated CABG between 2002 and 2015 and had undergone echocardiographic follow-up (median follow-up, 3.1 years; interquartile range 1.2-6.0 years) were analyzed. The Recovery group comprised patients with LVEF improvement ≥ 10%, whereas the Non-recovery group comprised those with an LVEF improvement events (MACEs), and readmission due to heart failure were evaluated. In addition, the risk factors for LVEF non-recovery were evaluated in a multivariate analysis. A total of 39 patients (48%) were in the Recovery group, whereas 42 patients (52%) were in the Non-recovery group. Although the survival and freedom from MACE rates were comparable, the rate of freedom from heart failure requiring hospitalization at 1, 5, and 8 years of follow-up was significantly lower in the Non-recovery group than in the Recovery group (p = 0.012). A history of percutaneous coronary intervention (PCI) was an exclusive independent risk factor for post-CABG myocardial non-recovery (odds ratio, 16.0; 95% confidence interval, 3.44-125). Furthermore, the number of coronary stents was negatively correlated with LVEF recovery (r = - 0.460, p = 0.024). Great consideration should be taken when performing CABG in patients with left ventricular dysfunction and a history of PCI, particularly in those with multiple coronary stents.

Platelets Inhibit Migration of Canine Osteosarcoma Cells.

Science.gov (United States)

Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

2017-01-01

The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.

Science.gov (United States)

Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G

2011-08-01

The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica. Copyright © 2010 Elsevier Ltd. All rights reserved.

Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.

Science.gov (United States)

Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio

2018-04-01

Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

Science.gov (United States)

Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

2012-07-20

Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

Science.gov (United States)

1981-06-05

anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

Science.gov (United States)

Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

2013-01-01

The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

A new experimental carotid siphon aneurysm model in canine based on the MR angiography and rapid prototyping technology

International Nuclear Information System (INIS)

Xie Jian; Li Minghua; Tan Huaqiao; Zhu Yueqi; Hu Dingjun; Qiao Ruihua; Fan Chunhua

2009-01-01

Objective: The aim of the experiment is to make an intracranial aneurysm model in canine. Methods: A digital tube was made based on raw magnetic resonance images of the human intracranial carotid artery. Then 6 tubes were made in the 3D rapid prototyping machine and coated with silicone. Finally we isolated the common carotid arteries of 6 canines and made them go through the tubes and anastomosed them end-to-side to get the aneurysm model. Six stents were implanted after one week. Results: Six aneurysm models were successfully made in canines. The parent artery had similar geometry of the human carotid siphon. All the aneurysms and parent arteries were patent in one week's follow-up. One canine died of excessive anesthesia after stenting. Two vascular models kept patent in one month without stenosis. The other 3 had some stenosis on the bends of the vessel. Conclusions: The aneurysm model in the experiment has high flexibility and reliability. The model provides an effective tool for research and testing neurovascular devices. It's also a useful device to train the neuroradiologists and interventional physicians. (authors)

Coronary artery bypass grafting-related bleeding complications in patients treated with dual antiplatelet treatment

NARCIS (Netherlands)

Tomšič, Anton; Schotborgh, Mark A.; Manshanden, Johan S. J.; Li, Wilson W. L.; de Mol, Bas A. J. M.

2016-01-01

To evaluate the relationship between the timing of either ticagrelor or clopidogrel discontinuation and bleeding-related complications in patients undergoing isolated on-pump coronary artery bypass grafting (CABG). Between January 2012 and December 2014, 705 consecutive patients underwent isolated

Calcified Plaque of Coronary Artery: Factors Influencing Overestimation of Coronary Artery Stenosis on Coronary CT Angiography

International Nuclear Information System (INIS)

Kim, Mok Hee; Kim, Yun Hyeon; Choi, Song; Seon, Hyun Ju; Jeong, Gwang Woo; Park, Jin Gyoon; Kang, Heoung Keun; Ko, Joon Seok

2010-01-01

To assess the influence of calcified plaque characteristics on the overestimation of coronary arterial stenosis on a coronary CT angiography (CCTA). The study included 271 coronary arteries with calcified plaques identified by CCTA, and based on 928 coronary arteries from 232 patients who underwent both CCTA and invasive coronary angiography (ICA). Individual coronary arteries were classified into two groups by agreement based on the degree of stenosis from each CCTA and ICA: 1) group A includes patients with concordant CCTA and ICA results and, 2) group B includes patients with an overestimation of CCTA compared to ICA. Parameters including total calcium score, calcium score of an individual coronary artery, calcium burden number of an individual coronary artery, and the density of each calcified plaque (calcium score / number of calcium burden) for each individual coronary artery were compared between the two groups. Of the 271 coronary arteries, 164 (60.5%) were overestimated on CCTA. The left anterior descending artery (LAD) had a significantly low rate of overestimation (47.1%) compared to the other coronary arteries (p=0.001). No significant differences for total calcium score, calcium score of individual coronary artery, and the density of each calcified plaque from individual coronary arteries between two groups was observed. However, a decreasing tendency for the rate of overestimation on CCTA was observed with an increase in calcium burden of individual coronary arteries (p<0.05). The evaluation of coronary arteries suggests that the degree of coronary arterial stenosis had a tendency to be overestimated by calcified plaques on CCTA. However, the rate of overestimation for the degree of coronary arterial stenosis by calcified plaques was not significantly influenced by total calcium score, calcium score of individual coronary artery, and density of each calcified plaque

Clinical and Statistical Study on Canine Impaction

Directory of Open Access Journals (Sweden)

Adina-Simona Coșarcă

2013-08-01

Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

Irradiation inhibits vascular anastomotic stenosis in a canine model

International Nuclear Information System (INIS)

Saito, Takeshi; Iguchi, Atsushi; Tabayashi, Koichi

2009-01-01

The graft patency rate after coronary artery bypass grafting (CABG) correlates with anastomotic stenosis. Intracoronary radiation therapy is effective for preventing restenosis after percutaneous coronary intervention (PCI). We postulated that intracoronary radiation therapy could prevent anastomotic stenosis and tested this hypothesis in an animal model. Femoral arteries and veins of beagle dogs were harvested, and composite arterioarterial and arteriovenous grafts were prepared. After external irradiation of the anastomotic sites, these composite grafts were transplanted into femoral arteries. Histomorphometric and immunohistological analyses of the anastomotic sites were performed. The study groups consisted of controls and animals exposed to 10 Gy, 20 Gy, and 30 Gy (n=5, in each group). In the artery graft model, the ratio of negative remodeling was significantly increased in all groups exposed to ≥10 Gy. The ratio of neointimal hyperplasia was significantly decreased in all groups exposed to ≥10 Gy. Cell density of anti-α-actin antibody-positive cells and anti-proliferating cell nuclear antigen (PCNA) antibody-positive cells was highest in the adventitial layer, and the density decreased as the dosage increased. Experimental results were almost the same in the vein graft models as in the artery graft models. With double immunohistostaining, the anti-PCNA antibody-positive cells expressed α-actin. Irradiation can inhibit anastomotic stenosis in a canine model. Adventitia is a factor in the creation of stenosis, and irradiation appears to target the adventitia. We speculate that there might be a possible role for intracoronary irradiation in the future to prevent anastomotic stenosis. (author)

Effects of dipyridamole and aminophylline on hemodynamics, regional myocardial blood flow and thallium-201 washout in the setting of a critical coronary stenosis

International Nuclear Information System (INIS)

Granato, J.E.; Watson, D.D.; Belardinelli, L.; Cannon, J.M.; Beller, G.A.

1990-01-01

Experiments were performed to characterize the interaction of intravenous dipyridamole and aminophylline on thallium-201 transport kinetics, regional myocardial blood flow and systemic hemodynamics in the presence of a critical coronary artery stenosis. In 12 dogs with a critical left anterior descending coronary artery stenosis, arterial pressure decreased from a mean value (+/- SEM) of 107 +/- 6 to 94 +/- 3 mm Hg and distal left anterior descending artery pressure decreased from 70 +/- 7 to 55 +/- 4 mm Hg after intravenous administration of dipyridamole. In the left anterior descending perfusion zone, the endocardial/epicardial flow ratio decreased from 0.70 to 0.36 and the intrinsic thallium washout rate was significantly prolonged. Intravenous aminophylline reversed the dipyridamole-induced systemic hypotension and transmural coronary steal and restored the thallium washout rate to baseline values. In six other dogs, aminophylline alone resulted in no alterations in systemic and coronary hemodynamics or regional myocardial blood flow. As expected, dipyridamole-induced vasodilation and coronary steal were prevented by aminophylline pretreatment. These data show that in a canine model of partial coronary stenosis, systemic hypotension, adverse regional flow effects and prolonged thallium-201 washout consequent to intravenously administered dipyridamole are promptly reversed by intravenous aminophylline administration. Aminophylline alone had no significant hemodynamic and coronary flow effects. This study provides further insight into the altered thallium kinetics occurring as a consequence of dipyridamole-induced vasodilation and suggests that the prompt reversal of symptoms and signs of ischemia with aminophylline in patients receiving intravenous dipyridamole for clinical imaging studies probably reflects the reversal of transmural coronary steal

Podoplanin Expression in Canine Melanoma.

Science.gov (United States)

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-12-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

Spinal cord activation differentially modulates ischaemic electrical responses to different stressors in canine ventricles.

Science.gov (United States)

Cardinal, René; Ardell, Jeffrey L; Linderoth, Bengt; Vermeulen, Michel; Foreman, Robert D; Armour, J Andrew

2004-03-31

Spinal cord stimulation (SCS) represents an acceptable treatment modality for patients with chronic angina pectoris refractory to standard therapy, but its mechanism of action remains unclear. To develop an experimental paradigm to study this issue, ameroid (AM) constrictors were implanted around the left circumflex coronary artery (LCx) in canines. Six weeks later, unipolar electrograms were recorded from 191 sites in the LCx territory in the open-chest, anesthetized state under basal pacing at 150 beats/min. We investigated the effect of SCS on ST segment displacements induced in the collateral-dependent myocardium in response to two stressors: (i) transient bouts of rapid ventricular pacing (TRP: 240/min for 1 min) and (ii) angiotensin II administered to right atrial neurons via their coronary artery blood supply. ST segment responses to TRP consisted of ST segment elevation in central areas of the LCx territory and ST depression at more peripheral areas. Such responses were unchanged when TRP was applied under SCS. Shortening of repolarization intervals in the metabolically compromised myocardium in response to TRP was also unaffected by SCS. In contrast, ST segment responses to intracoronary angiotensin II, which consisted of increased ST elevation, were attenuated by SCS in 6/8 preparations. The modulator effects of SCS were greatest at sites at which the greatest responses to angiotensin II occurred in the absence of SCS. These data indicate that spinal cord stimulation may attenuate the deleterious effects that stressors exert on the myocardium with reduced coronary reserve, particularly stressors associated with chemical activation of the intrinsic cardiac nervous system. Copyright 2004 Elsevier B.V.

Evaluation of mRNA expression levels and electrophysiological function of neuron-like cells derived from canine bone marrow stromal cells.

Science.gov (United States)

Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro

2013-10-01

To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.

Hemorrhagic and necrotizing hepatitis associated with administration of a modified live canine adenovirus-2 vaccine in a maned wolf (Chrysocyon brachyurus).

Science.gov (United States)

Swenson, Julie; Orr, Kathryn; Bradley, Gregory A

2012-06-01

A 15-yr-old, female, maned wolf (Chrysocyon brachyurus) was euthanized after presenting semicomatose with severe, uncontrolled frank hemorrhage from her rectum 6 days following a routine physical examination and vaccination. Histopathology indicated severe hemorrhagic and necrotizing hepatitis with intranuclear basophilic inclusion bodies in the liver that were thought to be consistent with adenoviral infection. Further classification by polymerase chain reaction, immunohistochemical staining, virus isolation, and electron microscopy confirmed the etiologic agent to be canine adenovirus-2. A representative sample of the vaccine that had been used was submitted and sequenced along with the virus isolated from the maned wolf. The sequencing of the etiologic agent that had been isolated from the maned wolf was determined to be the same as the strain of virus used in the production of the modified live vaccine that had been administered 6 days prior to death. From this information, the diagnosis of vaccine-induced adenoviral hepatitis was made. This is the first confirmed case of vaccine-induced canine adenoviral hepatitis in a maned wolf.

European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

Science.gov (United States)

Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

2017-09-01

Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Vaccines for canine leishmaniasis

Directory of Open Access Journals (Sweden)

Clarisa B. Palatnik-De-Sousa

2012-04-01

Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

Uridine Adenosine Tetraphosphate-Induced Coronary Relaxation Is Blunted in Swine With Pressure Overload: A Role for Vasoconstrictor Prostanoids.

Science.gov (United States)

Zhou, Zhichao; Lankhuizen, Inge M; van Beusekom, Heleen M; Cheng, Caroline; Duncker, Dirk J; Merkus, Daphne

2018-01-01

Plasma levels of the vasoactive substance uridine adenosine tetraphosphate (Up 4 A) are elevated in hypertensive patients and Up 4 A-induced vascular contraction is exacerbated in various arteries isolated from hypertensive animals, suggesting a potential role of Up 4 A in development of hypertension. We previously demonstrated that Up 4 A produced potent and partially endothelium-dependent relaxation in the porcine coronary microvasculature. Since pressure-overload is accompanied by structural abnormalities in the coronary microvasculature as well as by endothelial dysfunction, we hypothesized that pressure-overload blunts the coronary vasodilator response to Up 4 A, and that the involvement of purinergic receptors and endothelium-derived factors is altered. The effects of Up 4 A were investigated using wire-myography in isolated coronary small arteries from Sham-operated swine and swine with prolonged (8 weeks) pressure overload of the left ventricle induced by aortic banding (AoB). Expression of purinergic receptors and endothelium-derived factors was assessed in isolated coronary small arteries using real-time PCR. Up 4 A (10 -9 to 10 -5 M) failed to produce contraction in isolated coronary small arteries from either Sham or AoB swine, but produced relaxation in preconstricted arteries, which was significantly blunted in AoB compared to Sham. Blockade of purinergic P1, and P2 receptors attenuated Up 4 A-induced coronary relaxation more, while the effect of P2X 1 -blockade was similar and the effects of A 2A - and P2Y 1 -blockade were reduced in AoB as compared to Sham. mRNA expression of neither A1, A2, A3, nor P2X 1 , P2X 7 , P2Y 1 , P2Y 2 , nor P2Y 6 -receptors was altered in AoB as compared to Sham, while P2Y 12 expression was higher in AoB. eNOS inhibition attenuated Up 4 A-induced coronary relaxation in both Sham and AoB. Additional blockade of cyclooxygenase enhanced Up 4 A-induced coronary relaxation in AoB but not Sham swine, suggesting the involvement

MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas.

Science.gov (United States)

Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y

2013-06-01

Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

Directory of Open Access Journals (Sweden)

Nicola Decaro

Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

In vitro evaluation of three different biomaterials as scaffolds for canine mesenchymal stem cells

Directory of Open Access Journals (Sweden)

Oduvaldo Câmara Marques Pereira-Junior

2013-05-01

Full Text Available PURPOSE: To evaluate in vitro ability the of three different biomaterials - purified hydroxyapatite, demineralized bone matrix and castor oil-based polyurethane - as biocompatible 3D scaffolds for canine bone marrow mesenchymal stem cell (MSC intending bone tissue engineering. METHODS: MSCs were isolated from canine bone marrow, characterized and cultivated for seven days with the biomaterials. Cell proliferation and adhesion to the biomaterial surface were evaluated by scanning electron microscopy while differentiation into osteogenic lineage was evaluated by Alizarin Red staining and Sp7/Osterix surface antibody marker. RESULTS: The biomaterials allowed cellular growth, attachment and proliferation. Osteogenic differentiation occurred in the presence of hydroxyapatite, and matrix deposition commenced in the presence of the castor oil-based polyurethane. CONCLUSION: All the tested biomaterials may be used as mesenchymal stem cell scaffolds in cell-based orthopedic reconstructive therapy.

Evaluating coronary reperfusion during acute myocardial infarction in a canine model by gadolinium-DTPA-enhanced magnetic resonance imaging

Energy Technology Data Exchange (ETDEWEB)

Tanabe, Kazuaki; Ishibashi, Yutaka; Shimada, Toshio (Shimane Medical Univ., Izumo (Japan)) (and others)

1993-05-01

In previous studies, magnetic resonance imaging (MRI) using contrast agents was found to be useful in distinguishing reperfused infarcts from nonreperfused infarcts. However, there have been only a few detailed studies using consecutive MR images for the assessment of myocardial reperfusion during an acute infarction and also no studies have been performed using a percutaneous transluminal coronary occlusion model (closed chest model). We induced acute myocardial infarction in dogs by occluding and then reperfusing the coronary artery with a balloon catheter. ECG-gated MR images were taken using the spin-echo technique before and after Gd-DTPA injection during both coronary artery occlusion and after reperfusion. We defined the intensity ratio (IR) as the signal intensity at the ischemic area divided by that at the nonischemic area on MR images and compared each image by the IR. Without Gd-DTPA, there was no difference between infarcted and normally perfused myocardium. Infarcted myocardium had a low signal intensity (IR=0.68[+-]0.14) soon after Gd-DTPA injection. This difference diminished with time. After reperfusion the infarcted myocardium had a high signal intensity (IR: 1.76[+-]0.34). We conclude that Gd-DTPA-enhanced MRI can distinguish reperfused from nonreperfused infarcts soon after Gd-DTPA administration. (author).

Evaluating coronary reperfusion during acute myocardial infarction in a canine model by gadolinium-DTPA-enhanced magnetic resonance imaging

International Nuclear Information System (INIS)

Tanabe, Kazuaki; Ishibashi, Yutaka; Shimada, Toshio

1993-01-01

In previous studies, magnetic resonance imaging (MRI) using contrast agents was found to be useful in distinguishing reperfused infarcts from nonreperfused infarcts. However, there have been only a few detailed studies using consecutive MR images for the assessment of myocardial reperfusion during an acute infarction and also no studies have been performed using a percutaneous transluminal coronary occlusion model (closed chest model). We induced acute myocardial infarction in dogs by occluding and then reperfusing the coronary artery with a balloon catheter. ECG-gated MR images were taken using the spin-echo technique before and after Gd-DTPA injection during both coronary artery occlusion and after reperfusion. We defined the intensity ratio (IR) as the signal intensity at the ischemic area divided by that at the nonischemic area on MR images and compared each image by the IR. Without Gd-DTPA, there was no difference between infarcted and normally perfused myocardium. Infarcted myocardium had a low signal intensity (IR=0.68±0.14) soon after Gd-DTPA injection. This difference diminished with time. After reperfusion the infarcted myocardium had a high signal intensity (IR: 1.76±0.34). We conclude that Gd-DTPA-enhanced MRI can distinguish reperfused from nonreperfused infarcts soon after Gd-DTPA administration. (author)

Role of coronary endothelium in cyclic AMP formation by the heart

International Nuclear Information System (INIS)

Kroll, K.; Schrader, J.

1986-01-01

In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 μM), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine

Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

Science.gov (United States)

Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

2011-12-15

Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

Coronary artery bypass grafting versus percutaneous intervention in coronary revascularization: a historical perspective and review

Directory of Open Access Journals (Sweden)

Burgess SN

2015-06-01

Full Text Available Sonya N Burgess,1 John J Edmond,2 Craig P Juergens,1 John K French11Department of Cardiology, Liverpool Hospital and South Western Sydney Clinical School, The University of New South Wales, Sydney, NSW, Australia; 2Department of Cardiology, Dunedin Public Hospital, Dunedin, New Zealand Background: Coronary artery bypass graft surgery is arguably the most intensively studied surgical procedure, and percutaneous coronary intervention (PCI has been subjected to more randomized clinical trials than any other interventional procedure. Changes seen in revascularization techniques have been numerous. The rapid evolution of evidence-based revascularization procedures has occurred as a result of many pivotal large randomized clinical trials. Objective: This review compares and contrasts outcomes from two coronary revascularization techniques, coronary artery bypass grafting (CABG and PCI, with particular reference to the landmark trials that inform practice guidelines. Methods: We undertook a comprehensive review of published literature addressing trials in this field performed to address current knowledge both in the predrug-eluting stent and postdrug-eluting stent era. Results and discussion: Surgical and percutaneous revascularization strategies have different strengths and weaknesses, and neither strategy is superior in all patients, clinical presentations, or anatomical subgroups. Current data support the use of percutaneous intervention in ST elevation myocardial infarction and in single-vessel disease. In noncomplex multivessel disease and isolated left main stem PCI, the data support non-inferiority of PCI compared to CABG as reflected in the 2014 European Society of Cardiology guidelines. Landmark revascularization trials of multivessel disease comparing CABG to PCI found no survival benefit to CABG over PCI, except in patients with complex disease. In these trials, revascularization drove differences in primary endpoints and in all but the

Genotyping and pathobiologic characterization of canine parvovirus circulating in Nanjing, China.

Science.gov (United States)

Zhao, Yanbing; Lin, Yan; Zeng, Xujian; Lu, Chengping; Hou, Jiafa

2013-08-29

Canine parvovirus (CPV) is an important pathogen that causes acute enteric disease in dogs. It has mutated and spread throughout the world in dog populations. We provide an update on the molecular characterization of CPV that circulated in Nanjing, a provincial capital in China between 2009 and 2012. Seventy rectal swab samples were collected from the dogs diagnosed with CPV infection in 8 animal hospitals of Nanjing. Sequence analysis of VP2 genes of 31 samples revealed that 29 viral strains belonged to CPV-2a subtype, while other two strains were classified into CPV-2b. To investigate the pathogenicity of the prevalent virus, we isolated CPV-2a and performed the animal experiment. Nine beagles were inoculated with 105.86 of 50% tissue culture infectious doses (TCID50) of the virus. All the experimentally infected beagles exhibited mild to moderate mucoid or watery diarrhea on day 4 post-infection (p.i.). On day 9 p.i., characteristic histopathological lesions were clearly observed in multiple organs of infected dogs, including liver, spleen, kidney, brain and all segments of the small and large intestines, while viral DNA and antigen staining could be detected in the sampled tissues. It is notable that canine parvovirus was isolated in one from two brain samples processed. Our results indicated that CPV-2a is the predominant subtype in Nanjing of China. And this virus caused extensive lesions in a variety of tissues, including the brain.

Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

Directory of Open Access Journals (Sweden)

Parviz Torkzaban

2016-09-01

Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

Percutaneous coronary intervention versus coronary-artery bypass grafting for severe coronary artery disease

NARCIS (Netherlands)

P.W.J.C. Serruys (Patrick); M-C. Morice (Marie-Claude); A.P. Kappetein (Arie Pieter); A. Colombo (Antonio); D.R. Holmes Jr (David); M.J. Mack (Michael); E. Stahle (Elisabeth); T.E. Feldman (Ted); M.J.B.M. van den Brand (Marcel); E.J. Bass (Eric); N. van Dyck (Nic); K. Leadly (Katrin); K.D. Dawkins (Keith); F.W. Mohr (Friedrich)

2009-01-01

textabstractBACKGROUND Percutaneous coronary intervention (PCI) involving drug-eluting stents is increasingly used to treat complex coronary artery disease, although coronary-artery bypass grafting (CABG) has been the treatment of choice historically. Our trial compared PCI and CABG for treating

9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

Science.gov (United States)

2010-01-01

... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

Orthodontic Traction of Impacted Canine Using Cantilever

Directory of Open Access Journals (Sweden)

Cláudia Nakandakari

2016-01-01

Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

Transmigration of mandibular canine – case report

International Nuclear Information System (INIS)

Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

2014-01-01

Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

Canine Parvovirus: Current Perspective

OpenAIRE

Nandi, S.; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

Quantitative angiography of the left anterior descending coronary artery: correlations with pressure gradient and results of exercise thallium scintigraphy

NARCIS (Netherlands)

W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); C.J. Kooijman; K. Balakumaran (Kulasekaram); P.G. Hugenholtz (Paul)

1985-01-01

textabstractTo evaluate, during cardiac catheterization, what constitutes a physiologically significant obstruction to blood flow in the human coronary system, computer-based quantitative analysis of coronary angiograms was performed on the angiograms of 31 patients with isolated disease of the

Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

Science.gov (United States)

Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

2016-04-01

In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

Science.gov (United States)

2013-01-01

Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

CT coronary angiography vs. invasive coronary angiography in CHD

Directory of Open Access Journals (Sweden)

Anja Hagen

2012-04-01

Full Text Available Scientific background: Various diagnostic tests including conventional invasive coronary angiography and non-invasive computed tomography (CT coronary angiography are used in the diagnosis of coronary heart disease (CHD. Research questions: The present report aims to evaluate the clinical efficacy, diagnostic accuracy, prognostic value cost-effectiveness as well as the ethical, social and legal implications of CT coronary angiography versus invasive coronary angiography in the diagnosis of CHD. Methods: A systematic literature search was conducted in electronic data bases (MEDLINE, EMBASE etc. in October 2010 and was completed with a manual search. The literature search was restricted to articles published from 2006 in German or English. Two independent reviewers were involved in the selection of the relevant publications. The medical evaluation was based on systematic reviews of diagnostic studies with invasive coronary angiography as the reference standard and on diagnostic studies with intracoronary pressure measurement as the reference standard. Study results were combined in a meta-analysis with 95 % confidence intervals (CI. Additionally, data on radiation doses from current non-systematic reviews were taken into account. A health economic evaluation was performed by modelling from the social perspective with clinical assumptions derived from the meta-analysis and economic assumptions derived from contemporary German sources. Data on special indications (bypass or in-stent-restenosis were not included in the evaluation. Only data obtained using CT scanners with at least 64 slices were considered. Results: No studies were found regarding the clinical efficacy or prognostic value of CT coronary angiography versus conventional invasive coronary angiography in the diagnosis of CHD. Overall, 15 systematic reviews with data from 44 diagnostic studies using invasive coronary angiography as the reference standard (identification of obstructive

Evaluation of P16 expression in canine appendicular osteosarcoma.

Science.gov (United States)

Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

2017-06-20

Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

Cone beam computed tomography findings of impacted upper canines

Energy Technology Data Exchange (ETDEWEB)

Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

2014-12-15

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Cone beam computed tomography findings of impacted upper canines

International Nuclear Information System (INIS)

Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

2014-01-01

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Percutaneous coronary intervention versus coronary artery bypass grafting: where are we after NOBLE and EXCEL?

Science.gov (United States)

Fortier, Jacqueline H; Shaw, Richard E; Glineur, David; Grau, Juan B

2017-11-01

The publication of the NOBLE and EXCEL trials, with seemingly conflicting results, brought into question whether percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG) is better for low-risk patients with left main coronary artery stenosis (LMCAS). This review appraises the methods and results of NOBLE and EXCEL, contextualizes them within the literature, and determines how they may affect clinical practice. We appraised the trials and describe differences in methodology and results. NOBLE recruited primarily isolated LMCAS, and found that CABG was superior to PCI. EXCEL's population included patients LMCAS in the context of multivessel CAD, and found PCI and CABG were comparable. Both trials enrolled young patients with few comorbidities, and there was more protocol-mandated consistency in the procedural techniques and medical therapy of patients receiving PCI. The generalizability of these trials is limited by the use of young, healthy patients at highly skilled centres that rarely reflect typical clinical practice. If these studies are to maintain relevance, trialists must address the lack of protocolization of surgical interventions and inconsistent medical therapies. Unfortunately, the limitations of NOBLE and EXCEL mean that we are no closer to answering the question of what is the optimal treatment for patients with LMCAS.

The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

International Nuclear Information System (INIS)

Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

2015-01-01

Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

Early canine plaque biofilms: characterization of key bacterial interactions involved in initial colonization of enamel.

Directory of Open Access Journals (Sweden)

Lucy J Holcombe

Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.

Integral diagnosis of coronary atherosclerosis by coronary multidetector computed tomography and by invasive coronary angiography

International Nuclear Information System (INIS)

Llerena Rojas, Luis Roberto; Llerena Rojas, Lorenzo D; Mendoza Rodriguez, Vladimir

2013-01-01

Coronary angiography by multidetector computed tomography (CMDCT) visualizes the wall and lumen of coronary arteries. Invasive coronary angiography (INVCA) only visualizes the arterial lumen but with better resolution

Skeletal maturity assessment using mandibular canine calcification stages

Directory of Open Access Journals (Sweden)

Vildana Džemidžić

2016-11-01

Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

Single Coronary Artery Anomaly: A Case Report and Review of Literature.

Science.gov (United States)

Elbadawi, Ayman; Baig, Basarat; Elgendy, Islam Y; Alotaki, Erfan; Mohamed, Ahmed H; Barssoum, Kirolos; Fries, David; Khan, Muhammad; Khouzam, Rami N

2018-02-06

Single coronary artery is a rare anomaly, which is usually associated with other cardiac congenital abnormalities. A 56-year-old female presented with unstable angina. The patient reported complaints of typical chest pain on exertion few months prior to presentation, which progressed to become at rest. The pain was associated palpitations and dizziness. Past medical history was significant for hypertension and hyperlipidemia. Vital signs were stable. Physical examination was non-remarkable. Electrocardiogram showed normal sinus rhythm, with intermittent episodes of sinus bradycardia, and non-specific T-wave changes. Trans-thoracic echocardiogram showed normal left ventricular function and no segmental wall-motion abnormalities. Selective coronary angiography showed a normal left main coronary artery arising from left coronary cusp. The left main branched to a normal left anterior descending artery and to the left circumflex artery; a large vessel which supplied also the territory of the right coronary artery (RCA) through its terminal extension. Aortography showed absence of RCA with no other vessels arising from the right or non-coronary cusps. The patient was managed conservatively and discharged home with resolution of symptoms. We report a rare case of isolated single coronary artery with absent RCA. The patient presented with unstable angina, and was managed conservatively. Cardiologists should be aware of this rare condition, which carries a potential risk of sudden cardiac death.

Canine Distemper Virus in Wild Felids of Costa Rica.

Science.gov (United States)

Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

2016-04-28

Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

A new method for rapid Canine retraction

Directory of Open Access Journals (Sweden)

"Khavari A

2001-06-01

Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

Effect of simvastatin on vascular tone in porcine coronary artery: Potential role of the mitochondria

International Nuclear Information System (INIS)

Almukhtar, H.; Garle, M.J.; Smith, P.A.; Roberts, R.E.

2016-01-01

Statins induce acute vasorelaxation which may contribute to the overall benefits of statins in the treatment of cardiovascular disease. The mechanism underlying this relaxation is unknown. As statins have been shown to alter mitochondrial function, in this study we investigated the role of mitochondria in the relaxation to simvastatin. Relaxation of porcine coronary artery segments by statins was measured using isolated tissue baths. Mitochondrial activity was determined by measuring changes in rhodamine 123 fluorescence. Changes in intracellular calcium levels were determined in freshly isolated smooth muscle cells with Fluo-4 using standard epifluorescent imaging techniques. Simvastatin, but not pravastatin, produced a slow relaxation of the coronary artery, which was independent of the endothelium. The relaxation was attenuated by the mitochondrial complex I inhibitor rotenone (10 μM) and the complex III inhibitor myxothiazol (10 μM), or a combination of the two. The complex III inhibitor antimycin A (10 μM) produced a similar time-dependent relaxation of the porcine coronary artery, which was attenuated by rotenone. Changes in rhodamine 123 fluorescence showed that simvastatin (10 μM) depolarized the membrane potential of mitochondria in both isolated mitochondria and intact blood vessels. Simvastatin and antimycin A both inhibited calcium-induced contractions in isolated blood vessels and calcium influx in smooth muscle cells and this inhibition was prevented by rotenone. In conclusion, simvastatin produces an endothelium-independent relaxation of the porcine coronary artery which is dependent, in part, upon effects on the mitochondria. The effects on the mitochondria may lead to a reduction in calcium influx and hence relaxation of the blood vessel. - Highlights: • Simvastatin produces a relaxation of the porcine coronary artery. • This relaxation is inhibited by mitochondrial complex inhibitors. • Simvastatin alters mitochondrial membrane potential

Effect of simvastatin on vascular tone in porcine coronary artery: Potential role of the mitochondria

Energy Technology Data Exchange (ETDEWEB)

Almukhtar, H.; Garle, M.J.; Smith, P.A.; Roberts, R.E., E-mail: richard.roberts@nottingham.ac.uk

2016-08-15

Statins induce acute vasorelaxation which may contribute to the overall benefits of statins in the treatment of cardiovascular disease. The mechanism underlying this relaxation is unknown. As statins have been shown to alter mitochondrial function, in this study we investigated the role of mitochondria in the relaxation to simvastatin. Relaxation of porcine coronary artery segments by statins was measured using isolated tissue baths. Mitochondrial activity was determined by measuring changes in rhodamine 123 fluorescence. Changes in intracellular calcium levels were determined in freshly isolated smooth muscle cells with Fluo-4 using standard epifluorescent imaging techniques. Simvastatin, but not pravastatin, produced a slow relaxation of the coronary artery, which was independent of the endothelium. The relaxation was attenuated by the mitochondrial complex I inhibitor rotenone (10 μM) and the complex III inhibitor myxothiazol (10 μM), or a combination of the two. The complex III inhibitor antimycin A (10 μM) produced a similar time-dependent relaxation of the porcine coronary artery, which was attenuated by rotenone. Changes in rhodamine 123 fluorescence showed that simvastatin (10 μM) depolarized the membrane potential of mitochondria in both isolated mitochondria and intact blood vessels. Simvastatin and antimycin A both inhibited calcium-induced contractions in isolated blood vessels and calcium influx in smooth muscle cells and this inhibition was prevented by rotenone. In conclusion, simvastatin produces an endothelium-independent relaxation of the porcine coronary artery which is dependent, in part, upon effects on the mitochondria. The effects on the mitochondria may lead to a reduction in calcium influx and hence relaxation of the blood vessel. - Highlights: • Simvastatin produces a relaxation of the porcine coronary artery. • This relaxation is inhibited by mitochondrial complex inhibitors. • Simvastatin alters mitochondrial membrane potential

Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

OpenAIRE

Headley,Selwyn Arlington; Saito,Taís Berelli

2003-01-01

Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

Science.gov (United States)

Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

2018-05-14

Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

Macrophage cholesterol efflux correlates with lipoprotein subclass distribution and risk of obstructive coronary artery disease in patients undergoing coronary angiography

Directory of Open Access Journals (Sweden)

Kremer Werner

2009-04-01

Full Text Available Abstract Background Studies in patients with low HDL have suggested that impaired cellular cholesterol efflux is a heritable phenotype increasing atherosclerosis risk. Less is known about the association of macrophage cholesterol efflux with lipid profiles and CAD risk in normolipidemic subjects. We have therefore measured macrophage cholesterol efflux in142 normolipidemic subjects undergoing coronary angiography. Methods Monocytes isolated from blood samples of patients scheduled for cardiac catheterization were differentiated into macrophages over seven days. Isotopic cholesterol efflux to exogenously added apolipoprotein A-I and HDL2 was measured. Quantitative cholesterol efflux from macrophages was correlated with lipoprotein subclass distribution in plasma from the same individuals measured by NMR-spectroscopy of lipids and with the extent of coronary artery disease seen on coronary angiography. Results Macrophage cholesterol efflux was positively correlated with particle concentration of smaller HDL and LDL particles but not with total plasma concentrations of HDL or LDL-cholesterol. We observed an inverse relationship between macrophage cholesterol efflux and the concntration of larger and triglyceride rich particles (VLDL, chylomicrons. Subjects with significant stenosis on coronary angiography had lower cholesterol efflux from macrophages compared to individuals without significant stenosis (adjusted p = 0.02. Conclusion Macrophage cholesterol efflux is inversely correlated with lipoprotein particle size and risk of CAD.

Podoplanin Expression in Canine Melanoma

OpenAIRE

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-01-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.

Science.gov (United States)

Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto

2012-02-22

The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great

Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

International Nuclear Information System (INIS)

Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma

2010-01-01

Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

Finite element analysis of rapid canine retraction through reducing resistance and distraction

Directory of Open Access Journals (Sweden)

Junjie XUE

2014-01-01

Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

Canine scent detection of canine cancer: a feasibility study

Directory of Open Access Journals (Sweden)

Dorman DC

2017-10-01

Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

Environmental Factors and Ecosystems Associated with Canine Visceral Leishmaniasis in Northeastern Brazil.

Science.gov (United States)

da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; de Carvalho Araújo, Andreina; da Silva Ferreira, Juliana Isabel Giuli; Tonhosolo, Renata; Dias, Ricardo Augusto; Gennari, Solange Maria; Marcili, Arlei

2015-12-01

Environment influences the composition, distribution, and behavior of the vectors and mammalian hosts involved in the transmission of visceral leishmaniasis (VL), affecting the epidemiology of the disease. In Brazil, the urbanization process and canine cases of VL are indicators for local health authorities. This study aimed to investigate the occurrence of the canine visceral leishmaniasis (CVL) in Maranhão State, Brazil. Blood samples collected from 960 dogs from six municipalities and six different ecosystems (Baixada Maranhense, Mangue, Mata dos Cocais, Amazônia, Cerrado, and Restinga) to serological tests (enzyme-linked immunosorbent assay [ELISA], indirect fluorescence antibody test [IFAT], and chromatographic immunoassay methods [Dual Path Platform technology, DPP(®)]) and parasitological diagnosis. From serological tests, 11.14% (107) of the dogs were positive for CVL, with 59.16% (568), 14.5% (148), and 131% (126) positives to ELISA, DPP, and IFAT tests, respectively. Only seven animals (0.73%) were positive in a parasitological test. We also performed parasite isolation and phylogenetic characterization. All isolates of dogs obtained from Maranhão were grouped in a single branch with Leishmania infantum chagasi from Brazil. The ecosystem Amazonia presented the highest positivity rates to CVL in serological and parasitological tests. Brazilian biomes/ecosystems suffer large degradation and may favor, depending on climatic conditions, the installation of new diseases. In the case of VL, dogs are reservoirs of parasites and sentinels for human infection.

Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

Science.gov (United States)

Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

2006-11-25

The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

OpenAIRE

Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

2017-01-01

In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

Distal coronary hemoperfusion during percutaneous transluminal coronary angioplasty

NARCIS (Netherlands)

Muinck, Ebo Derk de

1994-01-01

In this thesis several aspects of passive and active coronary perfusion during coronary angioplasty are investigated. The autoperfusion balloon catheters that were evaluated are the Stack® and the RX-60® catheters (Advanced Cardiovascular Systems, inc., Santa Clara, California, U.S.A). The coronary

Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

Science.gov (United States)

Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

2004-01-01

The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

Brain Abscess Associated with Isolated Left Superior Vena Cava Draining into the Left Atrium in the Absence of Coronary Sinus and Atrial Septal Defect

International Nuclear Information System (INIS)

Erol, Ilknur; Cetin, I. Ilker; Alehan, Fuesun; Varan, Birguel; Ozkan, Sueleyman; Agildere, A. Muhtesem; Tokel, Kursad

2006-01-01

A previously healthy 12-year-old girl presented with severe headache for 2 weeks. On physical examination, there was finger clubbing without apparent cyanosis. Neurological examination revealed only papiledema without focal neurologic signs. Cerebral magnetic resonance imaging showed the characteristic features of brain abscess in the left frontal lobe. Cardiologic workup to exclude a right-to-left shunt showed an abnormality of the systemic venous drainage: presence of isolated left superior vena cava draining into the left atrium in the absence of coronary sinus and atrial septal defect. This anomaly is rare, because only a few other cases have been reported

Immunophenotypical characterization of canine mesenchymal stem cells from perivisceral and subcutaneous adipose tissue by a species-specific panel of antibodies.

Science.gov (United States)

Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio

2017-10-01

Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.

Impaired vascular sensitivity to nitric oxide in the coronary microvasculature after endotoxaemia

OpenAIRE

Bogle, Richard G; McLean, Peter G; Ahluwalia, Amrita; Vallance, Patrick

2000-01-01

The effects of endotoxaemia on coronary vasodilator responses to bradykinin (BK), sodium nitroprusside (SNP) and nicardipine were investigated in the rat isolated heart perfused at constant flow ex vivo.Dose-dependent reductions in coronary perfusion pressure reaching a maximum of 56±3 and 57±5 mmHg were observed for BK and SNP respectively. The BK response was biphasic, consisting of a rapid dilator response that was insensitive to NGnitro-L-arginine methyl ester (L-NAME, 0.1 mM) and a secon...

A survey of canine haemoprotozoan parasites from Turkey, including molecular evidence of an unnamed Babesia.

Science.gov (United States)

Aktas, Munir; Ozubek, Sezayi

2017-06-01

Canine tick-borne apicomplexan parasites have emerged in recent years, showing a wider geographic distribution and increased global prevalence. A reverse line blot assay was performed on 219 blood samples collected from domestic dogs for simultaneous detection of all named canine piroplasm species as well as Hepatozoon canis. Ten samples hybridized to the Theileria/Babesia and Babesia catch all probes but did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed 91.5%, 91.9%, 92.4%, 92.4%, and 89.2% similarity to B. canis, B. vogeli, B. rossi, B. gibsoni, and B. conradae, respectively. The highest homology (98.1-98.5%) observed was with unnamed Babesia sp. isolates (Ludhiana and Malbazar) described in dogs, Babesia sp. of buffalo origin, Babesia sp. Kashi 2, and Babesia orientalis, along with Babesia occultans of cattle origin. The partial cox1 sequence indicated that this isolate was most similar to Babesia sp. 1 HG-2012, with an identity of 86.5%. The survey revealed high prevalence of haemoprotozoans in domestic dogs (57.5%, CI 50.7-64.2), with Hepatozoon canis the most prevalent (54.3%, CI 47.5-61.117%), followed by Babesia sp. (4.6%, CI 2.2-8.2), B. vogeli (1.4%; CI 0.3-3.9), and B. canis (0.4%, CI 0-2.5). Combined infection of Hepatozoon canis and Babesia sp. was detected in five (2.3%, CI 0.7-5.2) samples and of H. canis and B. vogeli in two (0.9%, CI 0.1-3.2) dogs. The study contributes insight into the distribution and phylogenetic diversity of canine piroplasms in Turkey. Copyright © 2017 Elsevier Ltd. All rights reserved.

Surgical considerations and management of bilateral labially impacted canines

Directory of Open Access Journals (Sweden)

Yu-Shan Huang

2016-06-01

Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

Immunohistochemical Characterization of Canine Lymphomas

Directory of Open Access Journals (Sweden)

Roxana CORA

2017-11-01

Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

Stem Cell-Associated Marker Expression in Canine Hair Follicles.

Science.gov (United States)

Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

2016-03-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

HUMAN CORONARY ARTERIES- A STUDY BASED ON GROSS ANATOMY AND CORONARY CAST

Directory of Open Access Journals (Sweden)

Vijayamma K. N

2018-01-01

Full Text Available BACKGROUND Present study is an attempt to throw light upon the coronary arterial pattern, variations in arterial distribution and extent of intercoronary anastomosis and arterial preponderance in different age groups. MATERIALS AND METHODS Total of 115 hearts were made use for this study. Ninety hearts were dissected for the gross anatomical study of coronary arteries and 25 hearts including three fetal hearts were used for the coronary cast study. The right and left coronary arteries were traced from aortic sinus along the atrioventricular groove to the area of its termination. The atrial ventricular and septal branches were traced and looked for anastomosis. Coronary casts were prepared by injecting coloured liquid latex through the coronary ostia and the branching pattern and anastomosis were studied. The coronary arterial pattern, extent of distribution of its branches, arterial preponderance and variations were observed. RESULTS It was found that 73 % cases of SA nodal branch arise from right coronary artery and 27 % from circumflex branch of left coronary artery. SA node has dual blood supply from both coronary arteries in 4% cases. Right coronary preponderance was observed in 83% of cases and left coronary preponderance in 11 % cases, and balanced supply in 6% cases. Coronary cast was helpful to understand the branching pattern of vessels, and the anastomosis of small capillaries. It was also seen that all 11 % of left preponderance were seen in male hearts and all of the 31 female hearts dissected were right preponderant. CONCLUSION Coronary arteries are called end arteries functionally. Right coronary artery originates from anterior aortic sinus in all cases except one which takes origin from posterior left aortic sinus along with left coronary artery. Right coronary preponderance is observed in 83% cases. Left coronary artery branching pattern shows variability. Left coronary preponderance was observed in 11% and all cases are male

A comparison of hybrid coronary revascularization and off-pump coronary revascularization.

Science.gov (United States)

Umakanthan, Ramanan; Leacche, Marzia; Gallion, Anna H; Byrne, John G

2013-04-01

Minimally invasive approaches to treat vascular disease have been accruing significant popularity over the last several decades. Due to progressive advances in technology, a variety of techniques are being now utilized in the field of cardiovascular surgery. The objectives of minimally invasive techniques are to curtail operative trauma and minimize perioperative morbidity without decreasing the quality of the treatment. The standard surgical approach for the treatment of coronary artery disease has traditionally been coronary artery bypass grafting surgery via median sternotomy. Off-pump coronary artery bypass grafting surgery offers a less invasive alternative and enables coronary revascularization to be performed without cardiopulmonary bypass. Hybrid coronary revascularization offers an even less invasive option in which minimally invasive direct coronary artery bypass can be combined with percutaneous coronary intervention. In this article, the authors review a recent publication comparing hybrid coronary revascularization and off-pump coronary artery bypass grafting surgery.

A novel bocavirus in canine liver

Directory of Open Access Journals (Sweden)

Li Linlin

2013-02-01

Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

A compendium of canine normal tissue gene expression.

Directory of Open Access Journals (Sweden)

Joseph Briggs

Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

Pattern and predictors of dual antiplatelet use after coronary artery bypass graft surgery.

Science.gov (United States)

Mori, Makoto; Shioda, Kayoko; Yun, James J; Mangi, Abeel A; Darr, Umer; Geirsson, Arnar

2018-02-01

Resumption of dual antiplatelet therapy after coronary artery bypass grafting in patients presenting with acute coronary syndrome is recommended, but the current practice pattern in the United States remains unknown. We aimed to investigate the current pattern of dual antiplatelet therapy use after coronary artery bypass grafting at the Yale-New Haven Hospital. We conducted a single-center retrospective review of patients who presented with acute coronary syndrome and underwent coronary artery bypass grafting between 2014 and 2016. The primary outcome was hospital discharge with dual antiplatelet therapy. Mixed-effect multivariate logistic regression was used to evaluate predictors of dual antiplatelet therapy use or nonuse, accounting for surgeon-specific preference. The discriminatory ability of the model was evaluated with receiver operating characteristics analysis. Of 572 patients included, only 29% were discharged with dual antiplatelet therapy. In the mixed-effect multivariate model isolating surgeon preferences, increase in age (odds ratio, 0.95; 95% confidence interval, 0.92-0.98; P dual antiplatelet therapy use. Off-pump coronary artery bypass grafting compared with on-pump coronary artery bypass grafting was associated with increased odds of dual antiplatelet therapy use (odds ratio, 31.5; 95% confidence interval, 12.8-77.2; P dual antiplatelet therapy use in patients with acute coronary syndrome who underwent coronary artery bypass grafting was low and variable among surgeons. The use or nonuse was guided by previously established risk factors of recurrent ischemia and bleeding, along with surgeon preference. Published by Elsevier Inc.

Genomic instability and telomere fusion of canine osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Junko Maeda

Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

Science.gov (United States)

Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

2016-06-01

Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

Canine index – A tool for sex determination

Directory of Open Access Journals (Sweden)

Shankar M. Bakkannavar

2015-12-01

Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

Rubidium-82 PET-CT for quantitative assessment of myocardial blood flow: validation in a canine model of coronary artery stenosis

International Nuclear Information System (INIS)

Lautamaeki, Riikka; Higuchi, Takahiro; Merrill, Jennifer; Voicu, Corina; Bengel, Frank M.; George, Richard T.; Kitagawa, Kakuya; DiPaula, Anthony; Lima, Joao A.C.; Nekolla, Stephan G.; Lardo, Albert C.

2009-01-01

Absolute quantification of myocardial blood flow expands the diagnostic potential of PET for assessment of coronary artery disease. 82 Rb has significantly contributed to increasing utilization of PET; however, clinical studies are still mostly analysed qualitatively. The aim of this study was to reevaluate the feasibility of 82 Rb for flow quantification, using hybrid PET-CT in an animal model of coronary stenosis. Nine dogs were prepared with experimental coronary artery stenosis. Dynamic PET was performed for 8 min after 82 Rb(1480-1850 MBq) injection during adenosine-induced vasodilation. Microspheres were injected simultaneously for reference flow measurements. CT angiography was used to determine the myocardial regions related to the stenotic vessel. Two methods for flow calculation were employed: a two-compartment model including a spill-over term, and a simplified retention index. The two-compartment model data were in good agreement with microsphere flow (y=0.84x+0.20; r=0.92, p 82 Rb. A simplified approach based on tracer retention is practicable in the physiological flow range. These results encourage further testing of the robustness and usefulness in the clinical context of cardiac hybrid imaging. (orig.)

Coronary blood flow and coronary stenosis correlations in ischemic heart patients

International Nuclear Information System (INIS)

Manukov, I.

2003-01-01

The aim of the study is the assessment of the methodology for the C-TIMI frame count by Gibson for easy and fast determination of the coronary blood flow during a selective coronary angiography. 75 patient have been studied with one-branch affection of the coronary arteries. The criteria for exclusion are: myocardial hypertrophy, valve lesions, myocardial infarction and dyslipidemia. Depending of the characteristics of the coronary stenotic changes, the patients have been divided into two groups: 1) Patients with 'ordinary' stenosis of the coronary artery and 2) Patients with 'complex' stenosis. The severity of the stenotic changes in percents is the same for the two groups - 78%±13% vs 81±12%, respectively. In the first group a pronounced correlation is observed between the severity of the coronary stenosis and the slowing of the coronary blood flow. The 'threshold' stenotic level is 89%. In the second group the lowest value of the coronary stenosis is 73% (p>0.01 vs group 1). No correlation is observed between the severity of the coronary stenosis and the slowing of the coronary blood flow. A conclusion is made that the Gibson method for the assessment of the blood flow is convenient for the daily practice not only for the assessment of the significance of the coronary changes, but also for fast analysis of the achieved reconstruction of the coronary arteries after angioplasty. Additional studies of the significance of the different signs of 'complexity' of the coronary stenosis for the slowing of the blood flow are necessary

Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.

Science.gov (United States)

Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara

2018-04-01

Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

Rate of retraction of anterior teeth after canine distraction

Directory of Open Access Journals (Sweden)

Litesh Singla

2017-01-01

Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

OpenAIRE

Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Ara?jo, Maria Jos? Abigail Mendes; B?falo, Michelle Cristiane; Sforcin, Jos? Maur?cio

2013-01-01

Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

The effect of collateral flow and myocardial viability on the distribution of technetium-99m sestamibi in a closed-chest model of coronary occlusion and reperfusion

International Nuclear Information System (INIS)

Chareonthaitawee, P.; O'Connor, M.K.; Gibbons, R.J.; Christian, T.F.; Ritman, E.L.

2000-01-01

The objective of this study was to determine the effect of myocardial viability and the degree of collateral blood flow on the uptake and retention of 99m Tc-sestamibi by examining three animal models of coronary occlusion and reperfusion, each reflecting a different state of viability and collateral blood flow. Three closed-chest animal models were studied: canine (high collateral flow, preserved viability), porcine (low collateral flow, absent viability) and porcine with slowly occlusive coronary stents producing infarction and enhanced collateral blood flow (high collateral flow, absent viability). There were seven dogs, seven pigs and six pigs, respectively, in each animal model. Animals from all three models were subjected to a 40-min total left anterior descending artery (LAD) occlusion followed by 2 h of reperfusion. 99m Tc-sestamibi and radiolabelled microspheres were injected during LAD occlusion 10 min prior to reperfusion. Animals were sacrificed after 2 h of reperfusion flow. Ex situ heart slice imaging to determine risk area was followed by viability staining to determine infarct size. Slices were subsequently sectioned into equally sized radial segments and placed in a gamma well counter. Risk area as determined by ex situ 99m Tc-sestamibi imaging was not significantly different by model. Pathological infarct size differed significantly by model [canine = 1%±1% of the left ventricle (LV); porcine = 13%±8% LV; porcine with stent = 14%±7% LV; P=0.002]. Collateral blood flow by microspheres during occlusion tended to differ among models (overall P=0.08), with the canine and porcine with stent models having relatively high flow rates compared with the acute porcine model. 99m Tc-sestamibi activity correlated with microsphere blood flow in all three models, with r values for individual animals (n=20) ranging from 0.86 to 0.96 (all P 99m Tc-sestamibi uptake with myocardial blood flow. 99m Tc-sestamibi uptake overestimated blood flow to a greater extent

Fatal canine distemper virus infection of giant pandas in China.

Science.gov (United States)

Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

2016-06-16

We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.

Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

Science.gov (United States)

Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

2017-09-29

The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

Dietary manipulation and social isolation alter disease progression in a murine model of coronary heart disease.

Directory of Open Access Journals (Sweden)

Yumiko Nakagawa-Toyama

Full Text Available BACKGROUND: Mice with a deficiency in the HDL receptor SR-BI and low expression of a modified apolipoprotein E gene (SR-BI KO/ApoeR61(h/h called 'HypoE' when fed an atherogenic, 'Paigen' diet develop occlusive, atherosclerotic coronary arterial disease (CHD, myocardial infarctions (MI, and heart dysfunction and die prematurely (50% mortality ~40 days after initiation of this diet. Because few murine models share with HypoE mice these cardinal, human-like, features of CHD, HypoE mice represent a novel, small animal, diet-inducible and genetically tractable model for CHD. To better describe the properties of this model, we have explored the effects of varying the composition and timing of administration of atherogenic diets, as well as social isolation vs. group housing, on these animals. METHODOLOGY/PRINCIPAL FINDINGS: HypoE mice were maintained on a standard lab chow diet (control until two months of age. Subsequently they received one of three atherogenic diets (Paigen, Paigen without cholate, Western or control diet for varying times and were housed in groups or singly, and we determined the plasma cholesterol levels, extent of cardiomegaly and/or survival. The rate of disease progression could be reduced by lowering the severity of the atherogenic diet and accelerated by social isolation. Disease could be induced by Paigen diets either containing or free of cholate. We also established conditions under which CHD could be initiated by an atherogenic diet and then subsequently, by replacing this diet with standard lab chow, hypercholesterolemia could be reduced and progression to early death prevented. CONCLUSIONS/SIGNIFICANCE: HypoE mice provide a powerful, surgery-free, diet-'titratable' small animal model that can be used to study the onset of recovery from occlusive, atherosclerotic CHD and heart failure due to MI. HypoE mice can be used for the analysis of the effects of environment (diet, social isolation on a variety of features of

Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

Science.gov (United States)

Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

2008-07-01

Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

Directory of Open Access Journals (Sweden)

Gaurav Sharma

2011-01-01

Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

Evaluation of a vectored equine herpesvirus type 1 (EHV-1) vaccine expressing H3 haemagglutinin in the protection of dogs against canine influenza.

Science.gov (United States)

Rosas, Cristina; Van de Walle, Gerlinde R; Metzger, Stephan M; Hoelzer, Karin; Dubovi, Edward J; Kim, Sung G; Parrish, Colin R; Osterrieder, Nikolaus

2008-05-02

In 2004, canine influenza virus (CIV) was identified as a respiratory pathogen of dogs for the first time and found to be closely related to H3N8 equine influenza virus (EIV). We generated a recombinant vectored vaccine that expresses H3 of a recent isolate of EIV using equine herpesvirus type 1 (EHV-1) as the delivery vehicle. This EHV-1 vectored vaccine exhibited robust and stable EIV H3 expression and induced a strong influenza virus-specific response in both mice and dogs upon intranasal or subcutaneous administration. Furthermore, upon challenge with the recent CIV isolate A/canine/PA/10915-07, protection of vaccinated dogs could be demonstrated by a significant reduction in clinical sings, and, more importantly, by a significant reduction in virus shedding. We concluded that the EHV-1/H3 recombinant vector can be a valuable alternative for protection of dogs against clinical disease induced by CIV and can significantly reduce virus spread.

[Developments in percutaneous coronary intervention and coronary stents].

Science.gov (United States)

Simsek, C; Daemen, J; Zijlstra, F

2014-01-01

In The Netherlands, more than 30.000 patients undergo a percutaneous coronary intervention every year, during which a coronary stent implantation will be performed in 90% of the cases. It is estimated that more than 5 million coronary stent implantations will be performed worldwide this year. While these numbers are impressive, however, coronary stents still have as a limitation the possibility of stent thrombosis. This has been and is an important stimulus for the development of both coronary stents, from a bare metal stent via a drug eluting stent to the present-day development of bio-absorbable stents, and anti-platelet drugs,from acenocoumarol to thieropyridines. The possibility of shortening the period of use of this powerful medication by developing new kinds of non-thrombogenic stents would, for example, make it possible to achieve significant reductions in subsequent bleeding during (dental) procedures.

Asymmetry in development (mineralisation of permanent mandibular canine roots

Directory of Open Access Journals (Sweden)

Burić Mirjana V.

2012-01-01

Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

The effect of percutaneous transcatheter occlusion of left atrial appendage on left atrium and adjacent anatomic structure in canine

International Nuclear Information System (INIS)

Yang Zhihong; Wu Hong; Qin Yongwen; Hu Jianqiang; Ding Zhongru; Liu Zongjun; Liu Biao; Zheng Xing

2009-01-01

Objective: To observe the effect of percutaneous transcatheter occlusion of left atrial appendage (LAA) with a new self-manufactured LAA occluder on left atrium and adjacent anatomic structure in canine. Methods: A new self-manufactured LAA occluder was implanted into the LAA through a transseptal catheter in 20 dogs. Before and after the procedure, the experimental dogs were anaesthetized and examined by transthoracic echocardiography (TTE) to measure the diameter and the volume of the left atrium, the left superior pulmonary vein flow velocity and the left atrioventricular valve flow velocity separately. The contrast radiography of the LAA and the left coronary arteriography were performed. Results: The new LAA occluder was implanted successfully in 14 dogs. No obvious changes in the diameter and the volume of the left atrium, in left superior pulmonary vein flow velocity and in left atrioventricular valve flow velocity were found. On arteriography, left circumflex artery was normally displayed after the procedure. No migration of the occluder was seen on TTE and angiography after procedure. Conclusion: Percutaneous transcatheter occlusion of left atrial appendage with a new self-manufactured LAA occluder has no obvious effect on left atrium and adjacent anatomic structure in experimental canine, which indicates that the new-type device is a safe and feasible occluder for LAA. (authors)

Prospective association of polycystic ovary syndrome with coronary artery calcification and carotid-intima-media thickness: the Coronary Artery Risk Development in Young Adults Women's study.

Science.gov (United States)

Calderon-Margalit, Ronit; Siscovick, David; Merkin, Sharon S; Wang, Erica; Daviglus, Martha L; Schreiner, Pamela J; Sternfeld, Barbara; Williams, O Dale; Lewis, Cora E; Azziz, Ricardo; Schwartz, Stephen M; Wellons, Melissa F

2014-12-01

To study the independent associations of polycystic ovary syndrome (PCOS), and its 2 components, hyperandrogenism and anovulation, with coronary artery calcification (CAC) and carotid artery intima-media thickness (IMT). At the year 20 of the Coronary Artery Risk Development in Young Adults (CARDIA) study, a population-based multicenter cohort of young adults, women (mean age, 45 years) with information on menses and hirsutism in their twenties were assessed for CAC (n=982) and IMT (n=988). We defined PCOS as women who had both irregular menses and hyperandrogenism (n=55); isolated oligomenorrhea (n=103) as women who only had irregular menses; and isolated hyperandrogenism (n=156) as women who had either hirsutism or increased testosterone levels. Logistic regressions and general linear models were used to estimate the associations between components of PCOS and subclinical CVD. The prevalence of CAC was 10.3% overall. Women with PCOS had a multivariable adjusted odds ratio of 2.70 (95% confidence interval, 1.31-5.60) for CAC. Women with either isolated oligomenorrhea or isolated hyperandrogenism had no increased risk of CAC when compared with unexposed women. Women with PCOS had significantly increased bulb and internal carotid-IMT measurements; however, no significant differences were noted in bulb or internal carotid artery IMT among women with either isolated oligomenorrhea or isolated hyperandrogenism when compared with unexposed women. There were no differences in common carotid-IMT among the 4 study groups. In this study, women with PCOS, manifested as both anovulation and hyperandrogenism, but not women with one of these manifestations alone, were at increased risk for the development of subclinical CVD. © 2014 American Heart Association, Inc.

Characterization of lipoproteins in human and canine cerebrospinal fluid (CSF)

International Nuclear Information System (INIS)

Pitas, R.E.; Weisgraber, K.H.; Boyles, J.K.; Lee, S.; Mahley, R.W.

1986-01-01

Previously the authors demonstrated that rat brain astrocytes in vitro synthesize and secrete apo-E and possess apo-B,E(LDL) receptors. The apo-E secreted by astrocytes and apo-E in rat brain extracts differed from serum apo-E in two respects. Brain apo-E had a higher apparent molecular weight and a higher percentage of more acidic isoforms. To characterize further the apo-E within the central nervous system, apo-E in human and canine CSF was investigated. Compared to plasma apo-E, CSF apo-E had a higher apparent M/sub r/ and a higher percentage of acidic isoforms which were sialylated, as shown by neuraminidase digestion. The apo-E in human CSF was approx.5-10% of the plasma level. In CSF 60-80% of the apo-E was in lipoproteins with d = 1.09-1.15. The remainder of the apo-E was in the d > 1.21 fraction. Human CSF lipoproteins were primarily spherical (110-190 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) while canine CSF lipoproteins were a mixture of discs (205 x 65 A) and spheres (100-150 A). The CSF also contained apo-AI in the d = 1.09-1.15 g/ml fraction. Human CSF lipoproteins containing both apo-E and apo-AI were isolated on an anti-apo-E affinity column, suggesting that apo-E and AI occurred in the same particles. The CSF apo-E-containing lipoproteins competed for binding of 125 I-LDL to the apo-B,E(LDL) receptor. There was no detectable apo-B in CSF. These data suggest that CSF lipoproteins might transport lipid and regulate lipid homeostasis within the brain

Orthodontic management of buccally erupted ectopic canine with two case reports

Directory of Open Access Journals (Sweden)

Avesh Sachan

2012-01-01

Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

International Nuclear Information System (INIS)

Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.

2005-01-01

Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

Anomalous origin of right coronary artery from left coronary sinus.

Science.gov (United States)

Hamzeh, Gadah; Crespo, Alex; Estarán, Rafael; Rodríguez, Miguel A; Voces, Roberto; Aramendi, José I

2008-08-01

Anomalous aortic origin of the coronary arteries is uncommon but clinically significant. Manifestations vary from asymptomatic patients to those who present with angina pectoris, myocardial infarction, heart failure, syncope, arrhythmias, and sudden death. We describe 4 patients, aged 34 to 59 years, who were diagnosed with right coronary artery arising from the left sinus of Valsalva, confirmed by coronary angiography, which was surgically repaired. Three patients presented dyspnea and angina, and one with acute myocardial infarction. At operation, the right coronary artery was dissected at the take-off from the intramural course, and reimplanted into the right sinus of Valsalva. There was no mortality. One patient had associated coronary artery disease that required stent placement postoperatively. This reimplantation technique provides a good physiological and anatomical repair, eliminates a slit-like ostium, avoids compression of the coronary artery between the aorta and the pulmonary artery, and gives superior results to coronary artery bypass grafting or the unroofing technique.

Lincosamide resistance is less frequent in Denmark in Staphylococcus pseudintermedius from first-time canine superficial pyoderma compared with skin isolates from clinical samples with unknown clinical background.

Science.gov (United States)

Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter

2015-06-01

Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.

Canine parvovirus: current perspective.

Science.gov (United States)

Nandi, S; Kumar, Manoj

2010-06-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

Does grafting coronary arteries with only moderate stenosis affect long-term mortality?

Science.gov (United States)

Sabik, Joseph F.; Olivares, Gabriel; Raza, Sajjad; Lytle, Bruce W.; Houghtaling, Penny L.; Blackstone, Eugene H.

2016-01-01

Objective Stenting coronary arteries with non–ischemia-producing moderate stenosis leads to worse outcomes than leaving them unstented. We sought to determine whether grafting coronary arteries with angiographically moderate stenosis is associated with worse long-term survival than leaving them ungrafted. Methods From 1972 to 2011, 55,567 patients underwent primary isolated coronary artery bypass grafting (CABG); 8531 had a single coronary artery with moderate (50%-69%) stenosis, bypassed in 6598 (77%) and not bypassed in 1933 (23%). These arteries were grafted with internal thoracic arteries (ITAs) in 1806 patients (27%) and with saphenous veins (SVs) in 4625 (70%). Mean follow-up for all-cause mortality was 13.0 ± 9.7 years. Results Survival was similar for patients with and without a graft to the moderately stenosed coronary artery (P = .3): 97%, 76%, 43%, and 18% at 1, 10, 20, and 30 years among patients receiving no graft; 97%, 74%, 41%, and 18% among those receiving an SV graft; and 98%, 82%, 51%, and 23% among those receiving an ITA graft. After adjusting for patient characteristics, SV grafting versus nongrafting of moderately stenosed coronary arteries was associated with similar long-term mortality (P = .2), whereas ITA grafting was associated with 22% lower long-term mortality (hazard ratio 0.78; 68% confidence interval 0.75–0.82; P<.0001). Conclusions Grafting coronary arteries with angiographically moderate stenosis is not harmful. Instead, ITA grafting of such coronary arteries is associated with lower long-term mortality. Thus, after placing the first ITA to the left anterior descending, the second ITA should be placed to the second most important coronary artery, even if it is moderately stenosed. PMID:26611750

Consequences of crown shortening canine teeth in Greenland sled dogs

DEFF Research Database (Denmark)

Kortegaard, H E; Anthony Knudsen, T; Dahl, S

2015-01-01

OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

Dental anomalies associated with buccally- and palatally-impacted maxillary canines.

Science.gov (United States)

Sajnani, Anand K; King, Nigel M

2014-08-01

The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

Directory of Open Access Journals (Sweden)

Grassi Rici Rose

2012-02-01

Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

Coronary angiography in Qatar: the first ten years.

Science.gov (United States)

Chaikhouni, A; Gehani, A A; Horak, J; Hajar, H A

1998-08-01

Cardiac catheterization in Qatar was initiated in July 1982. In ten years, a total of 3900 procedures were performed at Hamad General Hospital. Computerized data registry has been maintained since 1982. Isolated coronary angiography was done in 2911 patients; of these, 2635 (90.5%) were men, and 276 (9.5%) were women, the average age of the patients was 47+/-9.2 years (range, twenty-five to eighty-eight). Patients' nationality was Qatari in 492 (17%), and other Arabs in 610 (21%), and 1512 (52%) were from the Asian subcontinent. Myocardial infarction was the most common indication (43%). Single-vessel disease was found in 638 (22%), two-vessel disease in 630 (22%), three-vessel disease in 950 (33%), and nonsignificant coronary artery disease in 693 (24%) patients. Morbidity related to the coronary angiography was reported in 147 (5%) patients, but there was no mortality related to the procedure. In 822 (28%) patients, the age was forty years or younger. The angiographic findings of these younger patients were compared with those of the older ones. Younger patients were usually men of Asian subcontinental origin with a recent myocardial infarction (MI). Often, they had normal coronary arteries or single-vessel disease. Patients of Asian subcontinent origin were usually young male patients with a recent MI, who receive streptokinase, and have single-vessel disease.

Overexpression of vimentin in canine prostatic carcinoma

DEFF Research Database (Denmark)

Rodrigues, M M P; Rema, A; Gärtner, F

2011-01-01

Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

Vaccines for Canine Leishmaniasis

Directory of Open Access Journals (Sweden)

Faeze Foroughi-Parvar

2014-01-01

Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

Upper canine inclination influences the aesthetics of a smile.

Science.gov (United States)

Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

2015-02-01

This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

Treatment modalities of palatal impacted canines

OpenAIRE

Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

2012-01-01

Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines.

Science.gov (United States)

Oz, A Z; Ciger, S

2018-03-01

The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

Evaluation of the restenosis of coronary artery after percutaneous transluminal coronary angioplasty by three-dimensional coronary magnetic resonance angiography

International Nuclear Information System (INIS)

Arisaka, Hiraku

2000-01-01

Coronary magnetic resonance angiography (MRA) has been recently brought into clinical use, however, there has not been reports on the comparison with MRA and conventional contrast coronary angiography (CAG) in the detection of the localization and characteristics of coronary restenosis after percutaneous transluminal coronary angioplasty (PTCA). To assess the restenosis of coronary artery after PTCA, this study compared three-dimensional (3D) coronary MRA and CAG. One hundred three patients (76 males and 27 females, average age of 64.6±9.3 years old) were performed coronary MRA at 3-6 months after PTCA. The right coronary artery (RCA) group consist of 21 patients, the left anterior descending branch (LAD) 63 patients and the left circumflex branch (LCX) 19 patients. Coronary MRA was performed with the patients in supine position on a 1.5 T whole body scanner (MAGNETOM VISION, Siemens AG, Germany) using body array coil. The imaging technique used a 3-D gradient echo sequence with respiratory gating and fat suppression. The slice thickness was 2 mm, slab thickness 32 mm, a field of view of 300 mm and a matrix of 128 x 256. Other parameters were an echo time of 2.7 ms and a repetition time of 600 to 1100 msec. The measurement time of 1 imaging slab took 15 to 20 minutes depending on the patient's heart rate. The coronary arteries were reconstructed from the 3-D data set using a multiplanar reconstruction (MPR) technique. According to previous coronary MRA studies, a significant stenosis with a luminal reduction of ≥50% was assumed if a marked signal reduction or signal loss of a vessel segment was visible. In CAG, 57 of 103 patients showed restenosis. In coronary MRA, 37 of 103 patients demonstrated restenosis. The sensitivity, specificity, positive and negative predictive values were 64.9%, 100%, 100% and 69.6%, respectively. Predictive accuracy was 79.6%. Three-dimensional coronary MRA is useful in a noninvasive diagnostic method to evaluate the coronary

Coronary CT Angiography in the Quantitative Assessment of Coronary Plaques

Directory of Open Access Journals (Sweden)

Zhonghua Sun

2014-01-01

Full Text Available Coronary computed tomography angiography (CCTA has been recently evaluated for its ability to assess coronary plaque characteristics, including plaque composition. Identification of the relationship between plaque composition by CCTA and patient clinical presentations may provide insight into the pathophysiology of coronary artery plaque, thus assisting identification of vulnerable plaques which are associated with the development of acute coronary syndrome. CCTA-generated 3D visualizations allow evaluation of both coronary lesions and lumen changes, which are considered to enhance the diagnostic performance of CCTA. The purpose of this review is to discuss the recent developments that have occurred in the field of CCTA with regard to its diagnostic accuracy in the quantitative assessment of coronary plaques, with a focus on the characterization of plaque components and identification of vulnerable plaques.

Comprehensive characterization of commercially available canine training aids.

Science.gov (United States)

Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

2014-09-01

Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

The anomalous origin of coronary arteries causing sudden death and its clinical significance

International Nuclear Information System (INIS)

Zhu Jiemin; Fan Lijuan; Sun Fengwei; Wu Xuesheng; Ying Yuanning; Dong Zhi; Li Xu

2010-01-01

Objective: To investigate the morbidity of anomalous coronary origin from the opposite coronary sinus, which may cause sudden death of young athletes in Chinese population. And to identify the imaging characteristics of this anomaly and its clinical significance combined with literature review. Methods: The computed tomographic coronary angiography (CTCA) database at TEDA International Cardiovascular Hospital was reviewed. All of the patients diagnosed with isolated anomalous origin of a coronary artery from the opposite sinus of valsalva (anomalous origin of coronary artery, AOCA) and subsequent coursing between the pulmonary artery and the aorta were collected from 14343 Chinese individuals. The location of anomalous coronary origin, the shape and course of the proximal ectopic arterial segments were identified. The nonatherosclerostic stenotic caliber of the segments and the angle between the ectopic coronary artery and the adjacent aortic wall were assessed. Results: Seventy-four patients of AOCA (including the left or right single coronary artery) were diagnosed using CTCA. Among the 74 cases, the potentially serious course of the ectopic coronary artery between the pulmonary artery and the aorta were identified in 59 individuals. Fifty-six cases of ectopic right coronary with interarterial course (anomalous origin of right coronary artery, AORCA) and three patients with anomalous origin of the left coronary artery (AOLCA) were found, including two cases judged as potentially serious origin of either single left coronary artery (n=1) or single right coronary artery (n=1). The morbidity of the potentially serious anomalous origin of coronary artery in Chinese population was established as 4.1% (59/14343). In the subgroup of AORCA, the lumen of initial ectopic segment was frequently compressed and stenotic. In 29 cases (52.7%) the stenosis of the lumen were more than 50%, and in 3 cases (5.4%) the stenosis of the ectopic coronary artery were more than 70%. The

Detection of coronary calcification in ultrafast CT compared to coronary angiography

International Nuclear Information System (INIS)

Koesling, S.; Hoffmann, U.; Rother, T.; Lieberenz, S.; Heywang-Koebrunner, S.H.; Schulz, H.G.

1994-01-01

The angiographical findings of 24 patients with coronary artery disease were compared with qualitative and quantitative detection of coronary calcification by ultrafast CT. Doubts concerning the capabilities of the ultrafast CT for a screening of coronary artery disease arise when the results of one third false positive and fase negative findings are considered. Variations in the quantification of coronary calcification were too great to allow a realistic assessment of the degree of stenosis of the coronary arteries. (orig.) [de

Genetic characterization of type 2a canine parvoviruses from Taiwan reveals the emergence of an Ile324 mutation in VP2

Science.gov (United States)

2014-01-01

Background Canine parvovirus 2 (CPV 2) is a major infectious cause of mortality in puppies. The characteristic symptom of CPV 2 disease is intestinal hemorrhage with severe bloody diarrhea. Soon after CPV was first recognized in the late 1970s, the original virus, CPV 2, was replaced in the canine population by strains carrying minor antigenic variants (termed 2a, 2b, and 2c) of the VP2 gene that could be distinguished using monoclonal antibodies and molecular analyses. Here, we provide an updated molecular characterization of the CPV 2 circulating in Taiwan. Methods In this study, 28 isolates of CPV 2 from 144 dogs with suspected CPV infection were obtained from northern, central, and southern Taiwan from 2008 to 2012 and screened by PCR. The 28 isolates were sequenced, and a phylogenetic analysis of the VP2 gene was performed. Results Of the 28 Taiwanese CPV 2 isolates, 15 were identified as new CPV 2a, and 13 were identified as new CPV 2b. Compared to the reference CPV 2a, all 15 of the CPV 2a sequences collected in this study contain an Ile324 mutation caused by a TAT to ATT mutation at nucleotides 970–972 of the VP2 gene. Conclusion Our VP2 sequence data revealed that both types are currently prevalent CPV 2 field strains circulating in Taiwan, and a unique Ile324 VP2 mutation was found in our Taiwanese CPV 2a isolates and recent Asian isolates. CPV 2c was not observed in this study. PMID:24568207

Venous coronary artery bypass surgery. A 15-year follow-up study

NARCIS (Netherlands)

van Brussel, B. L.; Plokker, H. W.; Ernst, S. M.; Ernst, N. M.; Knaepen, P. J.; Koomen, E. M.; Tijssen, J. G.; Vermeulen, F. E.; Voors, A. A.

1993-01-01

BACKGROUND: Although the long-term results of isolated venous coronary artery bypass surgery are well known, there are few multivariate statistical data on such patient groups. METHODS AND RESULTS: We report on 428 consecutive patients, 383 men and 45 women with a mean age of 52.6 years, who

The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

Science.gov (United States)

Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

2015-07-01

The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

OpenAIRE

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

Evaluation of post-vaccination immunity to canine distemper and ...

African Journals Online (AJOL)

SERVER

2007-08-20

Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

Relationship between regional myocardial blood flow and thallium-201 distribution in the presence of coronary artery stenosis and dipyridamole-induced vasodilation

International Nuclear Information System (INIS)

Mays, A.E. Jr.; Cobb, F.R.

1984-01-01

This study assesses the relationship between the distribution of thallium-201 and myocardial blood flow during coronary vasodilation induced by intravenous dipyridamole in canine models of partial and complete coronary artery stenosis. 10 dogs were chronically instrumented with catheters in the left atrium and aorta and with a balloon occluder and electromagnetic flow probe on the proximal left circumflex coronary artery. Regional myocardial blood flow was measured during control conditions with radioisotope-labeled microspheres, and the phasic reactive hyperemic response to a 20-s transient occlusion was then recorded. Dipyridamole was then infused intravenously until phasic coronary blood flow increased to match peak hyperemic values. The left circumflex coronary artery was either partially occluded to reduce phasic blood flow to control values (group 1) or it was completely occluded (group 2), and thallium-201 and a second microsphere label were injected. 5 min later, the animals were sacrificed, the left ventricle was sectioned into 1-2-g samples, and thallium-201 activity and regional myocardial blood flow were measured. Curvilinear regression analyses between thallium-201 localization and myocardial blood flow during dipyridamole infusion demonstrated a slightly better fit to a second- as compared with a first-order model, indicating a slight roll-off of thallium activity as myocardial blood flow increases. During the dipyridamole infusion, the increases in phasic blood flow, the distributions of regional myocardial blood flow, and the relationships between thallium-201 localization and regional blood flow were comparable to values previously observed in exercising dogs with similar occlusions. These data provide basic validation that supports the use of intravenous dipyridamole and thallium-201 as an alternative to exercise stress and thallium-201 for evaluating the effects of coronary occlusive lesions on the distribution of regional myocardial blood flow

Canine as a biomedical research model: immunological, hematological, and oncological aspects

International Nuclear Information System (INIS)

Shifrine, M.; Wilson, F.D.

1980-01-01

The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

Science.gov (United States)

Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

2014-06-01

More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

Directory of Open Access Journals (Sweden)

Sophia Pfahler

Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

Off-pump coronary artery bypass surgery in severe left ventricular dysfunction.

Science.gov (United States)

Azarfarin, Rasoul; Pourafkari, Leili; Parvizi, Rezayat; Alizadehasl, Azin; Mahmoodian, Roghaiyeh

2010-02-01

Our aim was to examine hospital outcomes of coronary artery bypass surgery in patients with and without left ventricular dysfunction, with regard to the surgical technique (off- or on-pump). Between March 2007 and March 2008, 689 consecutive patients underwent isolated first-time coronary artery bypass; 127 had ejection fractions fractions >30% (group 2). Data of preoperative risk profiles and hospital outcomes were collected prospectively. Off-pump operations were performed in 49 (38.6%) patients in group 1 and 196 (34.9%) in group 2. The incidences of infectious, neurologic, and cardiac complications postoperatively were significantly higher in group 1. In multivariate analysis, preoperative ejection fraction operations, but no significant difference in mortality was observed between those undergoing off-pump or conventional surgery in either group. Off-pump surgery helped to limit the increased morbidity rate after coronary bypass in patients with ventricular dysfunction.

Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).

Science.gov (United States)

Christiansen, Per

2008-07-01

The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

Canine length in wild male baboons: maturation, aging and social dominance rank.

Directory of Open Access Journals (Sweden)

Jordi Galbany

Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

2012-10-01

The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

IQGAP1 is an oncogenic target in canine melanoma.

Directory of Open Access Journals (Sweden)

Becky H Lee

Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

Expression and function of survivin in canine osteosarcoma.

Science.gov (United States)

Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

2012-01-01

Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

American Canine Hepatozoonosis

Science.gov (United States)

Ewing, S. A.; Panciera, R. J.

2003-01-01

American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

Questing Dermacentor reticulatus harbouring Babesia canis DNA associated with outbreaks of canine babesiosis in the Swiss Midlands.

Science.gov (United States)

Schaarschmidt, Daniel; Gilli, Urs; Gottstein, Bruno; Marreros, Nelson; Kuhnert, Peter; Daeppen, Jérôme A; Rosenberg, Gertrud; Hirt, Didier; Frey, Caroline F

2013-06-01

In 2011 and 2012, outbreaks of clinical canine babesiosis were observed in 2 areas of the Swiss Midlands that had no history of this disease so far. In one area, cases of canine babesiosis occurred over 2 consecutive tick seasons. The outbreaks involved 29 dogs, 4 of which died. All dogs were infected with large Babesia sp. as diagnosed in Giemsa-stained blood smears and/or PCR. These were identified as B. canis (formerly known as B. canis canis) by subsequent partial sequencing of the 18S rRNA gene of Babesia sp. Interestingly, the sequence indicated either a genotype with heterogeneity in the ssrRNA gene copies or double infection with different B. canis isolates. None of the dogs had a recent travel history, but one had frequently travelled to Hungary and had suffered twice from clinical babesiosis 18 and 24 months prior to the outbreak in autumn 2011. Retrospective sequencing of a stored blood DNA sample of this dog revealed B. canis, with an identical sequence to the Babesia involved in the outbreaks. For the first time in Switzerland, the partial 18S rRNA gene of B. canis could be amplified from DNA isolated from 19 out of 23 adult Dermacentor reticulatus ticks flagged in the same area. The sequence was identical to that found in the dogs. Furthermore, one affected dog carried a female D. reticulatus tick harbouring B. canis DNA. Our findings illustrate that, under favourable biogeographic and climatic conditions, the life-cycle of B. canis can relatively rapidly establish itself in previously non-endemic areas. Canine babesiosis should therefore always be a differential diagnosis when dogs with typical clinical signs are presented, regardless of known endemic areas. Copyright © 2013 Elsevier GmbH. All rights reserved.

National clinical guidelines for management of the palatally ectopic maxillary canine.

Science.gov (United States)

Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M

2012-08-01

This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

Science.gov (United States)

Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

2016-07-01

Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

Directory of Open Access Journals (Sweden)

Emily J Shields

Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique

Directory of Open Access Journals (Sweden)

Julieta Zacarias

2016-07-01

Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

Management of an Unusual Ectopic Eruption of Maxillary Canine.

Science.gov (United States)

Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

2017-05-01

Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

Directory of Open Access Journals (Sweden)

M. Ananda Chitra

2015-07-01

Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh

Directory of Open Access Journals (Sweden)

Shalini Sharma

2016-09-01

Full Text Available Aim: The present study was conducted to detect the presence of canine parvovirus (CPV among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. Materials and Methods: A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. Results: No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102 of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610 used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. Conclusion: This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.

First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.

Science.gov (United States)

Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep

2016-09-01

The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.

Cardiac involvement in canine babesiosis : review article

Directory of Open Access Journals (Sweden)

R.G. Lobetti

2005-06-01

Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

Frequency, antimicrobial susceptibility and clonal distribution of methicillin-resistant Staphylococcus pseudintermedius in canine clinical samples submitted to a veterinary diagnostic laboratory in Italy: A 3-year retrospective investigation

DEFF Research Database (Denmark)

Ventrella, G.; Moodley, A.; Grandolfo, E.

2017-01-01

In the last decade there has been a rapid global spread of methicillin-resistant Staphylococcus pseudintermedius (MRSP) clones displaying multidrug resistance in dogs. We investigated prevalence, antimicrobial susceptibility and clonal distribution of MRSP isolated from clinical canine samples be...

Management of an impacted and transposed maxillary canine

Directory of Open Access Journals (Sweden)

Deepti A

2010-03-01

Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

Inversion prepared coronary MR angiography: direct visualization of coronary blood flow

International Nuclear Information System (INIS)

Katoh, M.; Spuentrup, E.; Buecker, A.; Guenther, R.W.; Stuber, M.; Manning, W.J.; Botnar, R.M.

2005-01-01

Purpose: visualization of coronary blood flow by means of a slice-selective inversion pre-pulse in concert with bright-blood coronary MRA. Materials and methods: coronary magnetic resonance angiography (MRA) of the right coronary artery (RCA) was performed in eight healthy adult subjects on a 1.5 Tesla MR system (Gyroscan ACS-NT, Philips Medical Systems, Best, NL) using a free-breathing navigator-gated and cardiac-triggered 3D steady-state free-precession (SSFP) sequence with radial k-space sampling. Imaging was performed with and without a slice-selective inversion pre-pulse, which was positioned along the main axis of the coronary artery but perpendicular to the imaging volume. Objective image quality parameters such as SNR, CNR, maximal visible vessel length, and vessel border definition were analyzed. Results: in contrast to conventional bright-blood 3D coronary MRA, the selective inversion pre-pulse provided a direct measure of coronary blood flow. In addition, CNR between the RCA and right ventricular blood pool was increased and the vessels had a tendency towards better delineation. Blood SNR and CNR between right coronary blood and epicardial fat were comparable in both sequences. (orig.)

Aspects and clinical procedures of eruptive changes of permanent upper canines

Directory of Open Access Journals (Sweden)

Sheila Marcia Francisco

2012-04-01

Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

Establishment and characterization of canine parvovirus-specific murine CD4+ T cell clones and their use for the delineation of T cell epitopes.

NARCIS (Netherlands)

G.F. Rimmelzwaan (Guus); R.W.J. van der Heijden (Roger); E.J. Tijhaar (Edwin); M.C.M. Poelen (Martien); J. Carlson; A.D.M.E. Osterhaus (Albert); F.G.C.M. Uytdehaag (Fons)

1990-01-01

textabstractCanine parvovirus (CPV)-specific T cell clones were generated by culturing lymph node cells from CPV-immunized BALB/c mice at limiting dilutions in the presence of CPV antigen and interleukin-2 (IL-2). All isolated T cell clones exhibited the cell surface phenotype Thy1+, CD4+, CD8- and

Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

International Nuclear Information System (INIS)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-01-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.

Science.gov (United States)

Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul

2017-02-01

The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Canine detection of free-ranging brown treesnakes on Guam

Science.gov (United States)

Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.

2011-01-01

We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

Cryopreservation of microencapsulated canine sperm.

Science.gov (United States)

Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

2011-03-01

The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

Prevalence and zoonotic potential of canine hookworms in Malaysia

Directory of Open Access Journals (Sweden)

Mahdy Mohammed AK

2012-05-01

Full Text Available Abstract Background Canine hookworm infection is endemic in Southeast Asian countries with a prevalence ranging from 70% to 100%, with zoonotic transmission representing a potentially significant public health concern. However, there are limited data available on the prevalence of canine hookworms in Malaysia. This study was conducted to determine the prevalence of hookworm and Ancylostoma species among dogs in Malaysia. Methods Faecal samples were collected from 221 dogs living in urban areas, rural areas and animal shelters in Selangor. Faecal samples were processed using the formal-ether concentration technique followed by wet mount preparation and iodine staining for the detection of hookworm eggs. Samples positive for hookworm eggs were examined using PCR, targeting ITS2 and 28 s rRNA region, and subsequently sequenced in both directions. The sequences were phylogenetically analysed using MrBayes for Bayesian Inference. Results The overall prevalence of hookworm among dogs was 48% (95%CI; 41.41–54.95. Rural stray dogs had the highest prevalence 71.4% (95%CI; 61.13–81.49 followed by urban stray dogs, recording 48% (95%CI; 34.15–61.85 and lastly dogs in shelters with 28.7% (95%CI; 19.56–37.84. Logistic regression identified rural stray dogs as a high risk group (OR = 4.55, 95%; 2.50–8.31 and keeping dogs in shelters as a protective factor (OR = 0.24, 95%; 0.14–0.43. Molecular methods identified both Ancylostoma ceylanicum and Ancylostoma caninum with A. ceylanicum being predominant among urban stray dogs. Rural dogs had a higher prevalence of A. caninum than A. ceylanicum, while both species showed equal distribution among dogs in shelters. Phylogenetic analysis placed A. ceylanicum isolated from dogs in one group with A. ceylanicum human isolates. Conclusion This study indicates that dogs have the potential to act as reservoir hosts of human hookworm infection in Malaysia. This finding necessitates the inclusion of dogs

Ascorbic acid: Nonradioactive extracellular space marker in canine heart

International Nuclear Information System (INIS)

Reil, G.H.; Frombach, R.; Kownatzki, R.; Quante, W.; Lichtlen, P.R.

1987-01-01

The distribution pattern of ascorbic acid and L-[ 14 C]ascorbic acid in myocardial tissue was compared with those of the classical radioactive extracellular space markers [ 3 H]-inulin, [ 3 H]sucrose, and Na 82 Br. A new polarographic techniques was developed for analogue registration of ascorbic acid concentration in coronary venous blood. The kinetic data of the markers were studied in an open-chest canine heart preparation during a constant tracer infusion of up to 9 min. Distribution volumes were calculated based on the mean transit time method of Zierler. The distribution volume of ascorbic acid as well as of L-[ 14 C]ascorbic acid in myocardial tissue agreed closely with those of [ 3 H]inulin and [ 3 H]sucrose as well as 82 Br. The obtained kinetic data confirmed that ascorbic acid exhibits the physicochemical properties of an extracellular space marker, though this compound was shown to leak slowly into myocardial cells. Favorable attributes of this indicator are its low molecular weight, high diffusibility in interstitial fluid, low binding affinity to macromolecules, and high transcapillary as well as low transplasmalemmal penetration rate. Therefore, this nonradioactive marker can be applied in a safe and simple fashion, and without untoward side effects in experimental animals as well as in patients

Coronary artery bypass grafting-related bleeding complications in patients treated with dual antiplatelet treatment.

NARCIS (Netherlands)

Tomsic, A.; Schotborgh, M.A.; Manshanden, J.S.; Li, W.W.L.; Mol, B.A. de

2016-01-01

OBJECTIVES: To evaluate the relationship between the timing of either ticagrelor or clopidogrel discontinuation and bleeding-related complications in patients undergoing isolated on-pump coronary artery bypass grafting (CABG). METHODS: Between January 2012 and December 2014, 705 consecutive patients

Emergence of canine distemper virus strains with modified molecular signature and enhanced neuronal tropism leading to high mortality in wild carnivores.

Science.gov (United States)

Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P

2012-11-01

An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.

Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

Directory of Open Access Journals (Sweden)

Radha Katiyar

2013-01-01

Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

Diagnosing coronary artery disease after a positive coronary computed tomography angiography

DEFF Research Database (Denmark)

Nissen, L; Winther, S; Westra, J

2018-01-01

Aims: Perfusion scans after coronary computed tomography angiography (CCTA) in patients with suspected coronary artery disease (CAD) may reduce unnecessary invasive coronary angiographies (ICAs). However, the diagnostic accuracy of perfusion scans after primary CCTA is unknown. The aim...

Non-obstructive coronary artery disease assessed by coronary computed tomography angiography

DEFF Research Database (Denmark)

Nielsen, L.; Bøtker, H. E.; Sorensen, H.

2015-01-01

Introduction: Coronary CT angiography (CTA) detects non-obstructive coronary artery disease (CAD) that may not be recognized by functional testing, but the prognostic impact is not well understood. This study aimed to compare the risk of myocardial infarction (MI) and all-cause mortality...... in patients without or with non-obstructive and obstructive CAD assessed by coronary CTA. Methods: Consecutive patients without known coronary artery disease (CAD) and with chest pain who underwent coronary CTA (>64-detector row) between January 2007 and December 2012 in the 10 centers participating...... in the Western Denmark Cardiac Computed Tomography Registry were included. The endpoints were 3-year MI or all-cause mortality. The coronary CTA result was defined as normal (0% luminal stenosis), non-obstructive CAD (1%-49% luminal stenosis) or obstructive CAD (>50% luminal stenosis; 1-vessel, 2-vessel, or 3...

Fatal canine distemper virus infection of giant pandas in China

Science.gov (United States)

Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

2016-01-01

We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

High prevalence of small Babesia species in canines of Kerala, South India.

Science.gov (United States)

Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil

2017-11-01

Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni , in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni . Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni . Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni , Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

High prevalence of small Babesia species in canines of Kerala, South India

Directory of Open Access Journals (Sweden)

Kollannur Jose Jain

2017-11-01

Full Text Available Aim: Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni, in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. Materials and Methods: A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni. Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. Results: A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/ BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni, Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. Conclusion: A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.

Coronary hemodynamics in vasospastic angina

International Nuclear Information System (INIS)

Matsumura, Kentaro; Kubota, Shinobu; Serizawa, Takashi; Nakase, Emiko; Kawai, Ichiro; Saito, Takayuki

1991-01-01

To evaluate the coronary circulation and myocardial perfusion dynamics, we performed left coronary digital subtraction angiography (DSA) in 35 patients with vasospastic angina. The left coronary circulation time (CCT) measured from the proximal left coronary artery to the coronary sinus was 5.77±0.86 sec, and the left epicardial conducting artery transmission time (CAT) measured from the proximal left coronary artery to the apical area was 2.65±0.82 sec in normal controls. The CCT and CAT were significantly prolonged in patients with vasospastic angina, indicating that the coronary peripheral vascular resistance is probably greater after the cessation of nitrates and Ca ++ -antagonists. After the intracoronary injection of ergonovine malate, the CCT was slightly shortened, but the apical T 1/2 was significantly prolonged in patients with vasospastic angina. This suggested that coronary vasospasm is present not only in the epicardial arteries but also in coronary arteries with peripheral resistance. These phenomena were not observed in normal controls. We performed left coronary DSA after conventional left coronary cineangiography. When the CCT exceeded 6.7 sec, we considered that the coronary circulation was significantly impaired. We concluded that the coronary DSA is very useful for evaluating abnormal coronary circulation in patients with vasospastic angina during myocardial perfusion. (author)

FLT3 mutations in canine acute lymphocytic leukemia

International Nuclear Information System (INIS)

Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

2011-01-01

FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

Canine hip dysplasia: significance of early bony spurring

International Nuclear Information System (INIS)

Morgan, J.P.

1987-01-01

It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

DEFF Research Database (Denmark)

Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul

2008-01-01

dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

Directory of Open Access Journals (Sweden)

Da-Wei Yao

2014-06-01

Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

Directory of Open Access Journals (Sweden)

MarkéŽta Vaňkov‡á

2016-01-01

Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

Directory of Open Access Journals (Sweden)

Sumitra

2012-01-01

Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

Development and characterization of neutralizing monoclonal antibodies against canine distemper virus hemagglutinin protein.

Science.gov (United States)

Bi, Zhenwei; Xia, Xingxia; Wang, Yongshan; Mei, Yongjie

2015-04-01

Canine distemper virus (CDV) causes a serious multisystemic disease in dogs and other carnivora. Hemagglutinin (H) protein-specific antibodies are mainly responsible for protective immunity against CDV infection. In the present study, six neutralizing MAbs to the H protein of CDV were newly obtained and characterized by immunizing BALB/c mice with a recent Chinese field isolate. Competitive binding inhibition assay revealed that they recognized four distinct antigenic regions of the H protein. Immunofluorescence assay and western blotting showed that all MAbs recognize the conformational rather than the linear epitopes of the H protein. Furthermore, in immunofluorescence and virus neutralization assays, two of the MAbs were found to react only with the recent Chinese field isolate and not with older CDV strains, including vaccine strain Onderstepoort, indicating there are neutralization-related antigenic variations between the recent Chinese field isolate and the older CDV strains examined in this study. The newly established MAbs are useful for differentiating the expanding CDV strains and could be used in immunotherapy and immunodiagnosis against infection with CDV. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

The first reported case of canine subcutaneous Cryptococcus flavescens infection.

Science.gov (United States)

Kano, Rui; Ishida, Rinei; Nakane, Shinsuke; Sekiguchi, Maiko; Hasegawa, Atsuhiko; Kamata, Hiroshi

2012-03-01

This report describes the first documented case of subcutaneous infection due to Cryptococcus flavescens in a dog. The chief symptoms of the patient dog were abscessed lesions on the dorsal muzzle, right eyelid, and lower jaw. Biopsy specimens from the lesions on the dorsal muzzle and lower jaw showed pyogranulomatous inflammation with numerous yeast cells. The patient dog was diagnosed with a subcutaneous fungal infection and orally received 5 mg/kg itraconazole once a day for 2 months, the abscesses disappeared. After 1 month at the end of treatment, the skin lesions did not redevelop. Isolates from the biopsy specimens were identified as C. flavescens by molecular analysis as well as morphologic and biochemical examination, indicating that C. flavescens is a potential canine pathogen.

Isolation and sequence analysis of the complete NS1 and VP2 genes of canine parvovirus from domestic dogs in 2013 and 2014 in China.

Science.gov (United States)

Wang, Hualei; Jin, Hongli; Li, Qian; Zhao, Guoxing; Cheng, Nan; Feng, Na; Zheng, Xuexing; Wang, Jianzhong; Zhao, Yongkun; Li, Ling; Cao, Zengguo; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu

2016-02-01

Canine parvovirus (CPV) can cause severe disease in animals and continuously generates new variant and recombinant strains in dogs that have a strong impact on sanitation. It is therefore necessary to investigate epidemic CPV strains to improve our understanding of CPV transmission and epidemic behavior. However, most studies have focused on the analysis of VP2, and therefore, information about recombination and relationships between strains is still lacking. Here, 14 strains of CPV were isolated from domestic dogs suspected of hosting CPV between 2013 and 2014 in China. The complete NS1 and VP2 genes were sequenced and analyzed. The results suggest that the new CPV-2a and new CPV-2b types are the prevalent strains in China. In addition to a few mutations (residues 19, 544, 545, 572 and 583 of NS1 and residues 267, 370, 377 and 440 of VP2) that were preserved during transmission, new mutations (residues 60, 630 of NS1, and residues 21, 310 of VP2) were found in the isolated strains. A phylogenetic tree based on VP2 sequences illustrated that the new CPV-2a and new CPV-2b strains from China form single clusters that are distinct from lineages from other countries. Moreover, recombination between the new CPV-2a and new CPV-2b types was also identified in the isolated strains. Due to differences in selection pressures or recombination, there were a small number of inconsistencies between the phylogenetic trees for VP2 and NS1, which indicated that phylogenetic relationships based on VP2 might not be representative of those based on NS1. The data indicated that mutations and recombination are constantly occurring along with the spread of CPV in China.

Prostate histotripsy for BPH: initial canine results

Science.gov (United States)

Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

2009-02-01

Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

Difficulties in estimating the human burden of canine rabies.

Science.gov (United States)

Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

2017-01-01

Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Survival results of postoperative coronary angiogram for treatment of perioperative myocardial ischaemia following coronary artery bypass grafting: a single-centre experience.

Science.gov (United States)

Preußer, Maximilian J; Landwehrt, Jan; Mastrobuoni, Stefano; Biancari, Fausto; Dakkak, Abdul R; Alshakaki, Mosab; Martens, Sven; Dell'Aquila, Angelo M

2018-02-01

Although perioperative myocardial ischaemia (PMI) is a well-known complication following coronary artery bypass grafting (CABG), standard strategies for its diagnosis and treatment are so far not defined. In this study, we sought to evaluate the impact on survival of postoperative coronary angiogram for management of patients with PMI after CABG. Overall, 4028 patients underwent isolated CABG in a single-centre institution between January 2006 and September 2013. A total of 168 (4.2%) patients received postoperative coronary angiogram because of diagnosis of PMI. These patients were matched on the basis of gender, age at surgery and date of surgery, with 336 (1:2 ratio) CABG patients without PMI to determine the impact of the PMI management. A total of 476 grafts were examined (263 venous grafts, 196 internal mammary artery grafts and 17 radial artery grafts). Almost three-quarters of the 168 PMI (74.4%) patients underwent postoperative coronary angiogram within 24 h of surgery. Normal postoperative coronary angiogram, graft failure and new native vessels occlusion were observed in 23.2%, 52.4% and 24.4% of patients, respectively. A total of 30 (17.9%) patients underwent surgical revision of grafts, whereas 60 (35.7%) patients were treated with percutaneous coronary intervention. Eighteen (10.7%) PMI patients died during the hospital stay compared with 6 (1.8%) patients in the non-PMI group. Survival rates at 7 years were 62.5% in the PMI group and 81.1% in non-PMI group (P PMI (P 24 h after surgery) was an independent predictor of poorer mid-term survival (P = 0.008; hazard ratio 3.62, 95% confidence interval 1.41-9.33). PMI after CABG is associated with a significantly poorer survival. A prompt postoperative management must always be considered. Further prospective studies are required to confirm our results. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights

Early results of coronary artery bypass grafting with coronary endarterectomy for severe coronary artery disease

Directory of Open Access Journals (Sweden)

Toischer Karl

2009-09-01

Full Text Available Abstract Background Despite the existence of controversial debates on the efficiency of coronary endarterectomy (CE, it is still used as an adjunct to coronary artery bypass grafting (CABG. This is particularly true in patients with endstage coronary artery disease. Given the improvements in cardiac surgery and postoperative care, as well as the rising number of elderly patient with numerous co-morbidities, re-evaluating the pros and cons of this technique is needed. Methods Patient demographic information, operative details and outcome data of 104 patients with diffuse calcified coronary artery disease were retrospectively analyzed with respect to functional capacity (NYHA, angina pectoris (CCS and mortality. Actuarial survival was reported using a Kaplan-Meyer analysis. Results Between August 2001 and March 2005, 104 patients underwent coronary artery bypass grafting (CABG with adjunctive coronary endarterectomy (CE in the Department of Thoracic-, Cardiac- and Vascular Surgery, University of Goettingen. Four patients were lost during follow-up. Data were gained from 88 male and 12 female patients; mean age was 65.5 ± 9 years. A total of 396 vessels were bypassed (4 ± 0.9 vessels per patient. In 98% left internal thoracic artery (LITA was used as arterial bypass graft and a total of 114 vessels were endarterectomized. CE was performed on right coronary artery (RCA (n = 55, on left anterior descending artery (LAD (n = 52 and circumflex artery (RCX (n = 7. Ninety-five patients suffered from 3-vessel-disease, 3 from 2-vessel- and 2 from 1-vessel-disease. Closed technique was used in 18%, open technique in 79% and in 3% a combination of both. The most frequent endarterectomized localization was right coronary artery (RCA = 55%. Despite the severity of endstage atherosclerosis, hospital mortality was only 5% (n = 5. During follow-up (24.5 ± 13.4 months, which is 96% complete (4 patients were lost caused by unknown address 8 patients died (cardiac

Target vessel detection by epicardial ultrasound in off-pump coronary bypass surgery.

Science.gov (United States)

Hayakawa, Masato; Asai, Tohru; Kinoshita, Takeshi; Suzuki, Tomoaki; Shiraishi, Shoichiro

2013-01-01

The detection of embedded coronary arteries is difficult especially in off-pump coronary bypass surgery. From June 2010, we introduced high-frequency epicardial ultrasound (ECUS) to assess and evaluate embedded arteries during off-pump coronary bypass surgery. Between June 2010 and June 2011, a total of 89 consecutive patients underwent isolated coronary bypass surgery at our institution. The patients consisted of 72 men and 17 women with a mean age of 67.9 years. We routinely use the VeriQC system (MediStim, Oslo, Norway) to detect the target vessels in the operation. The patients were assigned to one of two groups, depending on whether ECUS was used in the operation (n = 10, ECUS group) or not (n = 79, non-ECUS group). We analyzed the impact of introducing the ECUS in terms of operative outcome. All patients underwent revascularization using the off-pump technique without emergent conversion to cardiopulmonary bypass during surgery. The total number of distal anastomoses was 299, and 12 target vessels could not be identified either visually or on palpation. Thus, the frequency of the embedded coronary arteries was 4.01% (12/299 cases). The preoperative profiles of the two groups were not significantly different. Operation time was significantly longer in the ECUS group (P = 0.02). There were no significant differences in postoperative outcome between the two groups. In the present study, in which the target coronary arteries could not be detected either visually or on palpation in 12 (4.01%) of 299 cases, the use of high-frequency ECUS allowed all patients to undergo off-pump coronary bypass surgery without conversion to cardiopulmonary bypass during the operation. High-frequency ECUS is therefore useful in off-pump coronary bypass surgery.

Impact of gender on outcome after coronary artery bypass surgery.

Science.gov (United States)

Ennker, Ina C; Albert, Alexander; Pietrowski, Detlef; Bauer, Kerstin; Ennker, Juergen; Florath, Ines

2009-06-01

Following recent studies concerning the increased risk of coronary artery bypass surgery for women, the impact of sex is still a controversial issue. Between 1996 and 2006, 9,527 men and 3,079 women underwent isolated coronary artery bypass in our institute. To adjust for dissimilarities in preoperative risk profiles, propensity score-based matching was applied. Before adjustment, clinical outcomes in terms of operative mortality, arrhythmias, intensive care unit stay, and maximum creatine kinase-MB levels were significantly different for men and women. After balancing the preoperative characteristics, including height, no significant differences in clinical outcomes were observed. However, there was decreased use of internal mammary artery, less total arterial revascularization, and increasing creatine kinase-MB levels with decreasing height. This study supports the theory that female sex per se does not increase operative risk, but shorter height, which is more common in women, affects the outcome, probably due to technical difficulties in shorter patients with smaller internal mammary arteries and coronary vessels. Thus women may especially benefit from sequential arterial grafting.

Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

Energy Technology Data Exchange (ETDEWEB)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-10-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

Science.gov (United States)

Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

2012-07-10

It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Pomegranate Extract Enhances Endothelium-Dependent Coronary Relaxation in Isolated Perfused Hearts from Spontaneously Hypertensive Ovariectomized Rats

Science.gov (United States)

Delgado, Nathalie T. B.; Rouver, Wender do N.; Freitas-Lima, Leandro C.; de Paula, Tiago D.-C.; Duarte, Andressa; Silva, Josiane F.; Lemos, Virgínia S.; Santos, Alexandre M. C.; Mauad, Helder; Santos, Roger L.; Moysés, Margareth R.

2017-01-01

Decline in estrogen levels promotes endothelial dysfunction and, consequently, the most prevalent cardiovascular diseases in menopausal women. The use of natural therapies such as pomegranate can change these results. Pomegranate [Punica granatum L. (Punicaceae)] is widely used as a phytotherapeutic agent worldwide, including in Brazil. We hypothesized that treatment with pomegranate hydroalcoholic extract (PHE) would improve coronary vascular reactivity and cardiovascular parameters. At the beginning of treatment, spontaneously hypertensive female rats were divided into Sham and ovariectomized (OVX) groups, which received pomegranate extract (PHE) (250 mg/kg) or filtered water (V) for 30 days by gavage. Systolic blood pressure was measured by tail plethysmography. After euthanasia, the heart was removed and coronary vascular reactivity was assessed by Langendorff retrograde perfusion technique. A dose-response curve for bradykinin was performed, followed by L-NAME inhibition. The protein expression of p-eNOS Ser1177, p-eNOS Thr495, total eNOS, p-AKT Ser473, total AKT, SOD-2, and catalase was quantified by Western blotting. The detection of coronary superoxide was performed using the protocol of dihydroethidium (DHE) staining Plasma nitrite measurement was analyzed by Griess method. Systolic blood pressure increased in both Sham-V and OVX-V groups, whereas it was reduced after treatment in Sham-PHE and OVX-PHE groups. The baseline coronary perfusion pressure was reduced in the Sham-PHE group. The relaxation was significantly higher in the treated group, and L-NAME attenuated the relaxation in all groups. The treatment has not changed p-eNOS (Ser1177), total eNOS, p-AKT (Ser473) and total AKT in any groups. However, in Sham and OVX group the treatment reduced the p-eNOS (Thr495) and SOD-2. The ovariectomy promoted an increasing in the superoxide anion levels and the treatment was able to prevent this elevation and reducing oxidative stress. Moreover, the treatment

Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

Science.gov (United States)

Glickman, L T; Appel, M J

1981-08-01

Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

Current practices and research updates on diabetes mellitus in canine

Directory of Open Access Journals (Sweden)

Pankaj Kumar

2014-11-01

Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

Eruption of the maxillary canines in relation to skeletal maturity.

Science.gov (United States)

Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

2008-05-01

Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

[Comparison of 64 MDCT coronary CTA and coronary angiography in the detection of coronary artery stenosis in low risk patients with stable angina and acute coronary syndrome].

Science.gov (United States)

Cazalas, G; Sarran, A; Amabile, N; Chaumoitre, K; Marciano-Chagnaud, S; Jacquier, A; Paganelli, F; Panuel, M

2009-09-01

To determine the accuracy of 64 MDCT coronary CTA (CCTA) compared to coronary angiography in low risk patients with stable angina and acute coronary syndrome and determine the number of significant coronary artery stenoses ( 50%) in these patients. Materials and methods. Fifty-five patients underwent CCTA using a 32 MDCT unit with z flying focus allowing the acquisition of 64 slices of 0.6 mm thickness as well as coronary angiography (gold standard). Nine patients were excluded due to prior coronary artery bypass surgery (n=4), insufficient breath hold (n=3), calcium scoring>1000 (n=1) and delay between both examinations over 4 months (n=1). Forty-six patients: 27 males and 19 females were included. CCTA results were compared to coronary angiography per segment and artery with threshold detection of stenoses 50%. The degree of correlation between both examinations was performed using a regression analysis with a Pearson correlation coefficient<0.05 considered significant. The overall accuracy of CCTA was 90%; limitations related to the presence of calcifications, motion artifacts or insufficient vessel opacification. The correlation for all analyzed segments was 96.4%. Thirty-eight of 50 significant stenoses seen on coronary angiography were correctly detected on CCTA. Sensitivity, specificity, PPVC and NPV for detection of stenoses 50% were 76%, 98.3%, 80.3% and 97.7% respectively. Evaluation per segment had a NPV of 96.8% (interventricular and diagonal segments) to 100% (main trunk). Our results for specificity and NPV are similar to reports from the literature. This suggests that CCTA in this clinical setting may replace coronary angiography.

Citizen science: a new direction in canine behavior research.

Science.gov (United States)

Hecht, Julie; Spicer Rice, Eleanor

2015-01-01

Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

Factors influencing delay time and coronary arterial density during coronary angiography with DSCT.

Science.gov (United States)

Tang, Lijun; Zhu, Xiaomei; Xu, Yi; Yu, Tongfu; Xu, Hai; Tang, Jinhua; Dogra, Vikram; Wang, Dehang

2011-02-01

CT angiography (CTA) plays an important role in diagnosing coronary arterial disease. Delay time and density of the coronary arteries related with patient-specific factors are essential for getting an optimal CTA image. To investigate various factors influencing delay time and coronary arterial density during coronary CTA with dual source CT. One hundred and sixteen consecutive subjects who underwent cardiac DSCT with retrospective ECG-gating were included. Factors including gender, age, height, weight, transversal cardiac diameter (TCD), transversal thoracic diameter (TTD), heart rate (HR), body surface area (BSA = [weight × height/3600](1/2)) and cardiothoracic ratio (CTR = TCD/TTD) were recorded, measured and calculated before administration of contrast media during coronary CT angiography. Delay time was determined as duration from the beginning of the injection to the density in the descending aorta at the level of right main pulmonary artery reaching a threshold of 100 HU. Coronary arterial density was measured at the mid portion of the right coronary artery. Regression analysis and stepwise regression analysis were used to investigate the influence of these factors on delay time and coronary arterial density. Delay time decreased with an increasing HR and it was shorter in women than men. Delay time increased with an increasing TCD. Delay time could be predicted by the formula: DT = 16.651-0.110 × HR + 1.902 × gender + 0.394 × TCD (where DT is abbreviation for delay time, gender is 0 for women and 1 for men). Coronary arterial density decreased with an increasing HR and weight. Coronary arterial density could be predicted by the formula: CAD = 923.42-4.099 × HR-3.293 × weight (CAD = coronary arterial density). There was no relationship between the other factors mentioned above and delay time or coronary arterial density. Delay time is influenced by HR, gender and TCD. Coronary arterial density also changes with HR and weight. So HR, gender, TCD and

Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

Science.gov (United States)

Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

2015-11-01

Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

Science.gov (United States)

Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

2016-08-02

In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

Science.gov (United States)

Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

2018-04-01

Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

Myocardial flow reserve is influenced by both coronary artery stenosis severity and coronary risk factors in patients with suspected coronary artery disease

International Nuclear Information System (INIS)

Tsukamoto, Takahiro; Naya, Masanao; Tsutsui, Hiroyuki; Morita, Koichi; Katoh, Chietsugu; Inubushi, Masayuki; Kuge, Yuji; Tamaki, Nagara

2006-01-01

Myocardial flow reserve (MFR) measurement has an important role in assessing the functional severity of coronary artery stenosis. However, a discrepancy between the anatomical severity of coronary artery stenosis and MFR is often observed. Such a discrepancy may be explained by coronary risk factors. In this study, we aimed to investigate the influence of coronary artery stenosis severity and risk factors on MFR. Seventy-four patients suspected to have coronary artery disease and seven age-matched healthy volunteers were enrolled. Myocardial blood flow (MBF) and MFR were measured using 15 O-labelled water PET. Regional MFR was calculated in regions with significant coronary artery stenosis (stenotic regions) and in regions without significant stenosis (remote regions). The contributions of coronary artery stenosis severity and coronary risk factors were assessed using univariate and multivariate analyses. In stenotic regions, MFR correlated inversely with coronary artery stenosis severity (r=-0.50, p<0.01). Univariate analysis did not show any significant difference in MFR between the patients with and the patients without each risk factor. In remote regions, however, MFR was significantly decreased in the diabetes and smoking groups (each p<0.05). By multivariate analysis, diabetes and smoking were independent predictors of MFR (each p<0.05). In the group with more than one risk factor, MFR was significantly lower (2.78±0.79) than in the other group (3.40±1.22, p<0.05). MFR is influenced not only by coronary stenosis severity but also by coronary risk factors. In particular, the influence of risk factors should be considered in regions without severe coronary stenosis. (orig.)

Coronary artery aneurysms

Energy Technology Data Exchange (ETDEWEB)

Koischwitz, D.; Harder, T.; Schuppan, U.; Thurn, P.

1982-04-01

Seven saccular coronary artery aneurysms have been demonstrated in the course of 1452 selective coronary artery angiograms. In six patients they were arterio-sclerotic; in one patient the aneurysm must have been congenital or of mycotic-embolic origin. The differential diagnosis between true aneurysms and other causes of vascular dilatation is discussed. Coronary artery aneurysms have a poor prognosis because of the possibility of rupture with resultant cardiac tamponade, or the development of thrombo-embolic myocardial infarction. These aneurysms can only be diagnosed by means of coronary angiography and require appropriate treatment.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

The Comparative Diagnostic Features of Canine and Human Lymphoma

Directory of Open Access Journals (Sweden)

Davis M. Seelig

2016-06-01

Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

The Comparative Diagnostic Features of Canine and Human Lymphoma.

Science.gov (United States)

Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

2016-06-01

The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

Directory of Open Access Journals (Sweden)

Shalini Gupta

2014-01-01

Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

[Nonsurgical endodontic treatment of an invaginated canine].

Science.gov (United States)

Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

1989-01-01

We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

Canine babesiosis: from molecular taxonomy to control

Directory of Open Access Journals (Sweden)

Irwin Peter J

2009-03-01

Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

Genetic characterization of canine influenza A virus (H3N2) in Thailand.

Science.gov (United States)

Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

2014-02-01

In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

Science.gov (United States)

Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

2015-07-01

In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.

Severity of coronary artery disease in obese patients undergoing coronary angiography

International Nuclear Information System (INIS)

Javed, A.; Ali, J.; Kayani, A.M.

2012-01-01

Objective: To assess the relationship of severity of coronary artery disease with obesity in patients undergoing coronary angiography. Design: Cross sectional study. Place and Duration of Study: Armed Forces Institute of Cardiology - National Institute of Heart Diseases (AFIC-NIHD), 1st February 2010 to 31st August 2010 Patients and Methods: The study population included 468 patients undergoing coronary angiography. Obesity was classified according to the BMI using the National Institutes of Health (NIH) criteria as normal (BMI 21-24 kg/m2), overweight (BMI 25-29 kg/m2), obesity class I (BMI 30-34 kg/m2), obesity class II (BMI 35 to 39 kg/m2 and obesity class III (BMI 40 or above kg/m2). Coronary angiography data were obtained from the Siemens Queries software system, which maintains the database including detailed angiographic findings of all patients at this institution. Significant lesions were defined as those with >70% diameter narrowing of coronary arteries (>50% for the left main coronary artery). We attempted to quantify the 'severity of CAD' by ascertaining the prevalence of High-Risk Coronary Anatomy (HRCA). Results: Insignificant difference was observed in traditional risk factors i.e. age, diabetes mellitus and smoking except hypertension and gender. Statistically significantly low prevalence of HRCA was encountered in the obese group (57.7%) as compared to normal/overweight group (75.8%) (p < 0.05). Conclusion: We conclude that obesity is associated with less severe coronary artery disease. (author)

Glucosamine and chondroitin use in canines for osteoarthritis: A ...

African Journals Online (AJOL)

Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis.

Science.gov (United States)

O'Flynn, Ciaran; Deusch, Oliver; Darling, Aaron E; Eisen, Jonathan A; Wallis, Corrin; Davis, Ian J; Harris, Stephen J

2015-11-13

Porphyromonads play an important role in human periodontal disease and recently have been shown to be highly prevalent in canine mouths. Porphyromonas cangingivalis is the most prevalent canine oral bacterial species in both plaque from healthy gingiva and plaque from dogs with early periodontitis. The ability of P. cangingivalis to flourish in the different environmental conditions characterized by these two states suggests a degree of metabolic flexibility. To characterize the genes responsible for this, the genomes of 32 isolates (including 18 newly sequenced and assembled) from 18 Porphyromonad species from dogs, humans, and other mammals were compared. Phylogenetic trees inferred using core genes largely matched previous findings; however, comparative genomic analysis identified several genes and pathways relating to heme synthesis that were present in P. cangingivalis but not in other Porphyromonads. Porphyromonas cangingivalis has a complete protoporphyrin IX synthesis pathway potentially allowing it to synthesize its own heme unlike pathogenic Porphyromonads such as Porphyromonas gingivalis that acquire heme predominantly from blood. Other pathway differences such as the ability to synthesize siroheme and vitamin B12 point to enhanced metabolic flexibility for P. cangingivalis, which may underlie its prevalence in the canine oral cavity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Impact of smoking on early clinical outcomes in patients undergoing coronary artery bypass grafting surgery

OpenAIRE

Ji, Qiang; Zhao, Hang; Mei, YunQing; Shi, YunQing; Ma, RunHua; Ding, WenJun

2015-01-01

Background To evaluate the impact of persistent smoking versus smoking cessation over one month prior to surgery on early clinical outcomes in Chinese patients undergoing isolated coronary artery bypass grafting (CABG) surgery in a retrospective study. Methods The peri-operative data of consecutive well-documented patients undergoing isolated CABG surgery from January 2007 to December 2013 were investigated and retrospectively analyzed. All included patients were divided into either a non-smo...

Coronary Anomaly and Coronary Artery Fistula as Cause of Angina Pectoris with Literature Review

Directory of Open Access Journals (Sweden)

Jayanth Koneru

2011-01-01

Full Text Available Coronary artery fistulas are rare anomalies of the coronary arteries that may sometimes cause symptoms by shunting blood flow away from the myocardial capillary network. We report the case of a 46-year old lady which shows the right coronary cusp giving rise to left main coronary artery called anomalous origin of a coronary artery (AOCA, and also a fistula between the left coronary artery and pulmonary artery. We describe our diagnostic approach and review the literature on the epidemiology, pathophysiology, the diagnostic modalities, and treatment options.

Role of coronary physiology in the contemporary management of coronary artery disease

Science.gov (United States)

Ruparelia, Neil; Kharbanda, Rajesh K

2015-01-01

Coronary artery disease (CAD) remains the leading cause of death worldwide with approximately 1 in 30 patients with stable CAD experiencing death or acute myocardial infarction each year. The presence and extent of resultant myocardial ischaemia has been shown to confer an increased risk of adverse outcomes. Whilst, optimal medical therapy (OMT) forms the cornerstone of the management of patients with stable CAD, a significant number of patients present with ischaemia refractory to OMT. Historically coronary angiography alone has been used to determine coronary lesion severity in both stable and acute settings. It is increasingly clear that this approach fails to accurately identify the haemodynamic significance of lesions; especially those that are visually “intermediate” in severity. Revascularisation based upon angiographic appearances alone may not reduce coronary events above OMT. Technological advances have enabled the measurement of physiological indices including the fractional flow reserve, the index of microcirculatory resistance and the coronary flow reserve. The integration of these parameters into the routine management of patients presenting to the cardiac catheterization laboratory with CAD represents a critical adjunctive tool in the optimal management of these patients by identifying patients that would most benefit from revascularisation and importantly also highlighting patients that would not gain benefit and therefore reducing the likelihood of adverse outcomes associated with coronary revascularisation. Furthermore, these techniques are applicable to a broad range of patients including those with left main stem disease, proximal coronary disease, diabetes mellitus, previous percutaneous coronary intervention and with previous coronary artery bypass grafting. This review will discuss current concepts relevant to coronary physiology assessment, its role in the management of both stable and acute patients and future applications. PMID

Role of coronary physiology in the contemporary management of coronary artery disease.

Science.gov (United States)

Ruparelia, Neil; Kharbanda, Rajesh K

2015-02-16

Coronary artery disease (CAD) remains the leading cause of death worldwide with approximately 1 in 30 patients with stable CAD experiencing death or acute myocardial infarction each year. The presence and extent of resultant myocardial ischaemia has been shown to confer an increased risk of adverse outcomes. Whilst, optimal medical therapy (OMT) forms the cornerstone of the management of patients with stable CAD, a significant number of patients present with ischaemia refractory to OMT. Historically coronary angiography alone has been used to determine coronary lesion severity in both stable and acute settings. It is increasingly clear that this approach fails to accurately identify the haemodynamic significance of lesions; especially those that are visually "intermediate" in severity. Revascularisation based upon angiographic appearances alone may not reduce coronary events above OMT. Technological advances have enabled the measurement of physiological indices including the fractional flow reserve, the index of microcirculatory resistance and the coronary flow reserve. The integration of these parameters into the routine management of patients presenting to the cardiac catheterization laboratory with CAD represents a critical adjunctive tool in the optimal management of these patients by identifying patients that would most benefit from revascularisation and importantly also highlighting patients that would not gain benefit and therefore reducing the likelihood of adverse outcomes associated with coronary revascularisation. Furthermore, these techniques are applicable to a broad range of patients including those with left main stem disease, proximal coronary disease, diabetes mellitus, previous percutaneous coronary intervention and with previous coronary artery bypass grafting. This review will discuss current concepts relevant to coronary physiology assessment, its role in the management of both stable and acute patients and future applications.

A case of unusual root morphology: Maxillary canine with two roots

Directory of Open Access Journals (Sweden)

Nagesh Bolla

2009-01-01

Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

Acute Thrombotic Coronary Occlusion in a Patient with Coronary Artery Anomaly

Directory of Open Access Journals (Sweden)

Beganu Elena

2017-09-01

Full Text Available Patients with coronary artery anomalies are more susceptible to develop acute thrombotic coronary occlusions due to the abnormal anatomy of these arteries and the disturbance of the pathophysiological mechanisms that lead to an accelerated atherosclerosis development. The following article presents the case of a 64-year-old female patient diagnosed with anterior ST-segment elevation myocardial infarction. The patient underwent primary percutaneous coronary intervention, which revealed the absence of the right coronary artery and separated origins of the left anterior descending artery and the left circumflex artery from the aorta.

SEROLOGIC RESPONSE TO CANINE DISTEMPER VACCINATION IN CAPTIVE LINNAEUS'S TWO-TOED SLOTHS ( CHOLOEPUS DIDACTYLUS) AFTER A FATAL CANINE DISTEMPER VIRUS OUTBREAK.

Science.gov (United States)

Sheldon, Julie D; Cushing, Andrew C; Wilkes, Rebecca P; Anis, Eman; Dubovi, Edward J

2017-12-01

Canine distemper virus (CDV) affects many wild and captive, nondomestic species worldwide but has not been previously reported in Xenarthra. Paucity of information on vaccination safety and efficacy presents challenges for disease prevention in captive collections. CDV infections and subsequent mortalities in five captive Linnaeus's two-toed sloths ( Choloepus didactylus) in eastern Tennessee are reported. Clinical signs included oculonasal discharge, oral ulcerations, and diarrhea, and the diagnosis was confirmed by necropsy, histopathology, immunohistochemistry, virus isolation, and polymerase chain reaction. Viral sequencing identified the strain to be consistent with a new CDV lineage currently affecting domestic dogs and wildlife in Tennessee. Seven sloths were examined and vaccinated using a recombinant CDV vaccine on days 0 and 21. Subsequent blood samples showed increased titers in 3/4 sloths. Based on the outbreak and serologic findings postvaccination without adverse effects, the authors recommend recombinant CDV vaccination in sloths exposed to known carriers of CDV.

Factors influencing delay time and coronary arterial density during coronary angiography with DSCT

International Nuclear Information System (INIS)

Lijun Tang; Xiaomei Zhu; Yi Xu; Tongfu Yu; Hai Xu; Jinhua Tang; Dehang Wang; Dogra, Vikram

2011-01-01

Background: CT angiography (CTA) plays an important role in diagnosing coronary arterial disease. Delay time and density of the coronary arteries related with patient-specific factors are essential for getting an optimal CTA image. Purpose: To investigate various factors influencing delay time and coronary arterial density during coronary CTA with dual source CT. Material and Methods: One hundred and sixteen consecutive subjects who underwent cardiac DSCT with retrospective ECG-gating were included. Factors including gender, age, height, weight, transversal cardiac diameter (TCD), transversal thoracic diameter (TTD), heart rate (HR), body surface area (BSA = [weight x height/3600]1/2) and cardiothoracic ratio (CTR = TCD/TTD) were recorded, measured and calculated before administration of contrast media during coronary CT angiography. Delay time was determined as duration from the beginning of the injection to the density in the descending aorta at the level of right main pulmonary artery reaching a threshold of 100 HU. Coronary arterial density was measured at the mid portion of the right coronary artery. Regression analysis and stepwise regression analysis were used to investigate the influence of these factors on delay time and coronary arterial density. Results: Delay time decreased with an increasing HR and it was shorter in women than men. Delay time increased with an increasing TCD. Delay time could be predicted by the formula: DT = 16.651-0.110 x HR + 1.902 x gender + 0.394 x TCD (where DT is abbreviation for delay time, gender is 0 for women and 1 for men). Coronary arterial density decreased with an increasing HR and weight. Coronary arterial density could be predicted by the formula: CAD = 923.42-4.099 x HR-3.293 x weight (CAD = coronary arterial density). There was no relationship between the other factors mentioned above and delay time or coronary arterial density. Conclusion: Delay time is influenced by HR, gender and TCD. Coronary arterial density

[Genetic variation analysis of canine parvovirus VP2 gene in China].

Science.gov (United States)

Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

2009-11-01

To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

Short-term memory and electrical restitution in the canine transmural ventricle

International Nuclear Information System (INIS)

Zhang, Hong; Ueyama, Takeshi; Lin, Shien-Fong; Wang, Juan; Wu, Rui-Juan

2011-01-01

Cardiac short-term memory is an intrinsic property of paced myocardium that reflects the influence of pacing history. Using an optical mapping method to record membrane voltage and intracellular calcium (Ca 2+ i ), this study investigated the properties and mechanisms of short-term memory in isolated and perfused canine wedge preparations. In addition to the dynamic and S1S2 pacing protocols, a perturbed downsweep pacing protocol was used to get a complete overview of the restitution portrait. Abrupt changes in basic cycle length (BCL) were applied to investigate the accommodation process of action potential duration (APD). The results showed unobvious differences of memory among the epi-, mid- and endo-myocytes, implying an insignificant memory-induced transient heterogeneity in APD across the transmural canine hearts. With the decrease of pacing rate S1, memory gradually elevated and achieved a maximum around 400 ms, and then reduced as S1 decreased further, indicating a non-monotonic relationship between memory and the pacing rate. After suppressing the Ca 2+ i transient with ryanodine (3 µmol l −1 ), the accommodation process of APD to a new BCL significantly abbreviated (τ = 37.41 ± 4.42 stimuli before ryanodine, τ = 15.84 ± 4.74 stimuli after ryanodine, p < 0.01). Therefore, Ca 2+ i cycling was suggested to play an important role in memory during dynamic pacing

Multiple Culprit Coronary Artery Thrombosis in a Patient with Coronary Ectasia

Directory of Open Access Journals (Sweden)

Bruno da Silva Matte

2018-01-01

Full Text Available We here report a case of ST-elevation myocardial infarction (STEMI due to simultaneous acute coronary artery occlusions of two major coronary arteries in a patient with coronary ectasia. The patient had been previously submitted to percutaneous coronary angioplasty with bare metal stent implantation in both culprit vessels. Very late stent thrombosis could be the cause of the first occlusion, triggering the event in the other vessel. In addition, concomitant embolic sources were not identified. Although routine aspiration thrombectomy in STEMI was not proven to be beneficial in randomized clinical trials, it was of great value in this case. We also discuss the relation between coronary ectasia, chronic inflammatory status, and increased platelet activity which may have caused plaque disruption in another already vulnerable vessel.

Imaging experimental coronary artery thrombosis with indium-111 platelets

International Nuclear Information System (INIS)

Riba, A.L.; Thakur, M.L.; Gottschalk, A.; Zaret, B.L.

1979-01-01

The ability of cardiac scintigraphy with indium-111 ( 111 In)-labeled platelets to detect coronary artery thrombosis (CAT) was assessed in a canine model. Cardiac imaging and tissue distribution studies were performed shortly after administering 111 In-labeled platelets to 12 dogs (group 1) with acute CAT. Four dogs (group 2) with acute CAT were studied 2 and 22 hours after administering 111 In platelets. In addition, four dogs (group 3) with 24-hour-old CAT were similarly evaluated. In all group 1 animals, in vivo imaging 1 to 2 hours after 111 In platelet administration revealed intense uptake in the region of thrombus-containing left anterior descending arteries that was readily discernible from background blood pool activity. Sequential imaging of the four group 2 animals over a 22-hour period revealed no change in the scintigraphic pattern of the thrombosed arteries. In contrast, 111 In platelet imaging in the four group 3 animals with 24-hour-old CAT failed to reveal enhanced activity within the region of the thrombus-containing coronary artery. In the 12 group 1 animals, the CAT accumulated 69 +- 10 (mean +- SEM) times greater activity than present in blood and 651 +- 135 times greater activity than normal left ventricular myocardium. There was 24 +- 7 times greater 111 In activity in the damaged left anterior descending arteries compared with normal circumflex arteries. Similar uptake ratios were seen in group 2 animals. The 24-hour old thrombi from group 3 animals showed no enhanced 111 In uptake. This study demonstrates that experimental acute CAT can be detected readily with 111 In platelet cardiac scintigraphy

[Experimental evaluation of the role of the coronary sinus pressure in the regulation of coronary return volume via the coronary sinus. Surgical considerations in atrio-pulmonary diversion procedures].

Science.gov (United States)

Fantidis, P; Fernández Ruiz, M A; Madero Jarabo, R; Moreno Granados, F; Cordovilla Zurdo, G; Sanz Galeote, E

1990-11-01

In order to find out the validity of the vascular waterfall mechanism in coronary venous circulation, the role of coronary sinus pressure in the regulation of coronary return volume via the coronary sinus is studied in healthy animals. An experimental model of pressure regulation in the coronary sinus was prepared, and aortic pressure, EKG and the cardiac output (measured by thermodilution) were recorded. The return volume via the coronary sinus was measured at coronary sinus pressure of 10 or less, 15, 20, and 25 mmHg or more, for a total of 36 determinations. Increased coronary sinus pressure did not produce significant changes in aortic pressure, heart rate, cardiac index or coronary return volume via coronary sinus. When coronary sinus pressure was 25 mmHg or more, there was a significant decline in the average of coronary return volume via coronary sinus. Nevertheless, stepwise variant regression showed that the coronary sinus pressure per se does not condition the volume of coronary return via the coronary sinus. Our results suggest that in the healthy animals, the vascular waterfall mechanism in coronary venous circulation is not valid. Our results suggest that in the correction of congenital cardiac malformations using atriopulmonary anastomosis procedures, employing techniques that ensure coronary sinus drainage into the left atrium, in order to avoid the hemodynamic repercussions attributable to the vascular waterfall mechanism, is not justified.

Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study.

Science.gov (United States)

Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E

2016-11-01

The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

Science.gov (United States)

von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

2008-05-01

Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

Orthodontic Traction of Impacted Canine Using Cantilever

OpenAIRE

Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

2016-01-01

The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

2013-12-01

Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

Directory of Open Access Journals (Sweden)

Patil Sandeep S

2012-01-01

Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

Deficiency of sex hormones does not affect 17-ß-estradiol-induced coronary vasodilation in the isolated rat heart.

Science.gov (United States)

Santos, R L; Lima, J T; Rouver, W N; Moysés, M R

2016-01-01

The relaxation of coronary arteries by estrogens in the coronary vascular beds of naive and hypertensive rats has been well described. However, little is known about this action in gonadectomized rats. We investigated the effect of 17-ß-estradiol (E2) in coronary arteries from gonadectomized rats, as well as the contributions of endothelium-derived factors and potassium channels. Eight-week-old female and male Wistar rats weighing 220-300 g were divided into sham-operated and gonadectomized groups (n=9-12 animals per group). The baseline coronary perfusion pressure (CPP) was determined, and the vasoactive effects of 10 μM E2 were assessed by bolus administration before and after endothelium denudation or by perfusion with NG-nitro-L-arginine methyl ester (L-NAME), indomethacin, clotrimazole, L-NAME plus indomethacin, L-NAME plus clotrimazole or tetraethylammonium (TEA). The CPP differed significantly between the female and sham-operated male animals. Gonadectomy reduced the CPP only in female rats. Differences in E2-induced relaxation were observed between the female and male animals, but male castration did not alter this response. For both sexes, the relaxation response to E2 was, at least partly, endothelium-dependent. The response to E2 was reduced only in the sham-operated female rats treated with L-NAME. However, in the presence of indomethacin, clotrimazole, L-NAME plus indomethacin or L-NAME plus clotrimazole, or TEA, the E2 response was significantly reduced in all groups. These results highlight the importance of prostacyclin, endothelium-derived hyperpolarizing factor, and potassium channels in the relaxation response of coronary arteries to E2 in all groups, whereas nitric oxide may have had an important role only in the sham-operated female group.