Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

Directory of Open Access Journals (Sweden)

Mariza M. Coêlho

2011-01-01

Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

Isolation of the opdE gene that encodes for a new hydrolase of Enterobacter sp. capable of degrading organophosphorus pesticides.

Science.gov (United States)

Chino-Flores, Concepción; Dantán-González, Edgar; Vázquez-Ramos, Alejandra; Tinoco-Valencia, Raunel; Díaz-Méndez, Rafael; Sánchez-Salinas, Enrique; Castrejón-Godínez, Maria Luisa; Ramos-Quintana, Fernando; Ortiz-Hernández, Maria Laura

2012-06-01

Microbial enzymes that can hydrolyze organophosphorus compounds have been isolated, identified and characterized from different microbial species in order to use them in biodegradation of organophosphorus compounds. We isolated a bacterial strain Cons002 from an agricultural soil bacterial consortium, which can hydrolyze methyl-parathion (MP) and other organophosphate pesticides. HPLC analysis showed that strain Cons002 is capable of degrading pesticides MP, parathion and phorate. Pulsed-field gel electrophoresis and 16S rRNA amplification were performed for strain characterization and identification, respectively, showing that the strain Cons002 is related to the genus Enterobacter sp. which has a single chromosome of 4.6 Mb and has no plasmids. Genomic library was constructed from DNA of Enterobacter sp. Cons002. A gene called opdE (Organophosphate Degradation from Enterobacter) consists of 753 bp and encodes a protein of 25 kDa, which was isolated using activity methods. This gene opdE had no similarity to any genes reported to degrade organophosphates. When kanamycin-resistance cassette was placed in the gene opdE, hydrolase activity was suppressed and Enterobacter sp. Cons002 had no growth with MP as a nutrients source.

Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

Directory of Open Access Journals (Sweden)

Hongle Xu

Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

2013-04-01

The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

Science.gov (United States)

A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

Science.gov (United States)

Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

2013-03-01

A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

Science.gov (United States)

Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

2013-03-01

Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

Science.gov (United States)

Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

2009-08-01

Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

Directory of Open Access Journals (Sweden)

Nandagopal Murugan

2018-02-01

Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

Directory of Open Access Journals (Sweden)

M. Ananda Chitra

2015-07-01

Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

Molecular cloning of cellulase genes from indigenous bacterial isolates

International Nuclear Information System (INIS)

Jong Bor Chyan; Pauline Liew Woan Ying; Mat Rasol Awang

2006-01-01

Indigenous cellulolytic bacterial isolates having high activities in degrading carboxymethyl cellulose (CMC) were isolated from local environments. Identification of these isolates were performed by molecular techniques. By using polymerase chain reaction (PCR) techniques, PCR products encoding cellulase gene were amplified from the total genomic DNAs. Purified PCR product was successfully cloned and expressed in Escherichia coli host system. The complete nucleotide sequences of the cellulase genes determined. The analysis of amino acid sequences deduced from the genes indicated that the cloned DNA fragments show high homology to those of endoglucanase genes of family GH5. All cloned genes consist of an N-terminal signal peptide, a catalytic domain of family 5 glycosyl hydrolase and a cellulose-binding domain of family III. (Author)

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

Directory of Open Access Journals (Sweden)

Se Chang Park

2013-01-01

Full Text Available Cyprinid herpes virus 3 (CyHV-3 diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio. Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116 of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116. In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

Science.gov (United States)

Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

2013-01-01

Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

Science.gov (United States)

Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

1995-06-01

cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

Clonal diversity and detection of carbapenem resistance encoding genes among multidrug-resistant Acinetobacter baumannii isolates recovered from patients and environment in two intensive care units in a Moroccan hospital

Directory of Open Access Journals (Sweden)

Jean Uwingabiye

2017-09-01

Full Text Available Abstract Background Carbapenem-resistant Acinetobacter baumannii has recently been defined by the World Health Organization as a critical pathogen. The aim of this study was to compare clonal diversity and carbapenemase-encoding genes of A. baumannii isolates collected from colonized or infected patients and hospital environment in two intensive care units (ICUs in Morocco. Methods The patient and environmental sampling was carried out in the medical and surgical ICUs of Mohammed V Military teaching hospital from March to August 2015. All A. baumannii isolates recovered from clinical and environmental samples, were identified using routine microbiological techniques and Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry. Antimicrobial susceptibility testing was performed using disc diffusion method. The carbapenemase-encoding genes were screened for by PCR. Clonal relatedness was analyzed by digestion of the DNA with low frequency restriction enzymes and pulsed field gel electrophoresis (PFGE and the multi locus sequence typing (MLST was performed on two selected isolates from two major pulsotypes. Results A total of 83 multidrug-resistant A. baumannii isolates were collected: 47 clinical isolates and 36 environmental isolates. All isolates were positive for the bla OXA51-like and bla OXA23-like genes. The coexistence of bla NDM-1 /bla OXA-23-like and bla OXA 24-like /bla OXA-23-like were detected in 27 (32.5% and 2 (2.4% of A. baumannii isolates, respectively. The environmental samples and the fecally-colonized patients were significantly identified (p < 0.05 as the most common sites of isolation of NDM-1-harboring isolates. PFGE grouped all isolates into 9 distinct clusters with two major groups (0007 and 0008 containing up to 59% of the isolates. The pulsotype 0008 corresponds to sequence type (ST 195 while pulsotype 0007 corresponds to ST 1089.The genetic similarity between the clinical and environmental isolates

High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

Science.gov (United States)

Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

2017-12-18

Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Isolation and identification of antibiotic resistance genes in Staphylococcus aureus isolates from respiratory system infections in shahrekord, Iran

Directory of Open Access Journals (Sweden)

Maryam Reisi

2014-07-01

Full Text Available   Introduction : Staphylococcus aureus is considered as one of pathogenic agents in humans, that engages different body parts including respiratory system and causes to spend lots of costs and extending patient’s treatment period. This study which is performed to separate and investigate the pattern of antibiotic resistance in Staphylococcus aureus isolates from upper respiratory system infections in Shahrekord.   Materials and methods: This study was done by sectional-descriptive method On 200 suspicious persons to the upper respiratory system infections who were referred to the Imam Ali clinic in Shahrekord in 2012. After isolation of Staphylococcus aureus from cultured nose discharges, antibiotic resistance genes were identified by polymerase chain reaction (PCR by using defined primer pairs .   Results : Among 200 investigated samples in 60 cases (30% Staphylococcus aureus infection (by culturing and PCR method was determined. Isolates showed the lowest amount of antibiotic resistance to vancomycin (0.5% and the highest amount of resistance to the penicillin G and cefotaxime (100%. mecA gene (encoding methicillin resistance with frequency of 85.18% and aacA-D gene (encoding resistance to aminoglycosides with frequency of 28.33% showed the highest and lowest frequency of antibiotic resistance genes coding in Staphylococcus aureus isolates respectively .   Discussion and conclusion : Notable prevalence of resistant Staphylococcus aureus isolates in community acquired respiratory infections, recommend continuous control necessity to impede the spreading of these bacteria and their infections.  

Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

Science.gov (United States)

Bartl, S; Weissman, I L

1994-01-04

The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated.

Isolation and characterization of the human parathyroid hormone-like peptide gene

International Nuclear Information System (INIS)

Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

1989-01-01

A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Isolation of a novel abscisic acid stress ripening ( OsASR ) gene ...

African Journals Online (AJOL)

Isolation of a novel abscisic acid stress ripening ( OsASR ) gene from rice and analysis of the response of this gene to abiotic stresses. ... The cDNA with the whole open reading frame (ORF) was amplified by PCR and cloned. Sequence analysis showed that the cDNA encodes a protein of 284 amino acid residues with ...

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden.

Directory of Open Access Journals (Sweden)

Gunlög Rasmussen

Full Text Available Staphylococcus aureus encodes a remarkable number of virulence factors which may contribute to its pathogenicity and ability to cause invasive disease. The main objective of this study was to evaluate the association between S. aureus invasiveness and bacterial genotype, in terms of the presence of virulence genes and affiliation to clonal complexes. Also, the significance of different virulence genes, mainly adhesins, for the development of infective endocarditis was investigated. DNA microarray technology was used to analyze 134 S. aureus isolates, all methicillin-susceptible, derived from three groups of clinically well-characterized patients: nasal carriers (n=46, bacteremia (n=55, and bacteremia with infective endocarditis (n=33. Invasive isolates were dominant in four of the major clonal complexes: 5, 8, 15, and 25. Of the 170 virulence genes examined, those encoding accessory gene regulator group II (agr II, capsule polysaccharide serotype 5 (cap5, and adhesins such as S. aureus surface protein G (sasG and fibronectin-binding protein B (fnbB were found to be associated with invasive disease. The same was shown for the leukocidin genes lukD/lukE, as well as the genes encoding serine protease A and B (splA/splB, staphylococcal complement inhibitor (scn and the staphylococcal exotoxin-like protein (setC or selX. In addition, there was a trend of higher prevalence of certain genes or gene clusters (sasG, agr II, cap5 among isolates causing infective endocarditis compared to other invasive isolates. In most cases, the presence of virulence genes was linked to clonal complex affiliation. In conclusion, certain S. aureus clonal lineages harboring specific sets of virulence genes seem to be more successful in causing invasive disease.

Frequency and expression of mutacin biosynthesis genes in isolates of Streptococcus mutans with different mutacin-producing phenotypes.

Science.gov (United States)

Kamiya, Regianne Umeko; Höfling, José Francisco; Gonçalves, Reginaldo Bruno

2008-05-01

The aim of this study was to analyse the frequency and expression of biosynthesis genes in 47 Streptococcus mutans isolates with different mutacin-producing phenotypes. Detection of the frequency and expression of genes encoding mutacin types I, II, III and IV were carried out by PCR and semi-quantitative RT-PCR, respectively, using primers specific for each type of biosynthesis gene. In addition, a further eight genes encoding putative bacteriocins, designated bsm 283, bsm 299, bsm 423, bsm 1889c, bsm 1892c, bsm 1896, bsm 1906c and bsm 1914, were also screened. There was a high phenotypic diversity; some Streptococcus mutans isolates presented broad antimicrobial spectra against other Streptococcus mutans clinical isolates, including bacteria resistant to common antibiotics, as well as Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis and Streptococcus pyogenes. The expression frequency of the bsm gene was higher than that of the previously characterized mutacins (I-IV). There was no positive correlation between the number of indicator strains inhibited (antimicrobial spectra) and the number of biosynthesis genes expressed (Spearman correlation test, r=-0.03, P>0.05). In conclusion, the high diversity of mutacin-producing phenotypes, associated with high frequency of expression of the biosynthesis genes screened, reveals a broad repertoire of genetic determinants encoding antimicrobial peptides that can act in different combinations.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran.

Science.gov (United States)

Hosseini Nave, Hossein; Mansouri, Shahla; Emaneini, Mohammad; Moradi, Mohammad

2016-03-01

Shigella is one of the important causes of diarrhea worldwide. Shigella has several virulence factors contributing in colonization and invasion of epithelial cells and eventually death of host cells. The present study was performed in order to investigate the distribution of virulence factors genes in Shigella spp. isolated from patients with acute diarrhea in Kerman, Iran as well as the genetic relationship of these isolates. A total of 56 isolates including 31 S. flexneri, 18 S. sonnei and 7 S. boydii were evaluated by polymerase chain reaction (PCR) for the presence of 11 virulence genes (ipaH, ial, set1A, set1B, sen, virF, invE, sat, sigA, pic and sepA). Then, the clonal relationship of these strains was analyzed by multilocus variable-number tandem repeat analysis (MLVA) method. All isolates were positive for ipaH gene. The other genes include ial, invE and virF were found in 80.4%, 60.7% and 67.9% of the isolates, respectively. Both set1A and set1B were detected in 32.3% of S. flexneri isolates, whereas 66.1% of the isolates belonging to different serogroup carried sen gene. The sat gene was present in all S. flexneri isolates, but not in the S. sonnei and S. boydii isolates. The result showed, 30.4% of isolates were simultaneously positive and the rest of the isolates were negative for sepA and pic genes. The Shigella isolates were divided into 29 MLVA types. This study, for the first time, investigated distribution of 11 virulence genes in Shigella spp. Our results revealed heterogeneity of virulence genes in different Shigella serogroups. Furthermore, the strains belonging to the same species had little diversity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

Science.gov (United States)

Rôças, Isabela N; Siqueira, José F

2012-12-01

Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Isolation and expression pattern of COR15b and KIN1 genes in ...

African Journals Online (AJOL)

STORAGESEVER

2009-11-02

Nov 2, 2009 ... COR15b and KIN1 (COR 6.5) genes encode polypeptides of 15 KDa and 6.5 KDa, respectively. They are involved in the dehydration tolerance mechanisms and play important role under cold stress. cDNA sequences of COR15b and KIN1 genes were firstly isolated from leaves of watermelon (Citrullus.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Type II heat-labile enterotoxins from 50 diverse Escherichia coli isolates belong almost exclusively to the LT-IIc family and may be prophage encoded.

Directory of Open Access Journals (Sweden)

Michael G Jobling

Full Text Available Some enterotoxigenic Escherichia coli (ETEC produce a type II heat-labile enterotoxin (LT-II that activates adenylate cyclase in susceptible cells but is not neutralized by antisera against cholera toxin or type I heat-labile enterotoxin (LT-I. LT-I variants encoded by plasmids in ETEC from humans and pigs have amino acid sequences that are ≥ 95% identical. In contrast, LT-II toxins are chromosomally encoded and are much more diverse. Early studies characterized LT-IIa and LT-IIb variants, but a novel LT-IIc was reported recently. Here we characterized the LT-II encoding loci from 48 additional ETEC isolates. Two encoded LT-IIa, none encoded LT-IIb, and 46 encoded highly related variants of LT-IIc. Phylogenetic analysis indicated that the predicted LT-IIc toxins encoded by these loci could be assigned to 6 subgroups. The loci corresponding to individual toxins within each subgroup had DNA sequences that were more than 99% identical. The LT-IIc subgroups appear to have arisen by multiple recombinational events between progenitor loci encoding LT-IIc1- and LT-IIc3-like variants. All loci from representative isolates encoding the LT-IIa, LT-IIb, and each subgroup of LT-IIc enterotoxins are preceded by highly-related genes that are between 80 and 93% identical to predicted phage lysozyme genes. DNA sequences immediately following the B genes differ considerably between toxin subgroups, but all are most closely related to genomic sequences found in predicted prophages. Together these data suggest that the LT-II loci are inserted into lambdoid type prophages that may or may not be infectious. These findings raise the possibility that production of LT-II enterotoxins by ETEC may be determined by phage conversion and may be activated by induction of prophage, in a manner similar to control of production of Shiga-like toxins by converting phages in isolates of enterohemmorhagic E. coli.

High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species.

Science.gov (United States)

Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å

2017-07-01

Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

Science.gov (United States)

Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

1995-01-01

Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Antimicrobial Resistance Pattern and Their Beta-Lactamase Encoding Genes among Pseudomonas aeruginosa Strains Isolated from Cancer Patients

Directory of Open Access Journals (Sweden)

Mai M. Zafer

2014-01-01

Full Text Available This study was designed to investigate the prevalence of metallo-β-lactamases (MBL and extended-spectrum β-lactamases (ESBL in P. aeruginosa isolates collected from two different hospitals in Cairo, Egypt. Antibiotic susceptibility testing and phenotypic screening for ESBLs and MBLs were performed on 122 P. aeruginosa isolates collected in the period from January 2011 to March 2012. MICs were determined. ESBLs and MBLs genes were sought by PCR. The resistant rate to imipenem was 39.34%. The resistance rates for P. aeruginosa to cefuroxime, cefoperazone, ceftazidime, aztreonam, and piperacillin/tazobactam were 87.7%, 80.3%, 60.6%, 45.1%, and 25.4%, respectively. Out of 122 P. aeruginosa, 27% and 7.4% were MBL and ESBL, respectively. The prevalence of blaVIM-2, blaOXA-10-, blaVEB-1, blaNDM-, and blaIMP-1-like genes were found in 58.3%, 41.7%, 10.4%, 4.2%, and 2.1%, respectively. GIM-, SPM-, SIM-, and OXA-2-like genes were not detected in this study. OXA-10-like gene was concomitant with VIM-2 and/or VEB. Twelve isolates harbored both OXA-10 and VIM-2; two isolates carried both OXA-10 and VEB. Only one strain contained OXA-10, VIM-2, and VEB. In conclusion, blaVIM-2- and blaOXA-10-like genes were the most prevalent genes in P. aeruginosa in Egypt. To our knowledge, this is the first report of blaVIM-2, blaIMP-1, blaNDM, and blaOXA-10 in P. aeruginosa in Egypt.

Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes

Directory of Open Access Journals (Sweden)

Valentina Monistero

2018-06-01

Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

Science.gov (United States)

Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

2017-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

Science.gov (United States)

Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

2010-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.

OpenAIRE

Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M

1989-01-01

Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...

Virulence Gene Pool Detected in Bovine Group C Streptococcus dysgalactiae subsp. dysgalactiae Isolates by Use of a Group A S. pyogenes Virulence Microarray ▿

Science.gov (United States)

Rato, Márcia G.; Nerlich, Andreas; Bergmann, René; Bexiga, Ricardo; Nunes, Sandro F.; Vilela, Cristina L.; Santos-Sanches, Ilda; Chhatwal, Gursharan S.

2011-01-01

A custom-designed microarray containing 220 virulence genes of Streptococcus pyogenes (group A Streptococcus [GAS]) was used to test group C Streptococcus dysgalactiae subsp. dysgalactiae (GCS) field strains causing bovine mastitis and group C or group G Streptococcus dysgalactiae subsp. equisimilis (GCS/GGS) isolates from human infections, with the latter being used for comparative purposes, for the presence of virulence genes. All bovine and all human isolates carried a fraction of the 220 genes (23% and 39%, respectively). The virulence genes encoding streptolysin S, glyceraldehyde-3-phosphate dehydrogenase, the plasminogen-binding M-like protein PAM, and the collagen-like protein SclB were detected in the majority of both bovine and human isolates (94 to 100%). Virulence factors, usually carried by human beta-hemolytic streptococcal pathogens, such as streptokinase, laminin-binding protein, and the C5a peptidase precursor, were detected in all human isolates but not in bovine isolates. Additionally, GAS bacteriophage-associated virulence genes encoding superantigens, DNase, and/or streptodornase were detected in bovine isolates (72%) but not in the human isolates. Determinants located in non-bacteriophage-related mobile elements, such as the gene encoding R28, were detected in all bovine and human isolates. Several virulence genes, including genes of bacteriophage origin, were shown to be expressed by reverse transcriptase PCR (RT-PCR). Phylogenetic analysis of superantigen gene sequences revealed a high level (>98%) of identity among genes of bovine GCS, of the horse pathogen Streptococcus equi subsp. equi, and of the human pathogen GAS. Our findings indicate that alpha-hemolytic bovine GCS, an important mastitis pathogen and considered to be a nonhuman pathogen, carries important virulence factors responsible for virulence and pathogenesis in humans. PMID:21525223

Identification of blaOXA-51, blaOXA-58, blaDIM-1 and blaVIM carbapenemase genes in hospital enterobacteriaceae isolates from Sierra Leone

Science.gov (United States)

We describe the results of a molecular epidemiological survey of 15 carbapenemase-encoding genes from a recent collection of clinical isolates. The most salient findings revealed that (i) 60% of the isolates harbored multiple carbapenemase genes, (ii) the blaDIM-1 gene that has only been reported in...

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Investigation of Virulence Genes by PCR in Stapylococcus aureus Isolates Originated from Subclinical Bovine Mastitis in Turkey

Directory of Open Access Journals (Sweden)

Murat Karahan, Mehmet Nuri Acik1* and Burhan Cetinkaya

2011-06-01

Full Text Available The aim of the present study was to characterize coagulase (coa positive Staphylococcus aureus strains (n=92 isolated from bovine subclinical mastitis in Turkey by PCR amplification of clumping factor A (clfA and protein A (spa genes. All the coa-positive S. aureus isolates were determined to harbor the genes encoding the IgG binding region (spa-IgG and the X region (spa-X of spa. On the other hand, 84 (91.3% isolates were positive for clfA gene. These three genes displayed size polymorphisms. It was concluded that spa gene polymorphisms for S. aureus, when used together with coa-PCR, can be proposed as good alternatives to conventional methods in typing S. aureus isolates of bovine origin which may provide valuable data for the development of effective control strategies against staphylococcal mastitis. The results of the present study showed that S. aureus isolates responsible for the mastitis cases in Turkey were genetically diverse.

Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene

International Nuclear Information System (INIS)

Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.

1988-01-01

The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region

Pectate lyase affects pathogenicity in natural isolates of Colletotrichum coccodes and in pelA gene-disrupted and gene-overexpressing mutant lines.

Science.gov (United States)

Ben-Daniel, Bat-Hen; Bar-Zvi, Dudy; Tsror Lahkim, Leah

2012-02-01

Colletotrichum coccodes (Wallr.) S. Hughes, the causal agent of black dot on potato and anthracnose on tomato, reduces yield and crop quality. We explored the role of secreted pectate lyase (PL), a cell wall-degrading enzyme, in the aggressiveness of C. coccodes. In vitro-cultivated highly aggressive isolates secreted immunologically detectable PL levels 6 h after transfer to secondary medium versus 12 h for mildly aggressive isolates, suggesting that secreted PL is a virulence factor. The gene encoding PL, CcpelA, was cloned and used for the genetic manipulation of highly (US-41 and Si-72) and mildly (Si-60) aggressive isolates. CcpelA gene-disrupted mutants showed reduced aggressiveness towards tomato fruits and impaired PL secretion and extracellular activity. Conversely, overexpression of CcpelA in the Si-60 isolate increased its aggressiveness and PL secretion. Comparison of CcpelA cloned from isolates US-41 and Si-60 revealed that both encode identical proteins, but differ in their promoters. Bioinformatics analysis for cis-acting elements suggested that the promoters of the US-41 and Si-60 isolates contain one and no AreA-binding site (GATA box), respectively. AreA has been suggested to be involved in fungal aggressiveness; therefore, CcpelA may be a key virulence factor in C. coccodes pathogenicity, and the differences in isolate aggressiveness might result from promoter activity. Quantitative reverse transcriptase-polymerase chain reaction analyses confirmed the higher level of CcpelA transcript in isolate US-41 versus Si-60. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

Detection of the intercellular adhesion gene cluster (ica in clinical Staphylococcus aureus isolates

Directory of Open Access Journals (Sweden)

Namvar, Amirmorteza Ebrahimzadeh

2013-04-01

Full Text Available [english] is a major hospital and community pathogen having the aptitude to cause a wide variety of infections in men. The ability of microorganisms to produce biofilm facilitates them to withstand the host immune response and is recognized as one factor contributing to chronic or persistent infections. It was demonstrated that the -encoded genes lead to the biosynthesis of polysaccharide intercellular adhesion (PIA molecules, and may be involved in the accumulation phase of biofilm formation. Different studies have shown the decisive role of the gene as virulence factors in staphylococcal infections. This study was carried out to demonstrate the relationship between gene and production of slime layer in strains. Sixty strains were isolated from patients. The isolates were identified morphologically and biochemically following standard laboratory methods. After identification, the staphylococcal isolates were maintained in trypticase soy broth (TSB, to which 15% glycerol was added, and stored at –20°C. Slime formation and biofilm assay was monitored. A PCR assay was developed to identify the presence of (intercellular adhesion gene gene in all isolates. Thirty-nine slime producing colonies with CRA plates (65% formed black colors, the remaining 21 isolates were pink (35%. In the quantitative biofilm assay 35 (58% produced biofilm while 25 (42% isolates did not exhibit this property. All isolates were positive for detection of gene by PCR method. The interaction of and in the investigated isolates may be important in slime layer formation and biofilm phenomena.We propose PCR detection of the gene locus as a rapid and effective method to be used for discrimination between potentially virulent and nonvirulent isolates, with implications for therapeutic and preventive measures pertainin to the management of colonized indwelling catheters.

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Simultaneous cloning and expression of two cellulase genes from Bacillus subtilis newly isolated from Golden Takin (Budorcas taxicolor Bedfordi)

International Nuclear Information System (INIS)

Li, Wang; Huan, Xiajuan; Zhou, Ying; Ma, Qingyi; Chen, Yulin

2009-01-01

A bacterial strain with high cellulase activity was isolated of feces sample of Golden Takin (Budorcas taxicolor Bedfordi). The bacterium was classified and designated Bacillus subtilis LN by morphological and 16SrDNA gene sequence analysis. Two putative cellulase genes, CelL15 and CelL73, were simultaneously cloned from the isolated strain by PCR. The putative gene CelL15 consisted of an open reading frame (ORF) of 1470 nucleotides and encoded a protein of 490 amino acids with a molecular weight of 54 kDa. The CelL73 gene consisted of an open reading frame (ORF) of 741 nucleotides and encoded a protein of 247 amino acids with a molecular weight of 27 kDa. Both genes were purified and cloned into pET-28a for expression in Escherichia coli BL21 (DE3). The ability of E. coli to degrade cellulose was enhanced when the two recombinants were cultured together.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

Science.gov (United States)

Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

2018-04-01

The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

Trichoderma genes

Science.gov (United States)

Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

2012-06-19

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

Directory of Open Access Journals (Sweden)

Mohammad Hossein Sarrafzadeh Zargar

2014-07-01

Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

Science.gov (United States)

Nabi, Ari Q.

2017-09-01

Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

OpenAIRE

Bartl, S; Weissman, I L

1994-01-01

The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse...

Detection of toxic shock toxin (tst gene in Staphylococcus aureus isolated from bovine milk samples

Directory of Open Access Journals (Sweden)

S. Baniardalan

2017-09-01

Full Text Available Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis in dairy cattle all over the world. This agent produces a variety of extracellular toxins and virulence factors in-cluding toxic shock syndrome toxin-1 (TSST-1 which is the major cause of toxic shock syndrome (TSS. In the present study, 76 S. aureus isolates have been obtained from milk samples collected from 7 dairy herds in Hamedan province of Iran. The isolates were identified based on the biochemical and molecular methods using PCR amplification of the femA gene. The staphylococcal isolates were also examined for the presence of TSST-1 (tst encoding gene. This gene was detected in only one S. aureus isolate (1.3%. The results revealed that S. aureus strains causing bovine mastitis may potentially produce staphylococcal toxic shock syndrome toxin-1, indicating that it is very important to follow the presence of TSST-1 producing S. aureus isolates in foodstuffs to protect consumers against the risk of toxic shock syndrome

Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

Science.gov (United States)

Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

1999-04-16

A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

The fosfomycin resistance gene fosB3 is located on a transferable, extrachromosomal circular intermediate in clinical Enterococcus faecium isolates.

Directory of Open Access Journals (Sweden)

Xiaogang Xu

Full Text Available Some VanM-type vancomycin-resistant Enterococcus faecium isolates from China are also resistant to fosfomycin. To investigate the mechanism of fosfomycin resistance in these clinical isolates, antimicrobial susceptibility testing, filter-mating, Illumina/Solexa sequencing, inverse PCR and fosfomycin resistance gene cloning were performed. Three E. faecium clinical isolates were highly resistant to fosfomycin and vancomycin with minimal inhibitory concentrations (MICs >1024 µg/ml and >256 µg/ml, respectively. The fosfomycin and vancomycin resistance of these strains could be co-transferred by conjugation. They carried a fosfomycin resistance gene fosB encoding a protein differing by one or two amino acids from FosB, which is encoded on staphylococcal plasmids. Accordingly, the gene was designated fosB3. The fosB3 gene was cloned into pMD19-T, and transformed into E. coli DH5α. The fosfomycin MIC for transformants with fosB3 was 750-fold higher than transformants without fosB3. The fosB3 gene could be transferred by an extrachromosomal circular intermediate. The results indicate that the fosB3 gene is transferable, can mediate high level fosfomycin resistance in both Gram-positive and Gram-negative bacteria, and can be located on a circular intermediate.

Enterobacteriaceae isolates carrying the New Delhi metallo-β-lactamase gene in Yemen.

Science.gov (United States)

Gharout-Sait, Alima; Alsharapy, Samer-Ahmed; Brasme, Lucien; Touati, Abdelaziz; Kermas, Rachida; Bakour, Sofiane; Guillard, Thomas; de Champs, Christophe

2014-10-01

Ten carbapenem-resistant Enterobacteriaceae (eight Klebsiella pneumoniae isolates and two Enterobacter cloacae) isolates from Yemen were investigated using in vitro antimicrobial susceptibility testing, phenotypic carbapenemase detection, multilocus sequence typing (MLST) and replicon typing. Carbapenemase, extended-spectrum β-lactamase (ESBL) and plasmid-mediated quinolone resistance determinant genes were identified using PCR and sequencing. All of the 10 carbapenem-resistant Enterobacteriaceae were resistant to β-lactams, tobramycin, ciprofloxacin and cotrimoxazole. Imipenem, doripenem and meropenem MICs ranged from 2 to >32 mg l(-1) and ertapenem MICs ranged from 6 to >32 mg l(-1). All of the K. pneumoniae isolates showed ESBL activity in phenotypic tests. Genes encoding blaNDM were detected in all strains. All K. pneumoniae strains produced CTX-M-15 ESBL and SHV β-lactamases. TEM-1 β-lactamase was detected in seven isolates. Nine isolates were qnr positive including QnrB1, QnrA1 and QnrS1, and six isolates produced AAC-6'-Ib-cr. MLST identified five different sequence types (STs): ST1399, ST147, ST29, ST405 and ST340. Replicon typing showed the presence of IncFII1K plasmids in four transformants. To the best of our knowledge, this is the first report of NDM-1-producing Enterobacteriaceae isolates in Yemen. © 2014 The Authors.

PHENOTYPIC AND GENOTYPIC ANALYSIS OF AN ARCANOBACTERIUM PLURANIMALIUM ISOLATED FROM A MUSKOX (OVIBOS MOSCHATUS

Directory of Open Access Journals (Sweden)

Siti Gusti Ningrum

2017-03-01

Full Text Available The present study was designed to characterize an Arcanobacterium pluranimalium strain isolated from a muskox (Ovibos moschatus phenotypically, by MALDI-TOF MS analysis and genotypically using various molecular targets. The phenotypic properties, the MALDI-TOF MS analysis and sequencing the 16S rRNA gene, the β subunit of bacterial RNA polymerase encoding gene rpoB, the glyceraldehyde 3-phosphate dehydrogenase encoding gene gap, the elongation factor tu encoding gene tuf and the pluranimaliumlysin encoding gene pla allowed a successful identification of the isolated strain as A. pluranimalium. Gene pla could also be detected by a previously described loop-mediated isothermal amplification (LAMP assay. This is first report on the isolation and characterization of A. pluranimalium originated from a Muskox.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Detection of toxin genes and RAPD analysis of bacillus cereus isolates from different soil types

Directory of Open Access Journals (Sweden)

Savic Dejana

2015-01-01

Full Text Available The aim of this study was to detect genes for enterotoxins (hbla, entFM and bceT and for emetic toxin (cer, to determine antibiotic resistance, and to estimate intraspecies diversity in B. cereus isolates by RAPD analysis. B. cereus was identified in 12 out of 117 indigenous Bacillus spp. using the classical microbiological methods and PCR. All isolates were resistant to penicillin and ampicillin, two to tetracyclin and four to trimethoprim-sulphamethoxazole. Also, all isolates produced inducible penicillinases and β-lactamase. Toxin genes were detected with PCR. EntFM and cer genes were present in all isolates, hbla in all, but two, and bceT in none. RAPD analysis was performed with four different primers, two of them designed for this study. The intraspecies diversity revealed 10 different patterns at the 90% similarity level. Two separate clusters were formed regardless of a soil type or utilization. The detection of genes encoding toxins in all B. cereus isolates indicated these bacteria as potentially pathogenic and seriously for human health. Regardless of a soil type or utilization, the RAPD analysis showed high intraspecies heterogeneity in B. cereus isolates. To the best of our knowledge, this is the first study to analyse the presence of entero- and emetic toxin genes and genetic heterogeneity in B. cereus isolates from different soil types and different soil utilization in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR37006

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex.

Science.gov (United States)

Gribble, Kristin E; Mark Welch, David B

2012-08-01

Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Isolates of the B. plicatilis species complex have 1-4 copies of mmr-b, each composed of 2-9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in

The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

Directory of Open Access Journals (Sweden)

Gribble Kristin E

2012-08-01

Full Text Available Abstract Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP, a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving

Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

Science.gov (United States)

Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

2014-12-01

The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Genetic diversity and virulence genes in Streptococcus uberis strains isolated from bovine mastitis

Directory of Open Access Journals (Sweden)

Rafael Ambrósio Loures

2017-08-01

Full Text Available Mastitis is one of the most common and costly infectious diseases in dairy cattle worldwide. This is a multifactorial illness caused by different microorganisms, including virus, yeasts, algae, parasites, and several species of bacteria. Among these bacteria, Streptococcus uberis is an important environmental pathogen that is responsible for a large range of clinical and subclinical mammary infections, especially in intensively managed herds. Despite the increasing importance of this pathogen in the etiology of bovine mastitis, data on its virulence and diversity in Brazilian dairy herds are scarce. The aims of the present study were to investigate the virulence characteristics of S. uberis isolated from bovine mastitis and to assess the molecular epidemiology of the Brazilian isolates using pulsed-field gel electrophoresis (PFGE. In this work, 46 strains of S. uberis isolated from bovine mastitis from 26 Brazilian dairy herds were evaluated regarding their genetic diversity by PFGE using with the SmaI enzyme. Additionally, the presence of the virulence genes skc and pauA, which encode plasminogen activators, and the gene sua, which encodes an adhesion molecule in mammary epithelial cells, were assessed by PCR. Our results showed a high genetic diversity in the population, displaying many different patterns in the PFGE analysis. A high proportion of strains was positive for virulence genes in the sampled population (sua [100%], pauA [91%], and skc [91%]. The high frequency of skc, pauA, and sua genes among the studied strains suggests the importance of these virulence factors, possibly helping S. uberis in the colonization of the bovine mammary gland. Surveys of the genetic and molecular characteristics of this pathogen can improve our knowledge of bacterial activity and identify molecules that have roles in the establishment of the infection. This might help in the development of more effective measures to control and prevent bovine mastitis.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia

Directory of Open Access Journals (Sweden)

King-Ting Lim

2009-01-01

Full Text Available The emergence of Escherichia coli that produce extended spectrum β-lactamases (ESBLs and are multidrug resistant (MDR poses antibiotic management problems. Forty-seven E. coli isolates from various public hospitals in Malaysia were studied. All isolates were sensitive to imipenem whereas 36 were MDR (resistant to 2 or more classes of antibiotics. PCR detection using gene-specific primers showed that 87.5% of the ESBL-producing E. coli harbored the blaTEM gene. Other ESBL-encoding genes detected were blaOXA, blaSHV, and blaCTX-M. Integron-encoded integrases were detected in 55.3% of isolates, with class 1 integron-encoded intI1 integrase being the majority. Amplification and sequence analysis of the 5′CS region of the integrons showed known antibiotic resistance-encoding gene cassettes of various sizes that were inserted within the respective integrons. Conjugation and transformation experiments indicated that some of the antibiotic resistance genes were likely plasmid-encoded and transmissible. All 47 isolates were subtyped by PFGE and PCR-based fingerprinting using random amplified polymorphic DNA (RAPD, repetitive extragenic palindromes (REPs, and enterobacterial repetitive intergenic consensus (ERIC. These isolates were very diverse and heterogeneous. PFGE, ERIC, and REP-PCR methods were more discriminative than RAPD in subtyping the E. coli isolates.

Isolation and characterization of the dnaA gene of Rickettsia prowazekii

International Nuclear Information System (INIS)

Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

1998-01-01

The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1991-08-30

Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

Directory of Open Access Journals (Sweden)

Reiss Monika

2008-11-01

Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

OpenAIRE

Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

1998-01-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogr...

Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia

Directory of Open Access Journals (Sweden)

Judy Natalia Jiménez

2011-12-01

Full Text Available Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA and methicillin-resistant S. aureus (MRSA strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL, staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%. MRSA strains harboured SCCmec types IVc (60%, I (30%, IVa (7% and V (3%. SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia.

Science.gov (United States)

Jiménez, Judy Natalia; Ocampo, Ana María; Vanegas, Johanna Marcela; Rodríguez, Erika Andrea; Garcés, Carlos Guillermo; Patiño, Luz Adriana; Ospina, Sigifredo; Correa, Margarita María

2011-12-01

Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL), staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec) was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%). MRSA strains harboured SCCmec types IVc (60%), I (30%), IVa (7%) and V (3%). SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Identification of virulence genes carried by bacteriophages obtained from clinically isolated methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Karasartova, Djursun; Cavusoglu, Zeynep Burcin; Turegun, Buse; Ozsan, Murat T; Şahin, Fikret

2016-12-01

Bacteriophages play an important role in the pathogenicity of Staphylococcus aureus (S. aureus) either by carrying accessory virulence factors or several superantigens. Despite their importance, there are not many studies showing the actual distribution of the virulence genes carried by the prophages obtained from the clinically isolated Staphylococcus. In this study, we investigated prophages obtained from methicillin-resistant S. aureus (MRSA) strains isolated from hospital- and community-associated (HA-CA) infections for the virulence factors. In the study, 43 phages isolated from 48 MRSA were investigated for carrying toxin genes including the sak, eta, lukF-PV, sea, selp, sek, seg, seq chp, and scn virulence genes using polymerase chain reaction (PCR) and Southern blot. Restriction fragment length polymorphism was used to analyze phage genomes to investigate the relationship between the phage profiles and the toxin genes' presence. MRSA strains isolated from HA infections tended to have higher prophage presence than the MRSA strains obtained from the CA infections (97% and 67%, respectively). The study showed that all the phages with the exception of one phage contained one or more virulence genes in their genomes with different combinations. The most common toxin genes found were sea (83%) followed by sek (77%) and seq (64%). The study indicates that prophages encode a significant proportion of MRSA virulence factors.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

International Nuclear Information System (INIS)

Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

1989-01-01

The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

Proteomic analysis of isolated chlamydomonas centrioles reveals orthologs of ciliary-disease genes.

Science.gov (United States)

Keller, Lani C; Romijn, Edwin P; Zamora, Ivan; Yates, John R; Marshall, Wallace F

2005-06-21

The centriole is one of the most enigmatic organelles in the cell. Centrioles are cylindrical, microtubule-based barrels found in the core of the centrosome. Centrioles also act as basal bodies during interphase to nucleate the assembly of cilia and flagella. There are currently only a handful of known centriole proteins. We used mass-spectrometry-based MudPIT (multidimensional protein identification technology) to identify the protein composition of basal bodies (centrioles) isolated from the green alga Chlamydomonas reinhardtii. This analysis detected the majority of known centriole proteins, including centrin, epsilon tubulin, and the cartwheel protein BLD10p. By combining proteomic data with information about gene expression and comparative genomics, we identified 45 cross-validated centriole candidate proteins in two classes. Members of the first class of proteins (BUG1-BUG27) are encoded by genes whose expression correlates with flagellar assembly and which therefore may play a role in ciliogenesis-related functions of basal bodies. Members of the second class (POC1-POC18) are implicated by comparative-genomics and -proteomics studies to be conserved components of the centriole. We confirmed centriolar localization for the human homologs of four candidate proteins. Three of the cross-validated centriole candidate proteins are encoded by orthologs of genes (OFD1, NPHP-4, and PACRG) implicated in mammalian ciliary function and disease, suggesting that oral-facial-digital syndrome and nephronophthisis may involve a dysfunction of centrioles and/or basal bodies. By analyzing isolated Chlamydomonas basal bodies, we have been able to obtain the first reported proteomic analysis of the centriole.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

Science.gov (United States)

Scorpio, A; Zhang, Y

1996-06-01

Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum.

Science.gov (United States)

Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang

2011-11-01

Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.

High diversity of genes and plasmids encoding resistance to third-generation cephalosporins and quinolones in clinical Escherichia coli from commercial poultry flocks in Italy

DEFF Research Database (Denmark)

Niero, Giulia; Bortolaia, Valeria; Vanni, Michele

2018-01-01

= 98) and layers (n = 22) between 2008 and 2012. 3GC-resistant isolates were screened for extended-spectrum and AmpC β-lactamase (ESBL/AmpC), while all isolates were tested for plasmid-mediated quinolone resistance (PMQR) genes. ESBL/AmpC- and PMQR-positive isolates were typed by pulsed-field gel......% of isolates from turkeys, broilers and layers, respectively. We identified seven ESBL/AmpC-encoding plasmid types, usually conjugative (78%), with a marked prevalence of IncI1/pST3 plasmids carrying blaCTX-M-1. PMQR occurred less frequently among isolates from turkeys (0.9%) compared to those from broilers (5......%) and layers (4%). The PMQR genes qnrS, qnrB19 and oqxA/B were located on three plasmid types and two non-typeable plasmids, mostly (85%) conjugative. ESBL/AmpC- and PMQR-positive isolates were genetically unrelated and 64% of them were additionally resistant to aminoglycosides, sulfonamides and tetracyclines...

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Genome sequence of Shigella flexneri strain SP1, a diarrheal isolate that encodes an extended-spectrum β-lactamase (ESBL).

Science.gov (United States)

Shen, Ping; Fan, Jianzhong; Guo, Lihua; Li, Jiahua; Li, Ang; Zhang, Jing; Ying, Chaoqun; Ji, Jinru; Xu, Hao; Zheng, Beiwen; Xiao, Yonghong

2017-05-12

Shigellosis is the most common cause of gastrointestinal infections in developing countries. In China, the species most frequently responsible for shigellosis is Shigella flexneri. S. flexneri remains largely unexplored from a genomic standpoint and is still described using a vocabulary based on biochemical and serological properties. Moreover, increasing numbers of ESBL-producing Shigella strains have been isolated from clinical samples. Despite this, only a few cases of ESBL-producing Shigella have been described in China. Therefore, a better understanding of ESBL-producing Shigella from a genomic standpoint is required. In this study, a S. flexneri type 1a isolate SP1 harboring bla CTX-M-14 , which was recovered from the patient with diarrhea, was subjected to whole genome sequencing. The draft genome assembly of S. flexneri strain SP1 consisted of 4,592,345 bp with a G+C content of 50.46%. RAST analysis revealed the genome contained 4798 coding sequences (CDSs) and 100 RNA-encoding genes. We detected one incomplete prophage and six candidate CRISPR loci in the genome. In vitro antimicrobial susceptibility testing demonstrated that strain SP1 is resistant to ampicillin, amoxicillin/clavulanic acid, cefazolin, ceftriaxone and trimethoprim. In silico analysis detected genes mediating resistance to aminoglycosides, β-lactams, phenicol, tetracycline, sulphonamides, and trimethoprim. The bla CTX-M-14 gene was located on an IncFII2 plasmid. A series of virulence factors were identified in the genome. In this study, we report the whole genome sequence of a bla CTX-M-14 -encoding S. flexneri strain SP1. Dozens of resistance determinants were detected in the genome and may be responsible for the multidrug-resistance of this strain, although further confirmation studies are warranted. Numerous virulence factors identified in the strain suggest that isolate SP1 is potential pathogenic. The availability of the genome sequence and comparative analysis with other S

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago.

Science.gov (United States)

Akpaka, Patrick E; Roberts, Rashida; Monecke, Stefan

Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago. Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST) analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions. S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community. S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB), linezolid (cfr) or vancomycin (vanA). The blaZ gene, which is the most common beta lactam (Penicillinase) resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster, belonged to CC8. Several

Virulence Factor Genes in Staphylococcus aureus Isolated From Diabetic Foot Soft Tissue and Bone Infections.

Science.gov (United States)

Víquez-Molina, Gerardo; Aragón-Sánchez, Javier; Pérez-Corrales, Cristian; Murillo-Vargas, Christian; López-Valverde, María Eugenia; Lipsky, Benjamin A

2018-03-01

The aim of this study is to describe the presence of genes encoding for 4 virulence factors (pvl, eta, etb, and tsst), as well as the mecA gene conferring resistance to beta-lactam antibiotics, in patients with diabetes and a staphylococcal foot infection. We have also analyzed whether isolates of Staphylococcus aureus from bone infections have a different profile for these genes compared with those from exclusively soft tissue infections. In this cross-sectional study of a prospectively recruited series of patients admitted to the Diabetic Foot Unit, San Juan de Dios Hospital, San José, Costa Rica with a moderate or severe diabetic foot infection (DFI), we collected samples from infected soft tissue and from bone during debridement. During the study period (June 1, 2014 to May 31, 2016), we treated 379 patients for a DFI. S aureus was isolated from 101 wound samples, of which 43 were polymicrobial infections; we only included the 58 infections that were monomicrobial S aureus for this study. Infections were exclusively soft tissue in 17 patients (29.3%) while 41 (70.7%) had bone involvement (osteomyelitis). The mecA gene was detected in 35 cases (60.3%), pvl gene in 4 cases (6.9%), and tsst gene in 3 (5.2%). We did not detect etA and etB in any of the cases. There were no differences in the profile of S aureus genes encoding for virulence factors (pvl, etA, etB, and tsst) recovered from DFIs between those with just soft tissue compared to those with osteomyelitis. However, we found a significantly higher prevalence of pvl+ strains of S aureus associated with soft tissue compared with bone infections. Furthermore, we observed a significantly longer time to healing among patients infected with mecA+ (methicillin-resistant) S aureus (MRSA).

RNA-Seq analysis of isolate- and growth phase-specific differences in the global transcriptomes of enteropathogenic Escherichia coli prototype isolates

Science.gov (United States)

Hazen, Tracy H.; Daugherty, Sean C.; Shetty, Amol; Mahurkar, Anup A.; White, Owen; Kaper, James B.; Rasko, David A.

2015-01-01

Enteropathogenic Escherichia coli (EPEC) are a leading cause of diarrheal illness among infants in developing countries. E. coli isolates classified as typical EPEC are identified by the presence of the locus of enterocyte effacement (LEE) and the bundle-forming pilus (BFP), and absence of the Shiga-toxin genes, while the atypical EPEC also encode LEE but do not encode BFP or Shiga-toxin. Comparative genomic analyses have demonstrated that EPEC isolates belong to diverse evolutionary lineages and possess lineage- and isolate-specific genomic content. To investigate whether this genomic diversity results in significant differences in global gene expression, we used an RNA sequencing (RNA-Seq) approach to characterize the global transcriptomes of the prototype typical EPEC isolates E2348/69, B171, C581-05, and the prototype atypical EPEC isolate E110019. The global transcriptomes were characterized during laboratory growth in two different media and three different growth phases, as well as during adherence of the EPEC isolates to human cells using in vitro tissue culture assays. Comparison of the global transcriptomes during these conditions was used to identify isolate- and growth phase-specific differences in EPEC gene expression. These analyses resulted in the identification of genes that encode proteins involved in survival and metabolism that were coordinately expressed with virulence factors. These findings demonstrate there are isolate- and growth phase-specific differences in the global transcriptomes of EPEC prototype isolates, and highlight the utility of comparative transcriptomics for identifying additional factors that are directly or indirectly involved in EPEC pathogenesis. PMID:26124752

Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

Science.gov (United States)

Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

1998-01-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

Science.gov (United States)

Allignet, J; Liassine, N; el Solh, N

1998-07-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

Regulation of gene expression by low levels of ultraviolet-B radiation in Pisum sativum: Isolation of novel genes by suppression subtractive hybridisation

International Nuclear Information System (INIS)

Sävenstrand, H.; Brosché, M.; Strid, A.

2002-01-01

Suppression subtractive hybridisation was used to isolate genes differentially regulated by low levels (UV-B BE,300 0.13 W m -2 ) of ultraviolet-B radiation (UV-B; 290–320 nm) in Pisum sativum. Six genes were regulated, two of which were novel. The mRNA levels for these two (PsTSDC and PsUOS1) were increased and depressed by UV-B treatment, respectively. Domains in the PsTSDC translation product was similar to TIR (Toll-Interleukin-1 receptor-similar) domains and a NB-ARC domain (nucleotide-binding domain in APAF-1, R gene products and CED-4). The PsUOS1 translation product was similar to an open reading frame in Arabidopsis. Genes encoding embryo-abundant protein (PsEMB) and S-adenosyl-l-methionine synthase (PsSAMS) were induced by UV-B, whereas the transcript levels for genes encoding sucrose transport protein (PsSUT) or ribulose-5-phosphate 3-epimerase (PsR5P3E) were decreased. These regulation patterns are novel, and the PsEMB and PsR5P3E sequences are reported for the first time. The stress-specificity of regulation of these genes were tested by ozone fumigation (100 ppb O 3 ). Qualitatively, the similarity of expression after both UV-B and ozone exposure suggests that, for these genes, similar stress-response pathways are in action. (author)

Large IncHI2-plasmids encode extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates, and support ESBL-transfer to Escherichia coli.

Science.gov (United States)

Nilsen, E; Haldorsen, B C; Sundsfjord, A; Simonsen, G S; Ingebretsen, A; Naseer, U; Samuelsen, O

2013-11-01

We investigated the prevalence of extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates from 19 hospital laboratories in Norway during 2011. A total of 62/230 (27%) isolates were resistant to third-generation cephalosporins and four (1.7%) were ESBL-positive; blaCTX -M-15 (n = 3) and blaSHV -12 (n = 1). This is comparable to the prevalence of ESBLs in clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway during the same period. All ESBL-positive isolates were multidrug resistant (MDR) and harboured plasmid-mediated quinolone resistance. Three isolates supported transfer of large IncHI2-plasmids harbouring ESBL- and MDR-encoding genes to E. coli recipients by in vitro conjugation. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Occurrence of Ambler Class B Metallo-β-Lactamase Gene in Imipenem-Resistant Pseudomonas Aeruginosa Strains Isolated from Clinical Samples

Directory of Open Access Journals (Sweden)

Zeynab Golshani

2014-02-01

Full Text Available Background: 5TMetallo-β-lactamase (MBLs can hydrolyze a broad spectrum of beta-lactams, including penicillins, cephalosporins, and carbapenems. Genes encoding these enzymes are located on the plasmid that can easily be transferred to other bacteria. The aim of this study was to isolate and identify the Pseudomonas aeruginosa strains encoding VIM1 gene, in clinical samples, using the PCR technique. Materials and Methods: During a 4 month period, 100 strains of Pseudomonas aeruginosa from clinical specimens were collected. Standard tests were performed to identify strains of Pseudomonas aeruginosa. Resistance to antibiotics was examined and then the PCR was used to detect VIM1gene. Results:In this study, the highest rates of resistance to antibiotics, amikacin and cefotaxime was observed (65% and 62%, the lowest resistance to antibiotics piperacillin (48% and imipenem and cefepime with 55% resistance was reported. DDST method was performed for 37 strains for the MBl detection. Among the 37 isolate, 30 strains were MBL-producing with imipenem-EDTA method. Twelve strains (18% were carriers of VIM1 gene using the PCR method. Conclusion: In the present study, the prevalence of strains producing MBL genes in strains of hospitals is a growing trend; correct prescription of medications can prevent the spread of resistant pathogens. It is suggested that molecular methods for rapid detection of resistance genes can be used to prevent the spread of this genes.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

Haloalkane-utilizing Rhodococcus strains isolated from geographically distinct locations possess a highly conserved gene cluster encoding haloalkane catabolism

NARCIS (Netherlands)

Poelarends, GJ; Bosma, T; Kulakov, LA; Larkin, MJ; Marchesi, [No Value; Weightman, AJ; Janssen, DB; Kulakov, Leonid A.; Larkin, Michael J.; Marchesi, Julian R.; Weightman, Andrew J.

The sequences of the 16S rRNA and haloalkane dehalogenase (dhaA) genes of five gram-positive haloalkane-utilizing bacteria isolated from contaminated sites in Europe, Japan, and the United States and of the archetypal haloalkane-degrading bacterium Rhodococcus sp. strain NCIMB13064 were compared.

Diverse and Abundant Secondary Metabolism Biosynthetic Gene Clusters in the Genomes of Marine Sponge Derived Streptomyces spp. Isolates

Directory of Open Access Journals (Sweden)

Stephen A. Jackson

2018-02-01

Full Text Available The genus Streptomyces produces secondary metabolic compounds that are rich in biological activity. Many of these compounds are genetically encoded by large secondary metabolism biosynthetic gene clusters (smBGCs such as polyketide synthases (PKS and non-ribosomal peptide synthetases (NRPS which are modular and can be highly repetitive. Due to the repeats, these gene clusters can be difficult to resolve using short read next generation datasets and are often quite poorly predicted using standard approaches. We have sequenced the genomes of 13 Streptomyces spp. strains isolated from shallow water and deep-sea sponges that display antimicrobial activities against a number of clinically relevant bacterial and yeast species. Draft genomes have been assembled and smBGCs have been identified using the antiSMASH (antibiotics and Secondary Metabolite Analysis Shell web platform. We have compared the smBGCs amongst strains in the search for novel sequences conferring the potential to produce novel bioactive secondary metabolites. The strains in this study recruit to four distinct clades within the genus Streptomyces. The marine strains host abundant smBGCs which encode polyketides, NRPS, siderophores, bacteriocins and lantipeptides. The deep-sea strains appear to be enriched with gene clusters encoding NRPS. Marine adaptations are evident in the sponge-derived strains which are enriched for genes involved in the biosynthesis and transport of compatible solutes and for heat-shock proteins. Streptomyces spp. from marine environments are a promising source of novel bioactive secondary metabolites as the abundance and diversity of smBGCs show high degrees of novelty. Sponge derived Streptomyces spp. isolates appear to display genomic adaptations to marine living when compared to terrestrial strains.

The first report of the vanC1 gene in Enterococcus faecium isolated from a human clinical specimen

Directory of Open Access Journals (Sweden)

Mingyue Sun

2014-09-01

Full Text Available The vanC1 gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC1gene. Polymerase chain reaction (PCR assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC1and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC1 gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC1gene. However, this study is the first to report the presence of the vanC1gene in E. faecium of human origin. Additionally, our research showed the vanC1gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC1gene from different species.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

Science.gov (United States)

Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

2014-03-01

The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

Directory of Open Access Journals (Sweden)

Heffer Alison

2011-03-01

Full Text Available Abstract Background Tremendous progress has been made in the field of evo-devo through comparisons of related genes from diverse taxa. While the vast number of species in nature precludes a complete analysis of the molecular evolution of even one single gene family, this would not be necessary to understand fundamental mechanisms underlying gene evolution if experiments could be designed to systematically sample representative points along the path of established phylogenies to trace changes in regulatory and coding gene sequence. This isolation of homologous genes from phylogenetically diverse, representative species can be challenging, especially if the gene is under weak selective pressure and evolving rapidly. Results Here we present an approach - Rapid Isolation of Gene Homologs across Taxa (RIGHT - to efficiently isolate specific members of gene families. RIGHT is based upon modification and a combination of degenerate polymerase chain reaction (PCR and gene-specific amplified fragment length polymorphism (AFLP. It allows targeted isolation of specific gene family members from any organism, only requiring genomic DNA. We describe this approach and how we used it to isolate members of several different gene families from diverse arthropods spanning millions of years of evolution. Conclusions RIGHT facilitates systematic isolation of one gene from large gene families. It allows for efficient gene isolation without whole genome sequencing, RNA extraction, or culturing of non-model organisms. RIGHT will be a generally useful method for isolation of orthologs from both distant and closely related species, increasing sample size and facilitating the tracking of molecular evolution of gene families and regulatory networks across the tree of life.

The distribution of beta lactamase genes in Escherichia coli phylotypes isolated from diarrhea and UTI cases in northwest Iran.

Science.gov (United States)

Hemati, Zahra; Ghanbarpour, Reza; Alizade, Hesam

2014-01-01

Pathogenic Escherichia coli strains are a common cause of intestinal and extra-intestinal infections, especially in developing countries. Extended spectrum beta-lactamases (ESBLS), a heterogeneous group of plasmid-encoded beta-lactamases, are common throughout the world. The aim of the present study was to determine the phenotypic and genotypic characteristics of ESBLS produced by E. coli isolates taken from patients with diarrhea and urinary tract infections (UTI) in northwest Iran. A total of 132 E. coli isolates (92 isolates from UTI and 40 isolates from diarrheic cases) were recovered and confirmed by biochemical tests. The isolates were examined for blaTEM and blaSHV genes and phylogenetic background by two multiplex PCR assays. The isolates were tested for antibiotic susceptibility against nine antibiotic agents by the disk diffusion method. The phylogenetic analysis showed that the UTI isolates mostly fell into phylo-group B2, followed by D, while the diarrheic isolates belonged to phylo-groups D and A. Out of 92 UTI isolates, 29.3% and 17.4% possessed blaTEM and blaSHV genes, respectively. Ten diarrheic isolates were positive for blaTEM, two isolates possessed the blaSHV gene, and one isolate was positive for both genes. The UTI isolates that were positive for blaTEM and blaSHV genes mostly belonged to phylo-groups D and B2, whereas the diarrhea isolates were in phylo-groups D and A. Phylogenetic group D isolates have an accumulation of ESBLS genes in the diarrheic and UTI isolates. In both the UTI and diarrhea isolates, the maximum rate of resistance was against cefazolin, and the minimum rate of resistance was against nitrofurantoin. Twenty-four antibiotic resistance patterns were observed among the isolates. The amikacin, ciprofloxacin, cefotaxime, cefuroxime, cefazolin, gentamicin, nalidixic acid and trimethoprim/sulfamethoxazole resistance pattern was the most prevalent in the isolates that belonged to phylo-group D. The correct choice of effective

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Molecular characterization of antimicrobial resistance genes against Staphylococcus aureus isolates from Trinidad and Tobago

Directory of Open Access Journals (Sweden)

Patrick E. Akpaka

2017-05-01

Full Text Available Summary: Staphylococcus aureus continues to pose major public health challenges in many areas because of antibiotic resistance problems. In the Caribbean, especially Trinidad and Tobago, the challenge is not different. This study was performed to evaluate the antimicrobial resistance gene prevalence among S. aureus isolates in Trinidad and Tobago.Standard and molecular microbiological methods, including the Microscan automated system, DNA microarray and multi locus sequence typing (MLST analysis, were performed on 309 clinical S. aureus isolates recovered from patients who were treated at three of the country's main health institutions.S. aureus exhibited susceptibilities ≥80% to eleven of the 19 antimicrobials tested against it, and these belong to the most commonly used and available antibiotics in the country. While the antibiotic to which it was most susceptible of the commonly used antibiotics was trimethoprim/sulfamethoxazole, the antibiotics to which it was least susceptible or most resistant to were ampicillin and penicillin. S. aureus isolates from the pediatric ward produced the greatest rate of susceptibility among the isolates recovered from patients admitted into hospitals, while isolates from Accident and Emergency rooms displayed the greatest susceptibilities among patients from the community.S. aureus isolates from the country did not harbor acquired resistant genes targeting clindamycin/macrolides (ermB, linezolid (cfr or vancomycin (vanA. The blaZ gene, which is the most common beta lactam (Penicillinase resistance mechanism for S. aureus, was observed in 88.7% of the methicillin susceptible S. aureus, while methicillin resistance mediated by the mec gene was present in 13.6%. Most of the resistance markers found in MRSA isolates were significantly associated with the ST239-MRSA-III strain in this study, and all isolates that belonged to the USA300 strain, which additionally encoded both the PVL gene and ACME cluster

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations.

Science.gov (United States)

Muller, L A H; Craciun, A R; Ruytinx, J; Lambaerts, M; Verbruggen, N; Vangronsveld, J; Colpaert, J V

2007-10-01

Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in different classes of expression pattern, were isolated and sequenced. Thirty-six of the represented genes showed homology to function-known genes, whereas 6 matched unknown protein coding sequences, and 102 were possibly novel. Although relatively few TDFs were found to be responsive to the different zinc treatments, their modulated expression levels may suggest a different transcriptional response to zinc treatments in both isolates. Among the identified genes that could be related to heavy-metal detoxification or the tolerance trait were genes encoding for homologues of a heat-shock protein, a putative metal transporter, a hydrophobin, and several proteins involved in ubiquitin-dependent proteolysis.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Multilocus Sequence Typing and Virulence-Associated Gene Profile Analysis of Staphylococcus aureus Isolates From Retail Ready-to-Eat Food in China.

Science.gov (United States)

Yang, Xiaojuan; Yu, Shubo; Wu, Qingping; Zhang, Jumei; Wu, Shi; Rong, Dongli

2018-01-01

The aim of this study was to characterize the subtypes and virulence profiles of 69 Staphylococcus aureus isolates obtained from retail ready-to-eat food in China. The isolates were analyzed using multilocus sequence typing (MLST) and polymerase chain reaction (PCR) analysis of important virulence factor genes, including the staphylococcal enterotoxin (SE) genes ( sea , seb , sec , sed , see , seg , seh , sei , sej ), the exfoliative toxin genes ( eta and etb ), the toxic shock syndrome toxin-1 gene ( tst ), and the Panton-Valentine leucocidin-encoding gene ( pvl ). The isolates encompassed 26 different sequence types (STs), including four new STs (ST3482, ST3484, ST3485, ST3504), clustered in three clonal complexes and 17 singletons. The most prevalent STs were ST1, ST6, and ST15, constituting 34.8% of all isolates. Most STs (15/26, 57.7%) detected have previously been associated with human infections. All 13 toxin genes examined were detected in the S. aureus isolates, with 84.1% of isolates containing toxin genes. The three most prevalent toxin genes were seb (36.2%), sea (33.3%), and seg (33.3%). The classical SE genes ( sea - see ), which contribute significantly to staphylococcal food poisoning (SFP), were detected in 72.5% of the S. aureus isolates. In addition, pvl , eta , etb , and tst were found in 11.6, 10.1, 10.1, and 7.2% of the S. aureus isolates, respectively. Strains ST6 carrying sea and ST1 harboring sec-seh enterotoxin profile, which are the two most common clones associated with SFP, were also frequently detected in the food samples in this study. This study indicates that these S. aureus isolates present in Chinese ready-to-eat food represents a potential public health risk. These data are valuable for epidemiological studies, risk management, and public health strategies.

Multilocus Sequence Typing and Virulence-Associated Gene Profile Analysis of Staphylococcus aureus Isolates From Retail Ready-to-Eat Food in China

Directory of Open Access Journals (Sweden)

Xiaojuan Yang

2018-03-01

Full Text Available The aim of this study was to characterize the subtypes and virulence profiles of 69 Staphylococcus aureus isolates obtained from retail ready-to-eat food in China. The isolates were analyzed using multilocus sequence typing (MLST and polymerase chain reaction (PCR analysis of important virulence factor genes, including the staphylococcal enterotoxin (SE genes (sea, seb, sec, sed, see, seg, seh, sei, sej, the exfoliative toxin genes (eta and etb, the toxic shock syndrome toxin-1 gene (tst, and the Panton-Valentine leucocidin-encoding gene (pvl. The isolates encompassed 26 different sequence types (STs, including four new STs (ST3482, ST3484, ST3485, ST3504, clustered in three clonal complexes and 17 singletons. The most prevalent STs were ST1, ST6, and ST15, constituting 34.8% of all isolates. Most STs (15/26, 57.7% detected have previously been associated with human infections. All 13 toxin genes examined were detected in the S. aureus isolates, with 84.1% of isolates containing toxin genes. The three most prevalent toxin genes were seb (36.2%, sea (33.3%, and seg (33.3%. The classical SE genes (sea–see, which contribute significantly to staphylococcal food poisoning (SFP, were detected in 72.5% of the S. aureus isolates. In addition, pvl, eta, etb, and tst were found in 11.6, 10.1, 10.1, and 7.2% of the S. aureus isolates, respectively. Strains ST6 carrying sea and ST1 harboring sec-seh enterotoxin profile, which are the two most common clones associated with SFP, were also frequently detected in the food samples in this study. This study indicates that these S. aureus isolates present in Chinese ready-to-eat food represents a potential public health risk. These data are valuable for epidemiological studies, risk management, and public health strategies.

Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase β-subunit gene family

International Nuclear Information System (INIS)

Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.

2011-01-01

Highlights: → Structural properties of BetaM and Na,K-ATPase β-subunits are sharply different. → BetaM protein is concentrated in nuclear membrane of skeletal myocytes. → BetaM does not associate with a Na,K-ATPase α-subunit in skeletal muscle. → Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. → BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a β-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase β-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was also characterized by SELDI-TOF mass

Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

Energy Technology Data Exchange (ETDEWEB)

Pestov, Nikolay B. [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Moscow 117997 (Russian Federation); Zhao, Hao [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Basrur, Venkatesha [Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109 (United States); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)

2011-09-09

Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Implication of lateral genetic transfer in the emergence of Aeromonas hydrophila isolates of epidemic outbreaks in channel catfish.

Directory of Open Access Journals (Sweden)

Mohammad J Hossain

Full Text Available To investigate the molecular basis of the emergence of Aeromonas hydrophila responsible for an epidemic outbreak of motile aeromonad septicemia of catfish in the Southeastern United States, we sequenced 11 A. hydrophila isolates that includes five reference and six recent epidemic isolates. Comparative genomics revealed that recent epidemic A. hydrophila isolates are highly clonal, whereas reference isolates are greatly diverse. We identified 55 epidemic-associated genetic regions with 313 predicted genes that are present in epidemic isolates but absent from reference isolates and 35% of these regions are located within genomic islands, suggesting their acquisition through lateral gene transfer. The epidemic-associated regions encode predicted prophage elements, pathogenicity islands, metabolic islands, fitness islands and genes of unknown functions, and 34 of the genes encoded in these regions were predicted as virulence factors. We found two pilus biogenesis gene clusters encoded within predicted pathogenicity islands. A functional metabolic island that encodes a complete pathway for myo-inositol catabolism was evident by the ability of epidemic A. hydrophila isolates to use myo-inositol as a sole carbon source. Testing of A. hydrophila field isolates found a consistent correlation between myo-inositol utilization as a sole carbon source and the presence of an epidemic-specific genetic marker. All epidemic isolates and one reference isolate shared a novel O-antigen cluster. Altogether we identified four different O-antigen biosynthesis gene clusters within the 11 sequenced A. hydrophila genomes. Our study reveals new insights into the evolutionary changes that have resulted in the emergence of recent epidemic A. hydrophila strains.

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

Isolation, characterization, and mapping of gene encoding dihydrolipoyl succinyltransferase (E2k) of human [alpha]-ketoglutarate dehydrogenase complex

Energy Technology Data Exchange (ETDEWEB)

Ali, G.; Cai, Xingang; Sheu, Kwan-Fu R.; Blass, J.P. (Cornell Univ. Medical College, White Plains, NY (United States)); Wasco, W.; Gaston, S.M.; Tanzi, R.E.; Cooper, A.J.L.; Gusella, J.F. (Massachusetts General Hospital, Charleston, MA (United States)); Szabo, P. (Cornell Univ. Medical College, New York, NY (United States))

1994-03-01

The authors have isolated and sequenced cDNAs representing the full-length (2987-bp) gene for dihydrolipoyl succinyltransferase (E2k component) of the human [alpha]-ketoglutarate dehydrogenase complex (KHDHC) from a human fetal brain cDNA library. The E2k cDNA was mapped to human chromosome 14 using a somatic cell hybrid panel, and more precisely to band 14q24.3 by in situ hybridization. This cDNA also cross-hybridized to an apparent E2k pseudogene on chromosome 1p31. Northern analysis revealed the E2k gene to be ubiquitously expressed in peripheral tissues and brain. Interestingly, chromosome 14q24.3 has recently been reported to contain gene defects for an early-onset form of familial Alzheimer's disease and for Machado-Joseph disease. Future studies will be necessary to determine whether the E2K gene plays a role in either of these two disorders.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

Science.gov (United States)

Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

2016-01-01

Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Isolation and characterization of a gene encoding a polyethylene ...

Indian Academy of Sciences (India)

Prakash

Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

Science.gov (United States)

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Isolation and characterization of cDNAs encoding leucoanthocyanidin reductase and anthocyanidin reductase from Populus trichocarpa.

Directory of Open Access Journals (Sweden)

Lijun Wang

Full Text Available Proanthocyanidins (PAs contribute to poplar defense mechanisms against biotic and abiotic stresses. Transcripts of PA biosynthetic genes accumulated rapidly in response to infection by the fungus Marssonina brunnea f.sp. multigermtubi, treatments of salicylic acid (SA and wounding, resulting in PA accumulation in poplar leaves. Anthocyanidin reductase (ANR and leucoanthocyanidin reductase (LAR are two key enzymes of the PA biosynthesis that produce the main subunits: (+-catechin and (--epicatechin required for formation of PA polymers. In Populus, ANR and LAR are encoded by at least two and three highly related genes, respectively. In this study, we isolated and functionally characterized genes PtrANR1 and PtrLAR1 from P. trichocarpa. Phylogenetic analysis shows that Populus ANR1 and LAR1 occurr in two distinct phylogenetic lineages, but both genes have little difference in their tissue distribution, preferentially expressed in roots. Overexpression of PtrANR1 in poplar resulted in a significant increase in PA levels but no impact on catechin levels. Antisense down-regulation of PtrANR1 showed reduced PA accumulation in transgenic lines, but increased levels of anthocyanin content. Ectopic expression of PtrLAR1 in poplar positively regulated the biosynthesis of PAs, whereas the accumulation of anthocyanin and flavonol was significantly reduced (P<0.05 in all transgenic plants compared to the control plants. These results suggest that both PtrANR1 and PtrLAR1 contribute to PA biosynthesis in Populus.

Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

Science.gov (United States)

Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

2006-01-01

Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

Microarray based study on virulence-associated genes and resistance determinants of Staphylococcus aureus isolates from cattle.

Science.gov (United States)

Monecke, Stefan; Kuhnert, Peter; Hotzel, Helmut; Slickers, Peter; Ehricht, Ralf

2007-11-15

Staphylococcus aureus is a common pathogen which can colonise and infect not only man, but also domestic animals. Especially, infection of cattle is of high economic relevance as S. aureus is an important causal agent of bovine mastitis. In the present contribution, a DNA microarray was applied for the study of 144 different gene targets, including resistance genes and genes encoding exotoxins, in S. aureus isolated from cows. One hundred and twenty-eight isolates from Germany and Switzerland were tested. These isolates were assigned to 20 different strains and nine clonal complexes. The majority of isolates belonged either to apparently closely related clonal complexes 8, 25, and 97 (together 34.4%) or were related to the sequenced bovine strain RF122 (48.4%). Notable characteristics of S. aureus of bovine origin are the carriage of intact haemolysin beta (in 82% of isolates tested), the absence of staphylokinase (in 89.1%), the presence of allelic variants of several exotoxins such as toxic shock syndrome toxin and enterotoxin N, and the occurrence of the leukocidin lukF-P83/lukM (in 53.1%). Two isolates were methicillin-resistant S. aureus (MRSA). One of them was a clonal complex 8 MRSA related to the epidemic MRSA strain Irish 01. The other one belonged to ST398/spa-type 34 resembling a newly emerging MRSA strain which has been described to occur in humans as well as in domestic animals. The presence of these two strains highlights the possibility of transfers of S. aureus strains between different host species.

Comparative gene expression analysis throughout the life cycle of Leishmania braziliensis: diversity of expression profiles among clinical isolates.

Directory of Open Access Journals (Sweden)

Vanessa Adaui

Full Text Available BACKGROUND: Most of the Leishmania genome is reported to be constitutively expressed during the life cycle of the parasite, with a few regulated genes. Inter-species comparative transcriptomics evidenced a low number of species-specific differences related to differentially distributed genes or the differential regulation of conserved genes. It is of uppermost importance to ensure that the observed differences are indeed species-specific and not simply specific of the strains selected for representing the species. The relevance of this concern is illustrated by current study. METHODOLOGY/PRINCIPAL FINDINGS: We selected 5 clinical isolates of L. braziliensis characterized by their diversity of clinical and in vitro phenotypes. Real-time quantitative PCR was performed on promastigote and amastigote life stages to assess gene expression profiles at seven time points covering the whole life cycle. We tested 12 genes encoding proteins with roles in transport, thiol-based redox metabolism, cellular reduction, RNA poly(A-tail metabolism, cytoskeleton function and ribosomal function. The general trend of expression profiles showed that regulation of gene expression essentially occurs around the stationary phase of promastigotes. However, the genes involved in this phenomenon appeared to vary significantly among the isolates considered. CONCLUSION/SIGNIFICANCE: Our results clearly illustrate the unique character of each isolate in terms of gene expression dynamics. Results obtained on an individual strain are not necessarily representative of a given species. Therefore, extreme care should be taken when comparing the profiles of different species and extrapolating functional differences between them.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Genomic sequence and organization of two members of a human lectin gene family

International Nuclear Information System (INIS)

Gitt, M.A.; Barondes, S.H.

1991-01-01

The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

Isolation and identification of gene mediating radiation-induced apoptosis in human leukemia U937 cells

International Nuclear Information System (INIS)

Tong Xin; Luo Ying; Dong Yan; Sun Zhixian

1998-01-01

Objective: Increasing evidences suggest that Caspase family proteases play an important role in the effector mechanism of apoptotic cell death. Radiation (IR) can induce apoptosis in tumor cells, so it is very important to isolate and identify the member of the Caspase family proteases involved in IR-induced apoptosis, and this would contribute to the understanding of the mechanism responsible for apoptosis execution. Methods: A PCR approach to isolate genes for IR-induced apoptosis was developed. The approach used degenerated oligonucleotide encoding the highly conserved peptides that were present in all known Caspases. Results: Protease inhibitors special for Caspases could block the apoptotic cell death caused by IR, and Caspase-3 was isolated from irradiated human leukemia U937 cells. Conclusion: Caspases involve in IR-induced apoptosis, and Caspase-3 is the pivotal element of IR-induced apoptosis

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

Science.gov (United States)

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

Directory of Open Access Journals (Sweden)

Soudabeh Heidari

2013-09-01

Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

The barley Jip23b gene

DEFF Research Database (Denmark)

Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John

2002-01-01

The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Development of a Rhizoctonia solani AG1-IB Specific Gene Model Enables Comparative Genome Analyses between Phytopathogenic R. solani AG1-IA, AG1-IB, AG3 and AG8 Isolates.

Directory of Open Access Journals (Sweden)

Daniel Wibberg

Full Text Available Rhizoctonia solani, a soil-born plant pathogenic basidiomycetous fungus, affects various economically important agricultural and horticultural crops. The draft genome sequence for the R. solani AG1-IB isolate 7/3/14 as well as a corresponding transcriptome dataset (Expressed Sequence Tags--ESTs were established previously. Development of a specific R. solani AG1-IB gene model based on GMAP transcript mapping within the eukaryotic gene prediction platform AUGUSTUS allowed detection of new genes and provided insights into the gene structure of this fungus. In total, 12,616 genes were recognized in the genome of the AG1-IB isolate. Analysis of predicted genes by means of different bioinformatics tools revealed new genes whose products potentially are involved in degradation of plant cell wall components, melanin formation and synthesis of secondary metabolites. Comparative genome analyses between members of different R. solani anastomosis groups, namely AG1-IA, AG3 and AG8 and the newly annotated R. solani AG1-IB genome were performed within the comparative genomics platform EDGAR. It appeared that only 21 to 28% of all genes encoded in the draft genomes of the different strains were identified as core genes. Based on Average Nucleotide Identity (ANI and Average Amino-acid Identity (AAI analyses, considerable sequence differences between isolates representing different anastomosis groups were identified. However, R. solani isolates form a distinct cluster in relation to other fungi of the phylum Basidiomycota. The isolate representing AG1-IB encodes significant more genes featuring predictable functions in secondary metabolite production compared to other completely sequenced R. solani strains. The newly established R. solani AG1-IB 7/3/14 gene layout now provides a reliable basis for post-genomics studies.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

Science.gov (United States)

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

International Nuclear Information System (INIS)

Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

1987-01-01

A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

K19 capsular polysaccharide of Acinetobacter baumannii is produced via a Wzy polymerase encoded in a small genomic island rather than the KL19 capsule gene cluster.

Science.gov (United States)

Kenyon, Johanna J; Shneider, Mikhail M; Senchenkova, Sofya N; Shashkov, Alexander S; Siniagina, Maria N; Malanin, Sergey Y; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2016-08-01

Polymerization of the oligosaccharides (K units) of complex capsular polysaccharides (CPSs) requires a Wzy polymerase, which is usually encoded in the gene cluster that directs K unit synthesis. Here, a gene cluster at the Acinetobacter K locus (KL) that lacks a wzy gene, KL19, was found in Acinetobacter baumannii ST111 isolates 28 and RBH2 recovered from hospitals in the Russian Federation and Australia, respectively. However, these isolates produced long-chain capsule, and a wzy gene was found in a 6.1 kb genomic island (GI) located adjacent to the cpn60 gene. The GI also includes an acetyltransferase gene, atr25, which is interrupted by an insertion sequence (IS) in RBH2. The capsule structure from both strains was →3)-α-d-GalpNAc-(1→4)-α-d-GalpNAcA-(1→3)-β-d-QuipNAc4NAc-(1→, determined using NMR spectroscopy. Biosynthesis of the K unit was inferred to be initiated with QuiNAc4NAc, and hence the Wzy forms the β-(1→3) linkage between QuipNAc4NAc and GalpNAc. The GalpNAc residue is 6-O-acetylated in isolate 28 only, showing that atr25 is responsible for this acetylation. The same GI with or without an IS in atr25 was found in draft genomes of other KL19 isolates, as well as ones carrying a closely related CPS gene cluster, KL39, which differs from KL19 only in a gene for an acyltransferase in the QuiNAc4NR synthesis pathway. Isolates carrying a KL1 variant with the wzy and atr genes each interrupted by an ISAba125 also have this GI. To our knowledge, this study is the first report of genes involved in capsule biosynthesis normally found at the KL located elsewhere in A. baumannii genomes.

PCR-Based Analysis of ColE1 Plasmids in Clinical Isolates and Metagenomic Samples Reveals Their Importance as Gene Capture Platforms

Directory of Open Access Journals (Sweden)

Manuel Ares-Arroyo

2018-03-01

Full Text Available ColE1 plasmids are important vehicles for the spread of antibiotic resistance in the Enterobacteriaceae and Pasteurellaceae families of bacteria. Their monitoring is essential, as they harbor important resistant determinants in humans, animals and the environment. In this work, we have analyzed ColE1 replicons using bioinformatic and experimental approaches. First, we carried out a computational study examining the structure of different ColE1 plasmids deposited in databases. Bioinformatic analysis of these ColE1 replicons revealed a mosaic genetic structure consisting of a host-adapted conserved region responsible for the housekeeping functions of the plasmid, and a variable region encoding a wide variety of genes, including multiple antibiotic resistance determinants. From this exhaustive computational analysis we developed a new PCR-based technique, targeting a specific sequence in the conserved region, for the screening, capture and sequencing of these small plasmids, either specific for Enterobacteriaceae or specific for Pasteurellaceae. To validate this PCR-based system, we tested various collections of isolates from both bacterial families, finding that ColE1 replicons were not only highly prevalent in antibiotic-resistant isolates, but also present in susceptible bacteria. In Pasteurellaceae, ColE1 plasmids carried almost exclusively antibiotic resistance genes. In Enterobacteriaceae, these plasmids encoded a large range of traits, including not only antibiotic resistance determinants, but also a wide variety of genes, showing the huge genetic plasticity of these small replicons. Finally, we also used a metagenomic approach in order to validate this technique, performing this PCR system using total DNA extractions from fecal samples from poultry, turkeys, pigs and humans. Using Illumina sequencing of the PCR products we identified a great diversity of genes encoded by ColE1 replicons, including different antibiotic resistance

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

Directory of Open Access Journals (Sweden)

Yi-Li Li

2017-11-01

Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

Science.gov (United States)

Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

2008-12-10

Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

Science.gov (United States)

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

Directory of Open Access Journals (Sweden)

Hamed Esmaeil Lashgarian

2016-10-01

Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Detection of the enterotoxigenic genes (sei,sej) in Staphylococcus aureus isolates from bovine mastitis milk in the West Azerbaijan of Iran.

Science.gov (United States)

Ahmady, Malahat; Kazemi, Sahar

2013-07-01

Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis of dairy domestic ruminants. This organism produces a variety of extracellular toxins and virulence factors such as enterotoxin SEI and SEJ that contribute to its pathogenic potential. In this study 25 S. aureus isolates obtained from four dairy herds of Urmia region which is located in West Azerbaijan province in Iran. The tested isolates were identified on the basis of the cultural and biochemical properties, as well as amplification of the aroA gene which is specific for S. aureus . All isolates were also analyzed for the presence of the SEI ( sei ) and SEJ ( sej ) encoding genes using polymerase chain reaction (PCR). Seven positive isolates were detected for sei , but sej gene was not detected in any of the total number of 25 isolates. The present study revealed that the PCR amplification of the aroA gene could be used as a powerful tool for identification of S. aureus from the cases of bovine mastitis. Results of the present study also showed that the strains of S. aureus which cause mastitis can potentially produce enterotoxin SEI. Overall, our results suggest that it is of special importance to follow the presence of enterotoxin-producing S. aureus in other dairy products, especially for protecting the consumers from staphylococcal food poisoning.

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Emergence of Imipenem-Resistant Pseudomonas aeruginosa Clinical Isolates from Egypt Coharboring VIM and IMP Carbapenemases.

Science.gov (United States)

El-Domany, Ramadan Ahmed; Emara, Mohamed; El-Magd, Mohammed A; Moustafa, Walaa H; Abdeltwab, Nesma M

2017-09-01

Pseudomonas aeruginosa is an important human pathogen and the leading cause of nosocomial infections. P. aeruginosa is characterized by massive intrinsic resistance to a multiple classes of antibiotics with carbapenems being the most potent inhibitor of P. aeruginosa and considered the first choice for its treatment. Therefore, it is crucial to investigate novel mechanisms of resistance of P. aeruginosa to carbapenems for achieving successful therapy. A total of 114 P. aeruginosa isolates from two university hospitals in Egypt were recruited in this study. Antimicrobial susceptibility testing revealed that 50 isolates (43.8%) exhibited multidrug-resistant (MDR) phenotype, of them 14 isolates (12.2%) were imipenem (IPM)-resistant. Of these 14 isolates, 13 isolates (11.4%) exhibited the metallo-β-lactamase (MBL) phenotype. MBLs encoding genes, VIM and IMP, were identified by PCR. PCR results revealed that four isolates harbored the VIM gene alone, one isolate harbored IMP gene alone, and four isolates harbored both genes. The correct size of PCR products of VIM and IMP genes (390 and 188 bp, respectively) were sequenced to confirm results of PCR and to look for any possible polymorphism among MBL genes of tested isolates. Data analysis of these sequences showed 100% identity of nucleotide sequences of MBL genes among tested Egyptian patients. To our knowledge, this is the first report of IMP carbapenemase-encoding gene in Africa and the first detection of the emergence of P. aeruginosa coproducing VIM and IMP genes in Egypt.

Specific Gene Loci of Clinical Pseudomonas putida Isolates.

Directory of Open Access Journals (Sweden)

Lázaro Molina

Full Text Available Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host's immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria.

Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

Science.gov (United States)

Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

2017-12-01

As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

MUTATIONS IN CALMODULIN GENES

DEFF Research Database (Denmark)

2013-01-01

The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

Characterization of class 1 integrons associated with R-plasmids in clinical Aeromonas salmonicida isolates from various geographical areas

DEFF Research Database (Denmark)

Schmidt, A.S.; Bruun, Morten Sichlau; Larsen, J.L.

2001-01-01

Class 1 integrons were found in 26 of 40 antibiotic-resistant isolates of the fish pathogen Aeromonas salmonicida from Northern Europe and North America. Three different dhfr genes, conferring trimethoprim resistance, and one ant(3 " )1a aminoglycoside resistance gene were identified as gene...... inserts. The gene cassettes tended to be conserved among isolates from a particular geographical area. Nineteen isolates transferred R- plasmids carrying different tet determinants to Escherichia coli in filter mating assays, and in 15 cases, the class 1 integrons were co-transferred. Transferable...... sulphadiazine, trimethoprim and streptomycin resistances were invariably encoded by integrons. It thus appears that integron-encoded antibiotic resistance genes contribute substantially to the horizontal spread of antimicrobial resistance within this species, being associated with conjugative plasmids....

Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

International Nuclear Information System (INIS)

Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

1990-01-01

Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

Science.gov (United States)

Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

2017-01-01

Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

Molecular characterization of diarrheagenic Escherichia coli isolated from vegetables in Argentina.

Science.gov (United States)

González, Juliana; Cadona, Jimena S; Sanz, Marcelo; Bustamante, Ana V; Sanso, A Mariel

2017-11-16

The aim of this study was to investigate the prevalence of diarrheagenic E. coli strains in vegetables from the humid Pampa region, Argentina, and to determine the occurrence of serotypes and virulence genes in the isolates. A total of 373 fresh vegetable samples obtained from 41 different geographical points were examined. E. coli was detected in 38.6% of the samples. Ten isolates could be obtained from 14 samples presumptively positive for diarrheagenic E. coli: 8 were identified as atypical Enteropathogenic E. coli (aEPEC) and 2 as Verocytotoxigenic E. coli (VTEC). Lettuce and beet were the vegetables most frequently contaminated with pathogenic E. coli. The isolates belonged to serotypes O1:H7, O28:H19, O39:H40, O86:H31, O132:H8, O139:H20, O178:H7 and O178:H19, some of which reportedly have caused human illness, and one isolate resulted non typeable. Taking into account the distribution of 16 nle genes, 7 profiles were detected. On the other hand, all tested isolates harbored the gene encoding for the adhesin HcpA. Other adhesion related genes were also identified: ecpA and elfA were detected in 90%, lpfA 0113 in 60%, and ehaA in 50% of the isolates meanwhile ihaA was only observed in O178:H19 isolate. This VTEC isolate harbored, also, Cdt-V toxin and megaplasmid encoding genes such as espP, subA and epeA and exhibited a strong cytotoxic effect. These data is the first molecular E. coli report that confirms the presence of E. coli pathotypes circulating among vegetables in Argentina. Genetic characterization showed that in addition to eae or vtx genes, isolates obtained from vegetables harbored genes encoding other toxins, adhesins, and components related to the type III secretion system that could contribute to their virulence. In conclusion, this research shows that vegetables in Argentina may be the source of VTEC and EPEC infections in the community and therefore, they should be considered as vehicles for transmission of these potentially pathogenic

Integration of the blaNDM-1 carbapenemase gene into Proteus genomic island 1 (PGI1-PmPEL) in a Proteus mirabilis clinical isolate.

Science.gov (United States)

Girlich, Delphine; Dortet, Laurent; Poirel, Laurent; Nordmann, Patrice

2015-01-01

To decipher the mechanisms and their associated genetic determinants responsible for β-lactam resistance in a Proteus mirabilis clinical isolate. The entire genetic structure surrounding the β-lactam resistance genes was characterized by PCR, gene walking and DNA sequencing. Genes encoding the carbapenemase NDM-1 and the ESBL VEB-6 were located in a 38.5 kb MDR structure, which itself was inserted into a new variant of the Proteus genomic island 1 (PGI1). This new PGI1-PmPEL variant of 64.4 kb was chromosomally located, as an external circular form in the P. mirabilis isolate, suggesting potential mobility. This is the first known description of the bla(NDM-1) gene in a genomic island structure, which might further enhance the spread of the bla(NDM-1) carbapenemase gene among enteric pathogens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Thermostable cellulase from a thermomonospora gene

Science.gov (United States)

Wilson, D.B.; Walker, L.P.; Zhang, S.

1997-10-14

The invention relates to a gene isolated from Thermomonospora fusca, wherein the gene encodes a thermostable cellulase. Disclosed is the nucleotide sequence of the T. fusca gene; and nucleic acid molecules comprising the gene, or a fragment of the gene, that can be used to recombinantly express the cellulase or a catalytically active polypeptide thereof, respectively. The isolated and purified recombinant cellulase or catalytically active polypeptide may be used to hydrolyze substrate either by itself; or in combination with other cellulases, with the resultant combination having unexpected hydrolytic activity. 3 figs.

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

Science.gov (United States)

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Prevalence and sequence variations of the genes encoding the five antigens included in the novel 5CVMB vaccine covering group B meningococcal disease.

Science.gov (United States)

Jacobsson, Susanne; Hedberg, Sara Thulin; Mölling, Paula; Unemo, Magnus; Comanducci, Maurizio; Rappuoli, Rino; Olcén, Per

2009-03-04

During the recent years, projects are in progress for designing broad-range non-capsular-based meningococcal vaccines, covering also serogroup B isolates. We have examined three genes encoding antigens (NadA, GNA1030 and GNA2091) included in a novel vaccine, i.e. the 5 Component Vaccine against Meningococcus B (5CVMB), in terms of gene prevalence and sequence variations. These data were combined with the results from a similar study, examining the two additional antigens included in the 5CVMB (fHbp and GNA2132). nadA and fHbp v. 1 were present in 38% (n=36), respectively 71% (n=67) of the isolates, whereas gna2132, gna1030 and gna2091 were present in all the Neisseria meningitidis isolates tested (n=95). The level of amino acid conservation was relatively high in GNA1030 (93%), GNA2091 (92%), and within the main variants of NadA and fHbp. GNA2132 (54% of the amino acids conserved) appeared to be the most diversified antigen. Consequently, the theoretical coverage of the 5CVMB antigens and the feasibility to use these in a broad-range meningococcal vaccine is appealing.

Cloning and occurrence of czrC, a gene conferring cadmium and zinc resistance in MRSA CC398 Isolates

DEFF Research Database (Denmark)

Cavaco, Lina; Hasman, Henrik; Stegger, Marc

2010-01-01

the genetic determinant causing zinc resistance in CC398 and examine its prevalence in isolates of animal and human origin. Based on the sequence of the staphylococcal cassette chromosome mec (SCCmec) element from methicillin-resistant S. aureus (MRSA) CC398 strain SO385, a putative metal resistance gene......-four percent (n = 23) of the animal isolates and 48% (n = 24) of the human MRSA isolates of CC398 were resistant to zinc chloride and positive for czrC. All 48 MSSA strains from both human and pig origins were found to be susceptible to zinc chloride and negative for czrC. Our findings showed that czr......C is encoding zinc and cadmium resistance in CC398 MRSA isolates, and that it is widespread both in humans and animals. Thus, resistance to heavy metals such as zinc and cadmium may play a role in the coselection of methicillin resistance in S. aureus....

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

Directory of Open Access Journals (Sweden)

Berhanu Ayalew

2010-08-01

Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

Science.gov (United States)

Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

2010-08-08

Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Isolation and characterization of the human uracil DNA glycosylase gene

International Nuclear Information System (INIS)

Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

1989-01-01

A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

Molecular Cloning and Sequencing of AlkalophilicCellulosimicrobium cellulans CKMX1 Xylanase Gene Isolated from Mushroom Compost and Characterization of the Gene Product

Directory of Open Access Journals (Sweden)

Abhishek Walia

2015-12-01

Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.

Genomic comparison of Escherichia coli serotype O103:H2 isolates with and without verotoxin genes: implications for risk assessment of strains commonly found in ruminant reservoirs

Directory of Open Access Journals (Sweden)

Robert Söderlund

2016-02-01

Full Text Available Introduction: Escherichia coli O103:H2 occurs as verotoxigenic E. coli (VTEC carrying only vtx1 or vtx2 or both variants, but also as vtx-negative atypical enteropathogenic E. coli (aEPEC. The majority of E. coli O103:H2 identified from cases of human disease are caused by the VTEC form. If aEPEC strains frequently acquire verotoxin genes and become VTEC, they must be considered a significant public health concern. In this study, we have characterized and compared aEPEC and VTEC isolates of E. coli O103:H2 from Swedish cattle. Methods: Fourteen isolates of E. coli O103:H2 with and without verotoxin genes were collected from samples of cattle feces taken during a nationwide cattle prevalence study 2011–2012. Isolates were sequenced with a 2×100 bp setup on a HiSeq2500 instrument producing >100× coverage per isolate. Single-nucleotide polymorphism (SNP typing was performed using the genome analysis tool kit (GATK. Virulence genes and other regions of interest were detected. Susceptibility to transduction by two verotoxin-encoding phages was investigated for one representative aEPEC O103:H2 isolate. Results and Discussion: This study shows that aEPEC O103:H2 is more commonly found (64% than VTEC O103:H2 (36% in the Swedish cattle reservoir. The only verotoxin gene variant identified was vtx1a. Phylogenetic comparison by SNP analysis indicates that while certain subgroups of aEPEC and VTEC are closely related and have otherwise near identical virulence gene repertoires, they belong to separate lineages. This indicates that the uptake or loss of verotoxin genes is a rare event in the natural cattle environment of these bacteria. However, a representative of a VTEC-like aEPEC O103:H2 subgroup could be stably lysogenized by a vtx-encoding phage in vitro.

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

Directory of Open Access Journals (Sweden)

LISTYA UTAMI KARMAWAN

2009-03-01

Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

Directory of Open Access Journals (Sweden)

Jessica Joerling

Full Text Available Swine dysentery (SD is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B. species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116 isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195, outer membrane proteins (OMPs (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h as well as iron acquisition factors (ftnA and bitC. Multilocus sequence typing (MLST revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%, ST8 (12.1%, and ST112 (25.9% which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193. The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s-2000s. The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1% varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant in ST8 isolates to 46.7% (14/30, 52.1% (25/48, and 85.7% (6/7 in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

Science.gov (United States)

Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

2018-01-01

Swine dysentery (SD) is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B.) species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs) to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116) isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin) and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195), outer membrane proteins (OMPs) (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h) as well as iron acquisition factors (ftnA and bitC). Multilocus sequence typing (MLST) revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%), ST8 (12.1%), and ST112 (25.9%) which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193). The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s–2000s). The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1%) varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant) in ST8 isolates to 46.7% (14/30), 52.1% (25/48), and 85.7% (6/7) in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

Science.gov (United States)

Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

1997-07-01

Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

Multiresistant Bacteria Isolated from Activated Sludge in Austria

Directory of Open Access Journals (Sweden)

Herbert Galler

2018-03-01

Full Text Available Wastewater contains different kinds of contaminants, including antibiotics and bacterial isolates with human-generated antibiotic resistances. In industrialized countries most of the wastewater is processed in wastewater treatment plants which do not only include commercial wastewater, but also wastewater from hospitals. Three multiresistant pathogens—extended spectrum β-lactamase (ESBL-harbouring Enterobacteriaceae (Gram negative bacilli, methicillin resistant Staphylococcus aureus (MRSA and vancomycin resistant Enterococci (VRE—were chosen for screening in a state of the art wastewater treatment plant in Austria. Over an investigation period of six months all three multiresistant pathogens could be isolated from activated sludge. ESBL was the most common resistance mechanism, which was found in different species of Enterobacteriaceae, and in one Aeromonas spp. Sequencing of ESBL genes revealed the dominance of genes encoding members of CTX-M β-lactamases family and a gene encoding for PER-1 ESBL was detected for the first time in Austria. MRSA and VRE could be isolated sporadically, including one EMRSA-15 isolate. Whereas ESBL is well documented as a surface water contaminant, reports of MRSA and VRE are rare. The results of this study show that these three multiresistant phenotypes were present in activated sludge, as well as species and genes which were not reported before in the region. The ESBL-harbouring Gram negative bacilli were most common.

Multiresistant Bacteria Isolated from Activated Sludge in Austria

Science.gov (United States)

Feierl, Gebhard; Petternel, Christian; Reinthaler, Franz F.; Haas, Doris; Habib, Juliana; Kittinger, Clemens; Luxner, Josefa

2018-01-01

Wastewater contains different kinds of contaminants, including antibiotics and bacterial isolates with human-generated antibiotic resistances. In industrialized countries most of the wastewater is processed in wastewater treatment plants which do not only include commercial wastewater, but also wastewater from hospitals. Three multiresistant pathogens—extended spectrum β-lactamase (ESBL)-harbouring Enterobacteriaceae (Gram negative bacilli), methicillin resistant Staphylococcus aureus (MRSA) and vancomycin resistant Enterococci (VRE)—were chosen for screening in a state of the art wastewater treatment plant in Austria. Over an investigation period of six months all three multiresistant pathogens could be isolated from activated sludge. ESBL was the most common resistance mechanism, which was found in different species of Enterobacteriaceae, and in one Aeromonas spp. Sequencing of ESBL genes revealed the dominance of genes encoding members of CTX-M β-lactamases family and a gene encoding for PER-1 ESBL was detected for the first time in Austria. MRSA and VRE could be isolated sporadically, including one EMRSA-15 isolate. Whereas ESBL is well documented as a surface water contaminant, reports of MRSA and VRE are rare. The results of this study show that these three multiresistant phenotypes were present in activated sludge, as well as species and genes which were not reported before in the region. The ESBL-harbouring Gram negative bacilli were most common. PMID:29522474

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-01-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-04-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

Science.gov (United States)

Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

2016-04-01

The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

Science.gov (United States)

Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

1998-01-01

All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

Determination of antibiotic resistance profile in Klebsiella pneumonia strains isolated from urinary tract infections of patients hospitalized in Peyambaran hospital (Tehran-Iran

Directory of Open Access Journals (Sweden)

Marzieh Tavakol

2017-04-01

Full Text Available Background: Urinary tract infection (UTI is the second prevalent infection in human mostly caused by Escherichia coli and Klebsiella pneumonia. The aim of this study was to determine the antibiotic resistance profile and detect the prevalence of antibiotic resistance encoding genes in K .pneumoniae isolated from UTI. Materials and Methods: Fifty K. pneumonia strains isolated from 122 UTI samples of hospitalized patients in Payambaran Hospital (Tehran, Iran which were subjected to this study (2014 were confirmed by standard biochemical tests. Isolates were tested for susceptibility to 10 antimicrobial drugs by using disk diffusion method. Antibiotic resistance encoding genes frequently include the aadA1, aac(3-IV, sul1, blaSHV, Cat1, cmlA, tetA, tetB, dfrA1, CITM, qnr in isolates were determined by PCR. Results: The highest antibiotic resistance in K. pneumoniae isolates were for Tetracycline and the lowest resistance (2% for Gentamicin and Imipenem. To determine the frequency of antibiotic resistant genes, 64% and 4% of isolates had tetA and Gentamicin-(aac(3-IV resistant genes, respectively. Conclusion: Frequency of antibiotic resistance encoding genes may have important and basic role in the occurrence and transfer of antibiotic resistance which can be due to the indiscriminate use of antibiotics.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Cloning and Genomic Organization of a Rhamnogalacturonase Gene from Locally Isolated Strain of Aspergillus niger.

Science.gov (United States)

Damak, Naourez; Abdeljalil, Salma; Taeib, Noomen Hadj; Gargouri, Ali

2015-08-01

The rhg gene encoding a rhamnogalacturonase was isolated from the novel strain A1 of Aspergillus niger. It consists of an ORF of 1.505 kb encoding a putative protein of 446 amino acids with a predicted molecular mass of 47 kDa, belonging to the family 28 of glycosyl hydrolases. The nature and position of amino acids comprising the active site as well as the three-dimensional structure were well conserved between the A. niger CTM10548 and fungal rhamnogalacturonases. The coding region of the rhg gene is interrupted by three short introns of 56 (introns 1 and 3) and 52 (intron 2) bp in length. The comparison of the peptide sequence with A. niger rhg sequences revealed that the A1 rhg should be an endo-rhamnogalacturonases, more homologous to rhg A than rhg B A. niger known enzymes. The comparison of rhg nucleotide sequence from A. niger A1 with rhg A from A. niger shows several base changes. Most of these changes (59 %) are located at the third base of codons suggesting maintaining the same enzyme function. We used the rhamnogalacturonase A from Aspergillus aculeatus as a template to build a structural model of rhg A1 that adopted a right-handed parallel β-helix.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Iron-dependent gene expression in Actinomyces oris

Directory of Open Access Journals (Sweden)

Matthew P. Mulé

2015-12-01

Results: When A. oris was grown under iron-limiting conditions, the genes encoding iron/siderophore transporters fetA and sidD showed increased expression. One of these genes (sidD was mutated, and the sidD::Km strain exhibited a 50% reduction in growth in late log and stationary phase cells in media that contained iron. This growth defect was restored when the sidD gene was provided in a complemented strain. We were able to isolate the AmdR-encoding gene in seven clinical isolates of Actinomyces. When these protein sequences were aligned to the laboratory strain, there was a high degree of sequence similarity. Conclusions: The growth of the sidD::Km mutant in iron-replete medium mirrored the growth of the wild-type strain grown in iron-limiting medium, suggesting that the sidD::Km mutant was compromised in iron uptake. The known iron regulator AmdR is well conserved in clinical isolates of A. oris. This work provides additional insight into iron metabolism in this important oral microbe.

Occurrence and Variety of β-Lactamase Genes among Aeromonas spp. Isolated from Urban Wastewater Treatment Plant

Directory of Open Access Journals (Sweden)

Marta Piotrowska

2017-05-01

Full Text Available Members of the genus Aeromonas that commonly occur in various aquatic ecosystems are taken into account as vectors spreading antibiotic resistance genes (ARGs in the environment. In our study strains of Aeromonas spp. (n = 104 not susceptible to ampicillin were isolated from municipal sewage of different levels of purification – raw sewage, activated sludge and treated wastewater. The crucial step of the study was the identification of β-lactamase resistance genes. The identified genes encode β-lactamases from 14 families – blaTEM, blaOXA, blaSHV, blaCTX-M, blaMOX, blaACC, blaFOX, blaGES, blaPER, blaV EB, blaKPC, cphA, imiH, and cepH. There were no significant differences in number of identified ARGs between isolation points. BlaOXA, blaFOX variants and, characteristic for Aeromonas genus, metallo-β-lactamase cphA-related genes were the most commonly identified types of β-lactam resistance determinants. Moreover, we found four extended-spectrum β-lactamases (blaSHV -11, blaCTX-M-27, blaCTX-M-98, and blaPER-4 – and seven AmpC (blaACC, blaFOX-2-like, blaFOX-3, blaFOX-4-like, blaFOX-9, blaFOX-10-like, and blaFOX-13-like types and variants of genes that had never been found among Aeromonas spp. before. Five of the β-lactamases families (blaTEM, blaOXA, blaFOX, blaV EB, and cphA were identified in all three isolation sites, which supports the hypothesis that wastewater treatment plants (WWTPs are hot spots of ARGs dissemination. The obtained ARGs sequences share high identity with previously described β-lactamases, but new variants of those genes have to be considered as well. Characterization of antibiotic susceptibility was performed using disk the diffusion method with 12 different antibiotics according to CLSI guidelines. Over 60% of the strains are unsusceptible to cefepime and chloramphenicol and the majority of the strains have a multidrug resistance phenotype (68%. Finally, analysis of plasmid profiles among the resistant strains

Cloning of a novel xylanase gene from a newly isolated Fusarium sp. Q7-31 and its expression in Escherichia coli

Directory of Open Access Journals (Sweden)

Zhan-Ling Xie

2012-03-01

Full Text Available A strain of Q7-31 was isolated from Qinghai-Tibet Plateau and was identified as Fusarium sp. based on its morphological characteristics and ITS rDNA gene sequence analysis. It has the highest capacity of degrading cell wall activity compared with other 11 strains. To do research on its xylanase activity of Fusarium sp. Q7-31 while the degrading the rice cell walls, the complete gene xyn8 that encodes endo-1, 4-β-xylanase secreted by Fusarium sp. Q7-31 was cloned and sequenced. The coding region of the gene is separated by two introns of 56bp and 55bp. It encodes 230 amino acid residues of a protein with a calculated molecular weight of 25.7 kDa. The animo acids sequence of xyn8 gene has higher similarity with those of family 11 of glycosyl hydrolases reported from other microorganisms. The nature peptide encodeing cDNA was subcloned into pGEX5x-1 expression vector. The recombinant plasmid was expressed in Escherichia coli BL21-CodonPlus (DE3-RIL, and xylanase activity was measured. The expression fusion protein was identified by SDS-PAGE and Western blotting, a new specific band of about 52kDa was identified when induced by IPTG. Enzyme activity assay verified the recombinants proteins as a xylanase. A maxium activity of 2.34U/ mg, the xylanase had optimal activity at pH 6.0 and temperature 40ºC .

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Streptogramin resistance among Enterococcus faecium isolated from production animals in Denmark in 1997

DEFF Research Database (Denmark)

Jensen, Lars Bogø; Hammerum, Anette Marie; Bager, Flemming

2002-01-01

The genetic background for streptogramin resistance was examined in Enterococcus faecium isolated from pigs (n = 55) and broilers (n = 207) in 1997 in Denmark. Fifty-one percent and 67%, respectively, of the isolates were resistant to streptogramins. Among streptogramin-resistant E. faecium (SREF......), the genetic background for streptogramin A resistance could be determined in 96% of the isolates from broilers, compared with 14% among SREF from pigs. For broiler isolates 89% of SREF contained the vat(E) gene and 10% the vat(D) gene. Three of these isolates contained both resistance genes. Among SREF from...... pigs two isolates contained the vat(E) gene and two others the vat(D) gene. The genetic background for streptogramin B was most often identified as the erm(B) gene encoding macrolide, lincosamide, and streptogramin B (MLSB) resistance. Among SREF, 84% and 86% of isolates from broilers and pigs...

Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

Science.gov (United States)

Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

2009-06-01

A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

Science.gov (United States)

Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

1996-01-01

we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

Science.gov (United States)

Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

2016-11-15

Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

Isolation and characterization of styrene metabolism genes from styrene-assimilating soil bacteria Rhodococcus sp. ST-5 and ST-10.

Science.gov (United States)

Toda, Hiroshi; Itoh, Nobuya

2012-01-01

Styrene metabolism genes were isolated from styrene-assimilating bacteria Rhodococcus sp. ST-5 and ST-10. Strain ST-5 had a gene cluster containing four open reading frames which encoded styrene degradation enzymes. The genes showed high similarity to styABCD of Pseudomonas sp. Y2. On the other hand, strain ST-10 had only two genes which encoded styrene monooxygenase and flavin oxidoreductase (styAB). Escherichia coli transformants possessing the sty genes of strains ST-5 and ST-10 produced (S)-styrene oxide from styrene, indicating that these genes function as styrene degradation enzymes. Metabolite analysis by resting-cell reaction with gas chromatography-mass spectrometry revealed that strain ST-5 converts styrene to phenylacetaldehyde via styrene oxide by styrene oxide isomerase (styC) reaction. On the other hand, strain ST-10 lacked this enzyme, and thus accumulated styrene oxide as an intermediate. HPLC analysis showed that styrene oxide was spontaneously isomerized to phenylacetaldehyde by chemical reaction. The produced phenylacetaldehyde was converted to phenylacetic acid (PAA) in strain ST-10 as well as in strain ST-5. Furthermore, phenylacetic acid was converted to phenylacetyl-CoA by the catalysis of phenylacetate-CoA ligase in strains ST-5 and ST-10. This study proposes possible styrene metabolism pathways in Rhodococcus sp. strains ST-5 and ST-10. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Single Nucleotide Polymorphisms in Regulator-Encoding Genes Have an Additive Effect on Virulence Gene Expression in a Vibrio cholerae Clinical Isolate.

Science.gov (United States)

Carignan, Bailey M; Brumfield, Kyle D; Son, Mike S

2016-01-01

Vibrio cholerae is the etiological agent of the infectious disease cholera, which is characterized by vomiting and severe watery diarrhea. Recently, V. cholerae clinical isolates have demonstrated increased virulence capabilities, causing more severe symptoms with a much higher rate of disease progression than previously observed. We have identified single nucleotide polymorphisms (SNPs) in four virulence-regulatory genes (hapR, hns, luxO, and vieA) of a hypervirulent V. cholerae clinical isolate, MQ1795. Herein, all SNPs and SNP combinations of interest were introduced into the prototypical El Tor reference strain N16961, and the effects on the production of numerous virulence-related factors, including cholera toxin (CT), the toxin-coregulated pilus (TCP), and ToxT, were analyzed. Our data show that triple-SNP (hapR hns luxO and hns luxO vieA) and quadruple-SNP combinations produced the greatest increases in CT, TCP, and ToxT production. The hns and hns luxO SNP combinations were sufficient for increased TCP and ToxT production. Notably, the hns luxO vieA triple-SNP combination strain produced TCP and ToxT levels similar to those of MQ1795. Certain SNP combinations (hapR and hapR vieA) had the opposite effect on CT, TCP, and ToxT expression. Interestingly, the hns vieA double-SNP combination strain increased TCP production while decreasing CT production. Our findings suggest that SNPs identified in the four regulatory genes, in various combinations, are associated with increased virulence capabilities observed in V. cholerae clinical isolates. These studies provide insight into the evolution of highly virulent strains. IMPORTANCE Cholera, an infectious disease of the small intestine caused by the aquatic bacterium Vibrio cholerae, often results in vomiting and acute watery diarrhea. If left untreated or if the response is too slow, the symptoms can quickly lead to extreme dehydration and ultimately death of the patient. Recent anecdotal evidence of cholera

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

Science.gov (United States)

Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

1999-07-01

The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

Science.gov (United States)

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

Science.gov (United States)

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Phylogeny of fungal hemoglobins and expression analysis of the Aspergillus oryzae flavohemoglobin gene fhbA during hyphal growth

NARCIS (Netherlands)

Biesebeke, R. te; Levasseur, A.; Boussier, A.; Record, E.; Hondel, C.A.M.J.J. van den; Punt, P.J.

2010-01-01

The fhbA genes encoding putative flavohemoglobins (FHb) from Aspergillus niger and Aspergillus oryzae were isolated. Comparison of the deduced amino acid sequence of the A. niger fhbA gene and other putative filamentous fungal FHb-encoding genes to that of Ralstonia eutropha shows an overall

Characterization of Vibrio Parahaemolyticus isolated from oysters and mussels in São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Martha Virginia Ribeiro Rojas

2011-08-01

Full Text Available Vibrio parahaemolyticus is a marine bacterium, responsible for gastroenteritis in humans. Most of the clinical isolates produce thermostable direct hemolysin (TDH and TDH-related hemolysin (TRH encoded by tdh and trh genes respectively. In this study, twenty-three V. parahaemolyticus, previously isolated from oysters and mussels were analyzed by PCR using specific primers for the 16S rRNA and virulence genes (tdh, trh and tlh and for resistance to different classes of antibiotics and PFGE. Nineteen isolates were confirmed by PCR as V. parahaemolyticus. The tlh gene was present in 100% of isolates, the tdh gene was identified in two (10.5% isolates, whereas the gene trh was not detected. Each isolate was resistant to at least one of the nine antimicrobials tested. Additionally, all isolates possessed the blaTEM-116 gene. The presence of this gene in V. parahaemolyticus indicates the possibility of spreading this gene in the environment. Atypical strains of V. parahaemolyticus were also detected in this study.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Widespread distribution of a tet W determinant among tetracycline-resistant isolates of the animal pathogen Arcanobacterium pyogenes.

Science.gov (United States)

Billington, Stephen J; Songer, J Glenn; Jost, B Helen

2002-05-01

Tetracycline resistance is common among isolates of the animal commensal and opportunistic pathogen Arcanobacterium pyogenes. The tetracycline resistance determinant cloned from two bovine isolates of A. pyogenes was highly similar at the DNA level (92% identity) to the tet(W) gene, encoding a ribosomal protection tetracycline resistance protein, from the rumen bacterium Butyrivibrio fibrisolvens. The tet(W) gene was found in all 20 tetracycline-resistant isolates tested, indicating that it is a widely distributed determinant of tetracycline resistance in this organism. In 25% of tetracycline-resistant isolates, the tet(W) gene was associated with a mob gene, encoding a functional mobilization protein, and an origin of transfer, suggesting that the determinant may be transferable to other bacteria. In fact, low-frequency transfer of tet(W) was detected from mob+ A. pyogenes isolates to a tetracycline-sensitive A. pyogenes recipient. The mobile nature of this determinant and the presence of A. pyogenes in the gastrointestinal tract of cattle and pigs suggest that A. pyogenes may have inherited this determinant within the gastrointestinal tracts of these animals.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Characterization of cDNA for PMT: a Partial Nicotine Biosynthesis-Related Gene Isolated from Indonesian Local Tobacco (Nicotiana tabacum cv. Sindoro1

Directory of Open Access Journals (Sweden)

SESANTI BASUKI

2013-12-01

Full Text Available Nicotine is the major alkaloid compound in cultivated tobacco (Nicotiana tabacum that could potentially be converted into carcinogenic compound (nor-nicotine. The PMT gene encoding putrescine N-methyltransferase (PMT is one of the two key genes that play a prominent role in nicotine biosynthesis. The aimed of this study was to isolate and characterize the cDNA sequence originated from Indonesian local tobacco cv. Sindoro1 (Ntpmt_Sindoro1. The results showed that the Ntpmt_Sindoro1 was 1124 bp in length. This cDNA fragment encodes for 374 amino acid residues. The predicted polypeptide from the cDNA is a hidrophilic protein, and has a predicted molecular weight of 40.95 kDa. The predicted amino acids sequence also showed high similarity to the PMT gene product Nicotiana sp. available in the GenBank data base. The amino acid sequences also exert conserved residues specifically exhibited only by PMT gene originated from N. tabacum. Clustering analysis revealed that Ntpmt_Sindoro1 belongs to the same clade as the PMT3 gene, a member of the N. tabacum PMT gene family. The Ntpmt_Sindoro1 cDNA sequence covering exon1-exon8 of the PMT gene fragment has been registered in the GenBank data base, under the accession number JX978277.

Plasmid-Mediated Quinolone Resistance in Shigella flexneri Isolated From Macaques

Directory of Open Access Journals (Sweden)

Anthony J. Mannion

2018-03-01

Full Text Available Non-human primates (NHPs for biomedical research are commonly infected with Shigella spp. that can cause acute dysentery or chronic episodic diarrhea. These animals are often prophylactically and clinically treated with quinolone antibiotics to eradicate these possible infections. However, chromosomally- and plasmid-mediated antibiotic resistance has become an emerging concern for species in the family Enterobacteriaceae. In this study, five individual isolates of multi-drug resistant Shigella flexneri were isolated from the feces of three macaques. Antibiotic susceptibility testing confirmed resistance or decreased susceptibility to ampicillin, amoxicillin-clavulanic acid, cephalosporins, gentamicin, tetracycline, ciprofloxacin, enrofloxacin, levofloxacin, and nalidixic acid. S. flexneri isolates were susceptible to trimethoprim-sulfamethoxazole, and this drug was used to eradicate infection in two of the macaques. Plasmid DNA from all isolates was positive for the plasmid-encoded quinolone resistance gene qnrS, but not qnrA and qnrB. Conjugation and transformation of plasmid DNA from several S. flexneri isolates into antibiotic-susceptible Escherichia coli strains conferred the recipients with resistance or decreased susceptibility to quinolones and beta-lactams. Genome sequencing of two representative S. flexneri isolates identified the qnrS gene on a plasmid-like contig. These contigs showed >99% homology to plasmid sequences previously characterized from quinolone-resistant Shigella flexneri 2a and Salmonella enterica strains. Other antibiotic resistance genes and virulence factor genes were also identified in chromosome and plasmid sequences in these genomes. The findings from this study indicate macaques harbor pathogenic S. flexneri strains with chromosomally- and plasmid-encoded antibiotic resistance genes. To our knowledge, this is the first report of plasmid-mediated quinolone resistance in S. flexneri isolated from NHPs and warrants

KvLEA, a New Isolated Late Embryogenesis Abundant Protein Gene from Kosteletzkya virginica Responding to Multiabiotic Stresses

Directory of Open Access Journals (Sweden)

Xiaoli Tang

2016-01-01

Full Text Available The LEA proteins are a kind of hydrophilic proteins, playing main functions in desiccation tolerance. However, their importance as a kind of stress proteins in abiotic stress is being clarified little by little. In this study we isolated, cloned, and identified the first KvLEA gene in Kosteletzkya virginica. Bioinformatic analysis showed that the protein encoded by this gene had common properties of LEA proteins and the multiple sequences alignment and phylogenetic analysis further showed that this protein had high homology with two Arabidopsis LEA proteins. Gene expression analysis revealed that this gene had a higher expression in root and it was induced obviously by salt stress. Moreover, the transcripts of KvLEA were also induced by other abiotic stresses including drought, high temperature, chilling, and ABA treatment. Among these abiotic stresses, ABA treatment brought about the biggest changes to this gene. Collectively, our research discovered a novel LEA gene and uncovered its involvement in multiabiotic stresses in K. virginica. This research not only enriched studies on LEA gene in plant but also would accelerate more studies on K. virginica in the future.

Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

International Nuclear Information System (INIS)

Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

1983-01-01

A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

Biofilm formation and virulence factor analysis of Staphylococcus aureus isolates collected from ovine mastitis.

Science.gov (United States)

Azara, E; Longheu, C; Sanna, G; Tola, S

2017-08-01

To perform a phenotypic and genotypic characterization of 258 Staphylococcus aureus isolates from clinical ovine mastitis and used for the preparation of inactivated autogenous vaccines. The potential for biofilm production was determined by phenotypic test of Congo Red Agar (CRA) and by PCR for the detection of icaA/D genes. Isolates were also screened by PCR for the presence of enterotoxins (sea, seb, sec, sed and see), toxic shock syndrome toxin (tsst), leukotoxins (lukD-E, lukM and lukPV83), haemolysins (hly-β and hly-γ), autolysin (atlA) genes and encoding microbial surface components recognizing adhesive matrix molecules (MSCRAMMs: clfA, clfB, fnbA, fnbB, bbp, cna, eno, fib, epbs, sdrC, sdrD and SdrE). None of the 258 isolates showed biofilm-forming ability on CRA and harboured icaA/D genes. The most frequent pyrogenic toxin superantigen genes amplified were sec plus tsst-1, which were found strictly in combination with 71·3% of the Staph. aureus isolates tested. None of the isolates harboured the genes encoding sea and see. Of the 258 isolates tested, 159 (61·6%) possessed all lukD-E/lukM/lukPV83 genes, 123 (47·7%) harboured both hly-β/hly-γ genes, whereas almost all (97·3%) were PCR positive for atlA gene. With respect to adhesion determinants, 179 (69·4%) isolates presented simultaneously four genes (fnbA, fib, clfA and clfB) for fibronectin- and fibrinogen-binding proteins. In this search, several putative virulence determinants have been identified in ovine Staph. aureus isolates collected in Sardinia. Some of the putative virulence determinants could be considered as components of a vaccine because of their role in ovine mastitis pathogenesis. © 2017 The Society for Applied Microbiology.

Ecological Divergence and the Origins of Intrinsic Postmating Isolation with Gene Flow

Directory of Open Access Journals (Sweden)

Aneil F. Agrawal

2011-01-01

Full Text Available The evolution of intrinsic postmating isolation has received much attention, both historically and in recent studies of speciation genes. Intrinsic isolation often stems from between-locus genetic incompatibilities, where alleles that function well within species are incompatible with one another when brought together in the genome of a hybrid. It can be difficult for such incompatibilities to originate when populations diverge with gene flow, because deleterious genotypic combinations will be created and then purged by selection. However, it has been argued that if genes underlying incompatibilities are themselves subject to divergent selection, then they might overcome gene flow to diverge between populations, resulting in the origin of incompatibilities. Nonetheless, there has been little explicit mathematical exploration of such scenarios for the origin of intrinsic incompatibilities during ecological speciation with gene flow. Here we explore theoretical models for the origin of intrinsic isolation where genes subject to divergent natural selection also affect intrinsic isolation, either directly or via linkage disequilibrium with other loci. Such genes indeed overcome gene flow, diverge between populations, and thus result in the evolution of intrinsic isolation. We also examine barriers to neutral gene flow. Surprisingly, we find that intrinsic isolation sometimes weakens this barrier, by impeding differentiation via ecologically based divergent selection.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

LENUS (Irish Health Repository)

Dunlop, Rebecca L E

2012-02-01

Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

Isolation of cowpea genes conferring drought tolerance ...

African Journals Online (AJOL)

The main objective of this study was to identify and isolate the genes conferring drought tolerance in cowpea. A cDNA library enriched for cowpea genes expressed specifically during responses to drought was constructed. A procedure called suppression subtractive hybridisation (SSH) was successfully employed to obtain ...

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Competence without a competence pheromone in a natural isolate of Streptococcus infantis

DEFF Research Database (Denmark)

Ween, O; Teigen, S; Gaustad, P

2002-01-01

C and a two-component regulatory system encoded by comDE. Here we report that a natural isolate of a mitis group streptococcus (Atu-4) is competent for genetic transformation even though it has lost the gene encoding the competence pheromone. In contrast to other strains, induction of competence in Atu-4...

Genetic characterization of Shigella spp. isolated from diarrhoeal and asymptomatic children.

Science.gov (United States)

Ghosh, Santanu; Pazhani, Gururaja P; Niyogi, Swapan Kumar; Nataro, James P; Ramamurthy, Thandavarayan

2014-07-01

Phenotypic and genetic characteristics of Shigella spp. isolated from diarrhoeal and asymptomatic children aged up to 5 years were analysed in this study. In total, 91 and 17 isolates were identified from diarrhoeal (case) and asymptomatic (control) children, respectively. All the isolates were tested for antimicrobial resistance, the presence of integrons, plasmid-mediated quinolone resistance (PMQR), virulence-associated genes and Shigella pathogenicity island (SH-PAI). The majority of the Shigella spp. from cases (68.1%) and controls (82.3%) were found to be resistant to fluoroquinolones. Integron carriage was detected more in cases (76.9%) than in controls (35.5%). Atypical class 1 integron was detected exclusively in Shigella flexneri from cases but not from the controls. PMQR genes such as aac(6')-Ib-cr and qnrS1 were detected in 82.4 and 14.3% of the isolates from cases and in 53 and 17.6% in controls, respectively. Shigella isolates from cases as well as from controls were positive for the invasive plasmid antigen H-encoding gene ipaH. The other virulence genes such as virF, sat, setA, setB, sen and ial were detected in Shigella isolates in 80.2, 49.4, 27.4, 27.4, 80.2 and 79.1% of cases and in 64.7, 52.9, 17.6, 17.6, 64.7 and 64.7% of controls, respectively. The entire SH-PAI was detected in S. flexneri serotype 2a from cases and controls. In an isolate from a control child, the SH-PAI was truncated. Integrons, PMQR and virulence-encoding genes were detected more frequently in cases than in controls. In diarrhoea endemic areas, asymptomatic carriers may play a crucial role in the transmission of multidrug-resistant Shigella spp. with all the putative virulence genes. © 2014 The Authors.

Expression pattern of two paralogs encoding cinnamyl alcohol dehydrogenases in Arabidopsis. Isolation and characterization of the corresponding mutants.

Science.gov (United States)

Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

2003-06-01

Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cbeta. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units.

Biocide Susceptibility of Staphylococcus aureus CC398 and CC30 Isolates from Pigs and Identification of the Biocide Resistance Genes, qacG and qacC

DEFF Research Database (Denmark)

Seier-Petersen, Maria Amalie; Nielsen, Lene Nørby; Ingmer, Hanne

2015-01-01

Objectives: Methicillin-resistant Staphylococcus aureus (MRSA), in particular clonal complex (CC) 398, is increasingly found in livestock. Recently, MRSA CC30 was identified in Danish pigs. We determined the susceptibility of porcine S. aureus isolates of CC398 and CC30 to disinfectants used in pig......)-encoding virulence factors were investigated. Methods: Susceptibilities to biocides and antimicrobial agents of 79 porcine S. aureus isolates were determined by the microdilution method. Isolates comprised 21 methicillin-sensitive S. aureus (MSSA) and 40 MRSA isolates belonging to CC398 and 13 MSSA and 5 MRSA...... isolates belonging to CC30. The presence of quaternary ammonium compound (QAC) resistance efflux pumps was analyzed using an ethidium bromide accumulation assay. The presence of qac resistance genes in active efflux pump positive isolates was determined by whole-genome sequencing data. All isolates were...

Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12.

Science.gov (United States)

Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui

2017-01-01

Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.

Isolation of stress responsive Psb A gene from rice (Oryza sativa l.) using differential display.

Science.gov (United States)

Tyagi, Aruna; Chandra, Arti

2006-08-01

Differential display (DD) experiments were performed on drought-tolerant rice (Oryza sativa L.) genotype N22 to identify both upregulated and downregulated partial cDNAs with respect to moisture stress. DNA polymorphism was detected between drought-stressed and control leaf tissues on the DD gels. A partial cDNA showing differential expression, with respect to moisture stress was isolated from the gel. Northern blotting analysis was performed using this cDNA as a probe and it was observed that mRNA corresponding to this transcript was accumulated to high level in rice leaves under water deficit stress. At the DNA sequence level, the partial cDNA showed homology with psb A gene encoding for Dl protein.

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.

Science.gov (United States)

Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L

2015-10-30

MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.

A study of coagulase-negative staphylococci (CoNS isolated from bovine mastitis for the presence of penicillin and methicillin resistance-encoding genes in the north west of Iran

Directory of Open Access Journals (Sweden)

Dastmalchi Saei, H.

2014-11-01

Full Text Available Coagulase-negative staphylococci (CoNS are often associated with bovine mastitis and may be resistant to antimicrobial therapy. The aim of the current study was to investigate the presence of blaZ (responsible for penicillin resistance and mecA (responsible for methicillin resistance genes among 108 CoNS belonging to 9 different species isolated from bovine mastitis in seven dairy herds (H1-H7. Of 108 CoNS isolates, 44 were Staphylococcus haemolyticus, 17 S. chromogenes, 11 S. epidermidis, 11 S. warneri, 11 S. cohnii, 6 S. simulans, 4 S. hominis, 3 S. capitis, and 1 S. xylosus. The blaZ was detected in 65.7% (n=71 of all Staphylococcus spp. isolates. Five isolates were positive for the presence of mecA gene (4.6%, including 2 S. hominis, 1 S. haemolyticus, 1 S. epidermidis, and 1 S. warneri. All mecA-carrying CoNS were also positive for the blaZ gene and were recovered from two studied herds (H3 and H6. Some variations were also observed in distribution of both blaZ and mecA genes between CoNS species. This study demonstrates that CoNS from bovine mastitis can be reservoirs of blaZ gene. This study also provides evidence of the presence of methicillin resistant CoNS (MR-CoNS and emphasizes the need for their epidemiological monitoring, in order to prevent the risk of spread to human through direct contact and/or consumption of contaminated food.

Detection of linezolid resistance due to the optrA gene in Enterococcus faecalis from poultry meat from the American continent (Colombia)

DEFF Research Database (Denmark)

Cavaco, Lina; Bernal, J F; Zankari, Ea

2017-01-01

Three Enterococcus isolates obtained from retail chicken collected in 2010-11 as part of the Colombian Integrated Program for Antimicrobial Resistance Surveillance (COIPARS) showed reduced susceptibility towards linezolid (MIC 8 mg/L). This study aimed at characterizing the isolates resistant......A gene encoding resistance to linezolid and phenicols. Additional screening of 37 enterococci strains from the same study did not detect any further positives. Typing showed that two of the isolates belong to ST59, while the last belongs to ST489. All isolates carry genes encoding resistance to macrolide...

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Comparative genomic and plasmid analysis of beer-spoiling and non-beer-spoiling Lactobacillus brevis isolates.

Science.gov (United States)

Bergsveinson, Jordyn; Ziola, Barry

2017-12-01

Beer-spoilage-related lactic acid bacteria (BSR LAB) belong to multiple genera and species; however, beer-spoilage capacity is isolate-specific and partially acquired via horizontal gene transfer within the brewing environment. Thus, the extent to which genus-, species-, or environment- (i.e., brewery-) level genetic variability influences beer-spoilage phenotype is unknown. Publicly available Lactobacillus brevis genomes were analyzed via BlAst Diagnostic Gene findEr (BADGE) for BSR genes and assessed for pangenomic relationships. Also analyzed were functional coding capacities of plasmids of LAB inhabiting extreme niche environments. Considerable genetic variation was observed in L. brevis isolated from clinical samples, whereas 16 candidate genes distinguish BSR and non-BSR L. brevis genomes. These genes are related to nutrient scavenging of gluconate or pentoses, mannose, and metabolism of pectin. BSR L. brevis isolates also have higher average nucleotide identity and stronger pangenome association with one another, though isolation source (i.e., specific brewery) also appears to influence the plasmid coding capacity of BSR LAB. Finally, it is shown that niche-specific adaptation and phenotype are plasmid-encoded for both BSR and non-BSR LAB. The ultimate combination of plasmid-encoded genes dictates the ability of L. brevis to survive in the most extreme beer environment, namely, gassed (i.e., pressurized) beer.

Evaluation of Antibiotic Resistance and Detection of papC and papG genes in Escherichia coli Strains Isolated from Patients with Urinary Tract Infection

Directory of Open Access Journals (Sweden)

Mitra Alishah

2016-11-01

Full Text Available Abstract Background and Objectives: Escherichia coli is the most common etiologic factor of urinary tract infection, which its most important virulence factor is P fimbriae. Uropathogenic E. coli expresses various types of adhesins, such as pili adhesins (pyelonephritis-associated pili, Pap that mediates binding to the surface of epithelial cells of the urinary tract. This study aims to identify papC and papG genes and to evaluate antibiotic resistance level in the isolated E. coli samples. Methods: In this descriptive cross-sectional study, 50 samples were collected from patients with urinary tract infection and after isolation of bacteria and DNA extraction, antibiotic susceptibility tests was performed by disc diffusion method using related antibiotics. Presence of papG and papC genes (class I, II, and III was assessed by multiplex PCR method. Statistical data were analyzed using descriptive t-test. Results: The isolated E. coli samples were susceptible to amikacin (100% and cefepime (72% and resistant to ampicillin (100% and nitrofurantoin (94%. Eighteen samples (32.7% had papG gene, of which 17 (30.9% samples had papGII gene and 1 sample (1.8% had papGIII gene; papGI gene was not detected in any of the samples. Conclusion: The results of the present study showed that papC and papGI genes are the most common Pap fimbriae adhesion-encoding genes in E. coli isolated from urinary tract infection. The difference between the results of this study with those of other studies is due to geographic diversity. Keywords: Escherichia coli; Adhesion pap, Disk diffusion antimicrobial tests; Multiplex polymerase chain reaction.

Cloning and expression of DNA encoding a ripening form of a polypeptide having rhamno-galacturonase activity.

NARCIS (Netherlands)

Musters, W.; Stam, H.; Suykerbuyk, M.E.; Visser, J.; Verbakel, J.M.

1993-01-01

The invention relates to isolation of an Aspergillus gene encoding rhamnogalacturonase (RG-ase) and the construction of recombinant Aspergillus strains with overexpression of RG-ase. These strains can be used for the commercial production of RG-ase. RG-ase is an important enzyme in processes

Diversity and Antimicrobial Resistance Genotypes in Non-Typhoidal Salmonella Isolates from Poultry Farms in Uganda

Directory of Open Access Journals (Sweden)

Terence Odoch

2018-02-01

Full Text Available Non-typhoidal Salmonella (NTS are foodborne pathogens of global public health significance. The aim of this study was to subtype a collection of 85 NTS originating from poultry farms in Uganda, and to evaluate a subgroup of phenotypically resistant isolates for common antimicrobial resistance genes and associated integrons. All isolates were subtyped by pulsed-field gel electrophoresis (PFGE. Phenotypically resistant isolates (n = 54 were screened by PCR for the most relevant AMR genes corresponding to their phenotypic resistance pattern, and all 54 isolates were screened by PCR for the presence of integron class 1 and 2 encoding genes. These genes are known to commonly encode resistance to ampicillin, tetracycline, ciprofloxacin, trimethoprim, sulfonamide and chloramphenicol. PFGE revealed 15 pulsotypes representing 11 serotypes from 75 isolates, as 10 were non-typable. Thirty one (57.4% of the 54 resistant isolates carried at least one of the seven genes (blaTEM-1, cmlA, tetA, qnrS, sul1, dhfrI, dhfrVII identified by PCR and six (11% carried class 1 integrons. This study has shown that a diversity of NTS-clones are present in Ugandan poultry farm settings, while at the same time similar NTS-clones occur in different farms and areas. The presence of resistance genes to important antimicrobials used in human and veterinary medicine has been demonstrated, hence the need to strengthen strategies to combat antimicrobial resistance at all levels.

Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

Science.gov (United States)

Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

2011-06-01

Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Antibiotic resistance and virulence genes in coliform water isolates.

Science.gov (United States)

Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

2016-11-01

Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

Science.gov (United States)

Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

2003-12-01

Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

Isolation and characterisation of mRNA encoding the salmon- and chicken-II type gonadotrophin-releasing hormones in the teleost fish Rutilus rutilus (Cyprinidae).

Science.gov (United States)

Penlington, M C; Williams, M A; Sumpter, J P; Rand-Weaver, M; Hoole, D; Arme, C

1997-12-01

The complementary DNAs (cDNA) encoding the [Trp7,Leu8]-gonadotrophin-releasing hormone (salmon-type GnRH; sGnRH:GeneBank accession no. u60667) and the [His5,Trp7,Tyr8]-GnRH (chicken-II-type GnRH; cGnRH-II: GeneBank accession no. u60668) precursor in the roach (Rutilus rutilus) were isolated and sequenced following reverse transcription and rapid amplification of cDNA ends (RACE). The sGnRH and cGnRH-II precursor cDNAs consisted of 439 and 628 bp, and included open reading frames of 282 and 255 bp respectively. The structures of the encoded peptides were the same as GnRHs previously identified in other vertebrates. The sGnRH and cGnRH-II precursor cDNAs, including the non-coding regions, had 88.6 and 79.9% identity respectively, to those identified in goldfish (Carassius auratus). However, significant similarity was not observed between the non-coding regions of the GnRH cDNAs of Cyprinidae and other fish. The presumed third exon, encoding partial sGnRH associated peptide (GAP) of roach, demonstrated significant nucleotide and amino acid similarity with the appropriate regions in the goldfish, but not with other species, and this may indicate functional differences of GAP between different families of fish. cGnRH-II precursor cDNAs from roach had relatively high nucleotide similarity across this GnRH variant. Cladistic analysis classified the sGnRH and cGnRH-II precursor cDNAs into three and two groups respectively. However, the divergence between nucleotide sequences within the sGnRH variant was greater than those encoding the cGnRH-II precursors. Consistent with the consensus developed from previous studies, Northern blot analysis demonstrated that expression of sGnRH and cGnRH-II was restricted to the olfactory bulbs and midbrain of roach respectively. This work forms the basis for further study on the mechanisms by which the tapeworm, Ligula intestinalis, interacts with the pituitary-gonadal axis of its fish host.

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

International Nuclear Information System (INIS)

Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

1987-01-01

The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Production of exfoliative toxin by isolates of Staphylococcus hyicus from different countries

DEFF Research Database (Denmark)

Andresen, Lars Ole

2005-01-01

A total of 218 isolates of Staphylococcus hyicus from pigs in eight countries (Belgium, Croatia, Germany, Japan, Korea, Slovenia, the UK and the USA) and 44 isolates from other animals in Belgium, India, Japan and the USA were examined for the genes encoding the exfoliative toxins ExhA, ExhB, Exhc...

Detection of Beta-lactamase gene in the culturable bacteria isolated from agricultural, pasture and mining soils around mines in Hamedan, Iran

Directory of Open Access Journals (Sweden)

Nayereh Younessi

2017-09-01

Full Text Available Introduction: Growing evidence exists that agriculture affects antibiotic resistance in human pathogens. Beta-lactam antibiotics are the most commonly used antimicrobial agents in many countries. The abundance of beta-lactamase encoding genes can be used as an indicator of antibiotic resistance in the environment. So, to determine the beta-lactamase resistance genes, the abundance of culturable bacteria having bla-TEM genesin the soils under different land uses wasexamined. Materials and methods: 44 Gram-positive and 34 Gram-negative bacteria plated on nutrient agar were isolated from agricultural, pasture and mining soils and selected to study the presence of TEM-class gene using PCR amplification. Antibiotic sensitivity test of bla-TEM+isolateswas done adopting the Kirby-Bauer disk diffusion method and antibiotic discs used were: ampicillin, amoxicillin, vancomicin, streptomycin, tetracycline and gentamicin. Finally, five multi-drug resistant and bla-TEM+ isolates were identified using universal primers. Results: The highest level of beta-lactamase genes was observed in the Gram-positive and Gram-negative isolates from the pasture soils. In the agricultural and mining soils, a high abundance of bla-TEM+ isolateswasfound which also showed resistance to beta-lactam antibiotics. The identified multi-drug resistant and bla-TEM+ isolates were from these genera: Achromobacter, Bacillus, Brevibacillus, Aminobacter and Brevundimonas. Discussion and conclusion: The high number of bla-TEM+ bacteria in all the soils may be attributed to the other important feature of bla genes which is their capability to extrude toxic compounds like heavy metals in contaminated environments. Sensitivity of some bla-TEM+ bacteria to beta-lactam antibiotics was interesting. This result shows that bla-TEM genes confer resistance to beta-lactamase inhibitors in a different degree. Some of the identified isolates were pathogen. These pathogens in soils can transfer to plants

Comparison of Brachyspira hyodysenteriae Isolates Recovered from Pigs in Apparently Healthy Multiplier Herds with Isolates from Herds with Swine Dysentery.

Directory of Open Access Journals (Sweden)

Tom La

Full Text Available Swine dysentery (SD is a mucohaemorrhagic colitis of grower/finisher pigs classically resulting from infection by the anaerobic intestinal spirochaete Brachyspira hyodysenteriae. This study aimed to determine whether B. hyodysenteriae isolates from pigs in three healthy German multiplier herds supplying gilts to other farms differed from isolates from nine German production herds with SD. Isolates were subjected to whole genomic sequencing, and in silico multilocus sequence typing showed that those from the three multiplier herds were of previously undescribed sequence types (ST132, ST133 and ST134, with all isolates from the same herd having the same ST. All isolates were examined for the presence of 332 genes encoding predicted virulence or virulence lifestyle associated factors, and these were well conserved. Isolates from one multiplier herd were atypical in being weakly haemolytic: they had 10 amino acid substitutions in the haemolysin III protein and five in the haemolysin activation protein compared to reference strain WA1, and had a disruption in the promoter site of the hlyA gene. These changes likely contribute to the weakly haemolytic phenotype and putative lack of virulence. These same isolates also had nine base pair insertions in the iron metabolism genes bitB and bitC and lacked five of six plasmid genes that previously have been associated with colonisation. Other overall differences between isolates from the different herds were in genes from three of five outer membrane proteins, which were not found in all the isolates, and in members of a block of six plasmid genes. Isolates from three herds with SD had all six plasmid genes, while isolates lacking some of these genes were found in the three healthy herds-but also in isolates from six herds with SD. Other differences in genes of unknown function or in gene expression may contribute to variation in virulence; alternatively, superior husbandry and better general health may have

Isolation and characterization of gene sequences expressed in cotton fiber

Directory of Open Access Journals (Sweden)

Taciana de Carvalho Coutinho

2016-06-01

Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

High diversity of genetic lineages and virulence genes in nasal Staphylococcus aureus isolates from donkeys destined to food consumption in Tunisia with predominance of the ruminant associated CC133 lineage

Directory of Open Access Journals (Sweden)

Gharsa Haythem

2012-10-01

Full Text Available Abstract Background The objective of this study was to determine the genetic lineages and the incidence of antibiotic resistance and virulence determinants of nasal Staphylococcus aureus isolates of healthy donkeys destined to food consumption in Tunisia. Results Nasal swabs of 100 donkeys obtained in a large slaughterhouse in 2010 were inoculated in specific media for S. aureus and methicillin-resistant S. aureus (MRSA recovery. S. aureus was obtained in 50% of the samples, being all of isolates methicillin-susceptible (MSSA. Genetic lineages, toxin gene profile, and antibiotic resistance mechanisms were determined in recovered isolates. Twenty-five different spa-types were detected among the 50 MSSA with 9 novel spa-types. S. aureus isolates were ascribed to agr type I (37 isolates, III (7, II (4, and IV (2. Sixteen different sequence-types (STs were revealed by MLST, with seven new ones. STs belonging to clonal clomplex CC133 were majority. The gene tst was detected in 6 isolates and the gene etb in one isolate. Different combinations of enterotoxin, leukocidin and haemolysin genes were identified among S. aureus isolates. The egc-cluster-like and an incomplete egc-cluster-like were detected. Isolates resistant to penicillin, erythromycin, fusidic acid, streptomycin, ciprofloxacin, clindamycin, tetracycline, or chloramphenicol were found and the genes blaZ, erm(A, erm(C, tet(M, fusC were identified. Conclusions The nares of donkeys frequently harbor MSSA. They could be reservoirs of the ruminant-associated CC133 lineage and of toxin genes encoding TSST-1 and other virulence traits with potential implications in public health. CC133 seems to have a broader host distribution than expected.

Isolation and preliminary function analysis of a Na + /H + antiporter ...

African Journals Online (AJOL)

A full-length cDNA Na+/H+ antiporter gene (MzNHX1) was isolated from Malus zumi according to the homologous Na+/H+ antiporter gene region in plants. Sequence analysis indicated that the cDNA was 2062 bp in length, including an open reading frame (ORF) of 1629 bp, which encoded a predicted polypeptide of 542 ...

Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

International Nuclear Information System (INIS)

Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

2006-01-01

Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

Directory of Open Access Journals (Sweden)

Chen Xu

2016-09-01

Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

Expression Pattern of Two Paralogs Encoding Cinnamyl Alcohol Dehydrogenases in Arabidopsis. Isolation and Characterization of the Corresponding Mutants1

Science.gov (United States)

Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

2003-01-01

Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cβ. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units. PMID:12805615

Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

DEFF Research Database (Denmark)

Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

2016-01-01

The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

Adding to Yersinia enterocolitica Gene Pool Diversity: Two Cryptic Plasmids from a Biotype 1A Isolate

Directory of Open Access Journals (Sweden)

Daniela Lepka

2009-01-01

Full Text Available We report the nucleotide sequence of two novel cryptic plasmids (4357 and 14 662 base pairs carried by a Yersinia enterocolitica biotype 1A strain isolated from pork. As distinguished from most biotype 1A strains, this isolate, designated 07-04449, exhibited adherence to eukaryotic cells. The smaller plasmid pYe4449-1 carries five attributable open reading frames (ORFs encoding the first CcdA/CcdB-like antitoxin/toxin system described for a Yersinia plasmid, a RepA-like replication initiation protein, and mobilizing factors MobA and MobC. The deduced amino acid sequences showed highest similarity to proteins described in Salmonella (CcdA/B, Klebsiella (RepA, and Plesiomonas (MobA/C indicating genomic fluidity among members of the Enterobacteriaceae. One additional ORF with unknown function, termed ORF5, was identified with an ancestry distinct from the rest of the plasmid. While the C+G content of ORF5 is 38.3%, the rest of pYe4449-1 shows a C+G content of 55.7%. The C+G content of the larger plasmid pYe4449-2 (54.9% was similar to that of pYe4449-1 (53.7% and differed from that of the Y. enterocolitica genome (47.3%. Of the 14 ORFs identified on pYe4449-2, only six ORFs showed significant similarity to database entries. For three of these ORFs likely functions could be ascribed: a TnpR-like resolvase and a phage replication protein, localized each on a low C+G island, and DNA primase TraC. Two ORFs of pYe4449-2, ORF3 and ORF7, seem to encode secretable proteins. Epitope-tagging of ORF3 revealed protein expression at 4°C but not at or above 27°C suggesting adaptation to a habitat outside swine. The hypothetical protein encoded by ORF7 is the member of a novel repeat protein family sharing the DxxGN(xnDxxGN motif. Our findings illustrate the exceptional gene pool diversity within the species Y. enterocolitica driven by horizontal gene transfer events.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

Molecular characterization of NDM-1 producing Enterobacteriaceae isolates in Singapore hospitals

Directory of Open Access Journals (Sweden)

Raymond Lin

2012-03-01

Full Text Available Objective: In this study, we molecularly characterized 12 NDM-1 producing clinical Enterobacteriaceae (Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae isolates that were part of a collection of non-carbapenem susceptible isolates obtained during a one-year period. These isolates were obtained from four local general hospitals in Singapore.Methods: Polymerase chain reaction (PCR assays and sequencing was used to determine the presence of β-lactamase encoding genes (bla including blaNDM-1 and plasmid-mediated quinolone and aminoglycoside resistance determinants. Conjugation experiments were performed to determine the transferability of blaNDM-1. Isolate relatedness was determined by multilocus sequence typing (MLST.Results: The isolates were completely resistant to the second- and third-generation cephalosporins tested as well as carbapenems. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to tigecycline while 11/12 (91.7% were susceptible to colistin. The blaNDM-1 gene was encoded on plasmids that were easily transferable. None of the patients had a travel history to countries where NDM-1 has been reported. The isolates appear clonally unrelated with MLST, revealing a diversity of clonal types among the K. pneumoniae and E. coli isolates.Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Enterobacteriaceae. Although it appears that the isolates are clonally unrelated, epidemiological links cannot be fully excluded without further research.

Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

Science.gov (United States)

Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

2005-01-01

In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

Molecular characterization of the Jatropha curcas JcR1MYB1 gene encoding a putative R1-MYB transcription factor

Directory of Open Access Journals (Sweden)

Hui-Liang Li

2014-09-01

Full Text Available The cDNA encoding the R1-MYB transcription factor, designated as JcR1MYB1, was isolated from Jatropha curcas using rapid amplification of cDNA ends. JcR1MYB1 contains a 951 bp open reading frame that encodes 316 amino acids. The deduced JcR1MYB1 protein was predicted to possess the conserved, 56-amino acid-long DNA-binding domain, which consists of a single helix-turn-helix module and usually occurs in R1-MYBs. JcR1MYB1 is a member of the R1-MYB transcription factor subfamily. A subcellular localization study confirmed the nuclear localization of JcR1MYB1. Expression analysis showed that JcR1MYB1 transcripts accumulated in various examined tissues, with high expression levels in the root and low levels in the stem. JcR1MYB1 transcription was up-regulated by polyethylene glycol, NaCl, and cold treatments, as well as by abscisic acid, jasmonic acid, and ethylene treatment. Analysis of transgenic tobacco plants over-expressing JcR1MYB1 indicates an inportant function for this gene in salt stress.

Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

Directory of Open Access Journals (Sweden)

Xiangqi Zhang

2013-07-01

Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

Comparative genomics of an IncA/C multidrug resistance plasmid from Escherichia coli and Klebsiella isolates from intensive care unit patients and the utility of whole-genome sequencing in health care settings.

Science.gov (United States)

Hazen, Tracy H; Zhao, LiCheng; Boutin, Mallory A; Stancil, Angela; Robinson, Gwen; Harris, Anthony D; Rasko, David A; Johnson, J Kristie

2014-08-01

The IncA/C plasmids have been implicated for their role in the dissemination of β-lactamases, including gene variants that confer resistance to expanded-spectrum cephalosporins, which are often the treatment of last resort against multidrug-resistant, hospital-associated pathogens. A bla(FOX-5) gene was detected in 14 Escherichia coli and 16 Klebsiella isolates that were cultured from perianal swabs of patients admitted to an intensive care unit (ICU) of the University of Maryland Medical Center (UMMC) in Baltimore, MD, over a span of 3 years. Four of the FOX-encoding isolates were obtained from subsequent samples of patients that were initially negative for an AmpC β-lactamase upon admission to the ICU, suggesting that the AmpC β-lactamase-encoding plasmid was acquired while the patient was in the ICU. The genomes of five E. coli isolates and six Klebsiella isolates containing bla(FOX-5) were selected for sequencing based on their plasmid profiles. An ∼ 167-kb IncA/C plasmid encoding the FOX-5 β-lactamase, a CARB-2 β-lactamase, additional antimicrobial resistance genes, and heavy metal resistance genes was identified. Another FOX-5-encoding IncA/C plasmid that was nearly identical except for a variable region associated with the resistance genes was also identified. To our knowledge, these plasmids represent the first FOX-5-encoding plasmids sequenced. We used comparative genomics to describe the genetic diversity of a plasmid encoding a FOX-5 β-lactamase relative to the whole-genome diversity of 11 E. coli and Klebsiella isolates that carry this plasmid. Our findings demonstrate the utility of whole-genome sequencing for tracking of plasmid and antibiotic resistance gene distribution in health care settings. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

Science.gov (United States)

Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

2014-06-01

Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

PCR-based isolation and identification of full-length low-molecular-weight glutenin subunit genes in bread wheat (Triticum aestivum L.).

Science.gov (United States)

Zhang, Xiaofei; Liu, Dongcheng; Jiang, Wei; Guo, Xiaoli; Yang, Wenlong; Sun, Jiazhu; Ling, Hongqing; Zhang, Aimin

2011-12-01

Low-molecular-weight glutenin subunits (LMW-GSs) are encoded by a multi-gene family and are essential for determining the quality of wheat flour products, such as bread and noodles. However, the exact role or contribution of individual LMW-GS genes to wheat quality remains unclear. This is, at least in part, due to the difficulty in characterizing complete sequences of all LMW-GS gene family members in bread wheat. To identify full-length LMW-GS genes, a polymerase chain reaction (PCR)-based method was established, consisting of newly designed conserved primers and the previously developed LMW-GS gene molecular marker system. Using the PCR-based method, 17 LMW-GS genes were identified and characterized in Xiaoyan 54, of which 12 contained full-length sequences. Sequence alignments showed that 13 LMW-GS genes were identical to those found in Xiaoyan 54 using the genomic DNA library screening, and the other four full-length LMW-GS genes were first isolated from Xiaoyan 54. In Chinese Spring, 16 unique LMW-GS genes were isolated, and 13 of them contained full-length coding sequences. Additionally, 16 and 17 LMW-GS genes in Dongnong 101 and Lvhan 328 (chosen from the micro-core collections of Chinese germplasm), respectively, were also identified. Sequence alignments revealed that at least 15 LMW-GS genes were common in the four wheat varieties, and allelic variants of each gene shared high sequence identities (>95%) but exhibited length polymorphism in repetitive regions. This study provides a PCR-based method for efficiently identifying LMW-GS genes in bread wheat, which will improve the characterization of complex members of the LMW-GS gene family and facilitate the understanding of their contributions to wheat quality.

Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny.

Science.gov (United States)

Adib, N; Ghanbarpour, R; Solatzadeh, H; Alizade, H

2014-03-01

Escherichia coli (E. coli) strains are the major cause of urinary tract infections (UTI) and belong to the large group of extra-intestinal pathogenic E. coli. The purposes of this study were to determine the antibiotic resistance profile, virulence genes and phylogenetic background of E. coli isolates from UTI cases. A total of 137 E. coli isolates were obtained from UTI samples. The antimicrobial susceptibility of confirmed isolates was determined by disk diffusion method against eight antibiotics. The isolates were examined to determine the presence and prevalence of selected virulence genes including iucD, sfa/focDE, papEF and hly. ECOR phylo-groups of isolates were determined by detection of yjaA and chuA genes and fragment TspE4.C2. The antibiogram results showed that 71% of the isolates were resistant to cefazolin, 60.42% to co-trimoxazole, 54.16% to nalidixic acid, 36.45% to gentamicin, 29.18% to ciprofloxacin, 14.58% to cefepime, 6.25% to nitrofurantoin and 0.00% to imipenem. Twenty-two antibiotic resistance patterns were observed among the isolates. Virulence genotyping of isolates revealed that 58.39% isolates had at least one of the four virulence genes. The iucD gene was the most prevalent gene (43.06%). The other genes including sfa/focDE, papEF and hly genes were detected in 35.76%, 18.97% and 2.18% isolates, respectively. Nine combination patterns of the virulence genes were detected in isolates. Phylotyping of 137 isolates revealed that the isolates fell into A (45.99%), B1 (13.14%), B2 (19.71%) and D (21.16%) groups. Phylotyping of multidrug resistant isolates indicated that these isolates are mostly in A (60.34%) and D (20.38%) groups. In conclusion, the isolates that possessed the iucD, sfa/focDE, papEF and hly virulence genes mostly belonged to A and B2 groups, whereas antibiotic resistant isolates were in groups A and D. Escherichia coli strains carrying virulence factors and antibiotic resistance are distributed in specific phylogenetic

Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

Directory of Open Access Journals (Sweden)

Felipe L Assis

Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

Emergence of Oxacillinases in Environmental Carbapenem-Resistant Acinetobacter baumannii Associated with Clinical Isolates.

Science.gov (United States)

Goic-Barisic, Ivana; Hrenovic, Jasna; Kovacic, Ana; Musić, Martina Šeruga

2016-10-01

Six carbapenem-resistant isolates of Acinetobacter baumannii were recovered from untreated and treated municipal wastewater of the capital city of Zagreb, Croatia. Molecular identification of environmental isolates of A. baumannii was performed by amplification, sequencing, and phylogenetic analyses of rpoB gene. The presence of bla OXA genes encoding OXA-type carbapenemases (OXA-51-like, OXA-23, and OXA-40-like) was confirmed by multiplex PCR and sequencing. Phylogenetic analyses corroborated the affiliation of detected bla OXA genes to three different clusters and showed association of environmental OXAs with those described from clinical isolates. This result suggests that isolates recovered from municipal wastewater are most probably of clinical origin. Furthermore, the presence of OXA-40-like (OXA-72) in an environmental A. baumannii isolate is reported for the first time. Persistence of A. baumannii harboring the clinically important OXAs in the wastewater treatment process poses a potentially significant source for horizontal gene transfer and implications for wider spread of antibiotic resistance genes.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

Antimicrobial activity and the presence of virulence factors and bacteriocin structural genes in Enterococcus faecium CM33 isolated from ewe colostrum

Directory of Open Access Journals (Sweden)

YOUSEF eNAMI

2015-07-01

Full Text Available AbstractScreening of lactic acid bacteria isolated from ewe colostrum led to the identification and isolation of Enterococcus faecium CM33 with interesting features, such as high-survival rates under acidic or bile salt conditions, high tolerance to the simulated gastrointestinal condition, and high adhesive potential to Caco-2 cells. According to the inhibition of pathogen adhesion test results, this strain could reduce more than 50% adhesion capacity of Escherichia coli, Shigella flexneri, Klebsiella pneumoniae, Listeria monocytogenes, and Staphylococcus aureus to Caco-2 cells. Based on the antibiotic sensitivity test findings, E. faecium CM33 was susceptible to gentamycin, vancomycin, erythromycin, ampicillin, penicillin, tetracycline, and rifampicin, but resistant to chloramphenicol, clindamycin, and kanamycin. Upon the assessment of the virulence determinants for E. faecium CM33, this strain was negative for all tested virulence genes. Furthermore, the genome of this strain was evaluated for the incidence of the known enterocin genes by specific PCR amplification, and the genes encoding enterocins A, 31, X, and Q were discovered. The findings of this study showed that the strain E. faecium CM33 could be considered a valuable nutraceutical, and it can be introduced as a new potential probiotic.

Omega-3 fatty acid desaturase genes isolated from purslane (Portulaca oleracea L.): expression in different tissues and response to cold and wound stress.

Science.gov (United States)

Teixeira, Monica C; Carvalho, Isabel S; Brodelius, Maria

2010-02-10

Two full-length cDNA clones PoleFAD7 and PoleFAD8, encoding plastidial omega-3 fatty acid desaturases were isolated from purslane (Portulaca oleracea). The encoded enzymes convert linoleic to alpha-linolenic acid (C18:3n-3). Three histidine clusters characteristic of fatty acid desaturases, a putative chloroplast transit peptide in the N-terminal, and three putative transmembrane domains were identified in the sequence. Both genes were expressed in all analyzed tissues showing different levels of expression. PoleFAD7 was up-regulated by wounding but not by low temperature. PoleFAD8 was up-regulated by cold stress but not by wounding. Total fatty acid and linolenic acid content were higher both, in wounded and intact leaves of plants exposed to low temperature.

Dysregulated gene expression in the primary osteoblasts and osteocytes isolated from hypophosphatemic Hyp mice.

Directory of Open Access Journals (Sweden)

Kazuaki Miyagawa

Full Text Available Osteocytes express multiple genes involved in mineral metabolism including PHEX, FGF23, DMP1 and FAM20C. In Hyp mice, a murine model for X-linked hypophosphatemia (XLH, Phex deficiency results in the overproduction of FGF23 in osteocytes, which leads to hypophosphatemia and impaired vitamin D metabolism. In this study, to further clarify the abnormality in osteocytes of Hyp mice, we obtained detailed gene expression profiles in osteoblasts and osteocytes isolated from the long bones of 20-week-old Hyp mice and wild-type (WT control mice. The expression of Fgf23, Dmp1, and Fam20c was higher in osteocytic cells than in osteoblastic cells in both genotypes, and was up-regulated in Hyp cells. Interestingly, the up-regulation of these genes in Hyp bones began before birth. On the other hand, the expression of Slc20a1 encoding the sodium/phosphate (Na+/Pi co-transporter Pit1 was increased in osteoblasts and osteocytes from adult Hyp mice, but not in Hyp fetal bones. The direct effects of extracellular Pi and 1,25-dihydroxyvitamin D3 [1,25(OH2D3] on isolated osteoblastic and osteocytic cells were also investigated. Twenty-four-hour treatment with 10-8 M 1,25(OH2D3 increased the expression of Fgf23 in WT osteoblastic cells but not in osteocytic cells. Dmp1 expression in osteocytic cells was increased due to the 24-hour treatment with 10 mM Pi and was suppressed by 10-8 M 1,25(OH2D3 in WT osteocytic cells. We also found the up-regulation of the genes for FGF1, FGF2, their receptors, and Egr-1 which is a target of FGF signaling, in Hyp osteocytic cells, suggesting the activation of FGF/FGFR signaling. These results implicate the complex gene dysregulation in osteoblasts and osteocytes of Hyp mice, which might contribute to the pathogenesis.

Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica.

Science.gov (United States)

Toval, Francisco; Guzmán-Marte, Anel; Madriz, Vivian; Somogyi, Teresita; Rodríguez, César; García, Fernando

2015-01-01

This study aimed to assess the molecular basis of the resistance to carbapenems in clinical isolates of Pseudomonas aeruginosa recovered from a tertiary-level health facility in San José, Costa Rica. A total of 198 non-duplicated isolates were evaluated for their susceptibility to β-lactams, aminoglycosides and fluoroquinolones. The production of metallo-β-lactamases (MBLs), the presence of MBL encoding genes (blaIMP, blaVIM and blaGIM-1) and the occurrence of these genes within class 1 integrons were investigated. In addition, an ERIC2 PCR fingerprinting method was used to elucidate the distribution of the detected MBL genes within the strain collection. Of the 198 isolates tested, 125 (63.1 %) were categorized as carbapenem-resistant. The majority (88.8 %) of the carbapemen-resistant isolates also showed resistance to ceftazidime, cefepime, aztreonam, ticarcillin/clavulanic acid, amikacin, gentamicin, tobramycin, ciprofloxacin and gatifloxacin. Among the carbapenem-resistant isolates, 102 (81.6 %) showed MBL activity. Strikingly, both blaIMP and blaVIM genes were simultaneously detected in most (94.1 %) of the 102 MBL producers. Five carbapenem-resistant MBL producers were positive only for blaIMP genes. Almost 70 % of the isolates examined harboured the intI1 gene, accompanied by the sul1 and qacEΔ1 genes in 136 (99 %) and 122 (89 %) isolates, respectively. The majority (94.4 %) of the carbapenem-resistant isolates carried the intI1 gene, in contrast to 26 % of the carbapenem-susceptible isolates. Ninety-three out of 96 (96.9 %) isolates carrying both blaIMP and blaVIM genes also harboured the intI1, sul1 and qacEΔ1 genes. Gene cassettes from carbapenem-susceptible and MBL-negative carbapenem-resistant isolates encoded aminoglycoside-resistance enzymes (aadA2, aadA4 and aadA6) as well as orfD and qacF genes. RAPD analysis distributed 126 of the isolates in 29 clusters. Eighty of the 90 blaIMP (+) blaVIM (+) isolates were sorted into 16