WorldWideScience

Sample records for isa derivative forms

  1. isa

    International Development Research Centre (IDRC) Digital Library (Canada)

    Rosario Quesada

    El proyecto “La exposición a plaguicidas y su relación con el neurodesarrollo de bebés de 0 a 2 años: un análisis integrado de la sostenibilidad de sistemas de producción de banano y plátano” denominado Infantes y Salud ambiental (ISA) parte de la necesidad de evaluar y mejorar la sostenibilidad de sistemas de ...

  2. Intelligent Speed Assistance (ISA).

    NARCIS (Netherlands)

    2015-01-01

    Intelligent Speed Assistance (ISA) has been a promising type of advanced driver support system for some decades. From a technical point of view, large scale ISA implementation is possible in the short term. The different types of ISA are expected to have different effects on behaviour and traffic

  3. Assessing the origin of old apparent ages derived by Pb stepwise leaching of vein-hosted epidote from Mount Isa, northwest Queensland, Australia

    Science.gov (United States)

    Duncan, Robert J.; Maas, Roland

    2014-12-01

    Epidote metasomatism affected large areas of tholeiitic metabasalts of the ~1,780 Ma Eastern Creek Volcanics in the Western Fold Belt of the Proterozoic Mount Isa inlier. Hydrothermal epidote generally occurs in quartz veins parallel to or boudinaged within the dominant S2 fabrics which formed during the regional metamorphic peak at ~1,570 Ma associated with the Isan orogeny. Previously published stable isotopic and halogen data suggest that the fluids responsible for epidote formation are metamorphic in origin (with an evaporitic component). Application of the Pb stepwise leaching technique to the epidote does not separate radiogenic Pb4+ and common Pb2+, generating little spread in 206Pb/204Pb (between 16.0 and 30.5). The causes for this relatively low range are twofold: There is little radiogenic Pb in the epidotes (the most radiogenic steps account for leaching data give ages between 150 and 1,500 myrs older than the host rocks and over 450 myrs older than the thermal metamorphic peak. These old ages are attributed to chemical inheritance from the host metabasalts, via radiogenic Pb release by breakdown of phases such as zircon, monazite, titanomagnetite, and ilmenite during metamorphism. This idea is supported by trace element data and chrondrite-normalized rare earth element patterns that are similar to both the metabasalts and epidotes (except for a variable Eu anomaly in the latter). Relatively high fO2 during vein formation (Fe3+ dominates in the epidote crystal lattice) would allow the incorporation of Th4+ and exclusion of U6+ and would explain elevated Th/U ratios (up to 12) in epidote compared with the host metabasalts. Non-incorporation of U would explain the relatively low U/Pb ratios and non-radiogenic character of the epidote. This process may provide a source of metal for the small U deposits around Mount Isa and may also suggest a relationship between U mineralization and regional Cu mobilization during the Isan orogeny. Our work suggests that

  4. eISA Acceptance Form

    Data.gov (United States)

    Department of Homeland Security — This dataset contains the online agreement information needs to share Trade information via a Trade VPN. When submitted, the data is sent in an email to the business...

  5. IS-A diversified

    DEFF Research Database (Denmark)

    Nilsson, Jørgen Fischer

    2014-01-01

    We reconsider the nature and formal properties of the class inclusion relation, IS-A, from the point of view of information modeling and engineering of formal ontologies. In particular we review approaches to the elusive notion of intensionality. We then conduct an analysis adopting a metalogic s...

  6. Controlled study of ISA effects

    DEFF Research Database (Denmark)

    Harms, Lisbeth; Klarborg, Brith; Lahrmann, Harry

    2007-01-01

    The present study is a part of the ISA PAYD project being conducted in the County of North Jutland, Denmark. The first part of the study compared background data and attitudes between young ISA-volunteers and non-volunteers. Volunteers and nonvolunteers differed only with respect to their judgeme...

  7. Onderzoeksopzet praktijkdemo intelligente snelheidsadaptatie ISA.

    NARCIS (Netherlands)

    Polak, P.H. & Roszbach, R.

    1999-01-01

    A practical experiment with intelligent speed adapters will be carried out in the Dutch borough of Tilburg during the period 1998-2000. The goal of this project is to: develop support and a public acceptance of ISA as a speed control instrument via a practical demonstration; and to gain insight in a

  8. A new Perspective on ISA-Equipment

    DEFF Research Database (Denmark)

    Klarborg, Brith; Lahrmann, Harry; Agerholm, Niels

    2007-01-01

    Intelligent Speed Adaptation [ISA] has proved successful at reducing the speed of normal drivers. However, until now the potential of ISA as an assistive device has been neglected. Two case studies were conducted to test ISA as a support for drivers with acquired brain injury [ABI] in driving wit...

  9. The Iran Sanctions Act (ISA)

    Science.gov (United States)

    2009-06-04

    billion4 contract (September 1997) for Total SA of France and its partners, Gazprom of Russia and Petronas of Malaysia to develop phases 2 and 3 of the 25...companies. On July 12, 2008, Total and Petronas , the original South Pars investors, pulled out of a deal to develop a liquified natural gas (LNG...do not exceed the $20 million in one year threshold for ISA sanctionability. Since the Total/ Petronas /Gazprom project in 1998, no projects have

  10. Vacuum guidelines for ISA insertions

    International Nuclear Information System (INIS)

    Edwards, D. Jr.

    1976-01-01

    Vacuum requirements place design restrictions on the ISA insertions. The vacuum tube diameter, given a distance L between pumps, is determined by the desorption of molecules from the wall under the impact of ions created by the beam, whereas the thickness of the tube must be sufficient to prevent collapse. In addition, the entire vacuum chamber must be able to be baked out at approximately 200 0 C

  11. LABORATORY DIAGNOSIS OF INFECTIOUS SALMON ANEMIA (ISA)

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Olesen, Niels Jørgen; Østergaard, Peter

    The first outbreak of ISA on the Faroe Islands was diagnosed in March 2000. Despite intensive surveillance, control and eradication of ISA, the disease has since spread to most of the Faroe Islands affecting about half of the 23 aquaculture farms. Sampling and laboratory diagnosis of ISA is perfo......The first outbreak of ISA on the Faroe Islands was diagnosed in March 2000. Despite intensive surveillance, control and eradication of ISA, the disease has since spread to most of the Faroe Islands affecting about half of the 23 aquaculture farms. Sampling and laboratory diagnosis of ISA...... is performed according to the EU Commission Decision draft on sampling and diagnostic procedures for ISA. Inspection, clinical and gross-pathological examination and tissue sampling is performed by the veterinarians on the islands. Laboratory examination is done in collaboration between the Veterinary...

  12. Reading the New Standard ISA700

    Directory of Open Access Journals (Sweden)

    Daniel Botez

    2010-12-01

    Full Text Available Review of permanent professional standards is a requirement for professional bodies of professional accountants, resulting in broader processes of globalization and harmonization. A set of revised standards on financial audit engagement was published by IFAC in April 2009. International Standard on Auditing (ISA 700 "Forming an opinion and reporting on financial statements” is one of them. This standard deals with the auditor's responsibility to form an opinion on the financial statements and determine the form and content of the auditor's report issued following an audit of financial statements. Even if you do not have major changes, the revised standard contains several provisions that emphasize the important role of the auditor's report and more specifically defines its responsibility.

  13. The biogeochemical fate of nickel during microbial ISA degradation; implications for nuclear waste disposal.

    Science.gov (United States)

    Kuippers, Gina; Boothman, Christopher; Bagshaw, Heath; Ward, Michael; Beard, Rebecca; Bryan, Nicholas; Lloyd, Jonathan R

    2018-06-08

    Intermediate level radioactive waste (ILW) generally contains a heterogeneous range of organic and inorganic materials, of which some are encapsulated in cement. Of particular concern are cellulosic waste items, which will chemically degrade under the conditions predicted during waste disposal, forming significant quantities of isosaccharinic acid (ISA), a strongly chelating ligand. ISA therefore has the potential to increase the mobility of a wide range of radionuclides via complex formation, including Ni-63 and Ni-59. Although ISA is known to be metabolized by anaerobic microorganisms, the biodegradation of metal-ISA complexes remains unexplored. This study investigates the fate of a Ni-ISA complex in Fe(III)-reducing enrichment cultures at neutral pH, representative of a microbial community in the subsurface. After initial sorption of Ni onto Fe(III)oxyhydroxides, microbial ISA biodegradation resulted in >90% removal of the remaining Ni from solution when present at 0.1 mM, whereas higher concentrations of Ni proved toxic. The microbial consortium associated with ISA degradation was dominated by close relatives to Clostridia and Geobacter species. Nickel was preferentially immobilized with trace amounts of biogenic amorphous iron sulfides. This study highlights the potential for microbial activity to help remove chelating agents and radionuclides from the groundwater in the subsurface geosphere surrounding a geodisposal facility.

  14. WACANA NARATIF KEHIDUPAN NABI ISA DALAM AL-QURʼAN

    Directory of Open Access Journals (Sweden)

    Toto Edidarmo

    2014-06-01

    Full Text Available The Holy Quran contains the faith, worship, Islamic morals, history, promises and threats, and information about Hereafter (eschatology. The narrative style of the Quran is less systematic and intact except the narration of the Prophet Yusuf (Surah Yusuf [12]: 1-111. This paper narrates the verses of the Quran about Prophet Isa's life since his birth, prophetness, until death. The aim is to reconstruct narrative discourse of Prophet Isa's life as a systematical text. The method used is content analysis through verses related analysis in order to classify the meaning and connect the verses with other verses into a systematize form, a unified narrative and chronological discourse. DOI: 10.15408/a.v1i1.1133

  15. Integrated Science Assessment (ISA) for Sulfur Oxides ...

    Science.gov (United States)

    This draft document provides EPA’s evaluation and synthesis of the most policy-relevant science related to the health effects of sulfur oxides. When final, it will provide a critical part of the scientific foundation for EPA’s decision regarding the adequacy of the current primary (health-based) National Ambient Air Quality Standard (NAAQS) for sulfur dioxide. The references considered for inclusion in or cited in the external review draft ISA are available at https://hero.epa.gov/hero/sulfur-oxides. The intent of the ISA, according to the CAA, is to “accurately reflect the latest scientific knowledge expected from the presence of [a] pollutant in ambient air” (U.S. Code, 1970a, 1970b). It includes an assessment of scientific research from atmospheric sciences, exposure sciences, dosimetry, mode of action, animal and human toxicology, and epidemiology. Key information and judgments formerly found in the Air Quality Criteria Documents (AQCDs) for sulfur oxides (SOx) are included; Annexes provide additional details supporting the ISA. Together, the ISA and Annexes serve to update and revise the last SOx ISA which was published in 2008.

  16. mzML2ISA & nmrML2ISA: generating enriched ISA-Tab metadata files from metabolomics XML data.

    Science.gov (United States)

    Larralde, Martin; Lawson, Thomas N; Weber, Ralf J M; Moreno, Pablo; Haug, Kenneth; Rocca-Serra, Philippe; Viant, Mark R; Steinbeck, Christoph; Salek, Reza M

    2017-08-15

    Submission to the MetaboLights repository for metabolomics data currently places the burden of reporting instrument and acquisition parameters in ISA-Tab format on users, who have to do it manually, a process that is time consuming and prone to user input error. Since the large majority of these parameters are embedded in instrument raw data files, an opportunity exists to capture this metadata more accurately. Here we report a set of Python packages that can automatically generate ISA-Tab metadata file stubs from raw XML metabolomics data files. The parsing packages are separated into mzML2ISA (encompassing mzML and imzML formats) and nmrML2ISA (nmrML format only). Overall, the use of mzML2ISA & nmrML2ISA reduces the time needed to capture metadata substantially (capturing 90% of metadata on assay and sample levels), is much less prone to user input errors, improves compliance with minimum information reporting guidelines and facilitates more finely grained data exploration and querying of datasets. mzML2ISA & nmrML2ISA are available under version 3 of the GNU General Public Licence at https://github.com/ISA-tools. Documentation is available from http://2isa.readthedocs.io/en/latest/. reza.salek@ebi.ac.uk or isatools@googlegroups.com. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  17. Photophysical properties of columnar phases formed by triphenylene derivatives

    International Nuclear Information System (INIS)

    Sigal, Herve

    1997-01-01

    This research thesis reports the study of the spectroscopic properties and of the migration of excitation energy in the singlet state in columnar phases formed by alkyloxy and alkylthio derivatives of triphenylene. First, the author studied the spectroscopic properties of chromophores in solutions, and characterized excited states by using computation codes (CS-INDO-CIPSI). Then, by using the excitonic theory in the case of the considered triphenylene derivatives, the author studied the influence of molecular movements and of the intra-columnar order on the spectroscopic properties. In some circumstances, the non-radiative transfer of excitation energy is governed by a mechanism displaying a random evolution. This stochastic movement is studied by using Monte Carlo simulations. The author shows that the energy migration is one-dimensional on short times, and then becomes three-dimensional. The evolution of excitation energy in space and in time is determined [fr

  18. Synthesis and complex forming property of phosphor acid derivatives

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from

  19. Pay as You Speed, ISA with incentive for not speeding

    DEFF Research Database (Denmark)

    Lahrmann, Harry Spaabæk; Agerholm, Niels; Tradisauskas, Nerius

    2012-01-01

    To simulate a market introduction of Intelligent Speed Adaptation (ISA) and to study the effect of a Pay as You Speed (PAYS) concept, a field trial with 153 drivers was conducted during 2007–2009. The participants drove under PAYS conditions for a shorter or a longer period. The PAYS concept......, with and without incentive crossed with informative ISA present or absent. The results showed that ISA is an efficient tool for reducing speeding particularly on rural roads. The analysis of speed data demonstrated that the proportion of distance driven above the speed where the ISA equipment responded (PDA...... level. Both informative ISA and incentive ISA reduced the PDA, but there was no statistically significant interaction. Informative reduced it more than the incentive....

  20. Intelligente snelheidsadaptatie ISA : een vergelijking van Nederlandse en Zweedse systemen.

    NARCIS (Netherlands)

    Oei, H.-l.

    1998-01-01

    An important part within developments in the field of telematics is Intelligent Speed Adaptation (ISA). Especially in Sweden, where the policy objective is to have zero fatalities or seriously injured victims on the road in 2020, research has been conducted on ISA during the last 10 years. In the

  1. Isa-ema maa : [luuletused] / Leelo Tungal

    Index Scriptorium Estoniae

    Tungal, Leelo, 1947-

    2001-01-01

    Sisu: Isa-ema maa ; Vahetund ; Päkapikk võis näha ; Kodune jutt ; Koeruse mõõt ; mütsid ; Loomade laul ; Igal sügisel ; Väike jõulusoov ; Millal tuled, jõuluvana ; Paharet ; Suur õun ; Teiste laste mänguasjad ; Oi heldeke! ; Tere-tere ; Kui ma ... ; Magus tähestik ; Pluss ja miinus ; Pinalis ; Esimese klassi õpilane ; Teise klassi õpilane ; Miks on kana vana? ; Hommik ; Seitsme maa ja mere taga ; Köha pere ; Harjad ; Täna sügist mängib suvi ; Toas ; Laps jäi voodis magama ; Klassivennad ; Talvehommik ; Siili elu ; Hiirehernesupp ; Hundi lugemine ; Karu ärkamine ; Unelaul ; Salajutt ; Kooli eel ; Laiskvorsti elu ; Kindel plaan ; Oma kohal ; Puhkama ; Vana vahva lasteaed ; Sama laps ; Tüli

  2. Pay as You Speed, ISA with incentives for not speeding

    DEFF Research Database (Denmark)

    Lahrmann, Harry Spaabæk; Agerholm, Niels; Tradisauskas, Nerius

    2012-01-01

    The Intelligent Speed Adaptation (ISA) project we describe in this article is based on Pay as You Drive principles. These principles assume that the ISA equipment informs a driver of the speed limit, warns the driver when speeding and calculates penalty points. Each penalty point entails the redu......The Intelligent Speed Adaptation (ISA) project we describe in this article is based on Pay as You Drive principles. These principles assume that the ISA equipment informs a driver of the speed limit, warns the driver when speeding and calculates penalty points. Each penalty point entails...... the reduction of a 30% discount on the driver's car insurance premium, which therefore produced the name, Pay as You Speed. The ISA equipment consists of a GPS-based On Board Unit with a mobile phone connection to a web server. The project was planned for a three-year test period with 300 young car drivers...

  3. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    International Nuclear Information System (INIS)

    Zabadal, J.; Vilhena, M.T.; Segatto, C.F.; Pazos, R.P.Ruben Panta.

    2002-01-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations

  4. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    Energy Technology Data Exchange (ETDEWEB)

    Zabadal, J. E-mail: jorge.zabadal@ufrgs.br; Vilhena, M.T. E-mail: vilhena@mat.ufrgs.br; Segatto, C.F. E-mail: cynthia@mat.ufrgs.br; Pazos, R.P.Ruben Panta. E-mail: rpp@mat.pucrgs.br

    2002-07-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations.

  5. Phosphorylated derivatives of anabasine: synthesis, constitution and complex forming properties

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text: With the purpose of detection of new effective extra gents of metals from number of sulphur containing derivatives of acids of phosphorus with different functional groups, analysis of effect of the different factors on selectivity of allocation of metals, installation of optimum conditions of an extraction, the detections of effective extra gents of noble metals from industrial sewage waters, are synthesized phosphorylated derivatives of the anabasine - O-alkyl-O-(anaba-sinoisopropyl)- and O-alkyl-O-(anabasinobutyn-2-yl)phenyl phosphonates and O-(anabasinoisopropyl)- and O-(anabasinobutyn-2-yl)diphenyl phosphonates In an IR-spectrum about O-pentyl-O-[anabasinoisopropyl]phenylphosphonate There are absorption band of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR O-(anabasinobutyn-2-yl)phenylphosphonate in the field of a weak field apart from signals of two phenylic radicals the signals of a b-displaced pyridine, reference for a molecule anabasine are observed: Hαa-8,46 p.m., H α '-8,41 p.m., H γ -7,60 p.m. And H β -7,15 p.m. A double triplet at 4,70 p.m. And triplet at 3,05 p.m. Belong to signals OCH 2 and N-CH 2 of groups, accordingly, separated by acetylene bond. The signals of piperidine cycle of anabasine have the following chemical shifts: H 2a -3,27 p.m., H 6e -2,78 p.m., H 6a -2,45 p.m., and remaining protons (6H, m, CH 2 ) are in resonance in the field of 1,1-1,9 p.m. The analysis of mass-spectrometer decay of the synthesized connections has shown, that the mass-spectrometer fragmentation M * about - O-alkyl-O- (anabasinoisopropyl) phenylphosphonates flows past in different directions and is characterized, as against about O-alkyl-O-(anabasinobutyn-2-yl)phenyl-phosphonates, large number of phosphor containing ions; the availability of the second phenylic radical in molecules anabasincontaining derivatives of a diphenyl phosphinic acid essentially

  6. Presidendi poeg piinab isa poliitilisi vastaseid / Aadu Hiietamm

    Index Scriptorium Estoniae

    Hiietamm, Aadu, 1954-

    2004-01-01

    Pärast Moskva-meelse Ahmad Kadõrovi valimist Tšetšeenia presidendiks valitseb olukord, kus presidendi poeg Ramzan peab vanglat ja tapab isa poliitilisi vastaseid, väidetakse maailma ajakirjanduses

  7. ISA 247: trans-ISA 247, trans-R 1524, ISA(TX)247, ISAtx 247, ISATx247, LX 211, LX211, R 1524, R-1524.

    Science.gov (United States)

    2007-01-01

    Isotechnika is developing the immunosuppressive drug ISA 247, a calcineurin inhibitor that is undergoing clinical development for the treatment of psoriasis (phase III) and prevention of organ rejection after transplantation (phase II). Preclinical development for uveitis is also underway. Other autoimmune disease indications that could be explored include arthritis, type I diabetes and Crohn's disease. ISA 247 was being co-developed as R 1524 by Isotechnika and Roche. However, Roche is no longer involved in the development of this compound. Based on analysis of previously collected data, the trans-ISA 247 isomer was found to be more bioavailable and it is expected that this isomer can be administered at a lower dose compared with the previous formulation that consisted of an equivalent mixture of the two geometric isomers (cis and trans). Preclinical observations indicate that ISA 247 has the potential to be more potent and less toxic than other marketed immunosuppressants in its class used for the prevention of transplant rejection. Experiments to date suggest that ISA 247 is about three times as potent as ciclosporin, while genotoxicity studies in animals have shown that the compound has a significantly reduced tendency to cause renal toxicity. The combination of reduced toxicity and improved potency would give ISA 247 a therapeutic benefit over existing calcineurin-based treatments. Isotechnika and Roche entered into a co-development and commercialisation agreement in April 2002, with Roche gaining the exclusive worldwide marketing rights for ISA 247; Isotechnika received milestone payments of $US4 million and $CAN21.9 million in September 2002 and May 2003, respectively. The agreement was restructured in April 2004, under which Isotechnika will now solely manage and fund the clinical development of trans-ISA 247. Upon successful completion of these trials, Isotechnika will conduct at its own expense a phase IIb study in renal transplantation and phase III

  8. Integrated Science Assessment (ISA) for Oxides of Nitrogen ...

    Science.gov (United States)

    This draft ISA document represents a concise synthesis and evaluation of the most policy-relevant science and will ultimately provide the scientific bases for EPA’s decision on retaining or revising the current secondary standards for NO2, SO2, PM 2.5 and PM 10 since the prior release of the assessment. The intent of the ISA, according to the CAA, is to “accurately reflect the latest scientific knowledge expected from the presence of [a] pollutant in ambient air” (U.S. Code, 1970a, 1970b). It includes scientific research from atmospheric sciences, exposure and deposition, biogeochemistry, hydrology, soil science, marine science, plant physiology, animal physiology, and ecology conducted at multiple scales (e.g., population, community, ecosystem, landscape levels). Key information and judgments formerly found in the Air Quality Criteria Documents (AQCDs) for oxides of nitrogen, oxides of nitrogen and particulate matter for ecological effects are included; Appendixes provide additional details supporting the ISA. Together, the ISA and Appendixes serve to update and revise the last oxides of nitrogen and oxides of sulfur ISA which was published in 2008 and the ecological portion of the last particulate matter ISA, which was published in 2009.

  9. Thermodynamic model of Ni(II) solubility, hydrolysis and complex formation with ISA

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Siso, Maria Rosa; Duro, Lara; Bruno, Jordi [Amphos21, Barcelona (Spain); Gaona, Xavier; Altmaier, Marcus [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Nuclear Waste Disposal

    2018-04-01

    the low solubility (<10{sup -7} M) of Ni(II) in hyperalkaline pH conditions representative of cementitious environments (10 ≤ pH ≤ 13), which increases to up to 10{sup -5} M in the presence of 0.2 M NaISA. These results significantly improve source term estimations for Ni(II) in environments relevant for the disposal of low and intermediate level radioactive waste (L/ILW). The chemical and thermodynamic models derived in this work can be implemented in geochemical models/calculations, and provide further confidence in the safety analysis of repositories for the disposal of L/ILW.

  10. Development of ISA procedure for uranium fuel fabrication and enrichment facilities: overview of ISA procedure and its application

    International Nuclear Information System (INIS)

    Yamate, Kazuki; Yamada, Takashi; Takanashi, Mitsuhiro; Sasaki, Noriaki

    2013-01-01

    Integrated Safety Analysis (ISA) procedure for uranium fuel fabrication and enrichment facilities has been developed for aiming at applying risk-informed regulation to these uranium facilities. The development has carried out referring to the ISA (NUREG-1520) by the Nuclear Regulatory Commission (NRC). The paper presents purpose, principles and activities for the development of the ISA procedure, including Risk Level (RL) matrix and grading evaluation method of IROFS (Items Relied on for Safety), as well as general description and features of the procedure. Also described in the paper is current status in application of risk information from the ISA. Japanese four licensees of the uranium facilities have been conducting ISA for their representative processes using the developed procedure as their voluntary safety activities. They have been accumulating experiences and knowledge on the ISA procedure and risk information through the field activities. NISA (Nuclear and Industrial Safety Agency) and JNES (Japan Nuclear Energy Safety Organization) are studying how to use such risk information for the safety regulation of the uranium facilities, taking into account the licensees' experiences and knowledge. (authors)

  11. Derivatives, forms and vector fields on the κ-deformed Euclidean space

    International Nuclear Information System (INIS)

    Dimitrijevic, Marija; Moeller, Lutz; Tsouchnika, Efrossini

    2004-01-01

    The model of κ-deformed space is an interesting example of a noncommutative space, since it allows a deformed symmetry. In this paper, we present new results concerning different sets of derivatives on the coordinate algebra of κ-deformed Euclidean space. We introduce a differential calculus with two interesting sets of one-forms and higher-order forms. The transformation law of vector fields is constructed in accordance with the transformation behaviour of derivatives. The crucial property of the different derivatives, forms and vector fields is that in an n-dimensional spacetime there are always n of them. This is the key difference with respect to conventional approaches, in which the differential calculus is (n + 1)-dimensional. This work shows that derivative-valued quantities such as derivative-valued vector fields appear in a generic way on noncommutative spaces

  12. Mining and urban impacts on semi-arid freshwater aquatic systems: the example of Mount Isa, Queensland.

    Science.gov (United States)

    Taylor, Mark P; Mackay, Alana; Kuypers, Tabitha; Hudson-Edwards, Karen

    2009-05-01

    This paper examines the environmental risk and impact of trace metals affecting river water and sediment in and around Mount Isa, Queensland, Australia. Bacterial indicator densities are also analysed throughout the catchment to assess the impacts and the potential hazards arising from agricultural activities, sewage treatment plant releases and urban runoff. The area is drained by the ephemeral Leichhardt River, which bisects Mount Isa City and the major Pb, Zn, Cu and Ag Mount Isa Mine. Runoff is captured downstream in Lake Moondarra, with the water being used following natural filtration via a lagoon-reed bed system for potable purposes by the residents of Mount Isa City. During the dry season, the channel is characterised by numerous pools that act as storage zones for sediment and water-soluble metals as well as urban and agriculturally derived nutrients and pathogens. Our results show that sediment and water quality within the Leichhardt River adjacent to and downstream of the mine frequently exceed Australian government sediment guidelines with average values of Cu, Pb and Zn found adjacent to the footprint of the mine being 1550, 510 and 470 mg kg(-1), respectively. Dry season analysis of water-soluble Cu, Pb and Zn concentrations within pools showed that Australian government low trigger guidelines are exceeded in 100, 46 and 100% cases, respectively. The densities of bacterial indicators in remnant pools throughout the Leichhardt River also exceeded acceptable guidelines. Maximum dry season faecal coliform densities of 2000 colony forming units (CFU) per 100 mL and Enterococcus counts of 900 organisms per 100 mL were recorded in dry season remnant pools compared to wet season maximum faecal coliform and Enterococcus densities of 119 000 CFU per 100 mL and 95 000 organisms per 100 mL, respectively. The impacts on biota were also examined by assessing the metal content of the tissue of seven fish from Lake Moondarra for their Cd, Cu, Hg, Pb and Zn

  13. Derivative spectrophotometric method for simultaneous determination of clindamycin phosphate and tretinoin in pharmaceutical dosage forms.

    Science.gov (United States)

    Barazandeh Tehrani, Maliheh; Namadchian, Melika; Fadaye Vatan, Sedigheh; Souri, Effat

    2013-04-10

    A derivative spectrophotometric method was proposed for the simultaneous determination of clindamycin and tretinoin in pharmaceutical dosage forms. The measurement was achieved using the first and second derivative signals of clindamycin at (1D) 251 nm and (2D) 239 nm and tretinoin at (1D) 364 nm and (2D) 387 nm.The proposed method showed excellent linearity at both first and second derivative order in the range of 60-1200 and 1.25-25 μg/ml for clindamycin phosphate and tretinoin respectively. The within-day and between-day precision and accuracy was in acceptable range (CVpharmaceutical dosage form.

  14. Vahetuspere isa osutus seksuaalseks ahistajaks / Merje Pors ; kommenteerinud Oliver Kontram

    Index Scriptorium Estoniae

    Pors, Merje

    2011-01-01

    Vahetusõpilase ahistamise juhtumist Argentiinas, kus vahetuspere isa kuritarvitas seksuaalselt vahetusõpilast. Vahetusprogrammide kaudu välismaale õppima minejate arvu vähenemisest, mistõttu on programmid sunnitud ümber orienteeruma ja rohkem välisõpilasi Eestisse tooma

  15. Evaluation of Montanide™ ISA 71 VG adjuvant during profilin vaccination against experimental coccidiosis.

    Directory of Open Access Journals (Sweden)

    Seung I Jang

    Full Text Available Chickens were immunized subcutaneously with an Eimeria recombinant profilin protein plus Montanide™ ISA 70 VG (ISA 70 or Montanide™ ISA 71 VG (ISA 71 water-in-oil adjuvants, or with profilin alone, and comparative RNA microarray hybridizations were performed to ascertain global transcriptome changes induced by profilin/ISA 70 vs. profilin alone and by profilin/ISA 71 vs. profilin alone. While immunization with profilin/ISA 70 vs. profilin alone altered the levels of more total transcripts compared with profilin/ISA 71 vs. profilin alone (509 vs. 296, the latter was associated with a greater number of unique biological functions, and a larger number of genes within these functions, compared with the former. Further, canonical pathway analysis identified 10 pathways that were associated with genes encoding the altered transcripts in animals immunized with profilin/ISA 71 vs. profilin alone, compared with only 2 pathways in profilin/ISA 70 vs. profilin alone. Therefore, ISA 71 was selected as a candidate adjuvant in conjunction with profilin vaccination for in vivo disease protection studies. Vaccination with profilin/ISA 71 was associated with greater body weight gain following E. acervulina infection, and decreased parasite fecal shedding after E. maxima infection, compared with profilin alone. Anti-profilin antibody levels were higher in sera of E. maxima- and E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. Finally, the levels of transcripts encoding interferon-γ, interleukin (IL-2, IL-10, and IL-17A were increased in intestinal lymphocytes from E. acervulina-, E. maxima-, and/or E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. None of these effects were seen in chickens injected with ISA 71 alone indicating that the adjuvant was not conferring non-specific immune stimulation. These results suggest that profilin plus ISA 71 augments protective immunity

  16. Evaluation of Montanide™ ISA 71 VG Adjuvant during Profilin Vaccination against Experimental Coccidiosis

    Science.gov (United States)

    Lillehoj, Hyun S.; Lee, Sung Hyen; Lee, Kyung Woo; Bertrand, François; Dupuis, Laurent; Deville, Sébastien; Ben Arous, Juliette; Lillehoj, Erik P.

    2013-01-01

    Chickens were immunized subcutaneously with an Eimeria recombinant profilin protein plus Montanide™ ISA 70 VG (ISA 70) or Montanide™ ISA 71 VG (ISA 71) water-in-oil adjuvants, or with profilin alone, and comparative RNA microarray hybridizations were performed to ascertain global transcriptome changes induced by profilin/ISA 70 vs. profilin alone and by profilin/ISA 71 vs. profilin alone. While immunization with profilin/ISA 70 vs. profilin alone altered the levels of more total transcripts compared with profilin/ISA 71 vs. profilin alone (509 vs. 296), the latter was associated with a greater number of unique biological functions, and a larger number of genes within these functions, compared with the former. Further, canonical pathway analysis identified 10 pathways that were associated with genes encoding the altered transcripts in animals immunized with profilin/ISA 71 vs. profilin alone, compared with only 2 pathways in profilin/ISA 70 vs. profilin alone. Therefore, ISA 71 was selected as a candidate adjuvant in conjunction with profilin vaccination for in vivo disease protection studies. Vaccination with profilin/ISA 71 was associated with greater body weight gain following E. acervulina infection, and decreased parasite fecal shedding after E. maxima infection, compared with profilin alone. Anti-profilin antibody levels were higher in sera of E. maxima- and E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. Finally, the levels of transcripts encoding interferon-γ, interleukin (IL)-2, IL-10, and IL-17A were increased in intestinal lymphocytes from E. acervulina-, E. maxima-, and/or E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. None of these effects were seen in chickens injected with ISA 71 alone indicating that the adjuvant was not conferring non-specific immune stimulation. These results suggest that profilin plus ISA 71 augments protective immunity against selective

  17. New oxirane derivatives of 1,4-naphthoquinones and their evaluation against T. cruzi epimastigote forms.

    Science.gov (United States)

    Carneiro, Paula F; do Nascimento, Samara B; Pinto, Antonio V; Pinto, Maria do Carmo F R; Lechuga, Guilherme C; Santos, Dilvani O; dos Santos Júnior, Helvécio M; Resende, Jackson A L C; Bourguignon, Saulo C; Ferreira, Vitor F

    2012-08-15

    New oxirane derivatives were synthesized using six naphthoquinones as the starting materials. Our biological results showed that these oxiranes acted as trypanocidal agents against Trypanosoma cruzi with minimal cytotoxicity in the VERO cell line compared to naphthoquinones. In particular, oxirane derivative 14 showed low cytotoxicity in a mammalian cell line and exhibited better activity against epimastigote forms of T.cruzi than the current drug used to treat Chagas disease, benznidazole. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Tumor cell-derived microparticles: a new form of cancer vaccine.

    Science.gov (United States)

    Zhang, Huafeng; Huang, Bo

    2015-08-01

    For cancer vaccines, tumor antigen availability is currently not an issue due to technical advances. However, the generation of optimal immune stimulation during vaccination is challenging. We have recently demonstrated that tumor cell-derived microparticles (MP) can function as a new form of potent cancer vaccine by efficiently activating type I interferon pathway in a cGAS/STING dependent manner.

  19. ISA-97 Compliant Architecture Testbed (ICAT) Projectry Organizations

    Science.gov (United States)

    1992-03-30

    by the System Integracion Directorate of the USAISEC, August 29, 1992. The report discusses the refinement of the ISA-97 Compliant Architecture Model...browser and iconic representations of system objects and resources. When the user is interacting with an application which has multiple compo- nents, it is...computer communications, it is not uncommon for large information systems to be shared by users on multiple machines. The trend towards the desktop

  20. A novel thiamine-derived pigment, pyrizepine, formed by the Maillard reaction.

    Science.gov (United States)

    Igoshi, Asuka; Noda, Kyoko; Murata, Masatsune

    2018-04-26

    To find a Maillard pigment derived from thiamine, a solution containing glucose and thiamine was heated and analyzed with high-performance liquid chromatography equipped with diode-array detection. As a result, a unique peak showing an absorption maximum at 380 nm was detected. This peak was then isolated from a reaction solution containing glucose, lysine and thiamine, and was identified as 1-(2-methyl-6,9-dihydro-5H-pyrimido[4,5-e][1,4]diazepin-7-yl)ethan-1-one using instrumental analyses. This compound, named pyrizepine, was a novel yellow pigment having a fused ring consisting of pyrimidine and diazepine. Pyrizepine was a major low-molecular-weight pigment in the reaction solution. The structure suggests that pyrizepine is formed by condensation reaction between a degradation product of thiamine and a tetrosone derivative formed from glucose by the Maillard reaction.

  1. Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.

    Science.gov (United States)

    Hotzel, Konrad; Heinze, Thomas

    2016-11-03

    An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Human embryonic stem cell derived mesenchymal progenitors express cardiac markers but do not form contractile cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Christophe M Raynaud

    Full Text Available Mesenchymal progenitors or stromal cells have shown promise as a therapeutic strategy for a range of diseases including heart failure. In this context, we explored the growth and differentiation potential of mesenchymal progenitors (MPs derived in vitro from human embryonic stem cells (hESCs. Similar to MPs isolated from bone marrow, hESC derived MPs (hESC-MPs efficiently differentiated into archetypical mesenchymal derivatives such as chondrocytes and adipocytes. Upon treatment with 5-Azacytidine or TGF-β1, hESC-MPs modified their morphology and up-regulated expression of key cardiac transcription factors such as NKX2-5, MEF2C, HAND2 and MYOCD. Nevertheless, NKX2-5+ hESC-MP derivatives did not form contractile cardiomyocytes, raising questions concerning the suitability of these cells as a platform for cardiomyocyte replacement therapy. Gene profiling experiments revealed that, although hESC-MP derived cells expressed a suite of cardiac related genes, they lacked the complete repertoire of genes associated with bona fide cardiomyocytes. Our results suggest that whilst agents such as TGF-β1 and 5-Azacytidine can induce expression of cardiac related genes, but treated cells retain a mesenchymal like phenotype.

  3. Two forms of Vibrio cholerae O1 El Tor hemolysin derived from identical precursor protein.

    Science.gov (United States)

    Ikigai, H; Ono, T; Nakae, T; Otsuru, H; Shimamura, T

    1999-01-08

    Vibrio cholerae O1 grown in heart infusion broth produces two forms of El Tor hemolysin (ETH) monomers of 65 and 50 kDa. These monomers form several different sizes of mixed oligomers ranging from 180 to 280 kDa in the liposomal membranes. We found that the N-terminal amino acid sequences, NH2-Trp-Pro-Ala-Pro-Ala-Asn-Ser-Glu, of both the 65- and 50-kDa toxins were identical. We assumed, therefore, that the 65- and 50-kDa toxins were derivatives of the identical precursor protein and the 50-kDa protein was a truncated derivative of 65-kDa ETH. To substantiate this assumption, we treated the 260-kDa oligomer with trypsin and obtained a 190-kDa oligomer. This 190-kDa oligomer consisted of only the 50-kDa subunits. Both 260- and 190-kDa oligomers formed ion channels indistinguishable from each other in planar lipid bilayers. These results suggest that the essential part of the ETH in forming the membrane-damaging aggregate is a 50-kDa protein.

  4. Induced pluripotent stem cell-derived cardiac progenitors differentiate to cardiomyocytes and form biosynthetic tissues.

    Directory of Open Access Journals (Sweden)

    Nicolas Christoforou

    Full Text Available The mammalian heart has little capacity to regenerate, and following injury the myocardium is replaced by non-contractile scar tissue. Consequently, increased wall stress and workload on the remaining myocardium leads to chamber dilation, dysfunction, and heart failure. Cell-based therapy with an autologous, epigenetically reprogrammed, and cardiac-committed progenitor cell source could potentially reverse this process by replacing the damaged myocardium with functional tissue. However, it is unclear whether cardiac progenitor cell-derived cardiomyocytes are capable of attaining levels of structural and functional maturity comparable to that of terminally-fated cardiomyocytes. Here, we first describe the derivation of mouse induced pluripotent stem (iPS cells, which once differentiated allow for the enrichment of Nkx2-5(+ cardiac progenitors, and the cardiomyocyte-specific expression of the red fluorescent protein. We show that the cardiac progenitors are multipotent and capable of differentiating into endothelial cells, smooth muscle cells and cardiomyocytes. Moreover, cardiac progenitor selection corresponds to cKit(+ cell enrichment, while cardiomyocyte cell-lineage commitment is concomitant with dual expression of either cKit/Flk1 or cKit/Sca-1. We proceed to show that the cardiac progenitor-derived cardiomyocytes are capable of forming electrically and mechanically coupled large-scale 2D cell cultures with mature electrophysiological properties. Finally, we examine the cell progenitors' ability to form electromechanically coherent macroscopic tissues, using a physiologically relevant 3D culture model and demonstrate that following long-term culture the cardiomyocytes align, and form robust electromechanical connections throughout the volume of the biosynthetic tissue construct. We conclude that the iPS cell-derived cardiac progenitors are a robust cell source for tissue engineering applications and a 3D culture platform for pharmacological

  5. Electron clearing and dimensional tolerance for the ISA chamber

    International Nuclear Information System (INIS)

    Herrera, J.C.

    1976-01-01

    In the straight sections of the ISA ring, the clearing of the low energy electrons produced by the beam-gas collisions will take place by longitudinal motion. Thus, an electron of low energy, which is prevented from escaping transversely by the attractive field of the beam, will receive successive kicks by the circulating protons and thereby acquire sufficient energy to travel longitudinally toward the clearing electrodes. However, a discontinuity or step in the chamber diameter, which occurs within an axial distance equal to a few diameters, gives rise to a potential difference along the chamber axis. In the case of a section of chambers which has a larger diameter, that is, a small cavity, the two steps result in a longitudinal potential well, or attractive region. It is then necessary that the electrons be given additional energy in order to overcome this longitudinal trapping potential. The ISA design envisions the placement of clearing electrodes at the location of significant chamber discontinuities, particularly in the experimental insertions. An estimate of the magnitude of the diameter discontinuity that can be tolerated without a clearing electrode is given

  6. Is it reliable that speed-calming solutions as ISA can reach the drivers, who needed it most?

    DEFF Research Database (Denmark)

    Agerholm, Niels

    A significant number of trials with Intelligent Speed Adaptation (ISA) have been carried out within the last two decades. Almost all with a promising result; the drivers reduce their proportion of speeding and are in general positive to ISA. However, two tings question this offhand success story; 1......: there has been no commercial break through for ISA so far, even though estimated has shown that ISA can reduce the n. of fatalities in traffic accidents with up to 59%, and 2: in the only ISA trial included drivers, who not participated voluntary in the trial, ISA had virtually no effect on these drivers...

  7. Integrated Science Assessment (ISA) for Carbon Monoxide (Second External Review Draft, Sep 2009)

    Science.gov (United States)

    EPA announced that the Second External Review Draft of the Integrated Science Assessment (ISA) for Carbon Monoxide (CO) and related Annexes was made available for independent peer review and public review. This draft ISA document represents a concise synthesis and evaluation of t...

  8. Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria (First External Review Draft, Sep 2007)

    Science.gov (United States)

    EPA has announced that the First External Review Draft of the Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria has been made available for independent peer review and public review. This draft ISA document represents a concise synthesis and evaluatio...

  9. Politiek draagvlak voor Intelligente Snelheidsaanpassing (ISA) : interviewstudie onder vertegenwoordigers van Nederlandse politieke partijen.

    NARCIS (Netherlands)

    Goldenbeld, C.

    2004-01-01

    Many road safety experts regard Intelligent Speed Adaptation (ISA) as a powerful instrument for regulating safe driving speeds and achieving more safety. In short, ISA ensures that, while it is in motion, the vehicle `receives' information about the speed limit that applies where it is. When driving

  10. Electron clearing and dimensional tolerance for the ISA chamber

    International Nuclear Information System (INIS)

    Herrera, J.C.

    1976-01-01

    In the straight sections of the ISA ring, the clearing of the low energy electrons produced by the beam-gas collisions will take place by longitudinal motion. Thus, an electron of low energy, which is prevented from escaping transversely by the attractive field of the beam, will receive successive kicks by the circulating protons and thereby acquire sufficient energy to travel longitudinally toward the clearing electrodes. However, a discontinuity or step in the chamber diameter, which occurs within an axial distance equal to a few diameters, gives rise to a potential difference along the chamber axis. An estimate of the magnitude of the diameter discontinuity that can be tolerated without a clearing electrode is given

  11. Safe handling of potential peroxide forming compounds and their corresponding peroxide yielded derivatives.

    Energy Technology Data Exchange (ETDEWEB)

    Sears, Jeremiah Matthew; Boyle, Timothy J.; Dean, Christopher J.

    2013-06-01

    This report addresses recent developments concerning the identification and handling of potential peroxide forming (PPF) and peroxide yielded derivative (PYD) chemicals. PPF chemicals are described in terms of labeling, shelf lives, and safe handling requirements as required at SNL. The general peroxide chemistry concerning formation, prevention, and identification is cursorily presented to give some perspective to the generation of peroxides. The procedure for determining peroxide concentrations and the proper disposal methods established by the Hazardous Waste Handling Facility are also provided. Techniques such as neutralization and dilution are provided for the safe handling of any PYD chemicals to allow for safe handling. The appendices are a collection of all available SNL documentation pertaining to PPF/PYD chemicals to serve as a single reference.

  12. Transmission FTIR derivative spectroscopy for estimation of furosemide in raw material and tablet dosage form

    Directory of Open Access Journals (Sweden)

    Máximo Gallignani

    2014-10-01

    Full Text Available A Fourier transform infrared derivative spectroscopy (FTIR-DS method has been developed for determining furosemide (FUR in pharmaceutical solid dosage form. The method involves the extraction of FUR from tablets with N,N-dimethylformamide by sonication and direct measurement in liquid phase mode using a reduced path length cell. In general, the spectra were measured in transmission mode and the equipment was configured to collect a spectrum at 4 cm−1 resolution and a 13 s collection time (10 scans co-added. The spectra were collected between 1400 cm−1 and 450 cm−1. Derivative spectroscopy was used for data processing and quantitative measurement using the peak area of the second order spectrum of the major spectral band found at 1165 cm−1 (SO2 stretching of FUR with baseline correction. The method fulfilled most validation requirements in the 2 mg/mL and 20 mg/mL range, with a 0.9998 coefficient of determination obtained by simple calibration model, and a general coefficient of variation <2%. The mean recovery for the proposed assay method resulted within the (100±3% over the 80%–120% range of the target concentration. The results agree with a pharmacopoeial method and, therefore, could be considered interchangeable.

  13. A generalized form of the Bernoulli Trial collision scheme in DSMC: Derivation and evaluation

    Science.gov (United States)

    Roohi, Ehsan; Stefanov, Stefan; Shoja-Sani, Ahmad; Ejraei, Hossein

    2018-02-01

    The impetus of this research is to present a generalized Bernoulli Trial collision scheme in the context of the direct simulation Monte Carlo (DSMC) method. Previously, a subsequent of several collision schemes have been put forward, which were mathematically based on the Kac stochastic model. These include Bernoulli Trial (BT), Ballot Box (BB), Simplified Bernoulli Trial (SBT) and Intelligent Simplified Bernoulli Trial (ISBT) schemes. The number of considered pairs for a possible collision in the above-mentioned schemes varies between N (l) (N (l) - 1) / 2 in BT, 1 in BB, and (N (l) - 1) in SBT or ISBT, where N (l) is the instantaneous number of particles in the lth cell. Here, we derive a generalized form of the Bernoulli Trial collision scheme (GBT) where the number of selected pairs is any desired value smaller than (N (l) - 1), i.e., Nsel < (N (l) - 1), keeping the same the collision frequency and accuracy of the solution as the original SBT and BT models. We derive two distinct formulas for the GBT scheme, where both formula recover BB and SBT limits if Nsel is set as 1 and N (l) - 1, respectively, and provide accurate solutions for a wide set of test cases. The present generalization further improves the computational efficiency of the BT-based collision models compared to the standard no time counter (NTC) and nearest neighbor (NN) collision models.

  14. Theoretical derivation of a simplified form of the OTOR/GOT differential equation

    International Nuclear Information System (INIS)

    Lovedy Singh, L.; Gartia, R.K.

    2013-01-01

    A simplified form of the OTOR/GOT differential equation has been derived, which may be employed in the evaluation of TL curves for saturated (N = n o ) and non-saturated cases (N > n o ). The present eqn. is found to be theoretically correct and physically sound in comparison with empirical general order kinetics. It has been found that the TL curve evaluated using the present eqn. matches the TL curves evaluated using differential eqn. formalism, and spans the region from α = n o /(100N) to α = 0.999 (where α is the ratio of the retrapping probability to the recombination probability). The simulated curve resembles a first order kinetics curve when α = n o /(100N) and a second order kinetics curve when α = 0.999. However, comparison with general order kinetics for the intermediate range is not possible as a one- to-one correspondence between α and b cannot be made. Also, calculation in the saturated case is made simpler since only three unknown parameters (E, s and α) are required. -- Highlights: • Theoretically and physically sound general order equation has been derived. • Can be employed in the calculation of saturated and non-saturated cases. • It is found to match with those evaluated using differential equation formalism. • Calculation in the saturated case requires only three unknown parameter

  15. Growth behavior of anodic oxide formed by aluminum anodizing in glutaric and its derivative acid electrolytes

    Science.gov (United States)

    Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.

    2014-12-01

    The growth behavior of anodic oxide films formed via anodizing in glutaric and its derivative acid solutions was investigated based on the acid dissociation constants of electrolytes. High-purity aluminum foils were anodized in glutaric, ketoglutaric, and acetonedicarboxylic acid solutions under various electrochemical conditions. A thin barrier anodic oxide film grew uniformly on the aluminum substrate by glutaric acid anodizing, and further anodizing caused the film to breakdown due to a high electric field. In contrast, an anodic porous alumina film with a submicrometer-scale cell diameter was successfully formed by ketoglutaric acid anodizing at 293 K. However, the increase and decrease in the temperature of the ketoglutaric acid resulted in non-uniform oxide growth and localized pitting corrosion of the aluminum substrate. An anodic porous alumina film could also be fabricated by acetonedicarboxylic acid anodizing due to the relatively low dissociation constants associated with the acid. Acid dissociation constants are an important factor for the fabrication of anodic porous alumina films.

  16. Isolation and characterization of human umbilical cord-derived endothelial colony-forming cells

    Science.gov (United States)

    Zhang, Hao; Tao, Yanling; Ren, Saisai; Liu, Haihui; Zhou, Hui; Hu, Jiangwei; Tang, Yongyong; Zhang, Bin; Chen, Hu

    2017-01-01

    Endothelial colony-forming cells (ECFCs) are a population of endothelial progenitor cells (EPCs) that display robust proliferative potential and vessel-forming capability. Previous studies have demonstrated that a limited number of ECFCs may be obtained from adult bone marrow, peripheral blood and umbilical cord (UC) blood. The present study describes an effective method for isolating ECFCs from human UC. The ECFCs derived from human UC displayed the full properties of EPCs. Analysis of the growth kinetics, cell cycle and colony-forming ability of the isolated human UC-ECFCs indicated that the cells demonstrated properties of stem cells, including relative stability and rapid proliferation in vitro. Gene expression of Fms related tyrosine kinase 1, kinase insert domain receptor, vascular endothelial cadherin, cluster of differentiation (CD)31, CD34, epidermal growth factor homology domains-2, von Willebrand factor and endothelial nitric oxide synthase was assessed by reverse transcription-polymerase chain reaction. The cells were positive for CD34, CD31, CD73, CD105 and vascular endothelial growth factor receptor-2, and negative for CD45, CD90 and human leukocyte antigen-antigen D related protein according to flow cytometry. 1,1′-dioctadecyl-3,3,3′,3′-tetra-methyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein and fluorescein isothiocyanate-Ulex europaeus-l were used to verify the identity of the UC-ECFCs. Matrigel was used to investigate tube formation capability. The results demonstrated that the reported technique is a valuable method for isolating human UC-ECFCs, which have potential for use in vascular regeneration. PMID:29067104

  17. Synthesis, structure and complex forming ability of phosphorylated derivatives of heterocyclic compounds

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text: The derivatives of acids of phosphorus, due to variety of properties, are a subject of numerous researches. Now it is known, that the derivatives of acids of phosphorus apart from insect, neurotoxic, antienzym and other kinds of physiological activity have also complex forming properties. As extra gents of noble metals particularly are analyzed by the derivatives of dithio phosphor of acids although organ phosphorus compounds with one nuclear of sulfur make extraction properties. Therefore, with the purpose of detection of effective extra gents of ions of argentum the phosphorylated derivatives of heterogeneous ring compounds were synthesized: Ph(RO)P(O)Cl + HOCH(CH 3 )CH 2 -R ' -> Ph(RO)P(O)OCH(CH 3 )CH 2 -R ' + HCl. R C 2 H 5 - C 6 H 13 , R ' = a piperidine, morpholine, anabasine Structure of the obtained connections is confirmed by the results IR -, Pm- and mass- spectrometry. In an IR-spectrum O-hexyl-O - [piperidynoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1260, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In an IR-spectrum O-pentyl-[anabasinoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR about O-pentyl-[morpholyniisopropyl] phenylphosphonate in the field of a weak field (7, 18-7, 29 p.m.) the multiplet about tones of phenyl group is watched. Me tin proton resonate at 4,66 m.d.as multiplet The signals O-CH 2 of protons of morpholinic cycle appear at 3,58 m.d.. 4H) by the way of triplet. The protons N-CH 2 (6H) three methylene groups will derivate a composite multiple at 2, 10-2, 70 m.d.. The signal of metil group's protons (3H) is watched at 1,15m.d.as doublet. Final metal group resonates at 0, 87 p.m. Six of C-CH 2 of groups give a complex signal in the field of 1, 2-1, 8 m.d. The obtained connections

  18. Cranial vasculature in zebrafish forms by angioblast cluster-derived angiogenesis.

    Science.gov (United States)

    Proulx, Kira; Lu, Annie; Sumanas, Saulius

    2010-12-01

    Formation of embryonic vasculature involves vasculogenesis as endothelial cells differentiate and aggregate into vascular cords and angiogenesis which includes branching from the existing vessels. In the zebrafish which has emerged as an advantageous model to study vasculogenesis, cranial vasculature is thought to originate by a combination of vasculogenesis and angiogenesis, but how these processes are coordinated is not well understood. To determine how angioblasts assemble into cranial vasculature, we generated an etsrp:GFP transgenic line in which GFP reporter is expressed under the promoter control of an early regulator of vascular and myeloid development, etsrp/etv2. By utilizing time-lapse imaging we show that cranial vessels originate by angiogenesis from angioblast clusters, which themselves form by the mechanism of vasculogenesis. The two major pairs of bilateral clusters include the rostral organizing center (ROC) which gives rise to the most rostral cranial vessels and the midbrain organizing center (MOC) which gives rise to the posterior cranial vessels and to the myeloid and endocardial lineages. In Etsrp knockdown embryos initial cranial vasculogenesis proceeds normally but endothelial and myeloid progenitors fail to initiate differentiation, migration and angiogenesis. Such angioblast cluster-derived angiogenesis is likely to be involved during vasculature formation in other vertebrate systems as well. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Sharing data for production scheduling using the ISA-95 standard

    Directory of Open Access Journals (Sweden)

    Iiro eHarjunkoski

    2014-10-01

    Full Text Available In the development and deployment of production scheduling solutions one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment and other resources are necessary for producing a realistic short-term production plan. Currently, a widely-accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data-exchange for scheduling solutions.

  20. Sharing Data for Production Scheduling Using the ISA-95 Standard

    Energy Technology Data Exchange (ETDEWEB)

    Harjunkoski, Iiro, E-mail: iiro.harjunkoski@de.abb.com; Bauer, Reinhard [ABB Corporate Research, Industrial Software and Applications, Ladenburg (Germany)

    2014-10-21

    In the development and deployment of production scheduling solutions, one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment, and other resources are necessary for producing a realistic short-term production plan. Currently, a widely accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data exchange for scheduling solutions.

  1. Sharing Data for Production Scheduling Using the ISA-95 Standard

    International Nuclear Information System (INIS)

    Harjunkoski, Iiro; Bauer, Reinhard

    2014-01-01

    In the development and deployment of production scheduling solutions, one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment, and other resources are necessary for producing a realistic short-term production plan. Currently, a widely accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data exchange for scheduling solutions.

  2. Mid-crustal uranium and rare metal mineralisation in the Mount Isa Inlier: a genetic model for formation of orogenic uranium deposits

    OpenAIRE

    McGloin, Matthew

    2017-01-01

    Uranium mineralisation near Mount Isa in northwest Queensland, Australia, is widespread yet poorly understood. Within this region in the Western Fold Belt, one hundred and ninety uranium-rare metal occurrences are known. This uranium mineralisation is similar to worldwide examples of albitite-hosted or sodium-metasomatic uranium deposits, which host albite-carbonate ore zones enriched in incompatible elements. Various metal sources and ore-forming processes have been sugg...

  3. Evelin Ilvese isa : oleme tütrega ära leppinud / Karoliina Vasli

    Index Scriptorium Estoniae

    Vasli, Karoliina

    2007-01-01

    Proua Evelin Ilvese Helsingis elav isa Lembit Int räägib oma suhetest tütre ja väimehega. Vt. samas: Isa: "Evelinil on kahju, et unistus külalistemajast hetkel soiku jääb." Lembit Int väljendab kahetsust, et Ärma talu enam külalistemajana ei tööta

  4. ISA100.11a*: The ISA100.11a extension for supporting energy-harvested I/O devices

    NARCIS (Netherlands)

    Zand, P.; Mathews, E.; Das, Kallol; Dilo, Arta; Havinga, Paul J.M.

    Wireless standards developed for industrial applications such as ISA100.11a and WirelessHART, generally use centralized management approaches. However, such centralized approaches cannot cope with network dynamicity in real-time manner. They also incur high management overhead and latency.

  5. The derivation of the general form of kinematics with the universal reference system

    Science.gov (United States)

    Szostek, Karol; Szostek, Roman

    2018-03-01

    In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether - with any transverse contraction. The entire article contains only original research conducted by its authors.

  6. The derivation of the general form of kinematics with the universal reference system

    Directory of Open Access Journals (Sweden)

    Karol Szostek

    2018-03-01

    Full Text Available In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether – with any transverse contraction. The entire article contains only original research conducted by its authors. Keywords: Kinematics of bodies, Universal frame of reference, Transformation of time and position, One-way speed of light, Anisotropy of cosmic microwave background

  7. An Activity of Thioacyl Derivatives of 4-Aminoquinolinium Salts towards Biofilm Producing and Planktonic Forms of Coagulase-Negative Staphylococci

    Directory of Open Access Journals (Sweden)

    Robert D. Wojtyczka

    2015-01-01

    Full Text Available Microorganisms present in different environments have developed specific mechanisms of settling on various abiotic and biotic surfaces by forming a biofilm. It seems to be well justified to search for new compounds enabling biofilm reduction, which is highly resistant to antibiotics. This study was thus an initial assessment of the antibacterial activity of two new quinoline derivatives of a structure of 3-thioacyl 1-methyl 4-arylaminoquinolinium salts against coagulase-negative staphylococci (CoNS isolated from a hospital environment, in a form of both biofilms and in planktonic form. Thirty-three stains of CoNS isolated from the hospital environment (air, surfaces and seven reference strains from the ATCC collection were selected for the study. The mean MIC value for 1-methyl-3-benzoylthio-4-(4-chlorophenylaminoquinolinum chloride (4-chlorophenylamino derivative was 42.60 ± 19.91 μg/mL, and in the case of strains subjected to 1-methyl-3-benzoylthio-4-(4-fluorophenylaminoquinolinum chloride (4-fluorophenylamino derivative activity, the mean MIC value was 43.20 ± 14.30 μg/mL. The mean concentration of 4-chlorophenylamino derivative that inhibited biofilm formation was 86.18 ± 30.64 μg/mL. The mean concentration of 4-fluorophenylamino derivatives that inhibited biofilm formation was higher and amounted to 237.09 ± 160.57 μg/mL. Based on the results, both derivatives of the examined compounds exhibit high antimicrobial activity towards strains growing both in planktonic and biofilm form.

  8. Selective displacement of the tributylstannyl group to form [125I]phenylboronic acid derivatives

    International Nuclear Information System (INIS)

    Kinsey, B.M.; Kassis, A.I.

    1990-01-01

    Three radioiodinated phenylboronic acid derivatives (1a, 2a, 3a) were prepared at the no-carrier-added level by selective displacement of the corresponding tributylstannyl group. The tributylstannyl compounds 1b, 2b, and 3b were synthesized from the bromo derivatives 1c, 2c and 3c. Radioiodination was accomplished using Na 125 I and either Chloramine-T or peracetic acid to give 1a, 2a and 3a in radiochemical yields of 46, 26, and 67% respectively after HPLC purification. Compounds 1a, 2a and 3a were concentrated in vitro preferentially in HT-29 human colon carcinoma cells compared to V79 Chinese hamster lung fibroblasts, with 3a having the highest uptake

  9. Identification of the products of the cleavage of the galactans of red seaweeds in the form of pyridylamino derivatives

    International Nuclear Information System (INIS)

    Usov, A.I.; Dobkina, I.M.

    1986-01-01

    It has been shown that pyridylamino derivatives are convenient for the identification of various products of the galactans of red algae. Reductive amination with 2-aminopyridine and sodium thiohydroborate has been investigated for the case of several monosaccharides that are common components of the polysaccharide fractions of red seaweeds and also for carrabiose, agarobiose, and oligosaccharides of the neoagarobiose series. Various forms of chromatography and high-voltage paper electrophoresis were used to separate the pyridylamino derivatives, and NMR spectroscopy and mass spectroscopy of the full acetates for structural characterization

  10. Functional neuromuscular junctions formed by embryonic stem cell-derived motor neurons.

    Directory of Open Access Journals (Sweden)

    Joy A Umbach

    Full Text Available A key objective of stem cell biology is to create physiologically relevant cells suitable for modeling disease pathologies in vitro. Much progress towards this goal has been made in the area of motor neuron (MN disease through the development of methods to direct spinal MN formation from both embryonic and induced pluripotent stem cells. Previous studies have characterized these neurons with respect to their molecular and intrinsic functional properties. However, the synaptic activity of stem cell-derived MNs remains less well defined. In this study, we report the development of low-density co-culture conditions that encourage the formation of active neuromuscular synapses between stem cell-derived MNs and muscle cells in vitro. Fluorescence microscopy reveals the expression of numerous synaptic proteins at these contacts, while dual patch clamp recording detects both spontaneous and multi-quantal evoked synaptic responses similar to those observed in vivo. Together, these findings demonstrate that stem cell-derived MNs innervate muscle cells in a functionally relevant manner. This dual recording approach further offers a sensitive and quantitative assay platform to probe disorders of synaptic dysfunction associated with MN disease.

  11. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  12. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  13. Properties and potential of formed cokes derived from two Turkish lignites by carbonization of binderless briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Bayraktur, K.N.; Lawson, G.J.

    1984-09-01

    Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lowerrank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy.

  14. Properties and potential of formed cokes derived from two Turkish lignites by carbonization of binderless briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Bayraktar, K.N.; Lawson, G.J.

    1984-09-01

    Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lower-rank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash yield and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy. 38 references.

  15. Current status and applications of intergrated safety assessment and simulation code system for ISA

    Energy Technology Data Exchange (ETDEWEB)

    Izquierdo, J. M.; Hortal, J.; Perea, M. Sanchez; Melendez, E. [Modeling and Simulation Area (MOSI), Nuclear Safety Council (CSN), Madrid (Spain); Queral, E.; Rivas-Lewicky, J. [Energy and Fuels Department, Technical University of Madrid (UPM), Madrid (Spain)

    2017-03-15

    This paper reviews current status of the unified approach known as integrated safety assessment (ISA), as well as the associated SCAIS (simulation codes system for ISA) computer platform. These constitute a proposal, which is the result of collaborative action among the Nuclear Safety Council (CSN), University of Madrid (UPM), and NFQ Solutions S.L, aiming to allow independent regulatory verification of industry quantitative risk assessments. The content elaborates on discussions of the classical treatment of time in conventional probabilistic safety assessment (PSA) sequences and states important conclusions that can be used to avoid systematic and unacceptable underestimation of the failure exceedance frequencies. The unified ISA method meets this challenge by coupling deterministic and probabilistic mutual influences. The feasibility of the approach is illustrated with some examples of its application to a real size plant.

  16. Semantic False Memories in the Form of Derived Relational Intrusions Following Training

    Science.gov (United States)

    Guinther, Paul M.; Dougher, Michael J.

    2010-01-01

    Contemporary behavior analytic research is making headway in characterizing memory phenomena that typically have been characterized by cognitive models, and the current study extends this development by producing "false memories" in the form of functional equivalence responding. A match-to-sample training procedure was administered in order to…

  17. ISA-TAB-Nano: A Specification for Sharing Nanomaterial Research Data in Spreadsheet-based Format

    Science.gov (United States)

    2013-01-01

    Background and motivation The high-throughput genomics communities have been successfully using standardized spreadsheet-based formats to capture and share data within labs and among public repositories. The nanomedicine community has yet to adopt similar standards to share the diverse and multi-dimensional types of data (including metadata) pertaining to the description and characterization of nanomaterials. Owing to the lack of standardization in representing and sharing nanomaterial data, most of the data currently shared via publications and data resources are incomplete, poorly-integrated, and not suitable for meaningful interpretation and re-use of the data. Specifically, in its current state, data cannot be effectively utilized for the development of predictive models that will inform the rational design of nanomaterials. Results We have developed a specification called ISA-TAB-Nano, which comprises four spreadsheet-based file formats for representing and integrating various types of nanomaterial data. Three file formats (Investigation, Study, and Assay files) have been adapted from the established ISA-TAB specification; while the Material file format was developed de novo to more readily describe the complexity of nanomaterials and associated small molecules. In this paper, we have discussed the main features of each file format and how to use them for sharing nanomaterial descriptions and assay metadata. Conclusion The ISA-TAB-Nano file formats provide a general and flexible framework to record and integrate nanomaterial descriptions, assay data (metadata and endpoint measurements) and protocol information. Like ISA-TAB, ISA-TAB-Nano supports the use of ontology terms to promote standardized descriptions and to facilitate search and integration of the data. The ISA-TAB-Nano specification has been submitted as an ASTM work item to obtain community feedback and to provide a nanotechnology data-sharing standard for public development and adoption. PMID

  18. Einstein in matrix form. Exact derivation of the theory of special and general relativity without tensors

    Energy Technology Data Exchange (ETDEWEB)

    Ludyk, Guenter [Bremen Univ. (Germany). Physics and Electrical Engineering

    2013-11-01

    Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  19. Einstein in matrix form. Exact derivation of the theory of special and general relativity without tensors

    International Nuclear Information System (INIS)

    Ludyk, Guenter

    2013-01-01

    Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  20. Role of Mesenchymal Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

    Science.gov (United States)

    2017-07-01

    Clinical Metastases PRINCIPAL INVESTIGATOR: Jeffrey Green CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017 TYPE...2016 - 14 June 2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical ...and/or select agents. Nothing to report. 6. PRODUCTS: • publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will

  1. Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

    Science.gov (United States)

    2017-07-01

    Clinical Metastases PRINCIPAL INVESTIGATOR: Rosandra Kaplan CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017...2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases 5a...PRODUCTS:  publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will present this work at the Annual

  2. Secondary phases formed during nuclear waste glass-water interactions: Thermodynamic and derived properties

    International Nuclear Information System (INIS)

    McKenzie, W.F.

    1992-08-01

    The thermodynamic properties of secondary phases observed to form during nuclear waste glass-water interactions are of particular interest as it is with the application of these properties together with the thermodynamic properties of other solid phases, fluid phases, and aqueous species that one may predict the environmental consequences of introducing radionuclides contained in the glass into groundwater at a high-level nuclear waste repository. The validation of these predicted consequences can be obtained from laboratory experiments and field observations at natural analogue sites. The purpose of this report is to update and expand the previous compilation (McKenzie, 1991) of thermodynamic data retrieved from the literature and/or estimated for secondary phases observed to form (and candidate phases from observed chemical compositions) during nuclear waste glass-water interactions. In addition, this report includes provisionally recommended thermodynamic data of secondary phases

  3. Einstein in matrix form exact derivation of the theory of special and general relativity without tensors

    CERN Document Server

    Ludyk, Günter

    2013-01-01

    This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the "Black Hole" phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  4. Derivative spectrophotometric method for simultaneous determination of zofenopril and fluvastatin in mixtures and pharmaceutical dosage forms.

    Science.gov (United States)

    Stolarczyk, Mariusz; Maślanka, Anna; Apola, Anna; Rybak, Wojciech; Krzek, Jan

    2015-09-05

    Fast, accurate and precise method for the determination of zofenopril and fluvastatin was developed using spectrophotometry of the first (D1), second (D2), and third (D3) order derivatives in two-component mixtures and in pharmaceutical preparations. It was shown, that the developed method allows for the determination of the tested components in a direct manner, despite the apparent interference of the absorption spectra in the UV range. For quantitative determinations, "zero-crossing" method was chosen, appropriate wavelengths for zofenopril were: D1 λ=270.85 nm, D2 λ=286.38 nm, D3 λ=253.90 nm. Fluvastatin was determined at wavelengths: D1 λ=339.03 nm, D2 λ=252.57 nm, D3 λ=258.50 nm, respectively. The method was characterized by high sensitivity and accuracy, for zofenopril LOD was in the range of 0.19-0.87 μg mL(-1), for fluvastatin 0.51-1.18 μg mL(-1), depending on the class of derivative, and for zofenopril and fluvastatin LOQ was 0.57-2.64 μg mL(-1) and 1.56-3.57 μg mL(-1), respectively. The recovery of individual components was within the range of 100±5%. For zofenopril, the linearity range was estimated between 7.65 μg mL(-1) and 22.94 μg mL(-1), and for fluvastatin between 5.60 μg mL(-1) and 28.00 μg mL(-1). Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Solubilization of Phenol Derivatives in Polymer Micelles Formed by Cationic Block Copolymer

    Directory of Open Access Journals (Sweden)

    Irma Fuentes

    2017-01-01

    Full Text Available The aggregation of cationic block copolymers formed by polystyrene (PS and poly(ethyl-4-vinylpyridine (PS-b-PE4VP was studied in aqueous solution. Diblock copolymers of PS and poly(4-vinylpyridine were synthesized by sequential anionic polymerization using BuLi as initiator. Subsequently, the 4-vinylpyridine units were quaternized with ethyl bromide to obtain cationic PS-b-PE4VP block copolymers with different quaternization degree. The self-aggregation of cationic block copolymers was studied by fluorescence probing, whereas the morphology and size of polymer micelles were determined by transmission electronic microscopy. Results indicate that spherical micelles with sizes lower than 100 nm were formed, whereas their micropolarity decreases with increasing quaternization degree. The partition of phenols between the micellar and aqueous phase was studied by using the pseudo-phase model, and the results show that the partition coefficients increase with increasing length of the side alkyl chain and are larger for star micelles. These results are discussed in terms of three-region model.

  6. Relationship of soil potassium forms with maize potassium contents in soils derived from different parent materials

    Directory of Open Access Journals (Sweden)

    Rashid Mehmood Butt

    2017-06-01

    Full Text Available Understanding of soil potassium (K dynamics is essential for sustainable crop production. Bioavailability of K depends on forms and distribution within the soil profile. The objectives of this research were to determine which soil K forms control the maize (Zea mays K contents and compare the extracting capability of sodium tetraphenylborate (NaTPB with ammonium acetate (NH4OAc method. Nine soils representing three different parent materials, i.e. loess, sandstone and shale were sampled at three surface genetic horizons. Within each parent material, three soils at varying level of development were selected. Besides basic soil parameters, K was fractioned into water soluble K, exchangeable K, non-exchangeable K, and NaTPB-extracted K. The maize was sown in pots having 2 kg soil from each genetic horizon. Crop was harvested at seven weeks and plant was analysed for K contents. Results show that NaTPB-extracted K gave best correlation as compared to NH4OAc method. This conveys that a non-exchangeable K portion that becomes available to plants can be better estimated by NaTPB method than NH4OAc extraction.

  7. Application of the integrated analysis of safety (ISA) to sequences of Total loss of feed water in a PWR Reactor

    International Nuclear Information System (INIS)

    Moreno Chamorro, P.; Gallego Diaz, C.

    2011-01-01

    The main objective of this work is to show the current status of the implementation of integrated analysis of safety (ISA) methodology and its SCAIS associated tool (system of simulation codes for ISA) to the sequence analysis of total loss of feedwater in a PWR reactor model Westinghouse of three loops with large, dry containment.

  8. The hematopoietic chemokine CXCL12 promotes integration of human endothelial colony forming cell-derived cells into immature vessel networks.

    Science.gov (United States)

    Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M

    2014-11-15

    Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.

  9. Characterization of Protein and Peptide Binding to Nanogels Formed by Differently Charged Chitosan Derivatives

    Directory of Open Access Journals (Sweden)

    Anastasia Zubareva

    2013-07-01

    Full Text Available Chitosan (Chi is a natural biodegradable cationic polymer with remarkable potency as a vehicle for drug or vaccine delivery. Chi possesses multiple groups, which can be used both for Chi derivatization and for particle formation. The aim of this work was to produce stable nanosized range Chi gels (nanogels, NGs with different charge and to study the driving forces of complex formation between Chi NGs and proteins or peptides. Positively charged NGs of 150 nm in diameter were prepared from hexanoyl chitosan (HC by the ionotropic gelation method while negatively charged NGs of 190 nm were obtained from succinoyl Chi (SC by a Ca2+ coacervation approach. NGs were loaded with a panel of proteins or peptides with different weights and charges. We show that NGs preferentially formed complexes with oppositely charged molecules, especially peptides, as was demonstrated by gel-electrophoresis, confocal microscopy and HPLC. Complex formation was accompanied by a change in zeta-potential and decrease in size. We concluded that complex formation between Chi NGs and peptide/proteins is mediated mostly by electrostatic interactions.

  10. Earthworm-Derived Pore-Forming Toxin Lysenin and Screening of Its Inhibitors

    Directory of Open Access Journals (Sweden)

    Neelanun Sukumwang

    2013-08-01

    Full Text Available Lysenin is a pore-forming toxin from the coelomic fluid of earthworm Eisenia foetida. This protein specifically binds to sphingomyelin and induces erythrocyte lysis. Lysenin consists of 297 amino acids with a molecular weight of 41 kDa. We screened for cellular signal transduction inhibitors of low molecular weight from microorganisms and plants. The purpose of the screening was to study the mechanism of diseases using the obtained inhibitors and to develop new chemotherapeutic agents acting in the new mechanism. Therefore, our aim was to screen for inhibitors of Lysenin-induced hemolysis from plant extracts and microbial culture filtrates. As a result, we isolated all-E-lutein from an extract of Dalbergia latifolia leaves. All-E-lutein is likely to inhibit the process of Lysenin-membrane binding and/or oligomer formation rather than pore formation. Additionally, we isolated tyrosylproline anhydride from the culture filtrate of Streptomyces as an inhibitor of Lysenin-induced hemolysis.

  11. Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria (Final Report, Sep 2008)

    Science.gov (United States)

    EPA announced the availability of the final report, Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria final assessment. This report represents a concise synthesis and evaluation of the most policy-relevant science and will ultimately provide the scien...

  12. 75 FR 69078 - Workshop To Review Draft Materials for the Lead (Pb) Integrated Science Assessment (ISA)

    Science.gov (United States)

    2010-11-10

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9224-7] Workshop To Review Draft Materials for the Lead (Pb) Integrated Science Assessment (ISA) AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of Workshop... (NAAQS) for Lead (Pb), EPA is announcing that a workshop to evaluate initial draft materials for the Pb...

  13. Year 2000 compliance concerns with the ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software system

    Energy Technology Data Exchange (ETDEWEB)

    Saviz, K.

    1998-05-26

    The year 2000 is rapidly approaching, and there is a good chance that computer systems that utilize two digit year dates will experience problems in retrieval of date information. The ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software and computer system has been reviewed for Year 2000 compliance issues.

  14. Year 2000 compliance concerns with the ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software system

    International Nuclear Information System (INIS)

    Saviz, K.

    1998-01-01

    The year 2000 is rapidly approaching, and there is a good chance that computer systems that utilize two digit year dates will experience problems in retrieval of date information. The ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software and computer system has been reviewed for Year 2000 compliance issues

  15. Intramolecular carbenoid ylide forming reactions of 2-diazo-3-keto-4-phthalimidocarboxylic esters derived from methionine and cysteine

    Directory of Open Access Journals (Sweden)

    Marc Enßle

    2012-03-01

    Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.

  16. DOCUMENTACIÓN DE UNA PRUEBA DE BIODEGRADACIÓN BAJO DIGESTIÓN ANAEROBIA CON ISA S.88

    Directory of Open Access Journals (Sweden)

    PAOLA MARCELA CERTUCHE MUÑOZ

    2016-12-01

    Full Text Available This paper proposes the ISA 88 standard as a tool to standardize a biodegradation test, through systematic documentation of tests, which contributes to the reproducibility and repetitividad of the method. This standard was applied to the ISO 15985 test; after the implementation of the standard, the process model was formed of 3 stages, 14 and 78 shares operations; procedural control model was formed of 3 unit procedures, operations 14 and 78 phases; the physical model, was formed of 4 units with their respective modules and control equipment; the recipe control model was integrated by physical model and procedural model and defines the formulation of materials. The automation level´s cell is determined at level 0 (74% manual, semiautomatic 33% and 6% automatic. The difficulty level of operating phases was identified as (77% under, 17% regulate and 6% higher. Finally, are exposed the advantages of the use for the standard in terms of standardization, frame generation control, flexibility and automation diagnosis.

  17. Development of ISA procedure for uranium fuel fabrication and enrichment facilities

    International Nuclear Information System (INIS)

    Yamate, Kazuki; Arakawa, Tomoyuki; Yamashita, Masahiro; Sasaki, Noriaki; Hirano, Mitsumasa

    2011-01-01

    The integrated safety analysis (ISA) procedure has been developed to apply risk-informed regulation to uranium fuel fabrication and enrichment facilities. The major development efforts are as follows: (a) preparing the risk level matrix as an index for items-relied-on-for-safety (IROFS) identification, (b) defining requirements of IROFS, and (c) determining methods of IROFS importance based on the results of risk- and scenario-based analyses. For the risk level matrix, the consequence and likelihood categories have been defined by taking into account the Japanese regulatory laws, rules, and safety standards. The trial analyses using the developed procedure have been performed for several representative processes of the reference uranium fuel fabrication and enrichment facilities. This paper presents the results of the ISA for the sintering process of the reference fabrication facility. The results of the trial analyses have demonstrated the applicability of the procedure to the risk-informed regulation of these facilities. (author)

  18. Open architecture design and approach for the Integrated Sensor Architecture (ISA)

    Science.gov (United States)

    Moulton, Christine L.; Krzywicki, Alan T.; Hepp, Jared J.; Harrell, John; Kogut, Michael

    2015-05-01

    Integrated Sensor Architecture (ISA) is designed in response to stovepiped integration approaches. The design, based on the principles of Service Oriented Architectures (SOA) and Open Architectures, addresses the problem of integration, and is not designed for specific sensors or systems. The use of SOA and Open Architecture approaches has led to a flexible, extensible architecture. Using these approaches, and supported with common data formats, open protocol specifications, and Department of Defense Architecture Framework (DoDAF) system architecture documents, an integration-focused architecture has been developed. ISA can help move the Department of Defense (DoD) from costly stovepipe solutions to a more cost-effective plug-and-play design to support interoperability.

  19. Integrated Safety Assessment (ISA): An approach for the assessment of the software aspects of protection systems

    International Nuclear Information System (INIS)

    Izquierdo-Rocha, Jose Maria; Sanchez-Perea, Miguel; Cojazzi, Giacomo

    2004-01-01

    This paper reviews the main features of ISA, a concept developed as a result of previous work on safety assessment and dynamic reliability. The method links the dynamics of the facility with its operating environment, subject to transitions between different time evolutions due to failures and/or system/operator interventions. For situations dominated by Deterministic Transitions (i.e., transitions upon deterministic demands as a result for instance of exceeding automatic-actions/alarm setpoints), the methodology can be considered an extension of PSA and accident analysis techniques that replaces the static event tree with a Deterministic Dynamic Event Tree (DDET) concept based on the Theory of Probabilistic Dynamics. The paper also summarizes some results of an ISA application to the assessment of the Emergency Operating Procedure (EOP) of a PWR-W to mitigate the Steam Generator Tube Rupture (SGTR) initiating event. (author)

  20. Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

    Science.gov (United States)

    Sasaki, Tomoyuki; Shoho, Takashi; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi

    2014-04-01

    A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

  1. Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

    Energy Technology Data Exchange (ETDEWEB)

    Sasaki, Tomoyuki, E-mail: sasaki-tomoy@vos.nagaokaut.ac.jp; Shoho, Takashi; Noda, Kohei; Ono, Hiroshi [Department of Electrical Engineering, Nagaoka University of Technology, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Kawatsuki, Nobuhiro [Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo 671-2280 (Japan)

    2014-04-21

    A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

  2. "Isa kuhu need värvid jäävad ..." : [luuletused] / Jaan Kaplinski

    Index Scriptorium Estoniae

    Kaplinski, Jaan, 1941-

    2002-01-01

    Sisu: "Isa kuhu need värvid jäävad ..." ; Lume ootamine ; "Oh sina paha peavalu ..." ; "Märg on vihmal märg on kastel ..." ; "Peet kisub peeti ..." ; "Küllap väikestel mustadel ..." ; "Mart haigutab ..." ; Kuu ; Teremees Tõnu ; Jalgrataste talveuni ; Kitsu ja kätsu ; Siret siret siterkuuti ; Suve soe silmadesse ; Iirimaal on ilmalapsed ; Miks ; Sügisel ; Täis ; Mis algab ; Aeg ; "Ma koiduajal ärkasin ..."

  3. Development of an international standard on instruments setpoints based on ISA S67.04 - 1994

    International Nuclear Information System (INIS)

    Quinn, E.L.

    1996-01-01

    This is a summary of the application for and development of an international standard on instrument setpoints, based on the Instrument Society of America (ISA) Standard S67.04 - 1994. The forum this new standard was proposed in is the International Electrotechnique Commission (IEC), based in Geneva, Switzerland, which is the international commission which oversees electrical and instrumentation standards for all applications around the world. The Instrument Society of America (ISA) is a United States based Society for the advancement of instrumentation and controls related science and technology and has 30,000 members. A division within the ISA is the Standard and Practices board which has over 5000 members actively involved in standards development and approval. In 1994, the ISA SP67, Nuclear Power Plant Standards Committee authorized that the IEC be approached to develop and issue an IEC standard on Instrument Setpoints. This application was formally submitted in January, 1995 to the IEC and approved for ballot to member countries in June, 1995. Approval for standard development by IEC was received in October, 1995 and the first draft vas issued in February, 1996, and is currently under review by the IEC working group. It is very important to focus on the approach that the U.S. and other countries are taking toward development of IEC standards that can apply to all nuclear instrumentation applications around the world. By referencing IEC standards in design specification, vendors can be solicited from many different countries, thereby ensuring that the highest quality products can be used. This also offsets the need to specify individual standards in the specification, based on the country that each vendor solicited, represents. In summary, this standard development process, with support from the American National Standards Institute (ANSI) will assist U.S. suppliers in competing in the global market for products and services into the next century. (author)

  4. Investigation of Antileishmanial Activities of Acridines Derivatives against Promastigotes and Amastigotes Form of Parasites Using Quantitative Structure Activity Relationship Analysis

    Directory of Open Access Journals (Sweden)

    Samir Chtita

    2016-01-01

    Full Text Available In a search of newer and potent antileishmanial (against promastigotes and amastigotes form of parasites drug, a series of 60 variously substituted acridines derivatives were subjected to a quantitative structure activity relationship (QSAR analysis for studying, interpreting, and predicting activities and designing new compounds by using multiple linear regression and artificial neural network (ANN methods. The used descriptors were computed with Gaussian 03, ACD/ChemSketch, Marvin Sketch, and ChemOffice programs. The QSAR models developed were validated according to the principles set up by the Organisation for Economic Co-operation and Development (OECD. The principal component analysis (PCA has been used to select descriptors that show a high correlation with activities. The univariate partitioning (UP method was used to divide the dataset into training and test sets. The multiple linear regression (MLR method showed a correlation coefficient of 0.850 and 0.814 for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. Internal and external validations were used to determine the statistical quality of QSAR of the two MLR models. The artificial neural network (ANN method, considering the relevant descriptors obtained from the MLR, showed a correlation coefficient of 0.933 and 0.918 with 7-3-1 and 6-3-1 ANN models architecture for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outsides compounds. The effects of different descriptors in the activities were described and used to study and design new compounds with higher activities compared to the existing ones.

  5. Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

    Science.gov (United States)

    Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

    2014-05-06

    Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

  6. Hayabusa Asteroidal Sample Preliminary Examination Team (HASPET) and the Astromaterial Curation Facility at JAXA/ISAS

    Science.gov (United States)

    Yano, H.; Fujiwara, A.

    After the successful launch in May 2003, the Hayabusa (MUSES-C) mission of JAXA/ISAS will collect surface materials (e.g., regolith) of several hundred mg to several g in total from the S-type near Earth asteroid (25143) Itokawa in late 2005 and bring them back to ground laboratories in the summer of 2007. The retrieved samples will be given initial analysis at the JAXA/ISAS astromaterial curation facility, which is currently in the preparation for its construction, by the Hayabusa Asteroidal Sample Preliminary Examination Team (HASPET). HASPET is consisted of the ISAS Hayabusa team, the international partners from NASA and Australia and all-Japan meteoritic scientists to be selected as outsourcing parts of the initial analyses. The initial analysis to characterize general aspects of returned samples can consume only 15 % of its total mass and must complete the whole analyses including the database building before international AO for detailed analyses within the maximum of 1 year. Confident exercise of non-destructive, micro-analyses whenever possible are thus vital for the HASPET analysis. In the purpose to survey what kinds and levels of micro-analysis techniques in respective fields, from major elements and mineralogy to trace and isotopic elements and organics, are available in Japan at present, ISAS has conducted the HASPET open competitions in 2000-01 and 2004. The initial evaluation was made by multiple domestic peer reviews. Applicants were then provided two kinds of unknown asteroid sample analogs in order to conduct proposed analysis with self-claimed amount of samples in self-claimed duration. After the completion of multiple, international peer reviews, the Selection Committee compiled evaluations and recommended the finalists of each round. The final members of the HASPET will be appointed about 2 years prior to the Earth return. Then they will conduct a test-run of the whole initial analysis procedures at the ISAS astromaterial curation facility and

  7. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    Science.gov (United States)

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  8. Monothiol glutaredoxin Grx5 interacts with Fe-S scaffold proteins Isa1 and Isa2 and supports Fe-S assembly and DNA integrity in mitochondria of fission yeast

    International Nuclear Information System (INIS)

    Kim, Kyoung-Dong; Chung, Woo-Hyun; Kim, Hyo-Jin; Lee, Kyung-Chang; Roe, Jung-Hye

    2010-01-01

    Mitochondrial monothiol glutaredoxins that bind Fe-S cluster are known to participate in Fe-S cluster assembly. However, their precise role has not been well understood. Among three monothiol glutaredoxins (Grx3, 4, and 5) in Schizosaccharomyces pombe only Grx5 resides in mitochondria. The Δgrx5 mutant requires cysteine on minimal media, and does not grow on non-fermentable carbon source such as glycerol. We found that the mutant is low in the activity of Fe-S enzymes in mitochondria as well as in the cytoplasm. Screening of multi-copy suppressor of growth defects of the mutant identified isa1 + gene encoding a putative A-type Fe-S scaffold, in addition to mas5 + and hsc1 + genes encoding putative chaperones for Fe-S assembly process. Examination of other scaffold and chaperone genes revealed that isa2 + , but not isu1 + and ssc1 + , complemented the growth phenotype of Δgrx5 mutant as isa1 + did, partly through restoration of Fe-S enzyme activities. The mutant also showed a significant decrease in the amount of mitochondrial DNA. We demonstrated that Grx5 interacts in vivo with Isa1 and Isa2 proteins in mitochondria by observing bimolecular fluorescence complementation. These results indicate that Grx5 plays a central role in Fe-S assembly process through interaction with A-type Fe-S scaffold proteins Isa1 and Isa2, each of which is an essential protein in S. pombe, and supports mitochondrial genome integrity as well as Fe-S assembly.

  9. Simultaneous Estimation of Ibuprofen and Phenylephrine Hydrochloride in Bulk and Combined Dosage Form by First Derivative UV Spectrophotometry Method

    Directory of Open Access Journals (Sweden)

    Mehul Patel

    2013-01-01

    Full Text Available A simple, precise, rapid, and economic method was developed for the simultaneous determination of Ibuprofen and Phenylephrine HCl in bulk and combined dosage form. This method involves first-order derivative spectroscopy using 248 nm and 237 nm as zero crossing points for Ibuprofen and Phenylephrine HCl, respectively. For spectrophotometric method 0.1 N NaOH was used as a solvent. The linearity was established over the concentration range of 12–72 μg/mL and 1.5–22 μg/mL for Ibuprofen and Phenylephrine HCl with correlation coefficient (r2 of 0.9972 and 0.9981, respectively. The mean % recoveries were found to be in the range of 98.88% and 98.54% for Ibuprofen and Phenylephrine HCl, respectively. Interday and intraday studies showed repeatability of the method. The method was found to be specific and robust. The method was successfully applied to pharmaceutical formulation, with no interference from excipients as indicated by the recovery study. Results of analysis were validated statistically and by recovery studies.

  10. Phase 1 trial of malaria transmission blocking vaccine candidates Pfs25 and Pvs25 formulated with montanide ISA 51.

    Directory of Open Access Journals (Sweden)

    Yimin Wu

    2008-07-01

    Full Text Available Pfs25 and Pvs25, surface proteins of mosquito stage of the malaria parasites P. falciparum and P. vivax, respectively, are leading candidates for vaccines preventing malaria transmission by mosquitoes. This single blinded, dose escalating, controlled Phase 1 study assessed the safety and immunogenicity of recombinant Pfs25 and Pvs25 formulated with Montanide ISA 51, a water-in-oil emulsion.The trial was conducted at The Johns Hopkins Center for Immunization Research, Washington DC, USA, between May 16, 2005-April 30, 2007. The trial was designed to enroll 72 healthy male and non-pregnant female volunteers into 1 group to receive adjuvant control and 6 groups to receive escalating doses of the vaccines. Due to unexpected reactogenicity, the vaccination was halted and only 36 volunteers were enrolled into 4 groups: 3 groups of 10 volunteers each were immunized with 5 microg of Pfs25/ISA 51, 5 microg of Pvs25/ISA 51, or 20 microg of Pvs25/ISA 51, respectively. A fourth group of 6 volunteers received adjuvant control (PBS/ISA 51. Frequent local reactogenicity was observed. Systemic adverse events included two cases of erythema nodosum considered to be probably related to the combination of the antigen and the adjuvant. Significant antibody responses were detected in volunteers who completed the lowest scheduled doses of Pfs25/ISA 51. Serum anti-Pfs25 levels correlated with transmission blocking activity.It is feasible to induce transmission blocking immunity in humans using the Pfs25/ISA 51 vaccine, but these vaccines are unexpectedly reactogenic for further development. This is the first report that the formulation is associated with systemic adverse events including erythema nodosum.ClinicalTrials.gov NCT00295581.

  11. A patient-derived mutant form of the Fanconi anemia protein, FANCA, is defective in nuclear accumulation.

    Science.gov (United States)

    Kupfer, G; Naf, D; Garcia-Higuera, I; Wasik, J; Cheng, A; Yamashita, T; Tipping, A; Morgan, N; Mathew, C G; D'Andrea, A D

    1999-04-01

    Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with at least eight complementation groups (A-H). Three FA genes, corresponding to complementation groups A, C, and G, have been cloned, but the function of the encoded FA proteins remains unknown. We recently demonstrated that the FANCA and FANCC proteins bind and form a nuclear complex. In the current study, we identified a homozygous mutation in the FANCA gene (3329A>C) in an Egyptian FA patient from a consanguineous family. This mutant FANCA allele is predicted to encode a mutant FANCA protein, FANCA(H1110P), in which histidine 1110 is changed to proline. Initially, we characterized the FANCA(H1110P) protein, expressed in an Epstein Barr virus (EBV)-immortalized lymphoblast line derived from the patient. Unlike wild-type FANCA protein expressed in normal lymphoblasts, FANCA(H1110P) was not phosphorylated and failed to bind to FANCC. To test directly the effect of this mutation on FANCA function, we used retroviral-mediated transduction to express either wild-type FANCA or FANCA(H1110P) protein in the FA-A fibroblast line, GM6914. Unlike wild-type FANCA, the mutant protein failed to complement the mitomycin C sensitivity of these cells. In addition, the FANCA(H1110P) protein was defective in nuclear accumulation in the transduced cells. The characteristics of this mutant protein underscore the importance of FANCA phosphorylation, FANCA/FANCC binding, and nuclear accumulation in the function of the FA pathway.

  12. INTERACTION BETWEEN DIFFERENT MOLECULAR FORMS OF IMMUNOGLOBULIN A AND RECOMBINANT DERIVATIVES POLYPEPTIDES OF BAC RECEPTOR PROTEINS FROM GROUP B STREPTOCOCCI

    Directory of Open Access Journals (Sweden)

    A. S. Korzhueva

    2008-01-01

    Full Text Available Abstract. The article concerns interactions between immunoglobulin A and recombinant P6, P7, P8 polypeptides, designed on the basis of externally localized Bac protein of the Group B streptococci, possessing IgA-binding activity.There is a current demand for immunochemical reagents that are strictly specific for IgA, in order to develop antigenic standards for detection of IgA levels in biological fluids, as well as for affinity purification of IgA and its fragments.To analyze an opportunity of the abovementioned application ways for these proteins, a special study was performed to assay an interaction capability of recombinant P6, P7, P8 polypeptides binding to Fc regions of different IgA forms (serum IgA, secretory IgA, subclasses of serum IgA – IgA1, IgA2. Selectivity of ligand binding was specially confirmed.It was found out that, among three presented polypeptides, the structure of recombinant P6 derivative proved to be optimal for IgA-binding ability of Bac protein.Structural features of IgA-binding fragments of Bac protein, i.e., binding site position on the IgA molecule (proximity to epitopes for three monoclonal antibodies, variability of the site structure, as well as resistance of binding site for P6, P7, P8 in IgA molecule against partial disulfide bonds reduction. (Med. Immunol., vol. 10, N 4-5, pp 327-336.

  13. The in-depth safety assessment (ISA) pilot projects in Ukraine

    International Nuclear Information System (INIS)

    Kot, C. A.

    1998-01-01

    Ukraine operates pressurized water reactors of the Soviet-designed type, VVER. All Ukrainian plants are currently operating with annually renewable permits until they update their safety analysis reports (SARs). After approval of the SARS by the Ukrainian Nuclear Regulatory Authority, the plants will be granted longer-term operating licenses. In September 1995, the Nuclear Regulatory Authority and the Government Nuclear Power Coordinating Committee of Ukraine issued a new contents requirement for the safety analysis reports of VVERs in Ukraine. It contains requirements in three major areas: design basis accident (DBA) analysis, probabilistic risk assessment (PRA), and beyond design-basis accident (BDBA) analysis. The DBA requirements are an expanded version of the older SAR requirements. The last two requirements, on PRA and BDBA, are new. The US Department of Energy (USDOE), through the International Nuclear Safety Program (INSP), has initiated an assistance and technology transfer program to Ukraine to assist their nuclear power stations in developing a Western-type technical basis for the new SARS. USDOE sponsored In-Depth Safety Assessments (ISAs) have been initiated at three pilot nuclear reactor units in Ukraine, South Ukraine Unit 1, Zaporizhzhya Unit 5, and Rivne Unit 1. USDOE/INSP have structured the ISA program in such a way as to provide maximum assistance and technology transfer to Ukraine while encouraging and supporting the Ukrainian plants to take the responsibility and initiative and to perform the required assessments

  14. O modelo ISA/JP - indicador de performance para diagnóstico do saneamento ambiental urbano ISA/JP model - indicator of performance for the diagnosis of urban environmental health

    Directory of Open Access Journals (Sweden)

    Marie Eugénie Malzac Batista

    2006-03-01

    Full Text Available Neste artigo apresenta-se o modelo ISA/JP - Indicador de Salubridade Ambiental, para análise intra-urbana por setor censitário e bairro como uma contribuição para a gestão urbana com enfoque para a área de saneamento ambiental. Trata-se de uma adaptação do ISA desenvolvido pelo Conselho Estadual de Saneamento do Estado de São Paulo, em 1999. Foi incorporado ao modelo ISA mais um sub-indicador, o de drenagem urbana. A utilização do modelo ISA/JP em um Sistema de Informação Geográfica - SIG permitiu que fosse explorada a potencialidade da espacialização dos resultados. Possibilitou ainda a representação e modelagem do conhecimento, constituindo um Sistema de Apoio a Decisão Espacial - SADE. É apresentado um estudo de caso nos bairros costeiros da cidade de João Pessoa, Brasil. Foi demonstrada a viabilidade do modelo proposto bem como o avanço na descrição da salubridade ambiental, mostrando a variabilidade das informações relevantes no espaço urbano.This work deals with the ISA/JP model - Indicator of Environmental Health for intra-urban analysis, according to the census sector and suburb, as a contribution to the urban management, with a focus on the area of environmental sanitation. It is an adaptation of ISA developed by São Paulo's State Council of Sanitation, in 1999. One more sub-indicator, that of urban drainage, was incorporated to the ISA model. The use of ISA/JP in a System of Geographic Information - SIG - permitted the exploration of the potentiality of distributing the results in the urban area. It also made possible the representation and modeling of knowledge, thus making up a System of Support to Space Decision - SSSD. A case study in the coastal suburbs of João Pessoa City, Brazil, was presented. The viability of the proposed model as well as the advance in the description of environmental health were demonstrated, thus showing the variability of relevant information in the urban space.

  15. Optimization of the culturing conditions of human umbilical cord blood-derived endothelial colony-forming cells under xeno-free conditions applying a transcriptomic approach

    NARCIS (Netherlands)

    Zeisberger, Steffen M.; Zoller, Stefan; Riegel, Mariluce; Chen, Shuhua; Krenning, Guido; Harmsen, Martin C.; Sachinidis, Agapios; Zisch, Andreas H.

    Establishment of fetal bovine serum (FBS)-free cell culture conditions is essential for transplantation therapies. Blood-derived endothelial colony-forming cells (ECFCs) are potential candidates for regenerative medicine applications. ECFCs were isolated from term umbilical cord blood units and

  16. Fecal concentrations of bacterially-derived vitamin K forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults

    Science.gov (United States)

    Background: Emerging evidence suggests novel roles for bacterially-derived vitamin K forms known as menaquinones (MKn) in health and disease which may be attributable in part to anti-inflammatory effects. However, the relevance of MKn produced by gut bacteria to vitamin K requirements and inflammati...

  17. A Pilot Study of Children’s Blood Lead Levels in Mount Isa, Queensland

    Directory of Open Access Journals (Sweden)

    Donna Green

    2017-12-01

    Full Text Available Mount Isa, Queensland, is one of three Australian cities with significant lead emissions due to nonferrous mining and smelting. Unlike the two other cities with lead mines or smelters, Mount Isa currently has no system of annual, systematic, community-wide blood lead level testing; and testing rates among Indigenous children are low. In previous screenings, this group of children has been shown to have higher average blood lead levels than non-Indigenous children. The first aim of this study was to assess whether parents and children would participate in less invasive, rapid point-of-care capillary testing. The second aim was to measure blood lead levels among a range of children that roughly reflected the percentage of the Indigenous/non-Indigenous population. This pilot study is based on a convenience sample of children between the ages of 12 and 83 months who were recruited to participate by staff at a Children and Family Centre. Over three half-days, 30 children were tested using capillary blood samples and the LeadCare II Point-of-Care testing system. Rapid point-of-care capillary testing was well tolerated by the children. Of 30 children tested, 40% (n = 12 had blood lead levels ≥5 µg/dL and 10% had levels ≥10 µg/dL. The highest blood lead level measured was 17.3 µg/dL. The percentage of children with blood lead levels ≥5 µg/dL was higher among Indigenous children compared to non-Indigenous (64.2% compared to 18.8% as was the geometric mean level (6.5 (95% CI, 4.7, 9.2 versus 2.4 (95% CI, 1.8, 3.1, a statistically significant difference. Though based on a small convenience sample, this study identified 12 children (40% of the sample with blood lead levels ≥5 µg/dL. Due to historical and ongoing heavy metal emissions from mining and smelting in Mount Isa, we recommend a multi-component program of universal blood lead level testing, culturally appropriate follow-up and intervention for children who are identified with blood lead

  18. A Pilot Study of Children's Blood Lead Levels in Mount Isa, Queensland.

    Science.gov (United States)

    Green, Donna; Sullivan, Marianne; Cooper, Nathan; Dean, Annika; Marquez, Cielo

    2017-12-13

    Mount Isa, Queensland, is one of three Australian cities with significant lead emissions due to nonferrous mining and smelting. Unlike the two other cities with lead mines or smelters, Mount Isa currently has no system of annual, systematic, community-wide blood lead level testing; and testing rates among Indigenous children are low. In previous screenings, this group of children has been shown to have higher average blood lead levels than non-Indigenous children. The first aim of this study was to assess whether parents and children would participate in less invasive, rapid point-of-care capillary testing. The second aim was to measure blood lead levels among a range of children that roughly reflected the percentage of the Indigenous/non-Indigenous population. This pilot study is based on a convenience sample of children between the ages of 12 and 83 months who were recruited to participate by staff at a Children and Family Centre. Over three half-days, 30 children were tested using capillary blood samples and the LeadCare II Point-of-Care testing system. Rapid point-of-care capillary testing was well tolerated by the children. Of 30 children tested, 40% ( n = 12) had blood lead levels ≥5 µg/dL and 10% had levels ≥10 µg/dL. The highest blood lead level measured was 17.3 µg/dL. The percentage of children with blood lead levels ≥5 µg/dL was higher among Indigenous children compared to non-Indigenous (64.2% compared to 18.8%) as was the geometric mean level (6.5 (95% CI, 4.7, 9.2) versus 2.4 (95% CI, 1.8, 3.1)), a statistically significant difference. Though based on a small convenience sample, this study identified 12 children (40%) of the sample with blood lead levels ≥5 µg/dL. Due to historical and ongoing heavy metal emissions from mining and smelting in Mount Isa, we recommend a multi-component program of universal blood lead level testing, culturally appropriate follow-up and intervention for children who are identified with blood lead levels ≥5

  19. Vaccination with Clostridium perfringens recombinant proteins in combination with Montanide™ ISA 71 VG adjuvant increases protection against experimental necrotic enteritis in commercial broiler chickens

    Science.gov (United States)

    This study was performed to compare four Clostridium perfringens recombinant proteins as vaccine candidates using the Montanide™ ISA 71 VG adjuvant in an experimental model of necrotic enteritis. Broiler chickens were immunized with clostridial recombinant proteins with ISA 71 VG, and intestinal le...

  20. Gestión estratégica institucional: Caso ISA

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Martínez Fajardo

    2003-12-01

    Full Text Available Desde la perspectiva histórica neoinstitucional, en el presente artículo se analiza la gestión estratégica de la empresa Interconexión Eléctrica S.A. (ISA, mostrando los principales elementos de los cambios institucionales, estratégicos, de estructura y resultados de la empresa desde mediados de la década de los noventa. Se destaca el desarrollo de capacidades organizacionales que le han permitido tener una clara ventaja competitiva en el sector eléctrico colombiano y una estrategia de desarrollo hacia el exterior, a través de la relativa posición favorable con respecto a empresas de países desarrollados.

  1. Hydrolysis and rearrangement of phthalamic acid derivatives and assessment of their potential as prodrug forms for amines

    DEFF Research Database (Denmark)

    Bundgaard, Hans; Steffansen, Bente

    1990-01-01

    Although it is well-known that N-substituted phthalamic acid derivatives are readily hydrolyzed in acidic aqueous solution due to intramolecular catalysis by the neighbouring carboxy group, sparse information is available on the degradation behaviour in neutral solutions. A recent publication [5]...

  2. Brote del virus ISA: crisis ambiental y capacidad de la institucionalidad ambiental para manejar el conflicto

    Directory of Open Access Journals (Sweden)

    Beatriz Bustos

    2012-09-01

    Full Text Available La industria salmonera chilena vivió recientemente una crisis de magnitud a partir de la aparición del virus ISA. El artículo examina esta situación, concentrándose en el papel que desempeña la ciencia en las soluciones políticas propuestas, como caso para discutir la capacidad de los mecanismos de gobernanza ambiental neoliberal para solucionar crisis ambientales y económicas. La pregunta que guía el trabajo es: ¿cuál fue el rol de la ciencia en la política ambiental para la industria? El argumento promovido es que la crisis representa un momento de reestructuración de la relación sociedad-naturaleza, en el cual se redefinieron mecanismos de propiedad, control y acceso a recursos naturales, pero en el que, pese al discurso neoliberal de confianza en los expertos y la ciencia como elementos de toma de decisiones, la información científica tuvo escasa relevancia.The Chilean salmon industry recently experienced a crisis due to an outbreak of the ISA virus. The article examines the crisis focusing on the role of science in the policy solutions proposed, to discuss the real capacity of neoliberal environmental governance mechanisms to solve environmental and economic crisis. The question guiding this research is, which was the role of science in environmental policy createdfor the salmon industry? The argument is that the crisis represents a reestructuring of the relationship between society and nature through the redefinition of property rights, control and access to natural resources, but in which, in spite of a neoliberal discourse of trust in experts and science as elements of decision making, scientific information had little relevance.

  3. The ISA 700 Auditor’s Report and the Audit Expectation Gap – Do Additional Explanations Matter?

    NARCIS (Netherlands)

    Gold, A.H.; Pott, C.; Gronewold, U.

    2012-01-01

    In this paper we test the effectiveness of explanations as mandated by the revised ISA 700 auditor's report in reducing the audit expectation gap. German auditors and financial statement users participated in an experiment where they read a summary of a firm's financial statements and an auditor's

  4. Efficient I/O Joining and Reliable Data Publication in Energy Harvested ISA100.11a Network

    NARCIS (Netherlands)

    Das, Kallol; Mathews, E.; Zand, P.; Sanchez Ramirez, Andrea; Havinga, Paul J.M.

    Energy harvesting technologies have brought a paradigm shift in the industrial automation sector by procreating self-powered wireless input/output (I/O) devices. Unfortunately, current wireless technologies for industrial applications, such as ISA100.11a and WirelessHART, are yet far from supporting

  5. Electrochemical oxidation of 3,5-di-tert-butylcatechol: Synthesis and characterization of the formed ortho-benzoquinhydrone derivative

    International Nuclear Information System (INIS)

    Nematollahi, D.; Shayani-Jam, H.

    2006-01-01

    Electrochemical oxidation of 3,5-di-tert-butylcatechol (1) has been studied in ethanol/water mixtures by means of cyclic voltammetry and controlled-potential coulometry. The results revealed that 3,5-di-tert-butyl-1,2-benenzoquinone (2) derived from oxidation of 3,5-di-tert-butylcatechol participate in noncovalently linked interactions with 1 converted to an ortho-benzoquinhydrone (3). The structure of 3 was characterized by MS, IR, 1 H NMR and 13 C NMR. The 1 H NMR studies reveal that the benzoquinhydrone complex 3 is stabilized by one H-bonding interaction. In this work we derived a novel ortho-bezoquinhydrone type complex (3) based on electrochemical oxidation of 3,5-di-tert-butylcatechol at carbon electrode in an undivided cell

  6. Improved prediction of hardwood tree biomass derived from wood density estimates and form factors for whole trees

    Science.gov (United States)

    David W. MacFarlane; Neil R. Ver Planck

    2012-01-01

    Data from hardwood trees in Michigan were analyzed to investigate how differences in whole-tree form and wood density between trees of different stem diameter relate to residual error in standard-type biomass equations. The results suggested that whole-tree wood density, measured at breast height, explained a significant proportion of residual error in standard-type...

  7. RAPID MULTICOMPONENT ANALYSIS OF HEMOGLOBIN DERIVATIVES FOR CONTROLLED ANTIDOTAL USE OF METHEMOGLOBIN-FORMING AGENTS IN CYANIDE POISONING

    NARCIS (Netherlands)

    ZIJLSTRA, WG

    When cyanide poisoning is treated with a methemoglobin-forming agent, oxidative metabolism is protected at the expense of the oxygen capacity of the blood.The affinity of methemoglobin for CN- is high enough to compete with cytochrome oxidase, which protects the latter from becoming blocked, but all

  8. Determination of UO2(II), and Ce(III) complexes formed with halogen and nitro derivatives of 8-hydroxyquinoline

    International Nuclear Information System (INIS)

    Teksoez, S.; Uenak, P.

    2001-01-01

    Proton-ligand stability constants for some iodo and nitro derivatives of 8-hydroxyquinoline were determined by Calvin Bjerrum potantiometrical method. The stability constants of the corresponding chelates with UO 2 (II), Th(IV) and Ce(III) were studied potentiometrically at 25 degree Celsius by applying Irving-Rossotti computing method. The complexes of the nitro-substituted ligands were less stable than the corresponding complexes of the unsubstituted ligands. The stability constants of metal-ligands depend on the ionic radii and ionic charge of metals and also they decrease with steric repulsions of the nitro groups

  9. High-performance liquid chromatography and derivative spectrophotometry for simultaneous determination of pravastatin and fenofibrate in the dosage form

    Directory of Open Access Journals (Sweden)

    Hefnawy Mohamed M.

    2014-12-01

    Full Text Available High performance liquid chromatography (HPLC and second-order derivative spectrophotometry have been used for simultaneous determination of pravastatin (PS and fenofibrate (FF in pharmaceutical formulations. HPLC separation was performed on a phenyl HYPERSIL C18 column (125 mm × 4.6 mm i.d., 5 μm particle diameter in the isocratic mode using a mobile phase acetonitrile/0.1 % diethyl amine (50:50, V/V, pH 4.5 pumped at a flow rate of 1.0 mL min-1. Measurement was made at 240 nm. Both drugs were well resolved on the stationary phase, with retention times of 2.15 and 5.79 min for PS and FF, respectively. Calibration curves were linear (R = 0.999 for PS and 0.996 for FF in the concentration range of 5-50 and 20-200 µg mL-1 for PS and FF, respectively. Pravastatin and fenofibrate were quantitated in combined preparations also using the second-order derivative response at 237.6 and 295.1 nm for PS and FF, respectively. Calibration curves were linear, with the correlation coefficient R = 0.999 for pravastatin and fenofibrate, in the concentration range of 5-20 and 3-20 µg mL-1 for PS and FF, respectively. Both methods were fully validated and compared, the results confirmed that they were highly suitable for their intended purpose.

  10. Genome-derived insights into the biology of the hepatotoxic bloom-forming cyanobacterium Anabaena sp. strain 90

    Directory of Open Access Journals (Sweden)

    Wang Hao

    2012-11-01

    Full Text Available Abstract Background Cyanobacteria can form massive toxic blooms in fresh and brackish bodies of water and are frequently responsible for the poisoning of animals and pose a health risk for humans. Anabaena is a genus of filamentous diazotrophic cyanobacteria commonly implicated as a toxin producer in blooms in aquatic ecosystems throughout the world. The biology of bloom-forming cyanobacteria is poorly understood at the genome level. Results Here, we report the complete sequence and comprehensive annotation of the bloom-forming Anabaena sp. strain 90 genome. It comprises two circular chromosomes and three plasmids with a total size of 5.3 Mb, encoding a total of 4,738 genes. The genome is replete with mobile genetic elements. Detailed manual annotation demonstrated that almost 5% of the gene repertoire consists of pseudogenes. A further 5% of the genome is dedicated to the synthesis of small peptides that are the products of both ribosomal and nonribosomal biosynthetic pathways. Inactivation of the hassallidin (an antifungal cyclic peptide biosynthetic gene cluster through a deletion event and a natural mutation of the buoyancy-permitting gvpG gas vesicle gene were documented. The genome contains a large number of genes encoding restriction-modification systems. Two novel excision elements were found in the nifH gene that is required for nitrogen fixation. Conclusions Genome analysis demonstrated that this strain invests heavily in the production of bioactive compounds and restriction-modification systems. This well-annotated genome provides a platform for future studies on the ecology and biology of these important bloom-forming cyanobacteria.

  11. Novel Aminoglycoside Resistance Transposons and Transposon-Derived Circular Forms Detected in Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates

    Science.gov (United States)

    Dwibedi, Chinmay Kumar; Sjöström, Karin; Edquist, Petra; Wai, Sun Nyunt; Uhlin, Bernt Eric

    2016-01-01

    Acinetobacter baumannii has emerged as an important opportunistic pathogen equipped with a growing number of antibiotic resistance genes. Our study investigated the molecular epidemiology and antibiotic resistance features of 28 consecutive carbapenem-resistant clinical isolates of A. baumannii collected throughout Sweden in 2012 and 2013. The isolates mainly belonged to clonal complexes (CCs) with an extensive international distribution, such as CC2 (n = 16) and CC25 (n = 7). Resistance to carbapenems was related to blaOXA-23 (20 isolates), blaOXA-24/40-like (6 isolates), blaOXA-467 (1 isolate), and ISAba1-blaOXA-69 (1 isolate). Ceftazidime resistance was associated with blaPER-7 in the CC25 isolates. Two classical point mutations were responsible for resistance to quinolones in all the isolates. Isolates with high levels of resistance to aminoglycosides carried the 16S rRNA methylase armA gene. The isolates also carried a variety of genes encoding aminoglycoside-modifying enzymes. Several novel structures involved in aminoglycoside resistance were identified, including Tn6279, ΔTn6279, Ab-ST3-aadB, and different assemblies of Tn6020 and TnaphA6. Importantly, a number of circular forms related to the IS26 or ISAba125 composite transposons were detected. The frequent occurrence of these circular forms in the populations of several isolates indicates a potential role of these circular forms in the dissemination of antibiotic resistance genes. PMID:26824943

  12. Pinatubo Emulation in Multiple Models (POEMs): co-ordinated experiments in the ISA-MIP model intercomparison activity component of the SPARC Stratospheric Sulphur and it's Role in Climate initiative (SSiRC)

    Science.gov (United States)

    Lee, Lindsay; Mann, Graham; Carslaw, Ken; Toohey, Matthew; Aquila, Valentina

    2016-04-01

    The World Climate Research Program's SPARC initiative has a new international activity "Stratospheric Sulphur and its Role in Climate" (SSiRC) to better understand changes in stratospheric aerosol and precursor gaseous sulphur species. One component of SSiRC involves an intercomparison "ISA-MIP" of composition-climate models that simulate the stratospheric aerosol layer interactively. Within PoEMS each modelling group will run a "perturbed physics ensemble" (PPE) of interactive stratospheric aerosol (ISA) simulations of the Pinatubo eruption, varying several uncertain parameters associated with the eruption's SO2 emissions and model processes. A powerful new technique to quantify and attribute sources of uncertainty in complex global models is described by Lee et al. (2011, ACP). The analysis uses Gaussian emulation to derive a probability density function (pdf) of predicted quantities, essentially interpolating the PPE results in multi-dimensional parameter space. Once trained on the ensemble, a Monte Carlo simulation with the fast Gaussian emulator enabling a full variance-based sensitivity analysis. The approach has already been used effectively by Carslaw et al., (2013, Nature) to quantify the uncertainty in the cloud albedo effect forcing from a 3D global aerosol-microphysics model allowing to compare the sensitivy of different predicted quantities to uncertainties in natural and anthropogenic emissions types, and structural parameters in the models. Within ISA-MIP, each group will carry out a PPE of runs, with the subsequent analysis with the emulator assessing the uncertainty in the volcanic forcings predicted by each model. In this poster presentation we will give an outline of the "PoEMS" analysis, describing the uncertain parameters to be varied and the relevance to further understanding differences identified in previous international stratospheric aerosol assessments.

  13. Antifungal effect and pore-forming action of lactoferricin B like peptide derived from centipede Scolopendra subspinipes mutilans.

    Science.gov (United States)

    Choi, Hyemin; Hwang, Jae-Sam; Lee, Dong Gun

    2013-11-01

    The centipede Scolopendra subspinipes mutilans has been a medically important arthropod species by using it as a traditional medicine for the treatment of various diseases. In this study, we derived a novel lactoferricin B like peptide (LBLP) from the whole bodies of adult centipedes, S. s. mutilans, and investigated the antifungal effect of LBLP. LBLP exerted an antifungal and fungicidal activity without hemolysis. To investigate the antifungal mechanism of LBLP, a membrane study with propidium iodide was first conducted against Candida albicans. The result showed that LBLP caused fungal membrane permeabilization. The assays of the three dimensional flow cytometric contour plot and membrane potential further showed cell shrinkage and membrane depolarization by the membrane damage. Finally, we confirmed the membrane-active mechanism of LBLP by synthesizing model membranes, calcein and FITC-dextran loaded large unilamellar vesicles. These results showed that the antifungal effect of LBLP on membrane was due to the formation of pores with radii between 0.74nm and 1.4nm. In conclusion, this study suggests that LBLP exerts a potent antifungal activity by pore formation in the membrane, eventually leading to fungal cell death. © 2013.

  14. The role of visual and spatial working memory in forming mental models derived from survey and route descriptions.

    Science.gov (United States)

    Meneghetti, Chiara; Labate, Enia; Pazzaglia, Francesca; Hamilton, Colin; Gyselinck, Valérie

    2017-05-01

    This study examines the involvement of spatial and visual working memory (WM) in the construction of flexible spatial models derived from survey and route descriptions. Sixty young adults listened to environment descriptions, 30 from a survey perspective and the other 30 from a route perspective, while they performed spatial (spatial tapping [ST]) and visual (dynamic visual noise [DVN]) secondary tasks - believed to overload the spatial and visual working memory (WM) components, respectively - or no secondary task (control, C). Their mental representations of the environment were tested by free recall and a verification test with both route and survey statements. Results showed that, for both recall tasks, accuracy was worse in the ST than in the C or DVN conditions. In the verification test, the effect of both ST and DVN was a decreasing accuracy for sentences testing spatial relations from the opposite perspective to the one learnt than if the perspective was the same; only ST had a stronger interference effect than the C condition for sentences from the opposite perspective from the one learnt. Overall, these findings indicate that both visual and spatial WM, and especially the latter, are involved in the construction of perspective-flexible spatial models. © 2016 The British Psychological Society.

  15. Digital Workflow for the Conservation of Bahrain Built Heritage: the Sheik Isa Bin ALI House

    Science.gov (United States)

    Barazzetti, L.; Mezzino, D.; Santana Quintero, M.

    2017-08-01

    Currently, the commercial market offers several tools for digital documentation of historic sites and buildings. Photogrammetry and laser scanning play a fundamental role in the acquisition of metric information, which is then processed to generate reliable records particularly useful also in the built heritage conservation field. Although potentially very fast and accurate, such techniques require expert operators to produce reliable results, especially in the case of complex and large sites. The aim of this paper is to present the digital workflow developed for data acquisition and processing of the Shaikh Isa Bin Ali house in Muharraq, Bahrain. This historic structure is an outstanding example of Bahrain architecture as well as tangible memory of the country history, with strong connotations in the Bahrain cultural identity. The building has been documented employing several digital techniques, including: aerial (drone) and terrestrial photogrammetry, rectifying photography, total station and laser scanning. The documentation project has been developed for the Bahrain Authority for Culture and Antiquities (BACA) by a multidisciplinary team of experts from Carleton Immersive Media Studio (CIMS, Carleton University, Canada) and Gicarus Lab (Politecnico di Milano, Italy).

  16. Symbolic regression via genetic programming for data driven derivation of confinement scaling laws without any assumption on their mathematical form

    International Nuclear Information System (INIS)

    Murari, A; Peluso, E; Gelfusa, M; Lupelli, I; Lungaroni, M; Gaudio, P

    2015-01-01

    Many measurements are required to control thermonuclear plasmas and to fully exploit them scientifically. In the last years JET has shown the potential to generate about 50 GB of data per shot. These amounts of data require more sophisticated data analysis methodologies to perform correct inference and various techniques have been recently developed in this respect. The present paper covers a new methodology to extract mathematical models directly from the data without any a priori assumption about their expression. The approach, based on symbolic regression via genetic programming, is exemplified using the data of the International Tokamak Physics Activity database for the energy confinement time. The best obtained scaling laws are not in power law form and suggest a revisiting of the extrapolation to ITER. Indeed the best non-power law scalings predict confinement times in ITER approximately between 2 and 3 s. On the other hand, more comprehensive and better databases are required to fully profit from the power of these new methods and to discriminate between the hundreds of thousands of models that they can generate. (paper)

  17. Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow–Derived Cells for Large Osteochondral Defects in Rabbit Knees

    Science.gov (United States)

    Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

    2013-01-01

    Objective: The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells. Methods: Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow–derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O’Driscoll score). Results: The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O’Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. Conclusions: This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated. PMID:26069678

  18. Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow-Derived Cells for Large Osteochondral Defects in Rabbit Knees.

    Science.gov (United States)

    Yoshioka, Tomokazu; Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

    2013-10-01

    The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells. Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow-derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O'Driscoll score). The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O'Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated.

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. Two dechlorinated chlordecone derivatives formed by in situ chemical reduction are devoid of genotoxicity and mutagenicity and have lower proangiogenic properties compared to the parent compound.

    Science.gov (United States)

    Legeay, Samuel; Billat, Pierre-André; Clere, Nicolas; Nesslany, Fabrice; Bristeau, Sébastien; Faure, Sébastien; Mouvet, Christophe

    2018-05-01

    Chlordecone (CLD) is a chlorinated hydrocarbon insecticide, now classified as a persistent organic pollutant. Several studies have previously reported that chronic exposure to CLD leads to hepatotoxicity, neurotoxicity, raises early child development and pregnancy complications, and increases the risk of liver and prostate cancer. In situ chemical reduction (ISCR) has been identified as a possible way for the remediation of soils contaminated by CLD. In the present study, the objectives were (i) to evaluate the genotoxicity and the mutagenicity of two CLD metabolites formed by ISCR, CLD-5a-hydro, or CLD-5-hydro (5a- or 5- according to CAS nomenclature; CLD-1Cl) and tri-hydroCLD (CLD-3Cl), and (ii) to explore the angiogenic properties of these molecules. Mutagenicity and genotoxicity were investigated using the Ames's technique on Salmonella typhimurium and the in vitro micronucleus micromethod with TK6 human lymphoblastoid cells. The proangiogenic properties were evaluated on the in vitro capillary network formation of human primary endothelial cells. Like CLD, the dechlorinated derivatives of CLD studied were devoid of genotoxic and mutagenic activity. In the assay targeting angiogenic properties, significantly lower microvessel lengths formed by endothelial cells were observed for the CLD-3Cl-treated cells compared to the CLD-treated cells for two of the three tested concentrations. These results suggest that dechlorinated CLD derivatives are devoid of mutagenicity and genotoxicity and have lower proangiogenic properties than CLD.

  1. THE EFFECT OF ENZYMATIC ADDITIVES ON THE PRODUCTIVITY OF LAYING HENS ISA BROWN

    Directory of Open Access Journals (Sweden)

    Branislav Gálik

    2011-01-01

    Full Text Available The aim of this work the influence of enzymatic additives on the productivity of laying hens ISA BROWN was to analyze. The experiment together with the Central Control and Testing Institute of Agriculture was realized. The experiment was conducted 11 months, in 3 phases: from the 22nd to the 28th week, from the 29th to the 46th week and from the 47th to the 68th week of production. Two groups with 1080 (540 in each group animals were examined (control group A, experimental group B. In the experiment diets based on wheat, rye, barley, soybean, minerals and vitamins were used. In group B we administered a feed mixture with endo-1,4-ß-xylanase (activity 7820 TXU.g-1 and endo-1,4-ß-glucanase (activity 2940 TGU.g-1 fortification. After finishing of the last period (68th week of hens´ age were registered parameters in both groups of animals. The body weight at the end of the experiment was positively affected in the second group (containing enzymes: B. This difference was significantly higher (P<0.05. In the B group was also confirmed significant better (P<0.05 feed intake (141.8 and 144.3 g respectively on the same level and non significant (P>0.05 heavier eggs (64.54 and 64.02 g respectively in A and B group. For hens in the control group (without enzymes, was registered significantly lower (P<0.05 body weight (2 239 and 2 307 g of hens, a lower weight of eggs (P>0.05, and higher feed intake (P<0.05. The feeding without enzymes in the A group negatively influenced the quality of eggs. It was higher percentage of total non-standard eggs (7.10 and 6.56 %, cracked eggs (4.0 and 3.64 % and broken eggs (0.52 and 0.39 %. The differences of these parameters are not significant (P>0.05. After the administration of the enzymes in the feed mixture fortification we determined a positive effect on laying hens´ productivity. The application of enzymes positively affected the average body weight of hens.

  2. GAS PHASE STRUCTURE AND STABILITY OF COMPLEX FORMED BY H2O, NH3, H2S AND THEIR METHYL DERIVATIVES WITH THE CATION CO2+

    Directory of Open Access Journals (Sweden)

    Cahyorini Kusumawardani

    2010-06-01

    Full Text Available Ab initio molecular orbital calculations at the Hartree-Fock-Self Consistent Field (HF-SCF have been performed in order to determine the structure and gas phase energies of complex formed by the Lewis bases of H2O, NH3, H2S and their methyl derivatives with the cation Co2+. The relative basicities of the base studied depend on both the substituent. The gas-phase interaction energies computed by the SCF method including electron correlation Møller-Plesset 2 (MP2 dan Configuration Iteration (CI were comparable in accuracy. The binding energies computed by these two methods reach the targeted chemical accuracy.   Keywords: ab initio calculation, cobalt complex, structure stability

  3. Adverse events associated with vaccine prepared Ngcgm3 / Vssp / montanide Isa 51 In patients with breast cancer Metastatic

    International Nuclear Information System (INIS)

    Perez Machin, Maikel; Torre Santos, Ana V de la; Perez Ramirez, Kirenia; Marinello, Patricia; Suarez Martinez, Giselle

    2009-01-01

    Among the best-studied antigenic systems, which have their expression increased in the membrane of tumor cells, are the gangliosides. Several clinical trials with therapeutic vaccines containing N-glycolylated gangliosides have been made in Cuba by the Center Molecular Immunology. One of these studies, it is the trial: 'Specific active immunotherapy with the vaccine preparation NGcGM3 / VSSP / Montanide ISA 51 in the treatment of patients with breast cancer metastatic. Phase II'. In order to assess the major events events related to this product, were reviewed the medical records of total patients in the clinical trial performed in the service Oncology Hospital Universitario 'Celestino Hernandez Robau' Villa Clara. (Author)

  4. Twelfth ISAS national symposium on analytical techniques for safety and sufficiency of natural resources/products: technical papers

    International Nuclear Information System (INIS)

    Padmanabhan, P.K.; Page, A.G.

    1997-02-01

    This volume contains the proceedings of the ISAS (Indian Society of Analytical Scientists) national symposium. The main thrust of the symposium was on new fuel cycle technologies relevant to thorium utilisation programmes. The technologies for different separation processes, techniques for measurements of various process parameters and highly sensitive analytical methods for the determination of the chemical constituents were among the other topics covered. Quality upgradation, standardisation of methods and validation of measurements which are integral parts of product evaluation were also discussed. Papers relevant to INIS are indexed separately

  5. Kjubrikovo čitanje Bardžisa: Značaj kostima za razumevanje Paklene pomorandže

    OpenAIRE

    Dijana Metlić

    2016-01-01

    Roman Paklena pomorandža Entonija Bardžisa, objavljen 1962. godine, postao je jedno od kultnih književnih dela XX veka, pre svega zahvaljujući istoimenom filmu Stenlija Kjubrika iz 1971. Okarakterisan kao dekadentno i nihilističko ostvarenje, snimljen tako da gledaoci „uživaju“ u scenama nasilja, Kjubrikov film bio je, uz prekide, u distribuciji u Britaniji do 1974. godine kada je povučen na zahtev reditelja zbog optužbi koje su ga implicitno teretile za povećanje stepena delinkventskog nasil...

  6. Efect of diferent rates of phosphorus and forms of application in the efficiency of triple superphosphate in a soil derived from volcanic ashes

    International Nuclear Information System (INIS)

    Pino, I.; Casas, L.

    1988-01-01

    Greenhouse experiments with a soil derived from volcanic ash were carried out in order to determine the efficiency of triple Superphosphate with different rates and forms of application. Oat (Avena Sativa L.) was used as reference crop. The P 32 labeled fertilizer was applied located 2,5 cm underneath the seeds. At the same time 500 mg P were applied located, mixed and in the surface of the soil. The P in the plant coming from the fertilizer was about 65%. This value was independent from the rates. The A value showed some fluctuations with the utmost rates of P. The fertilizer applied located and in the surface of the soil proved to be the most efficient form of application. The A value useful to compare the different treatments. The fertilizer efficiency was very low in both experiments, being the higher efficiency (5,9%) at the lowest rate which is not associated to a higher production. The best treatment was obtained with 500 mg of P located underneath the seed. (author)

  7. Acute regulation of circulating parathyroid hormone (PTH) molecular forms by calcium: utility of PTH fragments/PTH(1-84) ratios derived from three generations of PTH assays.

    Science.gov (United States)

    D'Amour, Pierre; Räkel, Agnès; Brossard, Jean-Hugues; Rousseau, Louise; Albert, Caroline; Cantor, Tom

    2006-01-01

    The quantitative evaluation of circulating PTH peaks revealed by PTH assays after HPLC separation constitutes the best way to study the behavior of PTH molecular forms, but it is also impractical. The objective of the study was to investigate the regulation of circulating PTH molecular forms by calcium through the use of PTH fragments/PTH (1-84) ratios derived from PTH assays with different specificities before and after HPLC separation of circulating PTH. CaCl2 and Na citrate were infused in eight volunteers. PTH was measured in serum and HPLC fractions at different calcium concentrations in PTH assays reacting with regions 1-2 (CA), 12-18 (T), and 65-69 (C) of the PTH structure. From hypo- to hypercalcemia, the C/CA ratio had the highest range (1.92 to 9.75; P < 0.001), and the C/T ratio had a higher range (1.69 to 6.11; P < 0.01) than the T/CA ratio (1.15 to 1.86). Human (h) PTH (1-84) represented 32.7 and 4.3% of circulating PTH in hypo- and hypercalcemic HPLC profiles, respectively. These numbers were 5 and 0.9% for amino-terminal (N)-PTH, an amino-terminal form of PTH distinct from hPTH (1-84), 7.3 and 6.8% for non-(1-84) PTH or large C-PTH fragments with a partially preserved N structure, and 54.9 and 88.1% for C-PTH fragments missing a N structure. The HPLC C-PTH fragments to hPTH (1-84) ratio had the most extensive range (1.67 to 20.58). Despite their quantitative differences, all ratios identified identical behavior of PTH fragments relative to PTH (1-84). PTH assay ratios are an adequate tool to investigate the modulation of PTH molecular forms, even if all PTH assays show some undesirable cross-reactivity with certain circulating forms of PTH.

  8. Monoclonal antibodies (MAb) made against insect-derived metacyclic trypomastigotes (IMT) of Trypanosoma cruzi (TC) cross-react with other parasite forms

    International Nuclear Information System (INIS)

    Kirchhoff, L.V.; Gilliam, F.C.

    1986-01-01

    Considerable information has been generated in recent years about stage-specific surface membrane antigens of a number of protozoa, and this phenomenon has been observed among several stages of TC as well. However, little is known about the surface antigens of IMT, the true infective stage of TC, because of the difficulty of obtaining sufficient numbers of these organisms for analysis. The Tulahuen strain of TC was maintained in the reduviid vector Dipetalogaster maximus by repeated feeding on mice with high parasitemias. IMT collected with insect urine were irradiated (150 krad) and used to immunize a BALB/c mouse for hybridoma production. Supernatants were screened by immunofluorescence assay for the presence of IgG MAb that react with methanol-fixed IMT, epimastogotes (EPI) and culture-derived metacyclic trypomastigoes (CMT). Of 41 MAb obtained, 40 reacted with IMT, 37 with EPI and 38 with CMT. Four MAb immunoprecipitated radioiodinated proteins or protein conjugates of M/sub r/ 80, 72, 45 and 45 from lysates of 125 I surface-labeled EPI. These results indicate that, at least at the epitopic level, there is considerable overlap among IMT, EPI and CMT surface antigens. This finding suggests that analysis of surface proteins of the latter 2 parasite forms may lead to identification of molecules useful for vaccine development

  9. ESTRATEGIAS DE MARKETING MIX PARA AUMENTAR LAS VENTAS DE SERVICIOS EDUCATIVOS EN LA ESPECIALIDAD DE SECRETARIADO EJECUTIVO EN EL INSTITUTO SUPERIOR TECNOLOGICO ISA-CHICLAYO-2014.

    OpenAIRE

    Anastasio Vallejos, Carla Arleen; Universidad César Vallejos- Chiclayo

    2016-01-01

    La investigación lleva como título “Estrategias de marketing mix para aumentar las ventas de servicios educativos en la especialidad de secretariado ejecutivo en el Instituto Superior Tecnológico ISA-chiclayo-2014”, donde se tuvo como principal objetivo proponer estrategias de marketing mix para aumentar las ventas de servicios educativos en la especialidad de secretariado ejecutivo en el Instituto Superior Tecnológico ISA-Chiclayo. Para ello se realizó un estudio de tipo descriptivo – propos...

  10. 17 CFR 249.820 - Form 19b-4(e) for the listing and trading of new derivative securities products by self...

    Science.gov (United States)

    2010-04-01

    ... and trading of new derivative securities products by self-regulatory organizations that are not deemed... listing and trading of new derivative securities products by self-regulatory organizations that are not... self-regulatory organization's listing and trading of a new derivative securities product that is not...

  11. Fecal concentrations of bacterially derived vitamin K forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults.

    Science.gov (United States)

    Karl, J Philip; Meydani, Mohsen; Barnett, Junaidah B; Vanegas, Sally M; Barger, Kathryn; Fu, Xueyan; Goldin, Barry; Kane, Anne; Rasmussen, Helen; Vangay, Pajau; Knights, Dan; Jonnalagadda, Satya S; Saltzman, Edward; Roberts, Susan B; Meydani, Simin N; Booth, Sarah L

    2017-10-01

    Background: Emerging evidence suggests novel roles for bacterially derived vitamin K forms known as menaquinones in health and disease, which may be attributable in part to anti-inflammatory effects. However, the relevance of menaquinones produced by gut bacteria to vitamin K requirements and inflammation is undetermined. Objective: This study aimed to quantify fecal menaquinone concentrations and identify associations between fecal menaquinone concentrations and serum vitamin K concentrations, gut microbiota composition, and inflammation. Design: Fecal and serum menaquinone concentrations, fecal microbiota composition, and plasma and fecal cytokine concentrations were measured in 80 men and postmenopausal women (48 men, 32 women, age 40-65 y) enrolled in a randomized, parallel-arm, provided-food trial. After consuming a run-in diet for 2 wk, participants were randomly assigned to consume a whole grain-rich (WG) or a refined grain-based (RG) diet for 6 wk. Outcomes were measured at weeks 2 and 8. Results: The median total daily excretion of menaquinones in feces was 850 nmol/d but was highly variable (range: 64-5358 nmol/d). The total median (IQR) fecal concentrations of menaquinones decreased in the WG diet compared with the RG diet [-6.8 nmol/g (13.0 nmol/g) dry weight for WG compared with 1.8 nmol/g (12.3 nmol/g) dry weight for RG; P < 0.01)]. However, interindividual variability in fecal menaquinone concentrations partitioned individuals into 2 distinct groups based on interindividual differences in concentrations of different menaquinone forms rather than the diet group or the time point. The relative abundances of several gut bacteria taxa, Bacteroides and Prevotella in particular, differed between these groups, and 42% of identified genera were associated with ≥1 menaquinone form. Menaquinones were not detected in serum, and neither fecal concentrations of individual menaquinones nor the menaquinone group was associated with any marker of inflammation

  12. Sentimento de felicidade em idosos: uma abordagem epidemiológica, ISA-Camp 2008 Happiness in the elderly: an epidemiological approach in the ISA-Camp 2008 study

    Directory of Open Access Journals (Sweden)

    Margareth Guimarães Lima

    2012-12-01

    Full Text Available O objetivo foi detectar fatores associados à felicidade na população idosa. O estudo é do tipo transversal, de base populacional, com dados de 1.431 idosos do ISA-Camp 2008. A amostragem foi probabilística, por conglomerado e em dois estágios. Foram estimadas as prevalências do sentimento de felicidade por todo o tempo, segundo variáveis sociais, demográficas, de comportamentos e condições de saúde. Os idosos que se sentem felizes por maior tempo são os casados, os que trabalham, são ativos ou insuficientemente ativos no lazer, ingerem bebida alcoólica ocasionalmente, consomem frutas, legumes e verduras todos os dias, não são obesos, apresentam um tempo de sono The objective was to identify factors associated with happiness in the elderly. A cross-sectional, population-based study was conducted in 1,431 elderly under the ISA-Camp 2008 project. The survey used a two-stage probabilistic cluster sample. Prevalence of happiness was measured over time according to socio-demographics variables, health behaviors, and health conditions. High prevalence of happiness was associated with: marital status (married, active working, activity and insufficient leisure-time activity, occasional consumption of alcoholic beverages, daily consumption of fruit, vegetables, and leafy vegetables, normal body mass index, and sleeping less than 10 hours/night and sleeping well. The highest prevalence of long-term happiness was observed among elderly with no reported illness, with better self-rated health, and with less disability. Happiness was strongly related to health indicators, suggesting the adequacy of complementary use of this indicator for evaluating health promotion programs in the elderly.

  13. Financial Derivatives

    DEFF Research Database (Denmark)

    Wigan, Duncan

    2013-01-01

    Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....

  14. Blue-emitting photoluminescence of rod-like and needle-like ZnO nanostructures formed by hot-water treatment of sol–gel derived coatings

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Wai Kian, E-mail: tanwaikian@cie.ignite.tut.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Kawamura, Go; Muto, Hiroyuki [Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Abdul Razak, Khairunisak; Lockman, Zainovia [School of Materials and Mineral Resources, Universiti Sains Malaysia, Engineering Campus, Nibong Tebal, Pulau Pinang 14300 Malaysia (Malaysia); Matsuda, Atsunori, E-mail: matsuda@tut.ee.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan)

    2015-02-15

    The morphological evolution of the zinc oxide (ZnO) nanostructures generated by hot-water treatment (HWT) of sol–gel derived coatings as a function of temperature from 30 to 90 °C was investigated. With increasing HWT temperature, the ZnO crystals evolved from nanoparticles to rod-like and needle-like nanostructures. High-resolution transmission electron microscope observations of rod-like and needle-like nanostructures generated at 60 and 90 °C indicated single crystal ZnO wurtzite structure was obtained. All the hot-water treated samples exhibited blue emission at approximately 440 nm in room temperature. The intensity of blue emission increased with higher HWT temperatures. The unique photoluminescence emission characteristic remained even after heat-treatment at 400 °C for 1 h. As the emission peak obtained in our work is approximately 440 nm (2.82 eV), the emission peak is corresponding to the electron transition from the interstitial Zn to the top of valence band. This facile formation of blue-emitting ZnO nanostructures at low-temperature can be utilized on substrate with low thermal stability for optoelectronic applications such as light emitting devices and biological fluorescence labeling. - Highlights: • Facile and novel formation of ZnO nanostructures by low temperature hot-water treatment. • No catalyst or inhibitor is used. • Evolution of ZnO nanostructures formation as a function of temperature is reported. • Dominant blue emissions are observed from the as-formed and annealed ZnO films. • Ultraviolet and visible emissions are observed for hot-water treated films.

  15. [The role of science in policy making--EuSANH-ISA project, framework for science advice for health].

    Science.gov (United States)

    Cianciara, Dorota; Piotrowicz, Maria; Bielska-Lasota, Magdalena; Wysocki, Mirosław J

    2012-01-01

    Governments and other authorities (including MPs) should be well informed on issues of science and technology. This is particularly important in the era of evidence-based practice. This implies the need to get expert advice. The process by which scientific knowledge is transmitted, along with proposals how to solve the problem, is called science advice. The main aim of the article is to discuss the issue of science advice--definitions, interaction between science and policymaking, and its position in contemporary policies. The second aim is to present European Science Advisory Network for Health (EuSANH), EuSANH-ISA project, and framework for science advice for health which was developed by participants. Furthermore, the role of civil society in decision-making process and science advice is also discussed. Interaction between scientists and policy-makers are described in terms of science-push approach (technocratic model), policy-pull (decisionistic) and simultaneous push-pull approach (pragmatic). The position of science advice is described in historical perspective from the 50s, especially in the last two decades. Description relies to USA, Canada and UK. Principles of scientific advice to government (Government Office for Science, UK) are quoted. Some important documents related to science advice in EU and UN are mentioned. EuSANH network is described as well as EuSANH-ISA project, with its objectives and outcomes. According to findings of this project, the process of science advice for health should follow some steps: framing the issue to be covered; planning entire process leading to the conclusion; drafting the report; reviewing the report and revision; publishing report and assessing the impact on policy.

  16. The role of the International Society for Applied Ethology (ISAE) in the global development of animal welfare science and its relationship with the OIE; strength through partnership

    Science.gov (United States)

    The objective of this presentation is to introduce the ISAE and to highlight members’ roles in the development and implementation of OIE’s animal welfare standards. Animal welfare science is a young discipline. Originally, welfare science was heavily focused on animal behavior (ethology), but it is ...

  17. Märt Agu: "Isa vari käib mul kogu aeg kannul" / Märt Agu ; interv. Aigi Viira

    Index Scriptorium Estoniae

    Agu, Märt

    2006-01-01

    1. okt. tähistas oma 30-aastast sünnipäeva ja oma ellukutsuja Mait Agu 55-sünniaastapäeva Tallinna Ülikooli koreograafiaosakond. Sel puhul esitati Estonias Mait Agu tantsulavastus "Kodalased ja kaasaegsed", mille seadis uuesti lavale Märt Agu oma isa loodud koreograafia põhjal

  18. Pretreatment with platelet derived growth factor-BB modulates the ability of costochondral resting zone chondrocytes incorporated into PLA/PGA scaffolds to form new cartilage in vivo.

    Science.gov (United States)

    Lohmann, C H; Schwartz, Z; Niederauer, G G; Carnes, D L; Dean, D D; Boyan, B D

    2000-01-01

    Optimal repair of chondral defects is likely to require both a suitable population of chondrogenic cells and a biodegradable matrix to provide a space-filling structural support during the early stages of cartilage formation. This study examined the ability of chondrocytes to support cartilage formation when incorporated into biodegradable scaffolds constructed from copolymers (PLG) of polylactic acid (PLA) and polyglycolic acid (PGA) and implanted in the calf muscle of nude mice. Scaffolds were fabricated to be more hydrophilic (PLG-H) or were reinforced with 10% PGA fibers (PLG-FR), increasing the stiffness of the implant by 20-fold. Confluent primary cultures of rat costochondral resting zone chondrocytes (RC) were loaded into PLG-H foams and implanted intramuscularly. To determine if growth factor pretreatment could modulate the ability of the cells to form new cartilage, RC cells were pretreated with recombinant human platelet derived growth factor-BB IPDGF-BB) for 4 or 24 h prior to implantation. To assess whether scaffold material properties could affect the ability of chondrogenic cells to form cartilage, RC cells were also loaded into PLG-FR scaffolds. To determine if the scaffolds or treatment with PDGF-BB affected the rate of chondrogenesis, tissue at the implant site was harvested at four and eight weeks post-operatively, fixed, decalcified and embedded in paraffin. Sections were obtained along the transverse plane of the lower leg, stained with haematoxylin and eosin, and then assessed by morphometric analysis for area of cartilage, area of residual implant, and area of fibrous connective tissue formation (fibrosis). Whether or not the cartilage contained hypertrophic cells was also assessed. The amount of residual implant did not change with time in any of the implanted tissues. The area occupied by PLG-FR implants was greater than that occupied by PLG-H implants at both time points. All implants were surrounded by fibrous connective tissue, whether

  19. The Prevalence Of Nasal Trauma In Uch,Ibadan - Nigeria | Isa ...

    African Journals Online (AJOL)

    Methods:- A one year prospective study of Nasal trauma at the University College Hospital, Ibadan, Nigeria. Results: A total of one thousand three hundred and fifty patients (1,350) with all forms of trauma presenting at UCH, Ibadan during the study period were included. Nasal trauma alone or in association with other ...

  20. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  1. Dimensions of human ejaculated spermatozoa in Papanicolaou-stained seminal and swim-up smears obtained from the Integrated Semen Analysis System (ISAS(®)).

    Science.gov (United States)

    Bellastella, Giuseppe; Cooper, Trevor G; Battaglia, Marina; Ströse, Anda; Torres, Inma; Hellenkemper, Barbara; Soler, Carles; Sinisi, Antonio A

    2010-11-01

    Objective measurements are required for computer-aided sperm morphometric analysis (CASMA) machines to distinguish normal from abnormal sperm heads. The morphometric characteristics of spermatozoa in 72 samples of semen and of spermatozoa from 72 other semen samples after swim-up were quantified by the semi-automated Integrated Sperm Analysis System (ISAS) computer-aided system, which measured the sperm head parameters length (L), width (W), area (A), perimeter (P), acrosomal area (Ac), and the derived values L/W and P/A. For each man a homogeneous population of distributions characterized seminal spermatozoa (7 942 cells: median values L 4.4 μm, W 2.8 μm, A 9.8 μm(2), P 12.5 μm, Ac 47.5%, L/W 1.57, P/A 1.27), and there was no significant difference in within- and among-individual variation. Different men could have spermatozoa of significantly different dimensions. Head dimensions for swim-up spermatozoa from different men (4 812 cells) were similar to those in semen, differing only by 2%-5%. The values of L, W and L/W fell within the limits given by the World Health Organization (WHO). Although these samples were not biologically matched, linear mixed-effects statistical analyses permitted valid comparison of the groups. A subpopulation of 404 spermatozoa considered to fit the stringent criteria of WHO 'normal' seminal spermatozoa from both semen and swim-up were characterized by median values (and 95% confidence intervals) of L, 4.3 μm (3.8-4.9), W, 2.9 μm (2.6-3.3), A, 10.2 μm(2) (8.5-12.2), P, 12.4 μm (11.3-13.9), Ac, 49% (36-60), L/W, 1.49 (1.32-1.67) and P/A, 1.22 (1.11-1.35). These median values fall within the 95th centile confidence limits given by WHO, but the confidence intervals for L and W were larger. Although these differences in head dimensions among men and after swim-up could be detected by CASMA, the small differences make it unlikely that technicians would be able to distinguish them. The values could be used as default sperm head

  2. Denaturing gradient gel electrophoresis (DGGE as a powerful novel alternative for differentiation of epizootic ISA virus variants.

    Directory of Open Access Journals (Sweden)

    Marisela Carmona

    Full Text Available Infectious Salmon Anemia is a devastating disease critically affecting world-wide salmon production. Chile has been particularly stricken by this disease which in all cases has been directly related with its causative agent, a novel orthomyxovirus which presents specific and distinctive infective features. Among these, two molecular markers have been directly associated with pathogenicity in two of the eight RNA sub genomic coding units of the virus: an insertion hot spot region present in viral segment 5 and a Highly Polymorphic Region (HPR located in viral segment 6. Here we report the successful adaptation of a PCR-dependent denaturing gel electrophoresis technique (DGGE, which enables differentiation of selected reported HPR epizootic variants detected in Chile. At the same time, the technique allows us to distinguish one nucleotide differences in sequences associated with the intriguing, and still not well-understood, insertion events which tend to occur on RNA Segment 5. Thus, the versatility of the technique opens new opportunities for improved understanding of the complex biology of all ISA variants as well as possible applications to other highly variable pathogens.

  3. Is Student Performance on the Information Systems Analyst Certification Exam Affected by Form of Delivery of Information Systems Coursework?

    Science.gov (United States)

    Haga, Wayne; Moreno, Abel; Segall, Mark

    2012-01-01

    In this paper, we compare the performance of Computer Information Systems (CIS) majors on the Information Systems Analyst (ISA) Certification Exam. The impact that the form of delivery of information systems coursework may have on the exam score is studied. Using a sample that spans three years, we test for significant differences between scores…

  4. Free radical derivatives formed from cyclooxygenase-catalyzed dihomo-γ-linolenic acid peroxidation can attenuate colon cancer cell growth and enhance 5-fluorouracil's cytotoxicity.

    Science.gov (United States)

    Xu, Yi; Qi, Jin; Yang, Xiaoyu; Wu, Erxi; Qian, Steven Y

    2014-01-01

    Dihomo-γ-linolenic acid (DGLA) and its downstream fatty acid arachidonic acid (AA) are both nutritionally important ω-6 polyunsaturated fatty acids (ω-6s). Evidence shows that, via COX-mediated peroxidation, DGLA and its metabolites (1-series prostaglandins) are associated with anti-tumor activity, while AA and its metabolites (2-series prostaglandins) could be tightly implicated in various cancer diseases. However, it still remains a mystery why DGLA and AA possess contrasting bioactivities. Our previous studies showed that DGLA could go through an exclusive C-8 oxygenation pathway during COX-catalyzed lipid peroxidation in addition to a C-15 oxygenation pathway shared by both DGLA and AA, and that the exclusive C-8 oxygenation could lead to the production of distinct DGLA׳s free radical derivatives that may be correlated with DGLA׳s anti-proliferation activity. In the present work, we further investigate the anti-cancer effect of DGLA׳s free radical derivatives and their associated molecular mechanisms. Our study shows that the exclusive DGLA׳s free radical derivatives from C-8 oxygenation lead to cell growth inhibition, cell cycle arrest and apoptosis in the human colon cancer cell line HCA-7 colony 29, probably by up-regulating the cancer suppressor p53 and the cell cycle inhibitor p27. In addition, these exclusive radical derivatives were also able to enhance the efficacy of 5-Fluorouracil (5-FU), a widely used chemo-drug for colon cancer. For the first time, we show how DGLA׳s radical pathway and metabolites are associated with DGLA׳s anti-cancer activities and able to sensitize colon cancer cells to chemo-drugs such as 5-FU. Our findings could be used to guide future development of a combined chemotherapy and dietary care strategy for colon cancer treatment.

  5. Performance Comparison of Wireless Sensor Network Standard Protocols in an Aerospace Environment: ISA100.11a and ZigBee Pro

    Science.gov (United States)

    Wagner, Raymond S.; Barton, Richard J.

    2011-01-01

    Standards-based wireless sensor network (WSN) protocols are promising candidates for spacecraft avionics systems, offering unprecedented instrumentation flexibility and expandability. Ensuring reliable data transport is key, however, when migrating from wired to wireless data gathering systems. In this paper, we conduct a rigorous laboratory analysis of the relative performances of the ZigBee Pro and ISA100.11a protocols in a representative crewed aerospace environment. Since both operate in the 2.4 GHz radio frequency (RF) band shared by systems such as Wi-Fi, they are subject at times to potentially debilitating RF interference. We compare goodput (application-level throughput) achievable by both under varying levels of 802.11g Wi-Fi traffic. We conclude that while the simpler, more inexpensive ZigBee Pro protocol performs well under moderate levels of interference, the more complex and costly ISA100.11a protocol is needed to ensure reliable data delivery under heavier interference. This paper represents the first published, rigorous analysis of WSN protocols in an aerospace environment that we are aware of and the first published head-to-head comparison of ZigBee Pro and ISA100.11a.

  6. Nordic Walking and the Isa Method for Breast Cancer Survivors: Effects on Upper Limb Circumferences and Total Body Extracellular Water - a Pilot Study.

    Science.gov (United States)

    Di Blasio, Andrea; Morano, Teresa; Napolitano, Giorgio; Bucci, Ines; Di Santo, Serena; Gallina, Sabina; Cugusi, Lucia; Di Donato, Francesco; D'Arielli, Alberto; Cianchetti, Ettore

    2016-12-01

    The negative side effects of breast cancer treatments can include upper limb lymphoedema. The growing literature indicates that Nordic walking is an effective discipline against several disease symptoms. The aim of this study was to determine whether introduction to Nordic walking alone is effective against total body extracellular water and upper limb circumferences in breast cancer survivors compared to its combination with a series of specifically created exercises (i.e. the Isa method). 16 breast cancer survivors (49.09 ± 2.24 years) were recruited and randomly assigned to 1 of 2 different training groups. 10 lessons on Nordic walking technique plus the Isa method significantly reduced both extracellular body water and the extracellular-to-total body water ratio (p = 0.01 for both), and also the circumference of the upper limb, (both relaxed arm and forearm circumferences) (p = 0.01 for all), whereas Nordic walking alone did not. Introduction to Nordic walking does not seem to affect lymphoedema in breast cancer survivors. This might be because novice Nordic Walkers do not adequately generate an effective muscular pump through coordination of the alternated bimanual open-close cycle. The Isa method appears to close this gap.

  7. Ethological parameters and performance of Hy Line W-98 and ISA Brown hens when housed in furnished cages Parâmetros etológicos e desempenho de poedeiras Hy line W-98 e Isa Brown alojadas em gaiolas enriquecidas

    Directory of Open Access Journals (Sweden)

    V.F.B. Roll

    2008-06-01

    Full Text Available This study was carried out throughout a laying period to compare the behaviour and performance of two groups of commercial layers, 180 ISA Brown and 120 Hy line W98, housed at 17 weeks of age in furnished cages with a nest box, perches, dust-bath, and claw shortening device. Based on productive parameters, the model of furnished cages studied is suitable for both, Isa Brown and Hy line hens. The study suggested that strain has a significant effect on feather condition and on some behavioural displays, particularly those related to the use of a dust-bath.Durante um ciclo completo de postura foram avaliados o comportamento e o desempenho de duas linhagens de poedeiras comerciais, 180 ISA Brown e 120 Hy line W98, alojadas com 17 semanas de idade em gaiolas enriquecidas com ninho, poleiros, banho de areia e dispositivos de desgaste de unhas. Em ambas as linhagens, Isa Brown e Hy line W98, o modelo de gaiola estudado foi apropriado em termos de desempenho produtivo. O estudo sugeriu que a linhagem teve efeito significativo sobre a condição da plumagem e sobre alguns aspectos comportamentais, particularmente, aqueles relacionados ao uso do banho de areia.

  8. Differential bone-forming capacity of osteogenic cells from either embryonic stem cells or bone marrow-derived mesenchymal stem cells

    NARCIS (Netherlands)

    Both, Sanne Karijn; van Apeldoorn, Aart A.; Jukes, J.M.; Englund, Mikael C.O.; Hyllner, Johan; van Blitterswijk, Clemens; de Boer, Jan

    2011-01-01

    For more than a decade, human mesenchymal stem cells (hMSCs) have been used in bone tissue-engineering research. More recently some of the focus in this field has shifted towards the use of embryonic stem cells. While it is well known that hMSCs are able to form bone when implanted subcutaneously in

  9. THE DETERMINATION OF BUPROPION HYDROCHLORIDE IN PHARMACEUTICAL DOSAGE FORMS BY ORIGINAL UV- AND SECOND DERIVATIVE UV SPECTROPHOTOMETRY, POTENTIOMETRIC AND CONDUCTOMETRIC METHODS

    Directory of Open Access Journals (Sweden)

    Duygu YENİCELİ

    2010-08-01

    Full Text Available Spectrophotometric, potentiometric and conductometric methods are developed for the determination of bupropion hydrochloride (BLIP in pharmaceutical tablets. For the first method, original UV-spectrophotometry, 252 nm was determined as the optimum wavelength and used for the determinations. For the other method, second derivative UV spectrophotometry, the absorbances were measured at 217.4 and 221.8 nm and the distance between these extremum values was determined according to peak to peak method. Two spectrophotometric methods were validated over the concentration range of 5.72 - 20.03 ug/mL. The limit of detection and limit of quantitation values of original UV-spectrophotometry were 0.75 ug/mL and 2.28 jug/mL. Also, these parameters were determined as 0.23 ug/mL and 0.68 ug/mL respectively, for the second derivative UV spectrophotometry. Developed methods were fully validated and the applicability of the methods for the determination of BUP in pharmaceuticals were demonstrated. Also, simple potentiometric and conductometric methods were developed and the applicability of these methods were demonstrated. The results of four analytical methods were compared with ANOVA test and no significant difference was found statistically. As a result, the developed methods could be proposed to the rutin content analysis to be simple, cheap, accurate, and precise

  10. Kjubrikovo čitanje Bardžisa: Značaj kostima za razumevanje Paklene pomorandže

    Directory of Open Access Journals (Sweden)

    Dijana Metlić

    2016-07-01

    Full Text Available Roman Paklena pomorandža Entonija Bardžisa, objavljen 1962. godine, postao je jedno od kultnih književnih dela XX veka, pre svega zahvaljujući istoimenom filmu Stenlija Kjubrika iz 1971. Okarakterisan kao dekadentno i nihilističko ostvarenje, snimljen tako da gledaoci „uživaju“ u scenama nasilja, Kjubrikov film bio je, uz prekide, u distribuciji u Britaniji do 1974. godine kada je povučen na zahtev reditelja zbog optužbi koje su ga implicitno teretile za povećanje stepena delinkventskog nasilja u Engleskoj, neposredno po bioskopskom prikazivanju filma. Ovaj tekst analizira specifičan Kjubrikov pristup adaptaciji književnog predloška, sa pozicije upotrebe filmskog kostima i umetničkih dela pop arta u njegovoj scenografiji, što postaju ključni elementi za konstruisanje nove slike budućeg društva, nastalog u periodu hladnoratovske krize, Vijetnamskog rata i učestalih protesta omladine nezadovoljne uslovima života koji im obezbeđuju njihovi očevi. U pitanju je klasno određen svet, korumpiran i sumoran, ispražnjen i bez vitalnosti. Bardžis predstavlja Englesku neposredno po završetku sukoba između modsa i rokera šezdesetih godina, a pre pojave pank pokreta u drugoj polovini sedamdesetih. Takvoj apokaliptičkoj viziji britanske budućnosti suprotstavlja se jaka i osvešćena individua oličena u harizmatičnom junaku Aleksu Dilarču, koji sa Kjubrikom konačno dobija i svoj „stvarni“, oživotvoreni lik zahvaljujući Malkolmu Mekdauelu koji tumači glavnu ulogu.

  11. Comparação das estimativas de prevalência de indicadores de saúde no Município de Campinas, São Paulo, Brasil, nos anos de 2001/2002 (ISA-SP e 2008/2009 (ISA-Camp Comparación de las estimaciones de prevalencia en los indicadores de salud en Campinas, São Paulo, Brasil, durante los años 2001/2002 (ISA-SP y 2008/2009 (ISA-Camp Comparison of prevalence estimates for health indicators in Campinas, São Paulo State, Brazil, in 2001-2002 (ISA-SP and 2008-2009 (ISA-Camp

    Directory of Open Access Journals (Sweden)

    Chester Luis Galvão César

    2013-06-01

    Full Text Available O objetivo do estudo foi comparar estimativas da prevalência de indicadores de saúde para adultos residentes em Campinas, São Paulo, Brasil, utilizando dados de inquéritos domiciliares realizados em diferentes períodos de tempo (ISA-SP 2001/2002 e ISA-Camp 2008/2009, com amostras de 941 e 2.637 indivíduos de 18 anos e mais, respectivamente. Variáveis sociodemográficas caracterizaram a população estudada. Foram estimadas prevalências e seus respectivos intervalos de 95% de confiança e as comparações foram realizadas pelas razões de prevalência ajustadas por sexo, idade e escolaridade, obtidas pela regressão de Poisson com variância robusta. Diferenças estatisticamente significantes foram observadas para as prevalências de: morbidade referida, uso de medicamentos, percentual dos que nunca fumaram, realização dos exames de Papanicolaou e de mamografia, alguma vez na vida. O acompanhamento de indicadores de saúde por inquéritos repetidos em uma mesma população pode facilitar o monitoramento de objetivos e metas fornecendo subsídios ao planejamento de ações em saúde.El objetivo del estudio fue comparar las estimaciones de prevalencia en los indicadores de salud para los adultos que viven en Campinas, São Paulo, Brasil, con datos de encuestas de diferentes períodos de tiempo (ISA-SP 2001/2002 y ISA-Camp 2008/2009, con muestras de 941 y 2.637 personas de 18 años y más, respectivamente. Las variables sociodemográficas caracterizaron a la población de estudio. Se estimaron la prevalencia y sus respectivos intervalos de confianza del 95% y las comparaciones se realizaron por razones de prevalencia ajustadas por sexo, edad y educación, obtenidas mediante la regresión de Poisson. Se observaron diferencias estadísticas en la prevalencia de morbilidad, uso de medicamentos, el porcentaje de quienes nunca habían fumado, la realización de citologías vaginales y mamografías, en algún momento de sus vidas. El seguimiento

  12. Rapid Chondrocyte Isolation for Tissue Engineering Applications: The Effect of Enzyme Concentration and Temporal Exposure on the Matrix Forming Capacity of Nasal Derived Chondrocytes

    Directory of Open Access Journals (Sweden)

    Srujana Vedicherla

    2017-01-01

    Full Text Available Laboratory based processing and expansion to yield adequate cell numbers had been the standard in Autologous Disc Chondrocyte Transplantation (ADCT, Allogeneic Juvenile Chondrocyte Implantation (NuQu®, and Matrix-Induced Autologous Chondrocyte Implantation (MACI. Optimizing cell isolation is a key challenge in terms of obtaining adequate cell numbers while maintaining a vibrant cell population capable of subsequent proliferation and matrix elaboration. However, typical cell yields from a cartilage digest are highly variable between donors and based on user competency. The overall objective of this study was to optimize chondrocyte isolation from cartilaginous nasal tissue through modulation of enzyme concentration exposure (750 and 3000 U/ml and incubation time (1 and 12 h, combined with physical agitation cycles, and to assess subsequent cell viability and matrix forming capacity. Overall, increasing enzyme exposure time was found to be more detrimental than collagenase concentration for subsequent viability, proliferation, and matrix forming capacity (sGAG and collagen of these cells resulting in nonuniform cartilaginous matrix deposition. Taken together, consolidating a 3000 U/ml collagenase digest of 1 h at a ratio of 10 ml/g of cartilage tissue with physical agitation cycles can improve efficiency of chondrocyte isolation, yielding robust, more uniform matrix formation.

  13. Long-Term Expansion in Platelet Lysate Increases Growth of Peripheral Blood-Derived Endothelial-Colony Forming Cells and Their Growth Factor-Induced Sprouting Capacity.

    Science.gov (United States)

    Tasev, Dimitar; van Wijhe, Michiel H; Weijers, Ester M; van Hinsbergh, Victor W M; Koolwijk, Pieter

    2015-01-01

    Efficient implementation of peripheral blood-derived endothelial-colony cells (PB-ECFCs) as a therapeutical tool requires isolation and generation of a sufficient number of cells in ex vivo conditions devoid of animal-derived products. At present, little is known how the isolation and expansion procedure in xenogeneic-free conditions affects the therapeutical capacity of PB-ECFCs. The findings presented in this study indicate that human platelet lysate (PL) as a serum substitute yields twice more colonies per mL blood compared to the conventional isolation with fetal bovine serum (FBS). Isolated ECFCs displayed a higher proliferative ability in PL supplemented medium than cells in FBS medium during 30 days expansion. The cells at 18 cumulative population doubling levels (CPDL) retained their proliferative capacity, showed higher sprouting ability in fibrin matrices upon stimulation with FGF-2 and VEGF-A than the cells at 6 CPDL, and displayed low β-galactosidase activity. The increased sprouting of PB-ECFCs at 18 CPDL was accompanied by an intrinsic activation of the uPA/uPAR fibrinolytic system. Induced deficiency of uPA (urokinase-type plasminogen activator) or uPAR (uPA receptor) by siRNA technology completely abolished the angiogenic ability of PB-ECFCs in fibrin matrices. During the serial expansion, the gene induction of the markers associated with inflammatory activation such as VCAM-1 and ICAM-1 did not occur or only to limited extent. While further propagation up to 31 CPDL proceeded at a comparable rate, a marked upregulation of inflammatory markers occurred in all donors accompanied by a further increase of uPA/uPAR gene induction. The observed induction of inflammatory genes at later stages of long-term propagation of PB-ECFCs underpins the necessity to determine the right time-point for harvesting of sufficient number of cells with preserved therapeutical potential. The presented isolation method and subsequent cell expansion in platelet lysate

  14. Long-Term Expansion in Platelet Lysate Increases Growth of Peripheral Blood-Derived Endothelial-Colony Forming Cells and Their Growth Factor-Induced Sprouting Capacity.

    Directory of Open Access Journals (Sweden)

    Dimitar Tasev

    Full Text Available Efficient implementation of peripheral blood-derived endothelial-colony cells (PB-ECFCs as a therapeutical tool requires isolation and generation of a sufficient number of cells in ex vivo conditions devoid of animal-derived products. At present, little is known how the isolation and expansion procedure in xenogeneic-free conditions affects the therapeutical capacity of PB-ECFCs.The findings presented in this study indicate that human platelet lysate (PL as a serum substitute yields twice more colonies per mL blood compared to the conventional isolation with fetal bovine serum (FBS. Isolated ECFCs displayed a higher proliferative ability in PL supplemented medium than cells in FBS medium during 30 days expansion. The cells at 18 cumulative population doubling levels (CPDL retained their proliferative capacity, showed higher sprouting ability in fibrin matrices upon stimulation with FGF-2 and VEGF-A than the cells at 6 CPDL, and displayed low β-galactosidase activity. The increased sprouting of PB-ECFCs at 18 CPDL was accompanied by an intrinsic activation of the uPA/uPAR fibrinolytic system. Induced deficiency of uPA (urokinase-type plasminogen activator or uPAR (uPA receptor by siRNA technology completely abolished the angiogenic ability of PB-ECFCs in fibrin matrices. During the serial expansion, the gene induction of the markers associated with inflammatory activation such as VCAM-1 and ICAM-1 did not occur or only to limited extent. While further propagation up to 31 CPDL proceeded at a comparable rate, a marked upregulation of inflammatory markers occurred in all donors accompanied by a further increase of uPA/uPAR gene induction. The observed induction of inflammatory genes at later stages of long-term propagation of PB-ECFCs underpins the necessity to determine the right time-point for harvesting of sufficient number of cells with preserved therapeutical potential.The presented isolation method and subsequent cell expansion in platelet

  15. Buthalital and methitural – 5,5-substituted derivatives of 2-thiobarbituric acid forming the same type of hydrogen-bonded chain

    Directory of Open Access Journals (Sweden)

    Thomas Gelbrich

    2017-12-01

    Full Text Available The molecule of buthalital, (I [systematic name: 5-(2-methylpropyl-5-(prop-2-en-1-yl-2-sulfanylidene-1,3-diazinane-4,6-dione], C11H16N2O2S, exhibits a planar pyrimidine ring, whereas the pyrimidine ring of methitural, (II [systematic name: 5-(1-methylbutyl-5-[2-(methylsulfanylethyl]-2-sulfanylidene-1,3-diazinane-4,6-dione], C12H20N2O2S2, is slightly puckered. (I and (II contain the same hydrogen-bonded chain structure in which each molecule is connected, via four N—H...O=C hydrogen bonds, to two other molecules, resulting in a hydrogen-bonded chain displaying a sequence of R22(8 rings. The same type of N—H...O=C hydrogen-bonded chain has previously been found in several 5,5-disubstituted derivatives of barbituric acid which are chemically closely related to (I and (II.

  16. CD133-enriched Xeno-Free human embryonic-derived neural stem cells expand rapidly in culture and do not form teratomas in immunodeficient mice

    Directory of Open Access Journals (Sweden)

    Daniel L. Haus

    2014-09-01

    Full Text Available Common methods for the generation of human embryonic-derived neural stem cells (hNSCs result in cells with potentially compromised safety profiles due to maintenance of cells in conditions containing non-human proteins (e.g. in bovine serum or on mouse fibroblast feeders. Additionally, sufficient expansion of resulting hNSCs for scaling out or up in a clinically relevant time frame has proven to be difficult. Here, we report a strategy that produces hNSCs in completely “Xeno-Free” culture conditions. Furthermore, we have enriched the hNSCs for the cell surface marker CD133 via magnetic sorting, which has led to an increase in the expansion rate and neuronal fate specification of the hNSCs in vitro. Critically, we have also confirmed neural lineage specificity upon sorted hNSC transplantation into the immunodeficient NOD-scid mouse brain. The future use or adaptation of these protocols has the potential to better facilitate the advancement of pre-clinical strategies from the bench to the bedside.

  17. PSNO: Predicting Cysteine S-Nitrosylation Sites by Incorporating Various Sequence-Derived Features into the General Form of Chou’s PseAAC

    Directory of Open Access Journals (Sweden)

    Jian Zhang

    2014-06-01

    Full Text Available S-nitrosylation (SNO is one of the most universal reversible post-translational modifications involved in many biological processes. Malfunction or dysregulation of SNO leads to a series of severe diseases, such as developmental abnormalities and various diseases. Therefore, the identification of SNO sites (SNOs provides insights into disease progression and drug development. In this paper, a new bioinformatics tool, named PSNO, is proposed to identify SNOs from protein sequences. Firstly, we explore various promising sequence-derived discriminative features, including the evolutionary profile, the predicted secondary structure and the physicochemical properties. Secondly, rather than simply combining the features, which may bring about information redundancy and unwanted noise, we use the relative entropy selection and incremental feature selection approach to select the optimal feature subsets. Thirdly, we train our model by the technique of the k-nearest neighbor algorithm. Using both informative features and an elaborate feature selection scheme, our method, PSNO, achieves good prediction performance with a mean Mathews correlation coefficient (MCC value of about 0.5119 on the training dataset using 10-fold cross-validation. These results indicate that PSNO can be used as a competitive predictor among the state-of-the-art SNOs prediction tools. A web-server, named PSNO, which implements the proposed method, is freely available at http://59.73.198.144:8088/PSNO/.

  18. Biochemical characterization of CK2alpha and alpha' paralogues and their derived holoenzymes: evidence for the existence of a heterotrimeric CK2alpha'-holoenzyme forming trimeric complexes

    DEFF Research Database (Denmark)

    Olsen, Birgitte; Rasmussen, Tine; Niefind, Karsten

    2008-01-01

    Altogether 2 holoenzymes and 4 catalytic CK2 constructs were expressed and characterized i.e. CK2alpha (2) (1-335) beta(2); CK2alpha'-derived holoenzyme; CK2alpha(1-335); MBP-CK2alpha'; His-tagged CK2alpha and His-tagged CK2alpha'. The two His-tagged catalytic subunits were expressed in insect...... cells, all others in Escherichia coli. IC(50) studies involving the established CK2 inhibitors DMAT, TBBt, TBBz, apigenin and emodin were carried out and the K(i) values calculated. Although the differences in the K(i) values found were modest, there was a general tendency showing that the CK2...... holoenzymes were more sensitive towards the inhibitors than the free catalytic subunits. Thermal inactivation experiments involving the individual catalytic subunits showed an almost complete loss of activity after only 2 min at 45 degrees C. In the case of the two holoenzymes, the CK2alpha...

  19. Simpsonite isa / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2007-01-01

    Joonisfilmi "Simpsonite film" ("The Simpsons Movie") maailmaesilinastuste puhul seriaali looja, Kanada päritolu Matt Groeningist ja tema loodud seriaali populaarsuse fenomenist. Lisaks filmi süzheest "Mees peab oma naist kuulama!" (režissöör David Silverman)

  20. ISA 2011 Workshop Report

    DEFF Research Database (Denmark)

    Kulik, Lars; Guting, Ralf Hartmut; Lu, Hua

    2012-01-01

    Large indoor spaces such as office complexes and shopping malls have become an important part of our daily lives and research into indoor space is increasingly attracting attention from academia and industry. Indoor space differs from outdoor space in several important aspects such as layout...... often involves the third dimension as office buildings and shopping malls typically have several floors....

  1. Suri fetishismi isa

    Index Scriptorium Estoniae

    1999-01-01

    New Yorgis suri kunstnik ja koomiksite joonistaja, pärastsõja-aegse Ameerika bondage-erootika illustraator Eric Stanton. Paar aastat tagasi avaldas Saksa kirjastus Taschen Stantoni elust ja loomingust raamatu, mille toimetas erootikafotograaf Eric Kroll

  2. Modelos matemáticos para estimar as exigências de lisina digestível para aves de corte ISA Label Mathematical models to estimate digestible lysine of ISA Label broilers

    Directory of Open Access Journals (Sweden)

    Jefferson Costa de Siqueira

    2009-09-01

    Full Text Available O objetivo neste estudo foi avaliar diferentes modelos ajustados às respostas de ganho de peso obtidas em experimento com aves da linhagem ISA Label no período de 1 a 28 dias de idade. Foram utilizados 480 pintos de ambos os sexos, distribuídos em delineamento inteiramente casualizado, em arranjo fatorial 4 X 2 (níveis de lisina X sexo, com três repetições, com 20 aves por unidade experimental. Uma ração basal foi formulada para atender às exigências das aves, exceto em lisina. Essa ração foi suplementada com L-lisina HCl em substituição ao ácido L-glutâmico, resultando em rações experimentais isonitrogênicas e isoenergéticas contendo 0,85; 0,97; 1,09 e 1,21% de lisina digestível. As respostas de ganho de peso foram ajustadas de acordo com os níveis de lisina da ração pelos modelos Linear Reponse Plateau (LRP, segmentado de duas inclinações, polinomial quadrático e exponencial. A primeira intersecção da equação quadrática com o platô do LRP também foi utilizado para estimar o nível ótimo. Os níveis de lisina digestível estimados pelos modelos LRP, segmentado e quadrático, foram 0,999; 1,010 e 1,116%, respectivamente. Na combinação do modelo quadrático com o LRP, a estimativa da exigência de lisina digestível foi de 1,041%. O modelo exponencial proporcionou estimativa de 1,066%, considerando 95% da resposta assintótica. Com base nos custos com alimentação, esse mesmo modelo gerou estimativas de 1,000 e 1,030% quando o custo do quilograma de L-lisina HCl foi R$ 8,50 e R$ 6,50, respectivamente. Considerando as limitações de cada um dos modelos propostos, o procedimento para estimar as exigências de lisina digestível pela primeira intersecção da equação quadrática com o platô do LRP foi o mais adequado para melhorar o ganho de peso das aves quando variáveis econômicas não foram consideradas.The objective of this study was to evaluate different models in the adjustment of weight gain (WG

  3. Comparative study of 5-fluorouracil and its derivative, N1-(2'-tetrahydrofuryl)-5-fluorouracil on endogenous colony forming units in spleens of mice

    International Nuclear Information System (INIS)

    Ueno, Yori

    1976-01-01

    The effect of intraperitoneal injection of N 1 -(2'-tetrahydrofuryl)-5-fluorouracil (FT-207) which is metabolized to 5-fluorouracil (5-FU) in vivo, on endogeneous colony forming units in the spleen (endogeneous CFU-s) was observed and compared with that of 5-FU. The 8 x 10 -4 m eqv of FT-207 injected in mice 20 minutes before x-rays irradiation of 450 rads suppressed the endogeneous CFU-s count to about 60% and about 5.5 x 10 -5 m eqv of 5-FU had the same effect. The suppression of FT-207 continued over 120 minutes and increased gradually. The effect of 5-FU was strong shortly after the injection but faded out for 120 minutes. FT-207 had almost no effect on the recovery constant (Blair) of endogeneous CFU-s for 3 days, whereas 5-FU reduced seriously, especially for the first 2 days. The differences in the effects of both compounds could not be explained on the base of the only differences in the metabolism of both compounds. (auth.)

  4. Egg quality and blood parameters of “Bianca di Saluzzo” and Isa Brown hens kept under free range conditions

    Directory of Open Access Journals (Sweden)

    Luca Doglione

    2010-01-01

    Full Text Available Egg quality traits and some blood parameters of Bianca di Saluzzo hen (BSh were compared to Isa Brown hen (IBh. Birds were reared in free range conditions. Weightofthewholeegg Weight of the whole egg was higher (P≤0.01 for IBh, due to its higher amount of albumen (P≤0.01 whereas BSh egg showed the highest weight and relative percentage of yolk (PP≤0.01. IBh and BSh egg chemical composition was similar.Totalredcellsdidnotshowstatisticaldifferencesbetweengroups,whiletotalleucocytes Total red cells did not show statistical differences between groups, while total leucocytes were lower (P≤0.05 forBShhens. Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P for BSh hens. Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P . Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P Heterophyl/Lymphocyte (H/L ratio of BSh was lower (P (PP≤0.01 than IBh(0.33 IBh (0.33 (0.33 vs. 0.82.IBh 0.82. IBh IBh α-1 acid glycoprotein (AGPmeanconcentrationswereaffectedbytime: (AGP mean concentrations were affected by time: the values registered after 15 d (T1 and 2 months (T2 of observation were similar (345±132 and 279±58 μg/mlrespectively,whileAGPvalueregisteredafter4months(T3weresignificantlyhigher μg/ml respectively,whileAGPvalueregisteredafter4months(T3weresignificantlyhigher , while AGP value registered after 4 months (T3 were significantly higher (700±487 μg/ml;BShdidnotdisplayanyAGPstatisticalvariationovertime.IBhalbuminmeancon- μg/ml; BShdidnotdisplayanyAGPstatisticalvariationovertime.IBhalbuminmeancon- BSh did not display any AGP statistical variation over time. IBh albumin mean con- centration (1.62 g/dL was statistically lower than BSh values (1.89 g/dL; in both groups no effect of time of sampling was recorded. Acutephaseprotein(APPvaluesofBShsuggestedamoreadaptive Acute phase protein (APPvaluesofBShsuggestedamoreadaptive (APP values of BSh suggested a more adaptive attitude to free range conditions and appeared more constant over time. The present

  5. Cu-catalyzed aerobic oxidative cyclizations of 3-N-hydroxyamino-1,2-propadienes with alcohols, thiols, and amines to form α-O-, S-, and N-substituted 4-methylquinoline derivatives.

    Science.gov (United States)

    Sharma, Pankaj; Liu, Rai-Shung

    2015-03-16

    A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Información en el proceso de toma de decisiones estratégicas en las empresas colombianas del grupo empresarial ISA

    OpenAIRE

    Montoya López, Jorge Eduardo

    2005-01-01

    113 p. En el proyecto de investigación se realizó inicialmente una exploración de las bases teóricas y empíricas del uso de la información en la toma de decisiones estratégicas, luego se indagó sobre el uso de la información en las decisiones estratégicas efectuadas recientemente en las empresas colombianas del grupo empresarial ISA, enfocándose en determinar la información utilizada desde un medio electrónico y concluyendo acerca de las reales posibilidades del apoyo de los sistemas de in...

  7. Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

    International Nuclear Information System (INIS)

    Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D.M.; Conway, Barbara R.; Timmins, Peter

    2007-01-01

    We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2 NC(CH 3 ) 3- n (CH 2 OH) n , with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family (n=0, 1, 2), but significantly contrasting structural properties for the member with n=3. - Graphical abstract: Structural properties of a family of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine are discussed and rationalized

  8. Performance Comparison of Wireless Sensor Network Standard Protocols in an Aerospace Environment: ISA100.11a and ZigBee

    Science.gov (United States)

    Wagner, Raymond S.; Barton, Richard J.

    2011-01-01

    Wireless Sensor Networks (WSNs) can provide a substantial benefit in spacecraft systems, reducing launch weight and providing unprecedented flexibility by allowing instrumentation capabilities to grow and change over time. Achieving data transport reliability on par with that of wired systems, however, can prove extremely challenging in practice. Fortunately, much progress has been made in developing standard WSN radio protocols for applications from non-critical home automation to mission-critical industrial process control. The relative performances of candidate protocols must be compared in representative aerospace environments, however, to determine their suitability for spaceflight applications. In this paper, we will present the results of a rigorous laboratory analysis of the performance of two standards-based, low power, low data rate WSN protocols: ZigBee Pro and ISA100.11a. Both are based on IEEE 802.15.4 and augment that standard's specifications to build complete, multi-hop networking stacks. ZigBee Pro targets primarily the home and office automation markets, providing an ad-hoc protocol that is computationally lightweight and easy to implement in inexpensive system-on-a-chip components. As a result of this simplicity, however, ZigBee Pro can be susceptible to radio frequency (RF) interference. ISA100.11a, on the other hand, targets the industrial process control market, providing a robust, centrally-managed protocol capable of tolerating a significant amount of RF interference. To achieve these gains, a coordinated channel hopping mechanism is employed, which entails a greater computational complexity than ZigBee and requires more sophisticated and costly hardware. To guide future aerospace deployments, we must understand how well these standards relatively perform in analog environments under expected operating conditions. Specifically, we are interested in evaluating goodput -- application level throughput -- in a representative crewed environment

  9. FECAL EXCRETION OF Salmonella Enteritidis IN BROILER LINES ROSS AND ISA LABEL EXCREÇÃO FECAL de Salmonella Enteritidis EM DUAS LINHAGENS DE FRANGOS DE CORTE

    Directory of Open Access Journals (Sweden)

    Adson Santa Cruz Oliveira

    2007-12-01

    Full Text Available

    The invasive capacity and persistence of this pathogen, crop and ceca in apparently healthy birds of two broiler lines raised without growth promoter antibiotics in ration and originated from eggs inoculated eggshell and in allantoidal cavity with Salmonella Enteritidis. Histological and bacteriological exams from cecal and crop were performed with one, seven, 14 and 21 days of age after hatch in broilers of fast and slow growing rate. Bacterio-logical exams were performed fecal excretion with one, eigth, 22 and 35 days. The Salmonella Enteritidis invaded and colonizated the gastrointestinal tract of the two lines tested, but the the infection reduced with age, and was more persistant in Ross broilers. The results were different for two lines. The pathogen was excreted from just one chick of ISA Label at 22 days of age and four Ross chicks until 35 days of age. In order, Salmonella was detected in 87.5% (14/16 and 38,1% (5/16 of ceca; in 81.2% (13/16 and 12.5% (2/16 of crops; in fast and slow growing rate lines, respectively. In apparent healthy organs, excepted the crop, an inflammatory process with predominance of macrophage and lymphocytes. The slow growing rate line was effective to eliminate bacteria in the organism.

    Key-words: Ceca, crop, fecal excretion, inflammation.

    Avaliaram-se, neste estudo, a capacidade inva-siva, a persistência e a freqüência de excreção fecal da Salmonella Enteritidis em aves aparentemente saudáveis de duas linhagens de frango de corte, criadas sem antibióticos promotores de crescimento na ração e oriundas de ovos inoculados na casca ou na cavidade alantóide com Salmonella Enteritidis fagotipo 4. Realizaram-se exames bacteriológicos das excretas com um, oito, 22 e 35 dias, e histológicos e bacteriológicos do inglúvio e ceco, com um, sete, quatorze e 21 dias pós-eclosão em frangos de crescimento rápido e lento. Salmonella

  10. Safety and immunogenicity of a malaria vaccine, Plasmodium falciparum AMA-1/MSP-1 chimeric protein formulated in montanide ISA 720 in healthy adults.

    Directory of Open Access Journals (Sweden)

    Jinhong Hu

    Full Text Available BACKGROUND: The P. falciparum chimeric protein 2.9 (PfCP-2.9 consisting of the sequences of MSP1-19 and AMA-1 (III is a malaria vaccine candidate that was found to induce inhibitory antibodies in rabbits and monkeys. This was a phase I randomized, single-blind, placebo-controlled, dose-escalation study to evaluate the safety and immunogenicity of the PfCP-2.9 formulated with a novel adjuvant Montanide ISA720. Fifty-two subjects were randomly assigned to 4 dose groups of 10 participants, each receiving the test vaccine of 20, 50, 100, or 200 microg respectively, and 1 placebo group of 12 participants receiving the adjuvant only. METHODS AND FINDINGS: The vaccine formulation was shown to be safe and well-tolerated, and none of the participants withdrew. The total incidence of local adverse events (AEs was 75%, distributed among 58% of the placebo group and 80% of those vaccinated. Among the vaccinated, 65% had events that were mild and 15% experienced moderate AEs. Almost all systemic adverse reactions observed in this study were graded as mild and required no therapy. The participants receiving the test vaccine developed detectable antibody responses which were boosted by the repeated vaccinations. Sixty percent of the vaccinated participants had high ELISA titers (>1:10,000 of antigen-specific antibodies which could also recognize native parasite proteins in an immunofluorescence assay (IFA. CONCLUSION: This study is the first clinical trial for this candidate and builds on previous investigations supporting PfCP-2.9/ISA720 as a promising blood-stage malaria vaccine. Results demonstrate safety, tolerability (particularly at the lower doses tested and immunogenicity of the formulation. Further clinical development is ongoing to explore optimizing the dose and schedule of the formulation to decrease reactogenicity without compromising immunogenicity. TRIAL REGISTRATION: Chinese State Food and Drug Administration (SFDA 2002SL0046; Controlled

  11. Vaccination with NY-ESO-1 overlapping peptides mixed with Picibanil OK-432 and montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

    Science.gov (United States)

    Wada, Hisashi; Isobe, Midori; Kakimi, Kazuhiro; Mizote, Yu; Eikawa, Shingo; Sato, Eiichi; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Yamasaki, Makoto; Miyata, Hiroshi; Matsushita, Hirokazu; Udono, Heiichiro; Seto, Yasuyuki; Yamada, Kazuhiro; Nishikawa, Hiroyoshi; Pan, Linda; Venhaus, Ralph; Oka, Mikio; Doki, Yuichiro; Nakayama, Eiichi

    2014-01-01

    We conducted a clinical trial of an NY-ESO-1 cancer vaccine using 4 synthetic overlapping long peptides (OLP; peptides #1, 79-108; #2, 100-129; #3, 121-150; and #4, 142-173) that include a highly immunogenic region of the NY-ESO-1 molecule. Nine patients were immunized with 0.25 mg each of three 30-mer and a 32-mer long NY-ESO-1 OLP mixed with 0.2 KE Picibanil OK-432 and 1.25 mL Montanide ISA-51. The primary endpoints of this study were safety and NY-ESO-1 immune responses. Five to 18 injections of the NY-ESO-1 OLP vaccine were well tolerated. Vaccine-related adverse events observed were fever and injection site reaction (grade 1 and 2). Two patients showed stable disease after vaccination. An NY-ESO-1-specific humoral immune response was observed in all patients and an antibody against peptide #3 (121-150) was detected firstly and strongly after vaccination. NY-ESO-1 CD4 and CD8 T-cell responses were elicited in these patients and their epitopes were identified. Using a multifunctional cytokine assay, the number of single or double cytokine-producing cells was increased in NY-ESO-1-specific CD4 and CD8 T cells after vaccination. Multiple cytokine-producing cells were observed in PD-1 (-) and PD-1 (+) CD4 T cells. In conclusion, our study indicated that the NY-ESO-1 OLP vaccine mixed with Picibanil OK-432 and Montanide ISA-51 was well tolerated and elicited NY-ESO-1-specific humoral and CD4 and CD8 T-cell responses in immunized patients.

  12. Transportation considerations related to waste forms and canisters for Defense TRU wastes

    International Nuclear Information System (INIS)

    Schneider, K.J.; Andrews, W.B.; Schreiber, A.M.; Rosenthal, L.J.; Odle, C.J.

    1981-09-01

    This report identifies and discusses the considerations imposed by transportation on waste forms and canisters for contact-handled, solid transuranic wastes from the US Department of Energy (DOE) activities. The report reviews (1) the existing raw waste forms and potential immobilized waste forms, (2) the existing and potential future DOE waste canisters and shipping containers, (3) regulations and regulatory trends for transporting commercial transuranic wastes on the ISA, (4) truck and rail carrier requirements and preferences for transporting the wastes, and (5) current and proposed Type B external packagings for transporting wastes

  13. Determination of the Morphology of the Starch Granules and the Optimum Internal Cooking Temperature of Four Andean Crops: Oca (Oxalis tuberosa Molina, Olluco (Ullucus tuberosus Loz, Isaño (Tropaeolum tuberosum Ruiz

    Directory of Open Access Journals (Sweden)

    Bellido-Valencia Omar

    2017-12-01

    Full Text Available Andean grains (i.e. quinoa, amaranth have been increasingly studied in recent times, mainly due to the increase in international consumption. However, Andean tubers other than potatoes have not been so widespread and are mainly studied for their starch, previously extracted. This work studied the morphology of native starch in four of these crops (oca, olluco, isaño and aracacha, during cooking and the evolution of their internal temperature in relation to sensory acceptability. Using scanning electron microscopy, it was determined that the size of crude starch granules was between 9 μm to 38.2 μm for oca, 4.48 to 24.9 μm for olluco, 4.45 to 22.9 μm for isaño, and 5.36 to 23.8 μm for arracacha. Sensorially, it was determined that the optimum cooking temperature for arracacha was 89.1°C, 90.9°C for oca, 91°C for isaño, and 91.4 °C for olluco. All samples had optimal cooking times shorter than potato, with the isaño having the best heat transfer.

  14. The links between implementing ISA 540 and mitigating the practice of smoothing reported net earnings using write-offs of accounts receivable and inventory by reporting entities in Poland

    Directory of Open Access Journals (Sweden)

    Andrzej Krystian Piosik

    2016-06-01

    Full Text Available The paper addresses the question of the links between implementing ISA 540 and mitigating the practice of smoothing reported net earnings using write-offs of accounts receivable and inventory by reporting entities in Poland. The research question stems from the previous analysis carried out by the author in which evidence was provided that reporting entities in Poland in the period 2000–2010 effectively used write-offs of accounts receivable and inventory in order to mitigate fluctuations of reported net earnings. This paper provides evidence that before implementing ISA 540 reporting entities used write-offs of receivables and inventory for income smoothing in effective manner, however in the period after implementing the standard (2009–2014 no link was observed between the write-offs and reduced fluctuations of reported net earnings. The research has been carried out using Wilcoxon signed-rank test used to check equality of medians of mean deviations of net earnings before write-offs of receivables and inventory and mean deviations of net earnings after write-offs. For the period before implementing ISA 540 there are grounds to reject the hypothesis of equality of medians of mean deviations of net earnings, however in the post-adoption period there is no justification to reject the hypothesis of equality of medians. The research provides evidence of positive impact of ISA 540 mitigating the processes of accounting earnings management. The indicated regularity does not apply to banks, because within this group of companies we have not observed the use of write-offs of loan receivables in order to reduce the variability of net earnings before implementing ISA 540 and in the period following the implementation of the standard.

  15. The effects of concentrate added to pineapple (Ananas comosus Linn. Mer.) waste silage in differing ratios to form complete diets, on digestion, excretion of urinary purine derivatives and blood metabolites in growing, male, Thai swamp buffaloes.

    Science.gov (United States)

    Jetana, T; Suthikrai, W; Usawang, S; Vongpipatana, C; Sophon, S; Liang, J B

    2009-04-01

    Four, male, growing Thai swamp buffaloes (197 +/- 5.3 kg and all 1 year old) were used to evaluate the effects of concentrate added to pineapple waste silage in differing ratios, to form a complete diet, studying in vivo digestion, the rate of passage, microbial protein synthesis and blood metabolites. Animals were fed ad libitum with 4 diets, using four combinations of pineapple waste silage (P) and concentrate (C), in the proportions (on a dry matter basis) of 0.8:0.2 (P80:C20), 0.6:0.4 (P60:C40), 0.4:0.6 (P40:C60) and 0.2:0.8 (P20:C80). The results showed that the intakes of dry matter (DM), organic matter (OM), nitrogen (N), the N-balance, urinary purine derivatives (PD) excretion, the ratios of allantoin to creatinine (CR), PD to CR, the plasma urea-N (PUN) and insulin increased in the animals, but the intake of neutral detergent fiber (NDF), the coefficient of whole tract, apparent digestibility of NDF, the transit time (TT) and the mean retention time (TMRT) decreased, when the proportion of concentrate in the diet increased. This study indicated that the proportion of P40:C60 in the diet produced the best efficiency of urinary PD excretion (mmol) per digestible OM intake (kg DOMI).

  16. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  17. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  18. Effect of genotype and transport on tonic immobility and heterophil/lymphocyte ratio in two local Italian breeds and Isa Brown hens kept under free-range conditions

    Directory of Open Access Journals (Sweden)

    Michele De Marco

    2013-10-01

    Full Text Available This study was undertaken to investigate the effect of transport and genotype on the welfare and fear response of laying hens through a comparison of three breeds reared in free-range conditions: a commercial strain, the Isa Brown (IBh, and two local chicken breeds, the Bionda Piemontese (BPh and the Bianca di Saluzzo (BSh. After a journey of 67 km (75 min from the farmhouse of origin to the experimental station, ninety hens, divided according to breed, were free-range reared for two months. Body weight (BW, tonic immobility (TI, red and white blood cells, heterophil to lymphocyte (H/L ratio and α1-acid glycoprotein (AGP were assessed at four different sampling times: at the farmhouse of origin (T1, at 1 day (T2, 15 days (T3 and at 2 months (T4 after arrival at the experimental station. No statistical differences were found between the four sampling times for BW, total red and white blood parameters. cells or for AGP. An increase in the H/L ratio (P<0.05 was recorded at time T2 for IBh and BSh, compared to BPh (P<0.05. TI was significantly higher (P<0.05 for the local breeds, BPh and BSh, than for the commercial strain IBh. The results of this study suggest that genetic and adaptive differences can affect both, physiological and ethological parameters.

  19. Utilisation of ISA Reverse Genetics and Large-Scale Random Codon Re-Encoding to Produce Attenuated Strains of Tick-Borne Encephalitis Virus within Days.

    Science.gov (United States)

    de Fabritus, Lauriane; Nougairède, Antoine; Aubry, Fabien; Gould, Ernest A; de Lamballerie, Xavier

    2016-01-01

    Large-scale codon re-encoding is a new method of attenuating RNA viruses. However, the use of infectious clones to generate attenuated viruses has inherent technical problems. We previously developed a bacterium-free reverse genetics protocol, designated ISA, and now combined it with large-scale random codon-re-encoding method to produce attenuated tick-borne encephalitis virus (TBEV), a pathogenic flavivirus which causes febrile illness and encephalitis in humans. We produced wild-type (WT) and two re-encoded TBEVs, containing 273 or 273+284 synonymous mutations in the NS5 and NS5+NS3 coding regions respectively. Both re-encoded viruses were attenuated when compared with WT virus using a laboratory mouse model and the relative level of attenuation increased with the degree of re-encoding. Moreover, all infected animals produced neutralizing antibodies. This novel, rapid and efficient approach to engineering attenuated viruses could potentially expedite the development of safe and effective new-generation live attenuated vaccines.

  20. Arquitectura flexible basada en ISA 88 para el diseño del diagrama de control de ejecución en aplicaciones distribuidas usando IEC 61499

    Directory of Open Access Journals (Sweden)

    Fabricio Chicaiza

    2018-03-01

    Full Text Available En la actualidad los sistemas de automatización industrial deben optimizar las técnicas de control y comunicación de sus procesos, para introducir conceptos dados por la Industria 4.0. Para lograr esto se necesita de la introducción de nuevas normas de automatización para obtener sistemas de fabricación ágiles e inteligentes, es por esto que la norma IEC 61499 es considerada como la opción principal. Industria 4.0 en unión con IEC 61499 permitirá la integración de sistemas de adquisición de datos tradicionales y novedosos sistemas de procesamiento inteligente de datos, con el objetivo de extraer información y mejorar el rendimiento general del sistema productivo. El presente trabajo establece un enfoque de arquitectura flexible para el diseño de los Diagramas de Control de Ejecución de los Bloques de Función basado en la norma ISA 88 aplicado a un proceso industrial, lo que permitirá implementar el control industrial bajo IEC 61499 de manera eficiente y rápida permitiendo un diseño se software basado en componentes con independencia de la plataforma hardware usada.

  1. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  2. Safety and immunogenicity of a recombinant Plasmodium falciparum AMA1 malaria vaccine adjuvanted with Alhydrogel, Montanide ISA 720 or AS02.

    Directory of Open Access Journals (Sweden)

    Meta Roestenberg

    Full Text Available Plasmodium falciparum Apical Membrane Antigen 1 (PfAMA1 is a candidate vaccine antigen expressed by merozoites and sporozoites. It plays a key role in red blood cell and hepatocyte invasion that can be blocked by antibodies.We assessed the safety and immunogenicity of recombinant PfAMA1 in a dose-escalating, phase Ia trial. PfAMA1 FVO strain, produced in Pichia pastoris, was reconstituted at 10 microg and 50 microg doses with three different adjuvants, Alhydrogel, Montanide ISA720 and AS02 Adjuvant System. Six randomised groups of healthy male volunteers, 8-10 volunteers each, were scheduled to receive three immunisations at 4-week intervals. Safety and immunogenicity data were collected over one year. Transient pain was the predominant injection site reaction (80-100%. Induration occurred in the Montanide 50 microg group, resulting in a sterile abscess in two volunteers. Systemic adverse events occurred mainly in the AS02 groups lasting for 1-2 days. Erythema was observed in 22% of Montanide and 59% of AS02 group volunteers. After the second dose, six volunteers in the AS02 group and one in the Montanide group who reported grade 3 erythema (>50 mm were withdrawn as they met the stopping criteria. All adverse events resolved. There were no vaccine-related serious adverse events. Humoral responses were highest in the AS02 groups. Antibodies showed activity in an in vitro growth inhibition assay up to 80%. Upon stimulation with the vaccine, peripheral mononuclear cells from all groups proliferated and secreted IFNgamma and IL-5 cytokines.All formulations showed distinct reactogenicity profiles. All formulations with PfAMA1 were immunogenic and induced functional antibodies.(Clinicaltrials.gov NCT00730782.

  3. Financial Derivatives

    OpenAIRE

    Janečková, Alena

    2011-01-01

    1 Abstract/ Financial derivatives The purpose of this thesis is to provide an introduction to financial derivatives which has been, from the legal perspective, described in a not satisfactory manner as quite little literature that can be found about this topic. The main objectives of this thesis are to define the term "financial derivatives" and its particular types and to analyse legal nature of these financial instruments. The last objective is to try to draft future law regulation of finan...

  4. 13C and 15N CP/MAS, 1H-15N SCT CP/MAS and FTIR spectroscopy as tools for qualitative detection of the presence of zwitterionic and non-ionic forms of ansa-macrolide 3-formylrifamycin SV and its derivatives in solid state.

    Science.gov (United States)

    Przybylski, Piotr; Pyta, Krystian; Klich, Katarzyna; Schilf, Wojciech; Kamieński, Bohdan

    2014-01-01

    (13)C, (15)N CP/MAS, including (1)H-(13)C and (1)H-(15)N short contact time CP/MAS experiments, and FTIR methods were applied for detailed structural characterization of ansa-macrolides as 3-formylrifamycin SV (1) and its derivatives (2-6) in crystal and in powder forms. Although HPLC chromatograms for 2/CH3 OH and 2/CH3 CCl3 were the same for rifampicin crystals dissolved in respective solvents, the UV-vis data recorded for them were different in 300-375 nm region. Detailed solid state (13)C and (15)N CP/MAS NMR and FTIR studies revealed that rifampicin (2), in contrast to 3-formylrifamycin SV (1) and its amino derivatives (3-6), can occur in pure non-ionic or zwitterionic forms in crystal and in pure these forms or a mixture of them in a powder. Multinuclear CP/MAS and FTIR studies demonstrated also that 3-6 derivatives were present exclusively in pure zwitterionic forms, both in powder and in crystal. On the basis of the solid state NMR and FTIR studies, two conformers of 3-formylrifamycin SV were detected in powder form due to the different orientations of carbonyl group of amide moiety. The PM6 molecular modeling at the semi-empirical level of theory, allowed visualization the most energetically favorable non-ionic and zwitterionic forms of 1-6 antibiotics, strongly stabilized via intramolecular H-bonds. FTIR studies indicated that the originally adopted forms of these type antibiotics in crystal or in powder are stable in standard laboratory conditions in time. The results presented point to the fact that because of a possible presence of two forms of rifampicin (compound 2), quantification of the content of this antibiotic in relevant pharmaceuticals needs caution. Copyright © 2013 John Wiley & Sons, Ltd.

  5. The Iran Sanctions Act (ISA)

    National Research Council Canada - National Science Library

    Katzman, Kenneth

    2009-01-01

    International pressure on Iran to curb its nuclear program is increasing the hesitation of many major foreign firms to invest in Iran's energy sector, hindering Iran's efforts to expand oil production beyond...

  6. ISA/92 Canada general program

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This volume contains the proceedings of a portion of the Instrument Society of America's 1992 General Meeting. Topics covered include: diesel fuels, wastewater treatment, the environment, advancements in measurement and control, improved control systems and construction and design

  7. Two Forms of Philosophical Argument or Critique

    Science.gov (United States)

    Marshall, James D.

    2004-01-01

    In this paper the author looks at two forms of philosophical argument or critique. These are derived by himself from the work of the late Kantian scholar, Stephan Korner who, in his book "What is Philosophy?" (1969), draws a number of distinctions between different forms of "philosophical" argument or critique. The two forms of derived argument,…

  8. Manganese concentrations in drinking water from villages near banana plantations with aerial mancozeb spraying in Costa Rica: Results from the Infants' Environmental Health Study (ISA).

    Science.gov (United States)

    van Wendel de Joode, Berna; Barbeau, Benoit; Bouchard, Maryse F; Mora, Ana María; Skytt, Åsa; Córdoba, Leonel; Quesada, Rosario; Lundh, Thomas; Lindh, Christian H; Mergler, Donna

    2016-08-01

    Elevated manganese (Mn) in drinking water has been reported worldwide. While, naturally occurring Mn in groundwater is generally the major source, anthropogenic contamination by Mn-containing fungicides such as mancozeb may also occur. The main objective of this study was to examine factors associated with Mn and ethylenethiourea (ETU), a degradation product of mancozeb, in drinking water samples from villages situated near banana plantations with aerial spraying of mancozeb. Drinking water samples (n = 126) were obtained from 124 homes of women participating in the Infants' Environmental Health Study (ISA, for its acronym in Spanish), living nearby large-scale banana plantations. Concentrations of Mn, iron (Fe), arsenic (As), lead (Pb), cadmium (Cd) and ethylenethiourea (ETU), a degradation product of mancozeb, were measured in water samples. Only six percent of samples had detectable ETU concentrations (limit of detection (LOD) = 0.15 μg/L), whereas 94% of the samples had detectable Mn (LOD = 0.05 μg/L). Mn concentrations were higher than 100 and 500 μg/L in 22% and 7% of the samples, respectively. Mn was highest in samples from private and banana farm wells. Distance from a banana plantation was inversely associated with Mn concentrations, with a 61.5% decrease (95% CI: -97.0, -26.0) in Mn concentrations for each km increase in distance. Mn concentrations in water transported with trucks from one village to another were almost 1000 times higher than Mn in water obtained from taps in houses supplied by the same well but not transported, indicating environmental Mn contamination. Elevated Mn in drinking water may be partly explained by aerial spraying of mancozeb; however, naturally occurring Mn in groundwater, and intensive agriculture may also contribute. Drinking water risk assessment for mancozeb should consider Mn as a health hazard. The findings of this study evidence the need for health-based World Health Organization (WHO) guidelines on Mn in

  9. Polyphony and verb forms

    Directory of Open Access Journals (Sweden)

    Jelena Rajić

    2012-12-01

    Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.

  10. Derivative chameleons

    International Nuclear Information System (INIS)

    Noller, Johannes

    2012-01-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂ μ φ∂ μ φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂ μ φ∂ μ φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type

  11. Derivative chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Noller, Johannes, E-mail: johannes.noller08@imperial.ac.uk [Theoretical Physics, Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2BZ (United Kingdom)

    2012-07-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂{sub μ}φ∂{sup μ}φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂{sub μ}φ∂{sup μ}φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type.

  12. Electricity derivatives

    CERN Document Server

    Aïd, René

    2015-01-01

    Offering a concise but complete survey of the common features of the microstructure of electricity markets, this book describes the state of the art in the different proposed electricity price models for pricing derivatives and in the numerical methods used to price and hedge the most prominent derivatives in electricity markets, namely power plants and swings. The mathematical content of the book has intentionally been made light in order to concentrate on the main subject matter, avoiding fastidious computations. Wherever possible, the models are illustrated by diagrams. The book should allow prospective researchers in the field of electricity derivatives to focus on the actual difficulties associated with the subject. It should also offer a brief but exhaustive overview of the latest techniques used by financial engineers in energy utilities and energy trading desks.

  13. The development of the architectural form of a tower derived from a traditional and philosophical symbol, realized by solutions of high-class technologies. The case of the Bitexco Financial Tower

    Science.gov (United States)

    Van Khai, Tran

    2018-03-01

    The Bitexco Financial Tower, majestically standing tall in the heart of Ho Chi Minh City, Vietnam, rejects the box-shaped, abstract forms of modernism, incorporating an innovative idea of contemporary architecture. Based on the inspiration from the Bitexco Group, a renowned architect designedthe tower that became an iconic landmark of the city in the form of a lotus bud, one of the most iconic symbols of Vietnamese culture since ancient times. High class structural system solution designed by top international professional teams enable the building to rise high with its graceful, statuesque design of the lotus flower shape. CNNGo recently ranked the Bitexco Financial Tower fifth in their listing of the world's 20 most-iconic skyscrapers.

  14. Comparative study of the interaction of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP) in its free base and Fe derivative form with oligo(dA.dT)15 and oligo(dG.dC)15.

    Science.gov (United States)

    Bathaie, S Zahra; Ajloo, Davood; Daraie, Marzieh; Ghadamgahi, Maryam

    2015-01-01

    Interaction between a cationic porphyrin and its ferric derivative with oligo(dA.dT)15 and oligo(dG.dC)15 was studied by UV-vis spectroscopy, resonance light scattering (RLS), and circular dichroism (CD) at different ionic strengths; molecular docking and molecular dynamics simulation were also used for completion. Followings are the observed changes in the spectral properties of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP), as a free-base porphyrin with no axial ligand, and its Fe derivative (FeTMAP) upon interaction with oligo(dA.dT)15 and oligo(dG.dC)15: (1) the substantial red shift and hypochromicity at the Soret maximum in the UV-vis spectra; (2) the increased RLS intensity by increasing the ionic strength; and (3) an intense bisignate excitonic CD signal. All of them are the reasons for TMAP and FeTMAP binding to oligo(dA.dT)15 and oligo(dG.dC)15 with the outside binding mode, accompanied by the self-stacking of the ligands along the oligonucleotide helix. The CD results demonstrated a drastic change from excitonic in monomeric behavior at higher ionic strengths, which indicates the groove binding of the ligands with oligonucleotides. Molecular docking also confirmed the groove binding mode of the ligands and estimated the binding constants and energies of the interactions. Their interaction trend was further confirmed by molecular dynamics technique and structure parameters obtained from simulation. It showed that TMAP reduced the number of intermolecular hydrogen bonds and increased the solvent accessible surface area in the oligonucleotide. The self-aggregation of ligands at lower concentrations was also confirmed.

  15. Contributor Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2014-09-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  16. Contributors Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2016-06-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  17. Dynamic event Tress applied to sequences Full Spectrum LOCA. Calculating the frequency of exceedance of damage by integrated Safety Analysis Methodology; Arboles de sucesos dinamicos aplicados a secuencias Full Spectrum LOCA. Calculo de la frequencia de excedencia del dano mediante la metodologia Analisis Integrados de Seguridad (ISA)

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Magan, J. J.; Fernandez, I.; Gil, J.; Marrao, H.; Queral, C.; Gonzalez-Cadelo, J.; Montero-Mayorga, J.; Rivas, J.; Ibane-Llano, C.; Izquierdo, J. M.; Sanchez-Perea, M.; Melendez, E.; Hortal, J.

    2013-09-01

    The Integrated Safety Analysis (ISA) methodology, developed by the Spanish Nuclear Safety council (CSN), has been applied to obtain the dynamic Event Trees (DETs) for full spectrum Loss of Coolant Accidents (LOCAs) of a Westinghouse 3-loop PWR plant. The purpose of this ISA application is to obtain the Damage Exceedance Frequency (DEF) for the LOCA Event Tree by taking into account the uncertainties in the break area and the operator actuation time needed to cool down and de pressurize reactor coolant system by means of steam generator. Simulations are performed with SCAIS, a software tool which includes a dynamic coupling with MAAP thermal hydraulic code. The results show the capability of the ISA methodology to obtain the DEF taking into account the time uncertainty in human actions. (Author)

  18. Diffusion from cylindrical waste forms

    International Nuclear Information System (INIS)

    Thomas, G.F.

    1985-05-01

    The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

  19. Clearing and settlement of exchange traded derivatives

    OpenAIRE

    John McPartland

    2009-01-01

    Derivatives are a class of financial instruments that derive their value from some underlying commodity, security, index, or other asset. Futures and options are common forms of derivatives. This article explains how clearing and settlement systems for exchange traded derivatives work.

  20. Changes in numbers and types of mast cell colony-forming cells in the peritoneal cavity of mice after injection of distilled water: evidence that mast cells suppress differentiation of bone marrow-derived precursors

    International Nuclear Information System (INIS)

    Kanakura, Y.; Kuriu, A.; Waki, N.; Nakano, T.; Asai, H.; Yonezawa, T.; Kitamura, Y.

    1988-01-01

    Two different types of cells in the peritoneal cavity of mice produce mast cell colonies in methylcellulose. Large mast cell colonies are produced by bone marrow-derived precursors resembling lymphoid cells by light microscopy (L-CFU-Mast), whereas medium and small mast cell colonies are produced by morphologically identifiable mast cells (M-CFU-Mast and S-CFU-Mast, respectively). In the present study we eradicated peritoneal mast cells by intraperitoneal (IP) injection of distilled water. The regeneration process was investigated to clarify the relationship between L-CFU-Mast, M-CFU-Mast, and S-CFU-Mast. After injection of distilled water, M-CFU-Mast and S-CFU-Mast disappeared, but L-CFU-Mast increased, and then M-CFU-Mast and S-CFU-Mast appeared, suggesting the presence of a hierarchic relationship. When purified peritoneal mast cells were injected two days after the water injection, the L-CFU-Mast did not increase. In the peritoneal cavity of WBB6F1-+/+ mice that had been lethally irradiated and rescued by bone marrow cells of C57BL/6-bgJ/bgJ (beige, Chediak-Higashi syndrome) mice, L-CFU-Mast were of bgJ/bgJ type, but M-CFU-Mast and S-CFU-Mast were of +/+ type. The injection of distilled water to the radiation chimeras resulted in the development of bgJ/bgJ-type M-CFU-Mast and then S-CFU-Mast. The presence of mast cells appeared to suppress the recruitment of L-CFU-Mast from the bloodstream and to inhibit the differentiation of L-CFU-Mast to M-CFU-Mast

  1. Small cell lymphocytic variant of marginal zone lymphoma: A distinct form of marginal zone lymphoma derived from naïve B cells as a cutaneous counterpart to the naïve marginal zone lymphoma of splenic origin.

    Science.gov (United States)

    Magro, Cynthia M; Olson, Luke C

    2018-02-21

    Primary cutaneous marginal zone lymphoma most commonly represents an indolent form of cutaneous B cell lymphoma. However, epidermotropic marginal zone lymphoma, blastic marginal zone lymphoma and B cell dominant variants without isotype switching can be associated with extracutaneous dissemination. The presumptive cell of origin is a post germinal center B cell with plasmacytic features. In the extracutaneous setting, however, a naïve B cell origin has been proposed for a subset of marginal zone lymphomas, notably splenic marginal zone lymphoma. The author encountered 11 cases of atypical lymphocytic infiltration of the skin primarily occurring in older individuals with an upper arm and head and neck localization; there was a reproducible pattern of diffuse and nodular infiltration by small monomorphic-appearing B cells. Phenotypically, the infiltrate was one predominated by B cells exhibiting CD23 and IgD positivity without immunoreactivity for CD38 and there were either no plasma cells or only a few without light chain restriction. In cases presenting with a solitary lesion complete excision and/or radiation led to successful disease remission in all cases without recurrence or metastatic disease. Of three cases with multiple initial lesions, evidence of extracutaneous disease was seen in two cases and recurrence occurred in one case. No patients have died of lymphoma. Longer term follows up and additional cases are needed to determine if this subset of marginal zone lymphoma is associated with a worse prognosis. Copyright © 2018. Published by Elsevier Inc.

  2. A general method for the derivation of the functional forms of the effective energy terms in coarse-grained energy functions of polymers. II. Backbone-local potentials of coarse-grained O 1 →4 -bonded polyglucose chains

    Science.gov (United States)

    Lubecka, Emilia A.; Liwo, Adam

    2017-09-01

    Based on the theory of the construction of coarse-grained force fields for polymer chains described in our recent work [A. K. Sieradzan et al., J. Chem. Phys. 146, 124106 (2017)], in this work effective coarse-grained potentials, to be used in the SUGRES-1P model of polysaccharides that is being developed in our laboratory, have been determined for the O ⋯O ⋯O virtual-bond angles (θ ) and for the dihedral angles for rotation about the O ⋯O virtual bonds (γ ) of 1 → 4 -linked glucosyl polysaccharides, for all possible combinations of [α ,β ]-[d,l]-glucose. The potentials of mean force corresponding to the virtual-bond angles and the virtual-bond dihedral angles were calculated from the free-energy surfaces of [α ,β ]-[d,l]-glucose pairs, determined by umbrella-sampling molecular-dynamics simulations with the AMBER12 force field, or combinations of the surfaces of two pairs sharing the overlapping residue, respectively, by integrating the respective Boltzmann factor over the dihedral angles λ for the rotation of the sugar units about the O ⋯O virtual bonds. Analytical expressions were subsequently fitted to the potentials of mean force. The virtual-bond-torsional potentials depend on both virtual-bond-dihedral angles and virtual-bond angles. The virtual-bond-angle potentials contain a single minimum at about θ =14 0° for all pairs except β -d-[α ,β ] -l-glucose, where the global minimum is shifted to θ =150° and a secondary minimum appears at θ =90°. The torsional potentials favor small negative γ angles for the α -d-glucose and extended negative angles γ for the β -d-glucose chains, as observed in the experimental structures of starch and cellulose, respectively. It was also demonstrated that the approximate expression derived based on Kubo's cluster-cumulant theory, whose coefficients depend on the identity of the disugar units comprising a trisugar unit that defines a torsional potential, fits simultaneously all

  3. Densified waste form and method for forming

    Science.gov (United States)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    2015-08-25

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  4. Development trends of the international derivatives market

    OpenAIRE

    Motorniuk, U.; Terebukh, M.; Kharchuk, V.

    2016-01-01

    The factors forming international derivatives market trends are researched in this article. The history of the formation of the global derivatives market was analyzed, in particular, events which have led to the growth of the derivatives market. Global derivatives market has revealed major changes in its trends and witnessed the gradual transformation of its structure, observed in recent years. Global derivatives market has revealed major changes in its trends and witnessed the gradual transf...

  5. Characterization of chars form biomass-derived materials: pectin chars

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, R.K.; Wooten, J.B.; Baliga, V.L.; Hajaligol, M.R. [Philip Morris USA, Richmond, VA (United States). Research Center

    2001-10-09

    The effect of pyrolysis conditions on the yield and composition of char from pectin was studied. The volatile product was analyzed by gas chromatography/mass spectrometry (GC/MS). The solid product, i.e. char, was characterised by solid-state {sup 13}C nuclear magnetic resonance (NMR) and Fourier-transform infrared (FTIR) spectrsocopy. The char was also analysed for its elemental composition and surface area. The surface morphology of the char was studied by scanning electron microscopy (SEM). The results were compared to those from chlorogenic acid (CA). For both pectin and CA, the char yield decreased with increasing temperature before levelling-off at ca.20% of the starting substrate in non-oxidative runs. In oxidative runs, the char yields from both substrates became negligible at 550{degree}C. NMR analysis indicated that the aromatic character of char increased as the pyrolysis temperature increased. The oxygen functionality was progressively lost and the resonance bands corresponding to carbonyl groups mostly disappeared above 350{degree}C. FTIR analysis also suggested the loss of hydroxyl and carbonyl groups from chars at high temperatures. The H/C and O/C ratios of chars decreased continuously with increasing temperature. The oxidative chars showed characteristics essentially similar to those of the non-oxidative chars. The surface area of char was negligible at low temperatures, but increased dramatically to a maximum of 70 m{sup 2}g{sup -1} at 450{degree}C before decreasing at 500{degree}C. SEM analysis indicated that the pyrolysis of pectin occurred via softening and melting of the substrate followed by bubble formation. At high temperatures, surface etching followed by the appearance of crystal

  6. Finite-time stabilization of uncertain nonholonomic systems in feedforward-like form by output feedback.

    Science.gov (United States)

    Gao, Fangzheng; Wu, Yuqiang; Zhang, Zhongcai

    2015-11-01

    This paper investigates the problem of finite-time stabilization by output feedback for a class of nonholonomic systems in chained form with uncertainties. Comparing with the existing relevant literature, a distinguishing feature of the systems under investigation is that the x-subsystem is a feedforward-like rather than feedback-like system. This renders the existing control methods inapplicable to the control problems of the systems. A constructive design procedure for output feedback control is given. The designed controller renders that the states of closed-loop system are regulated to zero in a finite time. Two simulation examples are provided to illustrate the effectiveness of the proposed approach. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  7. [Domestic violence against women of a crisis intervention population - forms of violence and risk factors].

    Science.gov (United States)

    Nyberg, E; Stieglitz, R-D; Flury, M; Riecher-Rössler, A

    2013-06-01

    BACKGROUND AND HYPOTHESES: Domestic violence is common and can lead to severe physical and psychological problems. Thus, we have investigated the frequency of occurrence, forms and risk factors of domestic violence against female patients on a crisis intervention ward. 115 women were screened with the "screening spouse violence" (SPG) and the "index of spouse abuse" (ISA). The life time prevalence concerning spouse violence was 70 %. Out of 74 women who were currently living in a relationship 28 (38 % )were victims of violence in the last 12 months prior to their admission. Women who experienced violence had a significantly lower level of education. Screening for domestic violence in female patients in the field of crisis intervention and psychiatry should become a standard of "good clinical practice". © Georg Thieme Verlag KG Stuttgart · New York.

  8. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  9. The integral form of supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, L. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy); Catenacci, R. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); Gruppo Nazionale di Fisica Matematica, INdAM,P.le Aldo Moro 5, 00185 Roma (Italy); Grassi, P.A. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy)

    2016-10-11

    By using integral forms we derive the superspace action of D=3,N=1 supergravity as an integral on a supermanifold. The construction is based on target space picture changing operators, here playing the rôle of Poincaré duals to the lower-dimensional spacetime surfaces embedded into the supermanifold. We show how the group geometrical action based on the group manifold approach interpolates between the superspace and the component supergravity actions, thus providing another proof of their equivalence.

  10. Carnitine derivatives: clinical usefulness.

    Science.gov (United States)

    Malaguarnera, Mariano

    2012-03-01

    Carnitine and its derivatives are natural substances involved in both carbohydrate and lipid metabolism. This review summarizes the recent progress in the field in relation to the molecular mechanisms. The pool of different carnitine derivatives is formed by acetyl-L-carnitine (ALC), propionyl-L-carnitine (PLC), and isovaleryl-carnitine. ALC may have a preferential effect on the brain tissue. ALC represents a compound of great interest for its wide clinical application in various neurological disorders: it may be of benefit in treating Alzheimer's dementia, depression in the elderly, HIV infection, chronic fatigue syndrome, peripheral neuropathies, ischemia and reperfusion of the brain, and cognitive impairment associated with various conditions. PLC has been demonstrated to replenish the intermediates of the tricarboxylic acid cycle by the propionyl-CoA moiety, a greater affinity for the sarcolemmal carrier, peripheral vasodilator activity, a greater positive inotropism, and more rapid entry into myocytes. Most studies of the therapeutic use of PLC are focused on the prevention and treatment of ischemic heart disease, congestive heart failure, hypertrophic heart disease, and peripheral arterial disease. ALC and PLC are considered well tolerated without significant side-effects. A number of therapeutic effects possibly come from the interaction of carnitine and its derivatives with the elements of cellular membranes.

  11. On good ETOL forms

    DEFF Research Database (Denmark)

    Skyum, Sven

    1978-01-01

    This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....

  12. Noncommutative differential forms on the kappa-deformed space

    International Nuclear Information System (INIS)

    Meljanac, Stjepan; Kresic-Juric, Sasa

    2009-01-01

    We construct a differential algebra of forms on the kappa-deformed space. For a given realization of noncommutative coordinates as formal power series in the Weyl algebra we find an infinite family of one-forms and nilpotent exterior derivatives. We derive explicit expressions for the exterior derivative and one-forms in covariant and noncovariant realizations. We also introduce higher order forms and show that the exterior derivative satisfies the graded Leibniz rule. The differential forms are generally not graded commutative, but they satisfy the graded Jacobi identity. We also consider the star-product of classical differential forms. The star-product is well defined if the commutator between the noncommutative coordinates and one-forms is closed in the space of one-forms alone. In addition, we show that in certain realizations the exterior derivative acting on the star-product satisfies the undeformed Leibniz rule.

  13. Second derivative spectrophotometric determination of ...

    African Journals Online (AJOL)

    A new, simple, rapid, wide applicable range and reliable second derivative spectrophotometric method has been developed for determination of cyclophosphamide (CP) in bulk and pharmaceutical dosage forms. Calibration graph is linear in the concentration range of 25 - 200 μg/ml of CP with 10 μg/ml of detection limit and ...

  14. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  15. Original and Derived Judgment

    DEFF Research Database (Denmark)

    Foss, Kirsten; Foss, Nicolai Juul; Klein, Peter G.

    2007-01-01

    Recent work links entrepreneurship to the economic theory of the firm, using the concept of entrepreneurship as judgment introduced by Frank Knight. When judgment is complementary to other assets, it makes sense for entrepreneurs to hire labour and to own assets. The entrepreneur's role, then...... to subordinates, who exercise derived judgment. We call these employees `proxy-entrepreneurs', and ask how the firm's organizational structure - its formal and informal systems of rewards and punishments, rules for settling disputes and renegotiating agreements, means of evaluating performance and so on - can...... be designed to encourage forms of proxy entrepreneurship that increase firm value while discouraging actions that destroy value. Building on key ideas from the entrepreneurship literature, Austrian economics and the economic theory of the firm, we develop a framework for analysing the trade-off between...

  16. Adaptive municipal electronic forms

    NARCIS (Netherlands)

    Kuiper, Pieternel; van Dijk, Elisabeth M.A.G.; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Guiderdoni-Jourdain, Karine; Oiry, Ewan

    Adaptation of electronic forms (e-forms) seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer e-forms online that can be used by citizens to request a municipal product or service or by municipal employees to place a request on behalf of a

  17. A phase I study of vaccination with NY-ESO-1f peptide mixed with Picibanil OK-432 and Montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

    Science.gov (United States)

    Kakimi, Kazuhiro; Isobe, Midori; Uenaka, Akiko; Wada, Hisashi; Sato, Eiichi; Doki, Yuichiro; Nakajima, Jun; Seto, Yasuyuki; Yamatsuji, Tomoki; Naomoto, Yoshio; Shiraishi, Kenshiro; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Oka, Mikio; Pan, Linda; Hoffman, Eric W; Old, Lloyd J; Nakayama, Eiichi

    2011-12-15

    We conducted a phase I clinical trial of a cancer vaccine using a 20-mer NY-ESO-1f peptide (NY-ESO-1 91-110) that includes multiple epitopes recognized by antibodies, and CD4 and CD8 T cells. Ten patients were immunized with 600 μg of NY-ESO-1f peptide mixed with 0.2 KE Picibanil OK-432 and 1.25 ml Montanide ISA-51. Primary end points of the study were safety and immune response. Subcutaneous injection of the NY-ESO-1f peptide vaccine was well tolerated. Vaccine-related adverse events observed were fever (Grade 1), injection-site reaction (Grade 1 or 2) and induration (Grade 2). Vaccination with the NY-ESO-1f peptide resulted in an increase or induction of NY-ESO-1 antibody responses in nine of ten patients. The sera reacted with recombinant NY-ESO-1 whole protein as well as the NY-ESO-1f peptide. An increase in CD4 and CD8 T cell responses was observed in nine of ten patients. Vaccine-induced CD4 and CD8 T cells responded to NY-ESO-1 91-108 in all patients with various HLA types with a less frequent response to neighboring peptides. The findings indicate that the 20-mer NY-ESO-1f peptide includes multiple epitopes recognized by CD4 and CD8 T cells with distinct specificity. Of ten patients, two with lung cancer and one with esophageal cancer showed stable disease. Our study shows that the NY-ESO-1f peptide vaccine was well tolerated and elicited humoral, CD4 and CD8 T cell responses in immunized patients. Copyright © 2011 UICC.

  18. Interest rate derivatives

    DEFF Research Database (Denmark)

    Svenstrup, Mikkel

    This Ph.D. thesis consists of four self-contained essays on valuation of interest rate derivatives. In particular derivatives related to management of interest rate risk care are considered.......This Ph.D. thesis consists of four self-contained essays on valuation of interest rate derivatives. In particular derivatives related to management of interest rate risk care are considered....

  19. Against Logical Form

    Directory of Open Access Journals (Sweden)

    P N Johnson-Laird

    2010-10-01

    Full Text Available An old view in logic going back to Aristotle is that an inference is valid in virtue of its logical form. Many psychologists have adopted the same point of view about human reasoning: the first step is to recover the logical form of an inference, and the second step is to apply rules of inference that match these forms in order to prove that the conclusion follows from the premises. The present paper argues against this idea. The logical form of an inference transcends the grammatical forms of the sentences used to express it, because logical form also depends on context. Context is not readily expressed in additional premises. And the recovery of logical form leads ineluctably to the need for infinitely many axioms to capture the logical properties of relations. An alternative theory is that reasoning depends on mental models, and this theory obviates the need to recover logical form.

  20. Forms of Arthritis

    Science.gov (United States)

    ... this page please turn Javascript on. Forms of Arthritis Past Issues / Fall 2006 Table of Contents Today, ... of Linda Saisselin Osteoarthritis (OA) — the form of arthritis typically occurring during middle or old age, this ...

  1. Forms Management Policy

    Science.gov (United States)

    To establish EPA’s Forms Management Program; to describe the requisite roles, responsibilities, and procedures necessary for the successful management of EPA forms; and to more clearly fulfill EPA’s obligations in this regard.

  2. FORMS OF YOUTH TRAVEL

    OpenAIRE

    Moisã Claudia Olimpia; Moisã Claudia Olimpia

    2011-01-01

    Taking into account the suite of motivation that youth has when practicing tourism, it can be said that the youth travel takes highly diverse forms. These forms are educational tourism, volunteer programs and “work and travel”, cultural exchanges or sports tourism and adventure travel. In this article, we identified and analyzed in detail the main forms of youth travel both internationally and in Romania. We also illustrated for each form of tourism the specific tourism products targeting you...

  3. Unified form language

    DEFF Research Database (Denmark)

    Alnæs, Martin S.; Logg, Anders; Ølgaard, Kristian Breum

    2014-01-01

    We present the Unied Form Language (UFL), which is a domain-specic language for representing weak formulations of partial dierential equations with a view to numerical approximation. Features of UFL include support for variational forms and functionals, automatic dierentiation of forms and expres...... libraries to generate concrete low-level implementations. Some application examples are presented and libraries that support UFL are highlighted....

  4. Method for forming ammonia

    Science.gov (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.

    2008-08-19

    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  5. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  6. Sol-gel derived sorbents

    Science.gov (United States)

    Sigman, Michael E.; Dindal, Amy B.

    2003-11-11

    Described is a method for producing copolymerized sol-gel derived sorbent particles for the production of copolymerized sol-gel derived sorbent material. The method for producing copolymerized sol-gel derived sorbent particles comprises adding a basic solution to an aqueous metal alkoxide mixture for a pH.ltoreq.8 to hydrolyze the metal alkoxides. Then, allowing the mixture to react at room temperature for a precalculated period of time for the mixture to undergo an increased in viscosity to obtain a desired pore size and surface area. The copolymerized mixture is then added to an immiscible, nonpolar solvent that has been heated to a sufficient temperature wherein the copolymerized mixture forms a solid upon the addition. The solid is recovered from the mixture, and is ready for use in an active sampling trap or activated for use in a passive sampling trap.

  7. Derivation of Hamiltonians for accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Symon, K.R.

    1997-09-12

    In this report various forms of the Hamiltonian for particle motion in an accelerator will be derived. Except where noted, the treatment will apply generally to linear and circular accelerators, storage rings, and beamlines. The generic term accelerator will be used to refer to any of these devices. The author will use the usual accelerator coordinate system, which will be introduced first, along with a list of handy formulas. He then starts from the general Hamiltonian for a particle in an electromagnetic field, using the accelerator coordinate system, with time t as independent variable. He switches to a form more convenient for most purposes using the distance s along the reference orbit as independent variable. In section 2, formulas will be derived for the vector potentials that describe the various lattice components. In sections 3, 4, and 5, special forms of the Hamiltonian will be derived for transverse horizontal and vertical motion, for longitudinal motion, and for synchrobetatron coupling of horizontal and longitudinal motions. Hamiltonians will be expanded to fourth order in the variables.

  8. ISA for the internet of tactical things

    Science.gov (United States)

    Moulton, Christine L.; Harrell, John M.; Hepp, Jared J.

    2017-05-01

    The Internet of Things (IoT) integrates a variety of different devices that provide more information than can currently be easily handled. While there is much good there are also many problems in the IoT world and not all of the potential solutions can be used in the unique environment of the military. The tactical edge of the military is an even harsher environment with both constrained communications and resources but still having requirements to process data in real time for improved command decisions.

  9. 1399-IJBCS-Article-Mohamed Isa

    African Journals Online (AJOL)

    USER

    SHESTCO), Abuja, Nigeria. *Corresponding author ... Chitin was synthesized from Nigerian brown shrimps by a chemical process involving demineralization and deproteinisation. ... biomedical, biocatalysis and waste water treatment processes (Li ...

  10. Electron clearing for the ISA proton beam

    International Nuclear Information System (INIS)

    Herrera, J.C.

    1976-01-01

    The circulating protons in the ISABELLE intersecting storage ring accelerator will collide with the residual gas in the vacuum chamber. The electrons produced will tend to be captured by the potential well of the beam itself and result in a neutralization of the space charge of the beam. A detailed analysis is given of the various mechanisms which can be used to reduce the net degree of beam neutralization. It is concluded that the average neutralization will be about 10 -4 for a residual gas pressure of 3 x 10 -11 torr of hydrogen

  11. Forms of Life, Forms of Reality

    Directory of Open Access Journals (Sweden)

    Piergiorgio Donatelli

    2015-10-01

    Full Text Available The article explores aspects of the notion of forms of life in the Wittgensteinian tradition especially following Iris Murdoch’s lead. On the one hand, the notion signals the hardness and inexhaustible character of reality, as the background needed in order to make sense of our lives in various ways. On the other, the hardness of reality is the object of a moral work of apprehension and deepening to the point at which its distinctive character dissolves into the family of connections we have gained for ourselves. The two movements of thought are connected and necessary.

  12. Micro metal forming

    CERN Document Server

    2013-01-01

    Micro Metal Forming, i. e. forming of parts and features with dimensions below 1 mm, is a young area of research in the wide field of metal forming technologies, expanding the limits for applying metal forming towards micro technology. The essential challenges arise from the reduced geometrical size and the increased lot size. In order to enable potential users to apply micro metal forming in production, information about the following topics are given: tribological behavior: friction between tool and work piece as well as tool wear mechanical behavior: strength and formability of the work piece material, durability of the work pieces size effects: basic description of effects occurring due to the fact, that the quantitative relation between different features changes with decreasing size process windows and limits for forming processes tool making methods numerical modeling of processes and process chains quality assurance and metrology All topics are discussed with respect to the questions relevant to micro...

  13. Gravitation and quadratic forms

    International Nuclear Information System (INIS)

    Ananth, Sudarshan; Brink, Lars; Majumdar, Sucheta; Mali, Mahendra; Shah, Nabha

    2017-01-01

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  14. Three forms of relativity

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1992-01-01

    The physical sense of three forms of the relativity is discussed. The first - instant from - respects in fact the traditional approach based on the concept of instant distance. The normal form corresponds the radar formulation which is based on the light or retarded distances. The front form in the special case is characterized by 'observable' variables, and the known method of k-coefficient is its obvious expression. 16 refs

  15. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  16. Gravitation and quadratic forms

    Energy Technology Data Exchange (ETDEWEB)

    Ananth, Sudarshan [Indian Institute of Science Education and Research,Pune 411008 (India); Brink, Lars [Department of Physics, Chalmers University of Technology,S-41296 Göteborg (Sweden); Institute of Advanced Studies and Department of Physics & Applied Physics,Nanyang Technological University,Singapore 637371 (Singapore); Majumdar, Sucheta [Indian Institute of Science Education and Research,Pune 411008 (India); Mali, Mahendra [School of Physics, Indian Institute of Science Education and Research,Thiruvananthapuram, Trivandrum 695016 (India); Shah, Nabha [Indian Institute of Science Education and Research,Pune 411008 (India)

    2017-03-31

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  17. Electronic Capitalization Asset Form -

    Data.gov (United States)

    Department of Transportation — National Automated Capitalization Authorization Form used by ATO Engineering Services, Logistics, Accounting for the purpose of identifying and capturing FAA project...

  18. Forming of superplastic ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Lesuer, D.R.; Wadsworth, J.; Nieh, T.G.

    1994-05-01

    Superplasticity in ceramics has now advanced to the stage that technologically viable superplastic deformation processing can be performed. In this paper, examples of superplastic forming and diffusion bonding of ceramic components are given. Recent work in biaxial gas-pressure forming of several ceramics is provided. These include yttria-stabilized, tetragonal zirconia (YTZP), a 20% alumina/YTZP composite, and silicon. In addition, the concurrent superplastic forming and diffusion bonding of a hybrid ceramic-metal structure are presented. These forming processes offer technological advantages of greater dimensional control and increased variety and complexity of shapes than is possible with conventional ceramic shaping technology.

  19. Cooperative Station History Forms

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  20. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen

    Directory of Open Access Journals (Sweden)

    Hanna L. Thim

    2014-03-01

    Full Text Available Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV as the test Ag, the combined use of two Toll-like receptor (TLR ligand adjuvants, CpG oligonucleotides (ODNs and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV glycoprotein (G was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing

  1. Derivatives in emerging markets

    OpenAIRE

    Dubravko Mihaljek; Frank Packer

    2010-01-01

    Turnover of derivatives has grown more rapidly in emerging markets than in developed countries. Foreign exchange derivatives are the most commonly traded of all risk categories, with increasingly frequent turnover in emerging market currencies and a growing share of cross-border transactions. As the global reach of the financial centres in emerging Asia has expanded, the offshore trading of many emerging market currency derivatives has risen as well. Growth in derivatives turnover is positive...

  2. Giro form reading machine

    Science.gov (United States)

    Minh Ha, Thien; Niggeler, Dieter; Bunke, Horst; Clarinval, Jose

    1995-08-01

    Although giro forms are used by many people in daily life for money remittance in Switzerland, the processing of these forms at banks and post offices is only partly automated. We describe an ongoing project for building an automatic system that is able to recognize various items printed or written on a giro form. The system comprises three main components, namely, an automatic form feeder, a camera system, and a computer. These components are connected in such a way that the system is able to process a bunch of forms without any human interactions. We present two real applications of our system in the field of payment services, which require the reading of both machine printed and handwritten information that may appear on a giro form. One particular feature of giro forms is their flexible layout, i.e., information items are located differently from one form to another, thus requiring an additional analysis step to localize them before recognition. A commercial optical character recognition software package is used for recognition of machine-printed information, whereas handwritten information is read by our own algorithms, the details of which are presented. The system is implemented by using a client/server architecture providing a high degree of flexibility to change. Preliminary results are reported supporting our claim that the system is usable in practice.

  3. PowerForms

    DEFF Research Database (Denmark)

    Brabrand, Claus; Møller, Anders; Ricky, Mikkel

    2000-01-01

    All uses of HTML forms may benefit from validation of the specified input field values. Simple validation matches individual values against specified formats, while more advanced validation may involve interdependencies of form fields. There is currently no standard for specifying or implementing...

  4. Mastering HTML5 forms

    CERN Document Server

    Gupta, Gaurav

    2013-01-01

    This tutorial will show you how to create stylish forms, not only visually appealing, but interactive and customized, in order to gather valuable user inputs and information.Enhance your skills in building responsive and dynamic web forms using HTML5, CSS3, and related technologies. All you need is a basic understanding of HTML and PHP.

  5. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  6. Method for forming materials

    Science.gov (United States)

    Tolle, Charles R [Idaho Falls, ID; Clark, Denis E [Idaho Falls, ID; Smartt, Herschel B [Idaho Falls, ID; Miller, Karen S [Idaho Falls, ID

    2009-10-06

    A material-forming tool and a method for forming a material are described including a shank portion; a shoulder portion that releasably engages the shank portion; a pin that releasably engages the shoulder portion, wherein the pin defines a passageway; and a source of a material coupled in material flowing relation relative to the pin and wherein the material-forming tool is utilized in methodology that includes providing a first material; providing a second material, and placing the second material into contact with the first material; and locally plastically deforming the first material with the material-forming tool so as mix the first material and second material together to form a resulting material having characteristics different from the respective first and second materials.

  7. Weather Derivatives – Origin, Types and Application

    Directory of Open Access Journals (Sweden)

    Piotr Binkowski

    2008-01-01

    Full Text Available The number of companies that are exposed to the revenues loss risk caused by weather variability is still increasing. The businesses that are mostly exposed to weather risk are following: energy, agriculture, constructions and transport. That situation has initiated dynamic growth of weather derivatives markets as well as the awareness of the weather risk among the market participants. Presently, the weather derivatives markets evaluate rapidly in all the mature economies: USA, Asia and Europe. Constructing weather derivatives relies on qu- antifying climate factors in the form of indexes, what is quite simple task, more difficultly can be gathering precise historical data of required climate factors. Taking into consideration so far development of derivatives especially the financial derivatives based on different types of indexes financial market has at disposal wide range of different types of proved derivatives (futures, forward, options, swaps, which can be successfully utilised on the weather-driven markets both for hedging weather risk and speculating.

  8. Meteorite Dichotomy Implies that Jupiter Formed Early

    Science.gov (United States)

    Kruijer, T. S.; Burkhardt, C.; Budde, G.; Kleine, T.

    2018-05-01

    Meteorites derive from two distinct nebular reservoirs that co-existed and remained spatially separated between 1 and 3–4 Ma after CAIs. This can most easily be explained if Jupiter acted as a barrier and formed early, within less than 1 Ma.

  9. Parametric form of QCD travelling waves

    OpenAIRE

    Peschanski, R.

    2005-01-01

    We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.

  10. Desarrollo de un método analítico para la determinación de selenio en huevos fortificados de gallinas (Isa Brown) por espectroscopia de absorción atómica con generación de hidruros

    OpenAIRE

    Gutiérrez Peña, Luís Vicente; Carrero, Pablo E; Delgado C, Yelitza J; Picón, David; Paz, Luis A; Vielma, José R; Quintero, Arlenis Y; Gutiérrez, Ever O; Gutiérrez, Iserslis A

    2014-01-01

    El huevo es una fuente proteica de uso masivo, en consideración a su bajo costo, es consumido con mayor frecuencia por toda la población. Por esta razón, es de gran interés introducir al mercado un tipo de huevo "saludable", que disminuya los riesgos ligados a enfermedades cardiovasculares y que actúe como antioxidante. Por ello, se evaluó la incorporación del Selenio Orgánico (Sel-Plex®, Alltech Inc) en el programa de alimentación de gallinas ponedoras comerciales raza isa brown con el objet...

  11. Package materials, waste form

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The schedules for waste package development for the various host rocks were presented. The waste form subtask activities were reviewed, with the papers focusing on high-level waste, transuranic waste, and spent fuel. The following ten papers were presented: (1) Waste Package Development Approach; (2) Borosilicate Glass as a Matrix for Savannah River Plant Waste; (3) Development of Alternative High-Level Waste Forms; (4) Overview of the Transuranic Waste Management Program; (5) Assessment of the Impacts of Spent Fuel Disassembly - Alternatives on the Nuclear Waste Isolation System; (6) Reactions of Spent Fuel and Reprocessing Waste Forms with Water in the Presence of Basalt; (7) Spent Fuel Stabilizer Screening Studies; (8) Chemical Interactions of Shale Rock, Prototype Waste Forms, and Prototype Canister Metals in a Simulated Wet Repository Environment; (9) Impact of Fission Gas and Volatiles on Spent Fuel During Geologic Disposal; and (10) Spent Fuel Assembly Decay Heat Measurement and Analysis

  12. Getting in-formed

    DEFF Research Database (Denmark)

    Hansbøl, Mikala

    det vi undersøger på form gennem vores beskrivelser. Paperet tager afsæt i empiriske eksempler fra et postdoc projekt om et såkaldt 'serious game' - Mingoville. Projektet følger circuleringer og etableringer af Mingoville 'på en global markedsplads'. I paperet diskuteres hvordan vi som forskere samler....../performer de fænomener vi forsker i. Aktør-Netværks-Teoretiker Bruno Latour (2005) pointerer at enhver beskrivelse også er en form for forklaring. En form for forklaring, der putter ting ind i et skript og dermed også putter ting på form. Paperet diskuterer to tilgange til at gøre serious games og derved skabe viden om...... engagementer med disse fænomener i serious games forskning: experimentel og etnografisk....

  13. NOAA Form 370 Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The data set contains information from submitted NOAA Form 370s, also known as the Fisheries Certificate of Origin, for imported shipments of frozen and/or processed...

  14. MAPS Appraisal Report Form

    CERN Multimedia

    HR Department

    2005-01-01

    As announced in Weekly Bulletin 48/2004, from now onwards, the paper MAPS appraisal report form has been replaced by an electronic form, which is available via EDH (on the EDH desktop under Other Tasks / HR & Training) No changes have been made to the contents of the form. Practical information will be available on the web page http://cern.ch/ais/projs/forms/maps/info.htm, and information meetings will be held on the following dates: 18 January 2005: MAIN AUDITORIUM (500-1-001) from 14:00 to 15:30. 20 January 2005: AB AUDITORIUM II (864-1-D02) from14:00 to 15:30. 24 January 2005: AT AUDITORIUM (30-7-018) from 10:00 to 11:30. Human Resources Department Tel. 73566

  15. VMS forms Output Tables

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These output tables contain parsed and format validated data from the various VMS forms that are sent from any given vessel, while at sea, from the VMS devices on...

  16. Science on form

    International Nuclear Information System (INIS)

    Ishizaka, Shozo; Kato, Yoshihiro; Takaki, Ryuji; Toriwaki, Jun-ichiro

    1987-01-01

    The purpose of the Symposium was to discuss interdisciplinal science aspects of form. 'Form' depends on the material and the changes. But, it is the form that appears evident at once and endures. Form is absorbed from every field as media of information. One part of the work covers the description of non-periodic phenomena, morphogenesis or evolution. Irreducible stubborn facts as diseases or social problems, or whatever else that could not be analyzed are integrally challenged to be systematized by computer simulation. The other part covers the finding of laws for determining how systems behave. Attention should be paid to pattern recognition, image processing and pattern formation. The Symposium proceeded with no parallel sessions, and participants from various fields made exciting discussions in an interdisciplinal atmosphere. (Auth.)

  17. Access Customized Forms

    OpenAIRE

    Cosma Emil; Jeflea Victor

    2010-01-01

    By using Word, Excel or PowerPoint one can automate routine operations using the VBA language (Visual Basic for Applications). This language is also used in Access, allowing access to data stored in tables or queries. Thus, Access and VBA resources can be used together. Access is designed for programming forms and reports (among other things), so there won’t be found any of the VBA editor’s specific forms.

  18. Forms of global governence

    Directory of Open Access Journals (Sweden)

    Maxim V. Kharkevich

    2014-01-01

    Full Text Available Global governance as a concept defines the meaning of contemporary world politics both as a discipline and as reality. Interdependent and globalized world requires governance, and a global government has not been formed yet. The theoretical possibility of global governance without global government is proved and justified. The purpose of this article is to analytically identify possible forms of global governance. Three such forms of global governance are identified: hierarchical, market and network. In a hierarchy the governance is due to the asymmetry of power between the parties. Market control happens via anonymous pricing mechanism. Network, in contrast to the market is characterized by a closer value link between the actors, but unlike the hierarchical relationship actors are free to leave the network. Global governance takes three forms and is being implemented by different actors. To determine the most efficient form of global governance is impossible. Efficiency depends on the match between a form and an object of government. It should be noted that meta governance is likely to remain a monopoly of institutionally strong states in global governance.

  19. Two forms for 3-uniform states of eight-qubits

    Science.gov (United States)

    Zha, Xinwei; Da, Zhang; Ahmed, Irfan; Zhang, Yanpeng

    2018-05-01

    In this paper, we study the relations between average bipartite entanglement and the n-tangle of eight-qubits. We have derived two forms for 3-uniform states of eight-qubits. One form has the n-tangle equal to zero; the other form has the n-tangle equal to unity.

  20. Electromagnetic form factors of a massive neutrino

    International Nuclear Information System (INIS)

    Dvornikov, M.S.; Studenikin, A.I.

    2004-01-01

    Electromagnetic form factors of a massive neutrino are studied in a minimally extended standard model in an arbitrary R ξ gauge and taking into account the dependence on the masses of all interacting particles. The contribution from all Feynman diagrams to the electric, magnetic, and anapole form factors, in which the dependence of the masses of all particles as well as on gauge parameters is accounted for exactly, are obtained for the first time in explicit form. The asymptotic behavior of the magnetic form factor for large negative squares of the momentum of an external photon is analyzed and the expression for the anapole moment of a massive neutrino is derived. The results are generalized to the case of mixing between various flavors of the neutrino. Explicit expressions are obtained for the electric, magnetic, and electric dipole and anapole transitional form factors as well as for the transitional electric dipole moment

  1. Comparative waste forms study

    International Nuclear Information System (INIS)

    Wald, J.W.; Lokken, R.O.; Shade, J.W.; Rusin, J.M.

    1980-12-01

    A number of alternative process and waste form options exist for the immobilization of nuclear wastes. Although data exists on the characterization of these alternative waste forms, a straightforward comparison of product properties is difficult, due to the lack of standardized testing procedures. The characterization study described in this report involved the application of the same volatility, mechanical strength and leach tests to ten alternative waste forms, to assess product durability. Bulk property, phase analysis and microstructural examination of the simulated products, whose waste loading varied from 5% to 100% was also conducted. The specific waste forms investigated were as follows: Cold Pressed and Sintered PW-9 Calcine; Hot Pressed PW-9 Calcine; Hot Isostatic Pressed PW-9 Calcine; Cold Pressed and Sintered SPC-5B Supercalcine; Hot Isostatic pressed SPC-5B Supercalcine; Sintered PW-9 and 50% Glass Frit; Glass 76-68; Celsian Glass Ceramic; Type II Portland Cement and 10% PW-9 Calcine; and Type II Portland Cement and 10% SPC-5B Supercalcine. Bulk property data were used to calculate and compare the relative quantities of waste form volume produced at a spent fuel processing rate of 5 metric ton uranium/day. This quantity ranged from 3173 L/day (5280 Kg/day) for 10% SPC-5B supercalcine in cement to 83 L/day (294 Kg/day) for 100% calcine. Mechanical strength, volatility, and leach resistance tests provide data related to waste form durability. Glass, glass-ceramic and supercalcine ranked high in waste form durability where as the 100% PW-9 calcine ranked low. All other materials ranked between these two groupings

  2. Current algebra constraints on K13 form factors

    International Nuclear Information System (INIS)

    Simmons, L.D.

    1975-01-01

    New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences

  3. Global Derivatives Market

    Directory of Open Access Journals (Sweden)

    Stankovska Aleksandra

    2017-06-01

    Full Text Available Globalization of financial markets led to the enormous growth of volume and diversification of financial transactions. Financial derivatives were the basic elements of this growth. Derivatives play a useful and important role in hedging and risk management, but they also pose several dangers to the stability of financial markets and thereby the overall economy. Derivatives are used to hedge and speculate the risk associated with commerce and finance.

  4. Directory of energy data collection forms. Forms in use as of October 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-01-01

    This is an authoritative listing of selected public use forms currently used as basic energy information gathering tools by the Department of Energy (DOE). This directory provides an overview of DOE`s energy information collection programs for decisionmakers in Government and industry. Forms designed to collect energy information and used by the Energy Information Administration (EIA) as of October 1995 are included in this directory. For each form listed in this directory, an abstract is included that describes the form`s uses, its respondents, and the data collected. For the reader`s convenience in finding specific types of collections, several indices have been provided in this directory. A listing of the forms grouped by energy source and function begins on page 26. Beginning on page 38 are the publications derived from the collections, and on page 50, are the forms linked to general respondent categories.

  5. Boronate Derivatives of Functionally Diverse Catechols: Stability Studies

    Directory of Open Access Journals (Sweden)

    Kamal Aziz Ketuly

    2010-03-01

    Full Text Available Benzeneboronate of catecholic carboxyl methyl esters, N-acetyldopamine, coumarin and catechol estrogens were prepared as crystalline derivatives in high yield. Related catechol compounds with extra polar functional group(s (OH, NH2 do not form or only partially form unstable cyclic boronate derivatives.

  6. Chemical forms of radioiodine

    International Nuclear Information System (INIS)

    Tachikawa, Enzo

    1979-01-01

    Release of radioiodine built-up during reactor operations presents a potential problem from the standpoint of environmental safety. Among the chemical forms of radioiodine, depending upon the circumstances, organic iodides cast a most serious problem because of its difficulties in the trapping and because of its stability compared to other chemical forms. Furthermore, pellet-cladding interaction (PCl) fuel failures in LWR fuel rods are believed to be stress corrosion cracks caused by embrittling fission product species, radioiodine. To deal with these problems, knowledge is required on the chemical behaviors of radioiodine in and out of fuels, as well as the release behaviors from fuels. Here a brief review is given of these respects, in aiming at clearing-up the questions still remaining unknown. The data seem to indicate that radioiodine exists as a combined form in fuels. upon heating slightly irradiated fuels, the iodine atoms are released in a chemical form associated with uranium atoms. Experiments, however, as needed with specimen of higher burnup, where the interactions of radioiodine with metallic fission products could be favored. The dominant release mechanism of radioiodine under normal operating temperatures will be diffusion to grain boundaries leading to open surfaces. Radiation-induced internal traps, however, after the rate of diffusion significantly. The carbon sources of organic iodides formed under various conditions and its formation mechanisms have also been considered. (author)

  7. Form finding in elastic gridshells

    Science.gov (United States)

    Baek, Changyeob; Sageman-Furnas, Andrew O.; Jawed, Mohammad K.; Reis, Pedro M.

    2018-01-01

    Elastic gridshells comprise an initially planar network of elastic rods that are actuated into a shell-like structure by loading their extremities. The resulting actuated form derives from the elastic buckling of the rods subjected to inextensibility. We study elastic gridshells with a focus on the rational design of the final shapes. Our precision desktop experiments exhibit complex geometries, even from seemingly simple initial configurations and actuation processes. The numerical simulations capture this nonintuitive behavior with excellent quantitative agreement, allowing for an exploration of parameter space that reveals multistable states. We then turn to the theory of smooth Chebyshev nets to address the inverse design of hemispherical elastic gridshells. The results suggest that rod inextensibility, not elastic response, dictates the zeroth-order shape of an actuated elastic gridshell. As it turns out, this is the shape of a common household strainer. Therefore, the geometry of Chebyshev nets can be further used to understand elastic gridshells. In particular, we introduce a way to quantify the intrinsic shape of the empty, but enclosed regions, which we then use to rationalize the nonlocal deformation of elastic gridshells to point loading. This justifies the observed difficulty in form finding. Nevertheless, we close with an exploration of concatenating multiple elastic gridshell building blocks.

  8. Methods for forming particles

    Science.gov (United States)

    Fox, Robert V.; Zhang, Fengyan; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin

    2016-06-21

    Single source precursors or pre-copolymers of single source precursors are subjected to microwave radiation to form particles of a I-III-VI.sub.2 material. Such particles may be formed in a wurtzite phase and may be converted to a chalcopyrite phase by, for example, exposure to heat. The particles in the wurtzite phase may have a substantially hexagonal shape that enables stacking into ordered layers. The particles in the wurtzite phase may be mixed with particles in the chalcopyrite phase (i.e., chalcopyrite nanoparticles) that may fill voids within the ordered layers of the particles in the wurtzite phase thus produce films with good coverage. In some embodiments, the methods are used to form layers of semiconductor materials comprising a I-III-VI.sub.2 material. Devices such as, for example, thin-film solar cells may be fabricated using such methods.

  9. Physical forms of MIPs.

    Science.gov (United States)

    Biffis, Andrea; Dvorakova, Gita; Falcimaigne-Cordin, Aude

    2012-01-01

    The current state of the art in the development of methodologies for the preparation of MIPs in predetermined physical forms is critically reviewed, with particular attention being paid to the forms most widely employed in practical applications, such as spherical beads in the micro- to nanometer range, microgels, monoliths, membranes. Although applications of the various MIP physical forms are mentioned, the focus of the paper is mainly on the description of the various preparative methods. The aim is to provide the reader with an overview of the latest achievements in the field, as well as with a mean for critically evaluating the various proposed methodologies towards an envisaged application. The review covers the literature up to early 2010, with special emphasis on the developments of the last 10 years.

  10. Sixth form pure mathematics

    CERN Document Server

    Plumpton, C

    1968-01-01

    Sixth Form Pure Mathematics, Volume 1, Second Edition, is the first of a series of volumes on Pure Mathematics and Theoretical Mechanics for Sixth Form students whose aim is entrance into British and Commonwealth Universities or Technical Colleges. A knowledge of Pure Mathematics up to G.C.E. O-level is assumed and the subject is developed by a concentric treatment in which each new topic is used to illustrate ideas already treated. The major topics of Algebra, Calculus, Coordinate Geometry, and Trigonometry are developed together. This volume covers most of the Pure Mathematics required for t

  11. Waste-form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.

    1982-01-01

    Contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements

  12. Medium modifications of nucleon electromagnetic form factors

    Energy Technology Data Exchange (ETDEWEB)

    Horikawa, T. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan); Bentz, W. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan)]. E-mail: bentz@keyaki.cc.u-tokai.ac.jp

    2005-11-28

    We use the Nambu-Jona-Lasinio model as an effective quark theory to investigate the medium modifications of the nucleon electromagnetic form factors. By using the equation of state of nuclear matter derived in this model, we discuss the results based on the naive quark-scalar diquark picture, the effects of finite diquark size, and the meson cloud around the constituent quarks. We apply this description to the longitudinal response function for quasielastic electron scattering. RPA correlations, based on the nucleon-nucleon interaction derived in the same model, are also taken into account in the calculation of the response function.

  13. Silsesquioxane-derived ceramic fibres

    Science.gov (United States)

    Hurwitz, F. I.; Farmer, S. C.; Terepka, F. M.; Leonhardt, T. A.

    1991-01-01

    Fibers formed from blends of silsesquioxane polymers were characterized to study the pyrolytic conversion of these precursors to ceramics. The morphology of fibers pyrolyzed to 1400 C revealed primarily amorphous glasses whose conversion to beta-SiC is a function of both blend composition and pyrolysis conditions. Formation of beta-SiC crystallites within the glassy phase is favored by higher than stoichiometric C/Si ratios, while carbothermal reduction of Si-O bonds to form SiC with loss of SiO and CO occurs at higher methyl/phenylpropyl silsesquioxane (lower C/Si) ratios. As the carbothermal reduction is assumed to be diffusion controlled, the fibers can serve as model systems to gain understanding of the silsesquioxane pyrolysis behavior, and therefore are useful in the development of polysilsesquioxane-derived ceramic matrices and coatings as well.

  14. On derived groups of division rings II

    International Nuclear Information System (INIS)

    Mahdavi Hezavehi, M.; Akbari Feyzaabaadi, S.; Mehraabaadi, M.; Hajie Abolhassan, H.

    1995-05-01

    Let D be a division ring with centre F and denote by D' the derived group (commutator subgroup) of D * = D - {0}. It is shown that if each element of D' is algebraic over F, then D is algebraic over F. It is also proved that each finite separable extension of F in D is of the form F(c) for some element c in the derived group D'. Using these results, it is shown that if each element of the derived group D' is of bounded degree over F, then D is finite dimensional over F. (author). 5 refs

  15. Risk and Derivative Price

    OpenAIRE

    Yusuke Osaki

    2007-01-01

    We consider an asset market traded three types of assets: the risk–free asset, the market portfolio and derivatives written on the market portfolio return. We determine a sufficient condition to guarantee that noise risk monotonically changes their derivatives. The condition is that Arrow–Pratt absolute risk aversion is decreasing and convex.

  16. Financial Derivatives in China

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Francis Repka sees bright prospects for the future development of the financial derivatives market in China. Repka,Vice President of the Asian Bond Finance Department of Societe Generale, says the situation in France just after the birth of derivatives was very similar to the situation in China today.

  17. Vitamin D derivatives

    International Nuclear Information System (INIS)

    Deluca, H.F.; Schnoes, H.K.; Napoli, J.L.; Fivizzani, M.A.

    1982-01-01

    The chemical preparation of 26,27-isotopically labelled vitamin D 3 derivatives of high specific activity is described. These labelled vitamin D derivatives are useful in the determination of vitamin D metabolite levels in the blood and tissues of man and animals. (U.K.)

  18. Many Forms of Culture

    Science.gov (United States)

    Cohen, Adam B.

    2009-01-01

    Psychologists interested in culture have focused primarily on East-West differences in individualism-collectivism, or independent-interdependent self-construal. As important as this dimension is, there are many other forms of culture with many dimensions of cultural variability. Selecting from among the many understudied cultures in psychology,…

  19. Inequalities for Differential Forms

    CERN Document Server

    Agarwal, Ravi P

    2009-01-01

    Presents a series of local and global estimates and inequalities for differential forms, in particular the ones that satisfy the A-harmonic equations. This work focuses on the Hardy-Littlewood, Poincare, Cacciooli, imbedded and reverse Holder inequalities. It is for researchers, instructors and graduate students

  20. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  1. Documentary form no. 1

    International Nuclear Information System (INIS)

    2002-12-01

    This first documentary form, edited by the national association of local commissions of information about nuclear activities (ANCLI), briefly presents the radioactivity phenomenon, the ionising radiations, the characteristics of radiation sources (activity, half life, energy), and the dosimetry (absorbed, equivalent, efficient doses). (J.S.)

  2. Metal forming and lubrication

    DEFF Research Database (Denmark)

    Bay, Niels

    2000-01-01

    Lubrication is essential in most metal forming processes. The lubricant film has two basic functions, [1]: i. to separate the work piece and tool surfaces and ii. to cool the workpiece and the tool. Separation of the two surfaces implies lower friction facilitating deformation and lowering the tool...

  3. Circle of Form

    DEFF Research Database (Denmark)

    Jaeger, Thomas Arvid

    2012-01-01

    a common professional language like in mathematics, colour and music. The result is a weaker professionalism in the aesthetic competences compared to the professionalism and competences in other areas. A research project [1] on contrasts or opposites in form investigated the phenomenon in the fields...

  4. Forms of Inattentiveness

    DEFF Research Database (Denmark)

    Knudsen, Morten

    2011-01-01

    and kept out of sight in the decision processes by looking at a specific case study involving the construction of a model intended to control, and render transparent, the quality of health services in Denmark. This paper outlines the forms of inattentiveness which make communication blind to information...

  5. Wars of Forms

    DEFF Research Database (Denmark)

    Clausen, Lars

    2013-01-01

    , both political and military, war between the two forms, the post-napoleonic, Fichtean notion of nationality (1807-8) and the historical notion of imperium. “Nationality” entered the political semantics witch such a force and shook the existing political order of empires to the ground because of its...

  6. Discover new cooperation forms

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    In spite of the good forecasts concerning the supply and demand, the gas market is full of uncertainties because of the competition and the industrial reorganizing. Producers and operators try to define new forms of cooperation allowing the attainments protection and at the same time allowing to take advantage of the market opportunities with a shared risk. (A.L.B.)

  7. Personal Information Request Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    PC Forms Inc. 834-4048

    To apply for information under the Privacy Act, complete this form or a written request mentioning the Act. Describe the information being sought and provide any relevant details necessary to help the. International Development Research Centre. (IDRC) find it. If you require assistance, refer to. Info Source (Sources of ...

  8. Taxation of Derivatives

    DEFF Research Database (Denmark)

    Dyppel, Katja Joo

    2013-01-01

    The main objective for this thesis is to analyse and systematise the Danish legislation on taxation of derivatives. According to financial terminology, a derivative is a financial instrument. Its value is derived from changes in the value of one or more underlying assets.The most common derivatives...... in the Danish tax legislation. However, contracts known as forwards (terminskontrakter) and options (aftaler om køberetter og salgsretter) are generally included in the term financials contracts covered by the Danish Act on Taxation of Gains and Losses on Claims and Debt. The main part of the analysis deals...... with the scope of sections 29-33 of the Danish Act on Taxation of Gains and Losses on Claims and Debt and the tax consequences for the covered financial contracts. In the analysis of taxation of derivatives, the fundamental issues of qualification and tax treatment of the instruments are dealt with....

  9. Linking Equilibrium and Nonequilibrium Dynamics in Glass-Forming Systems

    DEFF Research Database (Denmark)

    Mauro, John C.; Guo, Xiaoju; Smedskjær, Morten Mattrup

    , we show that the nonequilibrium glassy dynamics are intimately connected with the equilibrium liquid dynamics. This is accomplished by deriving a new functional form for the thermal history dependence of nonequilibrium viscosity, which is validated against experimental measurements of industrial...

  10. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  11. Waste form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.

    1982-01-01

    In this program, contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements (both as they exist and as they are modified with time). 6 tables

  12. GRACE with FORM

    International Nuclear Information System (INIS)

    Fujimoto, J.; Ishikawa, T.; Kato, K.; Kaneko, T.; Nakazawa, N..; Shimizu, Y.; Vermaseren, J.; Yasui, Y.

    2006-01-01

    A new version of GRACE/1-loop, a system for the automatic calculation of 1-loop Feynman diagrams, has been developed after the replacement of its symbolic manipulation engine from REDUCE to FORM. This enables us the efficient memory management that is essential for the handling of a tremendous number of Feynman diagrams, so that the performance of GRACE/1-loop is significantly improved as demonstrated in the text

  13. Differential forms of supermanifolds

    International Nuclear Information System (INIS)

    Beresin, P.A.

    1979-01-01

    The theory of differential and pseUdo-differential forms on supermanifolds is constructed. The definition and notations of superanalogy of the Pontryagin and Chern characteristic classes are given. The theory considered is purely local. The scheme suggested here generalizes the so-called Weil homomorphism for superspace which lays on the basis of the Chern and Potryagin characteristic class theory. The theory can be extended to the global supermanifolds

  14. Forms of Life

    Directory of Open Access Journals (Sweden)

    Peter Hacker

    2015-10-01

    Full Text Available The phrase ‘Lebensform’ (form of life had a long and varied history prior to Wittgenstein’s use of it on a mere three occasions in the Philosophical Investigations. It is not a pivotal concept in Wittgenstein’s philosophy. But it is a minor signpost of a major reorientation of philosophy, philosophy of language and logic, and philosophy of mathematics that Wittgenstein instigated. For Wittgenstein sought to replace the conception of a language as a meaning calculus (Frege, Russell, the Tractatus by an anthropological or ethnological conception. A language is not a class of sentences that can be formed from a set of axioms (definitions, formation and transformation rules and the meanings of which is given by their truth-conditions, but an open-ended series of interlocking language-games constituting a form of life or way of living (a culture. Wittgenstein’s uses of ‘Lebensform’ and its cognates, both in the Investigations and in his Nachlass are severally analysed, and various exegetical misinterpretations are clarified.

  15. Form factors of heavy mesons in QCD

    International Nuclear Information System (INIS)

    Shifman, M.A.; Vysotsky, M.I.

    1980-01-01

    Logarithmic corrections to form factors of mesons built from heavy quarks are dirived in the framework of quantum chromodynamics. The reactions e + e - → etasub(c)γ and H → J/PSIγ are considered as an example. A novel feature as compared to the well studied problem of the pion form factor is the existence of the transformations between the quark-antiquark state c anti c and the gluonic one. O(αsub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms is summed up with the help of the operator technique. Apart from already known results for quark operators some new results referring to gluon operators and their mixing with the quark ones are used. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second derivation is based on conformal symmetry considerations

  16. Forming of political opinion and decision

    International Nuclear Information System (INIS)

    Urban, K.

    1980-01-01

    Taking the SNR-300 reactor in Kalkar as an example, the process of forming of political opinion and decision is reconstructed in order to get a picture of typical consensus- and conflict patterns in the discussion of safety problems. On this basis, it should be possible to derive a freedom of action for the political and administrative managing of safety matters by means of feed back with social groups. As a crucial point the aspects concerning the steps of the forming of political opinion and decision are examined. (DG) [de

  17. Superstability of Generalized Derivations

    Directory of Open Access Journals (Sweden)

    Ansari-Piri Esmaeil

    2010-01-01

    Full Text Available We investigate the superstability of the functional equation , where and are the mappings on Banach algebra . We have also proved the superstability of generalized derivations associated to the linear functional equation , where .

  18. Amphetamine derivative related deaths.

    Science.gov (United States)

    Lora-Tamayo, C; Tena, T; Rodríguez, A

    1997-02-28

    Amphetamine its methylendioxy (methylendioxyamphetamine methylenedioxymethylamphetamine, methylenedioxyethylamphetamine) and methoxy derivatives (p-methoxyamphetamine and p-methoxymethylamphetamine) are widely abused in Spanish society. We present here the results of a systematic study of all cases of deaths brought to the attention of the Madrid department of the Instituto Nacional de Toxicologia from 1993 to 1995 in which some of these drugs have been found in the cadaveric blood. The cases were divided into three categories: amphetamine and derivatives, amphetamines and alcohol, amphetamines and other drugs. Data on age, sex, clinical symptoms, morphological findings, circumstances of death, when known, and concentration of amphetamine derivatives, alcohol and other drugs in blood are given for each group. The information provided here may prove to be useful for the forensic interpretation of deaths which are directly or indirectly related to abuse of amphetamine derivatives.

  19. Investigation - Derived Waste Program

    International Nuclear Information System (INIS)

    Beardsley, C.; Anderson, R.

    1998-06-01

    The Investigation-Derived Waste Program is a software application that was developed to identify the groundwater monitoring wells at the Savannah River Site that require containerization and treatment for purge water generated during sampling

  20. Development of Derivatives Reporting

    OpenAIRE

    Pejčochová, Kristina

    2012-01-01

    This thesis aims to summarise the theoretical principles, concepts and considerations pertaining to accounting for and reporting of derivatives and to describe and analyse the development of major accounting standards dealing with related issues. Sections 1 and 2 provide a basic overview of derivative instruments'categorisation, mechanics, valuation and uses. Section 3 studies the principles that ensure the provision of useful financial information, with specific focus on financial instrument...

  1. On higher derivative gravity

    International Nuclear Information System (INIS)

    Accioly, A.J.

    1987-01-01

    A possible classical route conducting towards a general relativity theory with higher-derivatives starting, in a sense, from first principles, is analysed. A completely causal vacuum solution with the symmetries of the Goedel universe is obtained in the framework of this higher-derivative gravity. This very peculiar and rare result is the first known vcuum solution of the fourth-order gravity theory that is not a solution of the corresponding Einstein's equations.(Author) [pt

  2. Brain derived neurotrophic factor

    DEFF Research Database (Denmark)

    Mitchelmore, Cathy; Gede, Lene

    2014-01-01

    Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies are curre......Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies...

  3. Gorenstein derived functions

    DEFF Research Database (Denmark)

    Holm, Henrik Granau

    2004-01-01

    Over any associative ring R it is standard to derive HomR(􀀀;􀀀) using projective resolutions in the rst variable, or injective resolutions in the second variable, and doing this, one obtains Extn R(􀀀;􀀀) in both cases. We examine the situation where projective...... and injective modules are replaced by Gorenstein projective and Gorenstein injective ones, respectively. Furthermore, we derive the tensor product 􀀀 R 􀀀 using Gorenstein at modules....

  4. Form of the manifestly covariant Lagrangian

    Science.gov (United States)

    Johns, Oliver Davis

    1985-10-01

    The preferred form for the manifestly covariant Lagrangian function of a single, charged particle in a given electromagnetic field is the subject of some disagreement in the textbooks. Some authors use a ``homogeneous'' Lagrangian and others use a ``modified'' form in which the covariant Hamiltonian function is made to be nonzero. We argue in favor of the ``homogeneous'' form. We show that the covariant Lagrangian theories can be understood only if one is careful to distinguish quantities evaluated on the varied (in the sense of the calculus of variations) world lines from quantities evaluated on the unvaried world lines. By making this distinction, we are able to derive the Hamilton-Jacobi and Klein-Gordon equations from the ``homogeneous'' Lagrangian, even though the covariant Hamiltonian function is identically zero on all world lines. The derivation of the Klein-Gordon equation in particular gives Lagrangian theoretical support to the derivations found in standard quantum texts, and is also shown to be consistent with the Feynman path-integral method. We conclude that the ``homogeneous'' Lagrangian is a completely adequate basis for covariant Lagrangian theory both in classical and quantum mechanics. The article also explores the analogy with the Fermat theorem of optics, and illustrates a simple invariant notation for the Lagrangian and other four-vector equations.

  5. Fra tanke til form

    DEFF Research Database (Denmark)

    Der er gået 20 år siden Aalborg og Nordjylland i 1997 fik sin egen, unikke civilingeniøruddannelse i form af Arkitektur & Design-uddannelsen ved Aalborg Universitet. Hele forløbet er nu dokumenteret i en jubilæumsbog, der fortæller om hvordan uddannelsen i sin tid blev etableret; hvordan undervis...... størrelse på over 500 studerende, de fleste med daglig gang i den store CREATE-bygning på havnefronten i Aalborg....

  6. Initial value formulation of higher derivative gravity

    International Nuclear Information System (INIS)

    Noakes, D.R.

    1983-01-01

    The initial value problem is considered for the conformally coupled scalar field and higher derivative gravity, by expressing the equations of each theory in harmonic coordinates. For each theory it is shown that the (vacuum) equations can take the form of a diagonal hyperbolic system with constraints on the initial data. Consequently these theories possess well-posed initial value formulations

  7. Bipolar pulse forming line

    Science.gov (United States)

    Rhodes, Mark A.

    2008-10-21

    A bipolar pulse forming transmission line module for linear induction accelerators having first, second, third, fourth, and fifth planar conductors which form an interleaved stack with dielectric layers between the conductors. Each conductor has a first end, and a second end adjacent an acceleration axis. The first and second planar conductors are connected to each other at the second ends, the fourth and fifth planar conductors are connected to each other at the second ends, and the first and fifth planar conductors are connected to each other at the first ends via a shorting plate adjacent the first ends. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short a high voltage from the first end of the third planar conductor to the first end of the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.

  8. Langmuir-Blodgett Films of Graphene Derivatives

    DEFF Research Database (Denmark)

    Petersen, Søren Vermehren

    The work presented in this PhD thesis can be divided into two main categories: 1) Syn-thesis and Langmuir-Blodgett assembly of graphene derivatives and 2) Application and characterization of graphene derivatives as an interface material in molecular electron-ics. While the first category could...... be divided further, the synthesis and Langmuir-Blodgett results are intertwined in such a way that it would be more confusing to pre-sent them separately. The Langmuir-Blodgett deposition also played a crucial, but more isolated, part in the investigation of graphene derivatives as interface material....... Solution processable graphene in the form of chemically derived graphene has been synthesized through the modified Hummers method with subsequent reduction into reduced graphene oxide with hydrazine. The completeness of oxidation, the effect of the refinement steps and the reduction of the graphene oxide...

  9. Differential forms orthogonal to holomorphic functions or forms, and their properties

    CERN Document Server

    Aizenberg, L A

    1983-01-01

    The authors consider the problem of characterizing the exterior differential forms which are orthogonal to holomorphic functions (or forms) in a domain D\\subset {\\mathbf C}^n with respect to integration over the boundary, and some related questions. They give a detailed account of the derivation of the Bochner-Martinelli-Koppelman integral representation of exterior differential forms, which was obtained in 1967 and has already found many important applications. They study the properties of \\overline \\partial-closed forms of type (p, n - 1), 0\\leq p\\leq n - 1, which turn out to be the duals (with respect to the orthogonality mentioned above) to holomorphic functions (or forms) in several complex variables, and resemble holomorphic functions of one complex variable in their properties.

  10. ELEMENTAL FORMS OF HOSPITALITY

    Directory of Open Access Journals (Sweden)

    Maximiliano Emanuel Korstanje

    2010-11-01

    Full Text Available Modern studies emphasized on the needs of researching the hospitality as relevant aspects of tourism and hospitality fields. Anyway, these approaches are inextricably intertwined to the industry of tourism and do not take seriously the anthropological and sociological roots of hospitality. In fact, the hotel seems to be a partial sphere of hospitality at all. Under this context, the present paper explores the issue of hospitality enrooted in the political and economic indo-European principle of free-transit which is associated to a much broader origin.  Starting from the premise etymologically hostel and hospital share similar origins, we follow the contributions of J Derrida to determine the elements that formed the hospitality up to date.

  11. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  12. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  13. Spray-formed tooling

    Science.gov (United States)

    McHugh, K. M.; Key, J. F.

    The United States Council for Automotive Research (USCAR) has formed a partnership with the Idaho National Engineering Laboratory (INEL) to develop a process for the rapid production of low-cost tooling based on spray forming technology developed at the INEL. Phase 1 of the program will involve bench-scale system development, materials characterization, and process optimization. In Phase 2, prototype systems will be designed, constructed, evaluated, and optimized. Process control and other issues that influence commercialization will be addressed during this phase of the project. Technology transfer to USCAR, or a tooling vendor selected by USCAR, will be accomplished during Phase 3. The approach INEL is using to produce tooling, such as plastic injection molds and stamping dies, combines rapid solidification processing and net-shape materials processing into a single step. A bulk liquid metal is pressure-fed into a de Laval spray nozzle transporting a high velocity, high temperature inert gas. The gas jet disintegrates the metal into fine droplets and deposits them onto a tool pattern made from materials such as plastic, wax, clay, ceramics, and metals. The approach is compatible with solid freeform fabrication techniques such as stereolithography, selective laser sintering, and laminated object manufacturing. Heat is extracted rapidly, in-flight, by convection as the spray jet entrains cool inert gas to produce undercooled and semi-solid droplets. At the pattern, the droplets weld together while replicating the shape and surface features of the pattern. Tool formation is rapid; deposition rates in excess of 1 ton/h have been demonstrated for bench-scale nozzles.

  14. Forming Spirals From Shadows

    Science.gov (United States)

    Kohler, Susanna

    2016-07-01

    What causes the large-scale spiral structures found in some protoplanetary disks? Most models assume theyre created by newly-forming planets, but a new study suggests that planets might have nothing to do with it.Perturbations from Planets?In some transition disks protoplanetary disks with gaps in their inner regions weve directly imaged large-scale spiral arms. Many theories currently attribute the formation of these structures to young planets: either the direct perturbations of a planet embedded in the disk cause the spirals, or theyre indirectly caused by the orbit of a planetary body outside of the arms.Another example of spiral arms detected in a protoplanetary disk, MWC 758. [NASA/ESA/ESO/M. Benisty et al.]But what if you could get spirals without any planets? A team of scientists led by Matas Montesinos (University of Chile) have recently published a study in which they examine what happens to a shadowed protoplanetary disk.Casting Shadows with WarpsIn the teams setup, they envision a protoplanetary disk that is warped: the inner region is slightly tilted relative to the outer region. As the central star casts light out over its protoplanetary disk, this disk warping would cause some regions of the disk to be shaded in a way that isnt axially symmetric with potentially interesting implications.Montesinos and collaborators ran 2D hydrodynamics simulations to determine what happens to the motion of particles within the disk when they pass in and out of the shadowed regions. Since the shadowed regions are significantly colder than the illuminated disk, the pressure in these regions is much lower. Particles are therefore accelerated and decelerated as they pass through these regions, and the lack of axial symmetry causes spiral density waves to form in the disk as a result.Initial profile for the stellar heating rate per unit area for one of the authors simulations. The regions shadowed as a result of the disk warp subtend 0.5 radians each (shown on the left

  15. Spinors, tensors and the covariant form of Dirac's equation

    International Nuclear Information System (INIS)

    Chen, W.Q.; Cook, A.H.

    1986-01-01

    The relations between tensors and spinors are used to establish the form of the covariant derivative of a spinor, making use of the fact that certain bilinear combinations of spinors are vectors. The covariant forms of Dirac's equation are thus obtained and examples in specific coordinate systems are displayed. (author)

  16. A QQ→QQ planar double box in canonical form

    Directory of Open Access Journals (Sweden)

    Marco S. Bianchi

    2018-02-01

    Full Text Available We consider a planar double box with four massive external momenta and two massive internal propagators. We derive the system of differential equations for the relevant master integrals, cast it in canonical form, write it as a dlog form and solve it in terms of iterated integrals up to depth four.

  17. Terminology for Neuroscience Data Discovery: Multi-tree Syntax and Investigator-Derived Semantics

    Science.gov (United States)

    Goldberg, David H.; Grafstein, Bernice; Robert, Adrian; Gardner, Esther P.

    2009-01-01

    The Neuroscience Information Framework (NIF), developed for the NIH Blueprint for Neuroscience Research and available at http://nif.nih.gov and http://neurogateway.org, is built upon a set of coordinated terminology components enabling data and web-resource description and selection. Core NIF terminologies use a straightforward syntax designed for ease of use and for navigation by familiar web interfaces, and readily exportable to aid development of relational-model databases for neuroscience data sharing. Datasets, data analysis tools, web resources, and other entities are characterized by multiple descriptors, each addressing core concepts, including data type, acquisition technique, neuroanatomy, and cell class. Terms for each concept are organized in a tree structure, providing is-a and has-a relations. Broad general terms near each root span the category or concept and spawn more detailed entries for specificity. Related but distinct concepts (e.g., brain area and depth) are specified by separate trees, for easier navigation than would be required by graph representation. Semantics enabling NIF data discovery were selected at one or more workshops by investigators expert in particular systems (vision, olfaction, behavioral neuroscience, neurodevelopment), brain areas (cerebellum, thalamus, hippocampus), preparations (molluscs, fly), diseases (neurodegenerative disease), or techniques (microscopy, computation and modeling, neurogenetics). Workshop-derived integrated term lists are available Open Source at http://brainml.org; a complete list of participants is at http://brainml.org/workshops. PMID:18958630

  18. Asia Pacific energy derivatives

    International Nuclear Information System (INIS)

    Fusaro, P.C.

    1997-09-01

    Asia Pacific Energy Derivatives, from FT Energy, is the first report of its kind to examine the growth of energy derivatives within Asia Pacific and their increasing importance within this region. It provides a comprehensive overview of the subject, including analysis of: deregulation as a market driver; the impact of privatisation; the future for energy risk management tools; the unique characteristics of the Asia Pacific energy market; the role of futures exchanges in Asia; existing indexes and their performance; the differences between the Asia Pacific markets and their more mature counterparts in London and New York; non-oil derivatives, project finance and cross commodity arbitrage; the thriving Pacific Rim Over the Counter (OTC) markets. (author)

  19. 4-Aminoquinoline derivatives

    DEFF Research Database (Denmark)

    Singh, Shailja; Agarwal, Drishti; Sharma, Kumkum

    2016-01-01

    and found them to be effective against Plasmodium falciparum under in vitro conditions. Further, we selected four most active derivatives 1m, 1o, 2c and 2j and evaluated their antimalarial potential against Plasmodium berghei in vivo. These 4-aminoquinolines cured BALB/c mice infected with P. berghei......Synthetic quinoline derivatives continue to be considered as candidates for new drug discovery if they act against CQ-resistant strains of malaria even after the widespread emergence of resistance to CQ. In this study, we explored the activities of two series of new 4-aminoquinoline derivatives...... for structure activity relationship to find lead molecules for treating multidrug-resistant Plasmodium falciparum and Plasmodium vivax....

  20. Essays on Derivatives Pricing

    DEFF Research Database (Denmark)

    Kokholm, Thomas

    . With the existence of a liquid market for derivatives with variance as underlying, such as VIX options, VIX futures and a well-developed over-the-counter market for options on variance swaps, it is important to consider models that are able to fit these markets while consistently pricing vanilla options...... financial models, and most importantly, to be aware of their limitations. Following that belief, this thesis consists of three independent and self-contained papers, all dealing with topics in derivatives pricing. The first paper considers the pricing of traffic light options, which are appropriate...... the market for multivariate credit instruments, we take a step back and focus on single-name default modeling and introduce two new model classes for modeling of the default time of a company. Finally, in the third paper we propose a consistent pricing model for index and volatility derivatives...

  1. Safeguards and retrievability from waste forms

    Energy Technology Data Exchange (ETDEWEB)

    Danker, W.

    1996-05-01

    This report describes issues discussed at a session from the PLutonium Stabilization and Immobilization Workshop related to safeguards and retrievability from waste forms. Throughout the discussion, the group probed the goals of disposition efforts, particularly an understanding of the {open_quotes}spent fuel standard{close_quotes}, since the disposition material form derives from these goals. The group felt strongly that not only the disposition goals but safeguards to meet these goals could affect the material form. Accordingly, the Department was encouraged to explore and apply safeguards as early in the implementation process as possible. It was emphasized that this was particularly true for any planned use of existing facilities. It is much easier to build safeguards approaches into the development of new facilities, than to backfit existing facilities. Accordingly, special safeguards challenges are likely to be encountered, given the cost and schedule advantages offered by use of existing facilities.

  2. Moon (Form-Origin)

    Science.gov (United States)

    Tsiapas, Elias; Soumelidou, Despina; Tsiapas, Christos

    2017-04-01

    When the Earth was formed, it was in a state of burning heat. As time went by, temperature on the planet's surface was falling due to radiation and heat transfer, and various components (crusts) began taking solid form at the Earth's poles. The formation of crusts took place at the Earth's poles, because the stirring of burning and fluid masses on the surface of the Earth was significantly slighter there than it was on the equator. Due to centrifugal force and Coriolis Effect, these solid masses headed towards the equator; those originating from the North Pole followed a south-western course, while those originating from the South Pole followed a north-western course and there they rotated from west to east at a lower speed than the underlying burning and liquid earth, because of their lower initial linear velocity, their solid state and inertia. Because inertia is proportional to mass, the initially larger solid body swept all new solid ones, incorporating them to its western side. The density of the new solid masses was higher, because the components on the surface would freeze and solidify first, before the underlying thicker components. As a result, the western side of the initial islet of solid rocks submerged, while the east side elevated. . As a result of the above, this initial islet began to spin in reverse, and after taking on the shape of a sphere, it formed the "heart" of the Moon. The Moon-sphere, rolling on the equator, would sink the solid rocks that continued to descend from the Earth's poles. The sinking rocks partially melted because of higher temperatures in the greater depths that the Moon descended to, while part of the rocks' mass bonded with the Moon and also served as a heat-insulating material, preventing the descended side of the sphere from melting. Combined with the Earth's liquid mass that covered its emerging eastern surface, new sphere-shaped shells were created, with increased density and very powerful structural cohesion. During the

  3. The combinatorial derivation

    Directory of Open Access Journals (Sweden)

    Igor V. Protasov

    2013-09-01

    $\\Delta(A=\\{g\\in G:|gA\\cap A|=\\infty\\}$. The mapping $\\Delta:\\mathcal{P}_G\\rightarrow\\mathcal{P}_G$, $A\\mapsto\\Delta(A$, is called a combinatorial derivation and can be considered as an analogue of the topological derivation $d:\\mathcal{P}_X\\rightarrow\\mathcal{P}_X$, $A\\mapsto A^d$, where $X$ is a topological space and $A^d$ is the set of all limit points of $A$. Content: elementary properties, thin and almost thin subsets, partitions, inverse construction and $\\Delta$-trajectories,  $\\Delta$ and $d$.

  4. Optimal economic order quantity for buyer-distributor-vendor supply chain with backlogging derived without derivatives

    Science.gov (United States)

    Teng, Jinn-Tsair; Cárdenas-Barrón, Leopoldo Eduardo; Lou, Kuo-Ren; Wee, Hui Ming

    2013-05-01

    In this article, we first complement an inappropriate mathematical error on the total cost in the previously published paper by Chung and Wee [2007, 'Optimal the Economic Lot Size of a Three-stage Supply Chain With Backlogging Derived Without Derivatives', European Journal of Operational Research, 183, 933-943] related to buyer-distributor-vendor three-stage supply chain with backlogging derived without derivatives. Then, an arithmetic-geometric inequality method is proposed not only to simplify the algebraic method of completing prefect squares, but also to complement their shortcomings. In addition, we provide a closed-form solution to integral number of deliveries for the distributor and the vendor without using complex derivatives. Furthermore, our method can solve many cases in which their method cannot, because they did not consider that a squared root of a negative number does not exist. Finally, we use some numerical examples to show that our proposed optimal solution is cheaper to operate than theirs.

  5. Energy derivatives, experiences in derivative trading from the natural gas industry : back to basics

    International Nuclear Information System (INIS)

    Dittmer, G.; Coyle, T.

    1998-01-01

    Some basic facts regarding derivatives in the electric power industry were discussed based on experiences in the natural gas industry. Derivatives were described as financial instruments that have no value of their own but derive their value from other assets, such as commodities. Futures and Options are the two forms of derivatives. Electricity as a commodity was characterized, and a historical parallel was drawn between deregulation in the natural gas and electric power industry. Short term and long term factors impacting the market and market dynamics impacting derivatives were identified. The latter include: (1) volatility, (2) liquidity, (3) correlations, and (4) price discovery. In contrast to the natural gas market, the electricity market is considered as lacking liquidity and in need of moving farther along the maturity timeline. The question of natural gas/ electricity convergence was also addressed refs., tabs., figs

  6. Radiation processing of polysaccharide derivatives

    International Nuclear Information System (INIS)

    Yoshii, Fumio

    2004-01-01

    Carboxymethylcellulose (CMC), carboxymethylstarch (CMS), carboxymethylchitin (CM-chitin) and carboxymethylchitosan (CM-chitosan) form gels when irradiated at paste-like condition. Bedsore prevention mat filled up CMC hydrogel crosslinked by irradiation at paste-like condition was practical applied as a health care products. It was found that CM-chitosan hydrogels have anti-microbial activity and effective as absorbents to remove metal ions. When crosslinked gel sheets of CM-chitin and CM-chitosan were immersed in copper (II) aqueous solution, absorption of Cu (II) were 161 mg/g and 172 mg/g, respectively. Radiation crosslinking of cellulose derivative such as hydroxypropyl methylcellulose phthalate, (HPMCP) kneaded with aqueous alkali solution and methanol was achieved with EB-irradiation at paste-like condition. The HPMCP gel absorbed organic solvents such as chloroform and pyridine. (author)

  7. Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, their hierarchies and bi-Hamiltonian structures

    Energy Technology Data Exchange (ETDEWEB)

    Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

    2009-10-02

    Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.

  8. How desert varnish forms?

    Science.gov (United States)

    Perry, Randall S.; Kolb, Vera M.; Lynne, Bridget Y.; Sephton, Mark A.; Mcloughlin, Nicola; Engel, Michael H.; Olendzenski, Lorraine; Brasier, Martin; Staley, James T., Jr.

    2005-09-01

    Desert varnish is a black, manganese-rich rock coating that is widespread on Earth. The mechanism underlying its formation, however, has remained unresolved. We present here new data and an associated model for how desert varnish forms, which substantively challenges previously accepted models. We tested both inorganic processes (e.g. clays and oxides cementing coatings) and microbial methods of formation. Techniques used in this preliminary study include SEM-EDAX with backscatter, HRTEM of focused ion beam prepared (FIB) wafers and several other methods including XRPD, Raman spectroscopy, XPS and Tof-SIMS. The only hypothesis capable of explaining a high water content, the presence of organic compounds, an amorphous silica phase (opal-A) and lesser quantities of clays than previously reported, is a mechanism involving the mobilization and redistribution of silica. The discovery of silica in desert varnish suggests labile organics are preserved by interaction with condensing silicic acid. Organisms are not needed for desert varnish formation but Bacteria, Archaea, Eukarya, and other organic compounds are passively incorporated and preserved as organominerals. The rock coatings thus provide useful records of past environments on Earth and possibly other planets. Additionally this model also helps to explain the origin of key varnish and rock glaze features, including their hardness, the nature of the "glue" that binds heterogeneous components together, its layered botryoidal morphology, and its slow rate of formation.

  9. How delusion is formed?

    Science.gov (United States)

    Park, Jong Suk; Kang, Ung Gu

    2016-02-01

    Traditionally, delusions have been considered to be the products of misinterpretation and irrationality. However, some theorists have argued that delusions are normal or rational cognitive responses to abnormal experiences. That is, when a recently experienced peculiar event is more plausibly explained by an extraordinary hypothesis, confidence in the veracity of this extraordinary explanation is reinforced. As the number of such experiences, driven by the primary disease process in the perceptual domain, increases, this confidence builds and solidifies, forming a delusion. We tried to understand the formation of delusions using a simulation based on Bayesian inference. We found that (1) even if a delusional explanation is only marginally more plausible than a non-delusional one, the repetition of the same experience results in a firm belief in the delusion. (2) The same process explains the systematization of delusions. (3) If the perceived plausibility of the explanation is not consistent but varies over time, the development of a delusion is delayed. Additionally, this model may explain why delusions are not corrected by persuasion or rational explanation. This Bayesian inference perspective can be considered a way to understand delusions in terms of rational human heuristics. However, such experiences of "rationality" can lead to irrational conclusions, depending on the characteristics of the subject. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Image forming apparatus

    DEFF Research Database (Denmark)

    2005-01-01

    An image H(x, y) for displaying a target image G(x, y) is displayed on a liquid-crystal display panel and illumination light from an illumination light source is made to pass therethrough to form an image on a PALSLM. Read light hv is radiated to the PALSLM and a phase-modulated light image alpha...... (x, y) read out of the PALSLM is subjected to Fourier transform by a lens. A phase contrast filter gives a predetermined phase shift to only the zero-order light component of Fourier light image alpha f(x, y). The phase-shifted light image is subjected to inverse Fourier transform by a lens...... to project an output image O(x, y) to an output plane. A light image O'(x, y) branched by a beam sampler is picked up by a pickup device and an evaluation value calculating unit evaluates conformity between the image O(x, y) and the image G(x, y).; A control unit performs feedback control of optical...

  11. Quinazolin-4-one derivatives

    DEFF Research Database (Denmark)

    Mosley, Cara A; Acker, Timothy M; Hansen, Kasper Bø

    2010-01-01

    We describe a new class of subunit-selective antagonists of N-methyl D-aspartate (NMDA)-selective ionotropic glutamate receptors that contain the (E)-3-phenyl-2-styrylquinazolin-4(3H)-one backbone. The inhibition of recombinant NMDA receptor function induced by these quinazolin-4-one derivatives...

  12. Metal borohydrides and derivatives

    DEFF Research Database (Denmark)

    Paskevicius, Mark; Haarh Jepsen, Lars; Schouwink, Pascal

    2017-01-01

    major classes of metal borohydride derivatives have also been discovered: anion-substituted compounds where the complex borohydride anion, BH4 -, is replaced by another anion, i.e. a halide or amide ion; and metal borohydrides modified with neutral molecules, such as NH3, NH3BH3, N2H4, etc. Here, we...

  13. 78 FR 32191 - Derivatives

    Science.gov (United States)

    2013-05-29

    ... rate risk. This proposed rule applies to federal credit unions and any federally insured, state... risk to the National Credit Union Share Insurance Fund (NCUSIF). \\1\\ A derivative is an instrument... degrees of risk to a credit union. Accordingly, this risk calls for a more robust asset/ liability...

  14. Superstability of Generalized Derivations

    Directory of Open Access Journals (Sweden)

    Esmaeil Ansari-Piri

    2010-01-01

    Full Text Available We investigate the superstability of the functional equation f(xy=xf(y+g(xy, where f and g are the mappings on Banach algebra A. We have also proved the superstability of generalized derivations associated to the linear functional equation f(γx+βy=γf(x+βf(y, where γ,β∈ℂ.

  15. Comments on electromagnetic form factors of the nucleon

    International Nuclear Information System (INIS)

    Sachs, R.G.; Wali, K.C.

    1989-01-01

    This paper draws the concept of nucleon form factors further to consider the electromagnetic aspect based on the magnetic moment of the nucleon. These are seen as valid physical interpretations of form factors in electron-nucleon interactions. A linear combination of two functions, associated with charge radius, is derived, which agreed well with experimental results. The paper also expands the specific form to include relativistic cases and consider appropriate frames of reference. (UK)

  16. Forms of War

    Energy Technology Data Exchange (ETDEWEB)

    Vogel, H. [Asklepios Klinik St. Georg, Roentgenabteilung, Lohmuehlenstrasse 5, 20099 Hamburg (Germany)], E-mail: Hermann.vogel@ak-stgeorg.lbk-hh.de; Bartelt, D. [Asklepios Klinik St. Georg, Roentgenabteilung, Lohmuehlenstrasse 5, 20099 Hamburg (Germany)

    2007-08-15

    Purpose: Under war conditions, employed weapons can be identified on radiographs obtained in X-ray diagnostic. The analysis of such X-ray films allows concluding that there are additional information about the conditions of transport and treatment; it shall be shown that there are X-ray findings which are typical and characteristic for certain forms of warfare. Material and method: The radiograms have been collected during thirty years; they come from hospitals, where war casualties had been treated, and personal collections. Results: The material is selected, because in war X-ray diagnostic will be limited and the interest of the opposing parties influence the access to the material; furthermore the possibilities to publish or to communicate facts and thoughts are different. Citizens of the USA, GB, France, or Israel will have easier access to journals than those of Vietnam, Chad, and Zimbabwe. Under war conditions, poor countries, like North Vietnam may develop own concepts of medical care. There are X-ray findings which are typical or even characteristic for air warfare, guerrilla warfare, gas war, desert warfare, conventional warfare, and annihilation warfare, and city guerrilla warfare/civil war. The examples demonstrate that weapons and the conditions of transport and treatment can be recognized by X-ray findings. The radiogram can be read like a document. Conclusion: In War, there are differences between a treatment and imaging diagnostic in countries, which control the air space and in those who do not. Medical care of the poor, i.e. in countries (in general those opposing the western nations) will hardly be published, and poverty has no advocate.

  17. Forms of War

    International Nuclear Information System (INIS)

    Vogel, H.; Bartelt, D.

    2007-01-01

    Purpose: Under war conditions, employed weapons can be identified on radiographs obtained in X-ray diagnostic. The analysis of such X-ray films allows concluding that there are additional information about the conditions of transport and treatment; it shall be shown that there are X-ray findings which are typical and characteristic for certain forms of warfare. Material and method: The radiograms have been collected during thirty years; they come from hospitals, where war casualties had been treated, and personal collections. Results: The material is selected, because in war X-ray diagnostic will be limited and the interest of the opposing parties influence the access to the material; furthermore the possibilities to publish or to communicate facts and thoughts are different. Citizens of the USA, GB, France, or Israel will have easier access to journals than those of Vietnam, Chad, and Zimbabwe. Under war conditions, poor countries, like North Vietnam may develop own concepts of medical care. There are X-ray findings which are typical or even characteristic for air warfare, guerrilla warfare, gas war, desert warfare, conventional warfare, and annihilation warfare, and city guerrilla warfare/civil war. The examples demonstrate that weapons and the conditions of transport and treatment can be recognized by X-ray findings. The radiogram can be read like a document. Conclusion: In War, there are differences between a treatment and imaging diagnostic in countries, which control the air space and in those who do not. Medical care of the poor, i.e. in countries (in general those opposing the western nations) will hardly be published, and poverty has no advocate

  18. A 'simple' hybrid model for power derivatives

    International Nuclear Information System (INIS)

    Lyle, Matthew R.; Elliott, Robert J.

    2009-01-01

    This paper presents a method for valuing power derivatives using a supply-demand approach. Our method extends work in the field by incorporating randomness into the base load portion of the supply stack function and equating it with a noisy demand process. We obtain closed form solutions for European option prices written on average spot prices considering two different supply models: a mean-reverting model and a Markov chain model. The results are extensions of the classic Black-Scholes equation. The model provides a relatively simple approach to describe the complicated price behaviour observed in electricity spot markets and also allows for computationally efficient derivatives pricing. (author)

  19. Approximate *-derivations and approximate quadratic *-derivations on C*-algebras

    Directory of Open Access Journals (Sweden)

    Park Choonkil

    2011-01-01

    Full Text Available Abstract In this paper, we prove the stability of *-derivations and of quadratic *-derivations on Banach *-algebras. We moreover prove the superstability of *-derivations and of quadratic *-derivations on C*-algebras. 2000 Mathematics Subject Classification: 39B52; 47B47; 46L05; 39B72.

  20. Optimal Mortgage Refinancing: A Closed Form Solution.

    Science.gov (United States)

    Agarwal, Sumit; Driscoll, John C; Laibson, David I

    2013-06-01

    We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least [Formula: see text] In this formula W (.) is the Lambert W -function, [Formula: see text] ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods.

  1. Optimal Mortgage Refinancing: A Closed Form Solution

    Science.gov (United States)

    Agarwal, Sumit; Driscoll, John C.; Laibson, David I.

    2013-01-01

    We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least 1ψ[ϕ+W(−exp(−ϕ))]. In this formula W(.) is the Lambert W-function, ψ=2(ρ+λ)σ,ϕ=1+ψ(ρ+λ)κ∕M(1−τ), ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods. PMID:25843977

  2. Variational problems with fractional derivatives: Euler-Lagrange equations

    International Nuclear Information System (INIS)

    Atanackovic, T M; Konjik, S; Pilipovic, S

    2008-01-01

    We generalize the fractional variational problem by allowing the possibility that the lower bound in the fractional derivative does not coincide with the lower bound of the integral that is minimized. Also, for the standard case when these two bounds coincide, we derive a new form of Euler-Lagrange equations. We use approximations for fractional derivatives in the Lagrangian and obtain the Euler-Lagrange equations which approximate the initial Euler-Lagrange equations in a weak sense

  3. Hedging Yield with Weather Derivatives: A Role for Options

    OpenAIRE

    Manfredo, Mark R.; Richards, Timothy J.

    2005-01-01

    While there are few risk management alternatives available to specialty crop growers, weather derivatives provide an important advancement. As with the use of any derivatives contract, the behavior of the basis will ultimately determine the net-hedged outcome. However, when using weather derivatives to hedge yield risks for specialty crops, growers face a unique form of basis risk because weather (temperature) and yield are nonlinearly related. Using the forecast encompassing principle, this ...

  4. Physical equivalence of the point and instant forms of relativistic dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Sokolov, S N [Gosudarstvennyj Komitet po Ispol' zovaniyu Atomnoj Ehnergii SSSR, Serpukhov. Inst. Fiziki Vysokikh Ehnergij

    1975-01-01

    As a proof of total physical equivalence of point and instantaneous forms of dynamics, a unitary transformation is derived which connects these forms of dynamics without changing the scattering matrix.

  5. Infection studies in mink with seal-derived morbillivirus

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, M; Svansson, V; Have, P.

    1989-01-01

    Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper.......Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper....

  6. A new derivation of Dirac's magnetic monopole strength

    International Nuclear Information System (INIS)

    Panat, P V

    2003-01-01

    A new derivation of the strength of Dirac's magnetic monopole is presented which does not require an explicit form of the magnetic induction in terms of g, the magnetic pole strength. The derivation essentially uses a modification of Faraday's law of induction and quantization of angular momentum

  7. Remarks on the microscopic derivation of the collective model

    International Nuclear Information System (INIS)

    Toyoda, T.; Wildermuth, K.

    1984-01-01

    The rotational part of the phenomenological collective model of Bohr and Mottelson and others is derived microscopically, starting with the Schrodinger equation written in projection form and introducing a new set of 'relative Euler angles'. In order to derive the local Schrodinger equation of the collective model, it is assumed that the intrinsic wave functions give strong peaking properties to the overlapping kernels

  8. Characterization of form variants of Xenorhabdus luminescens.

    Science.gov (United States)

    Gerritsen, L J; de Raay, G; Smits, P H

    1992-01-01

    From Xenorhabdus luminescens XE-87.3 four variants were isolated. One, which produced a red pigment and antibiotics, was luminescent, and could take up dye from culture media, was considered the primary form (XE-red). A pink-pigmented variant (XE-pink) differed from the primary form only in pigmentation and uptake of dye. Of the two other variants, one produced a yellow pigment and fewer antibiotics (XE-yellow), while the other did not produce a pigment or antibiotics (XE-white). Both were less luminescent, did not take up dye, and had small cell and colony sizes. These two variants were very unstable and shifted to the primary form after 3 to 5 days. It was not possible to separate the primary form and the white variant completely; subcultures of one colony always contained a few colonies of the other variant. The white variant was also found in several other X. luminescens strains. DNA fingerprints showed that all four variants are genetically identical and are therefore derivatives of the same parent. Protein patterns revealed a few differences among the four variants. None of the variants could be considered the secondary form. The pathogenicity of the variants decreased in the following order: XE-red, XE-pink, XE-yellow, and XE-white. The mechanism and function of this variability are discussed. Images PMID:1622273

  9. Derived enriched uranium market

    International Nuclear Information System (INIS)

    Rutkowski, E.

    1996-01-01

    The potential impact on the uranium market of highly enriched uranium from nuclear weapons dismantling in the Russian Federation and the USA is analyzed. Uranium supply, conversion, and enrichment factors are outlined for each country; inventories are also listed. The enrichment component and conversion components are expected to cause little disruption to uranium markets. The uranium component of Russian derived enriched uranium hexafluoride is unresolved; US legislation places constraints on its introduction into the US market

  10. Computation of Mie derivatives.

    Science.gov (United States)

    Li, Yang; Bowler, Nicola

    2013-07-10

    Analytical expressions are obtained for the derivatives of Mie scattering coefficients with respect to the electrical radius of the spherical scattering particle, and to the relative permittivity and permeability of both the particle and the surrounding medium. Their corresponding approximate expressions are developed to avoid numerical overflow based on the logarithmic derivative of Riccati-Bessel functions. The analytical expressions have been verified by comparing their results with those calculated by analytical expressions developed by Mathematica. Compared with the numerical derivative, the analytical expressions and approximate expressions show a higher accuracy and are 2.0 and 2.8 times, respectively, faster in the case of a single magnetodielectric sphere. Generally, for spheres with an electrical radius in a large range, the approximate expressions can yield acceptable accuracy and computation time up to a high order. This work can be used in the design of nonmetallic metamaterials, and in the retrieval of aerosol properties from remote sensing data. An example calculation is given for the design of an optical, all-dielectric, mu-negative metamaterial consisting of a simple cubic array of tellurium nanoparticles.

  11. Multifunctional Cinnamic Acid Derivatives

    Directory of Open Access Journals (Sweden)

    Aikaterini Peperidou

    2017-07-01

    Full Text Available Our research to discover potential new multitarget agents led to the synthesis of 10 novel derivatives of cinnamic acids and propranolol, atenolol, 1-adamantanol, naphth-1-ol, and (benzylamino ethan-1-ol. The synthesized molecules were evaluated as trypsin, lipoxygenase and lipid peroxidation inhibitors and for their cytotoxicity. Compound 2b derived from phenoxyphenyl cinnamic acid and propranolol showed the highest lipoxygenase (LOX inhibition (IC50 = 6 μΜ and antiproteolytic activity (IC50 = 0.425 μΜ. The conjugate 1a of simple cinnamic acid with propranolol showed the higher antiproteolytic activity (IC50 = 0.315 μΜ and good LOX inhibitory activity (IC50 = 66 μΜ. Compounds 3a and 3b, derived from methoxylated caffeic acid present a promising combination of in vitro inhibitory and antioxidative activities. The S isomer of 2b also presented an interesting multitarget biological profile in vitro. Molecular docking studies point to the fact that the theoretical results for LOX-inhibitor binding are identical to those from preliminary in vitro study.

  12. Funding climate adaptation strategies with climate derivatives

    Directory of Open Access Journals (Sweden)

    L. Richard Little

    2015-01-01

    Full Text Available Climate adaptation requires large capital investments that could be provided not only by traditional sources like governments and banks, but also by derivatives markets. Such markets would allow two parties with different tolerances and expectations about climate risks to transact for their mutual benefit and, in so doing, finance climate adaptation. Here we calculate the price of a derivative called a European put option, based on future sea surface temperature (SST in Tasmania, Australia, with an 18 °C strike threshold. This price represents a quantifiable indicator of climate risk, and forms the basis for aquaculture industries exposed to the risk of higher SST to finance adaptation strategies through the sale of derivative contracts. Such contracts provide a real incentive to parties with different climate outlooks, or risk exposure to take a market assessment of climate change.

  13. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU

    2011-01-01

    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  14. Credit derivatives and risk management

    OpenAIRE

    Michael S. Gibson

    2007-01-01

    The striking growth of credit derivatives suggests that market participants find them to be useful tools for risk management. I illustrate the value of credit derivatives with three examples. A commercial bank can use credit derivatives to manage the risk of its loan portfolio. An investment bank can use credit derivatives to manage the risks it incurs when underwriting securities. An investor, such as an insurance company, asset manager, or hedge fund, can use credit derivatives to align its...

  15. Credit derivatives in emerging markets

    OpenAIRE

    Romain Rancière

    2002-01-01

    Credit Derivatives are securities that offer protection against credit or default risk of bonds or loans. The credit derivatives emerging market has grown rapidly and credit derivatives are widely used. This paper describes the emerging credit derivatives market structure. The current market activity is analyzed through elementary pricing dynamics and the study of the term structure of default risk. Focusing on the performance of credit derivatives in stress situation, including legal and mar...

  16. Perturbative QCD and electromagnetic form factors

    International Nuclear Information System (INIS)

    Carlson, C.E.; Gross, F.

    1987-01-01

    We calculate nucleon magnetic form factors using perturbative QCD for several distribution amplitudes including a general one given in terms of Appell polynomials. We find that the magnitude and sign of both nucleon magnetic form factors can be explained within perturbative QCD. The observed normalization of G/sub Mp/ requires that the distribution amplitude be broader than its superhigh momentum transfer limit, and the G/sub Mn//G/sub Mp/ data may require the distribution amplitude to be asymmetric, in accord with distribution amplitudes derived from QCD sum rules. Some speculation as to how an asymmetric distribution amplitude can come about is offered. Finally, we show that the soft contributions corresponding to the particular distribution amplitudes we use need not be bigger than the data. 16 refs., 6 figs

  17. Calculus of tensors and differential forms

    CERN Document Server

    Sinha, Rajnikant

    2014-01-01

    Calculus of tensors and differential forms is an introductory-level textbook. Through this book, students will familiarize themselves with tools they need in order to use for further study on general relativity and research, such as affine tensors, tensor calculus on manifolds, relative tensors, Lie derivatives, wedge products, differential forms, and Stokes' theorem. The treatment is concrete and in detail, so that abstract concepts do not deter even physics and engineering students. This self contained book requires undergraduate-level calculus of several variables and linear algebra as prerequisite. Fubini's theorem in real analysis, to be used in Stokes' theorem, has been proved earlier than Stokes' theorem so that students don't have to search elsewhere.

  18. Differential form representation of stochastic electromagnetic fields

    Directory of Open Access Journals (Sweden)

    M. Haider

    2017-09-01

    Full Text Available In this work, we revisit the theory of stochastic electromagnetic fields using exterior differential forms. We present a short overview as well as a brief introduction to the application of differential forms in electromagnetic theory. Within the framework of exterior calculus we derive equations for the second order moments, describing stochastic electromagnetic fields. Since the resulting objects are continuous quantities in space, a discretization scheme based on the Method of Moments (MoM is introduced for numerical treatment. The MoM is applied in such a way, that the notation of exterior calculus is maintained while we still arrive at the same set of algebraic equations as obtained for the case of formulating the theory using the traditional notation of vector calculus. We conclude with an analytic calculation of the radiated electric field of two Hertzian dipole, excited by uncorrelated random currents.

  19. Differential form representation of stochastic electromagnetic fields

    Science.gov (United States)

    Haider, Michael; Russer, Johannes A.

    2017-09-01

    In this work, we revisit the theory of stochastic electromagnetic fields using exterior differential forms. We present a short overview as well as a brief introduction to the application of differential forms in electromagnetic theory. Within the framework of exterior calculus we derive equations for the second order moments, describing stochastic electromagnetic fields. Since the resulting objects are continuous quantities in space, a discretization scheme based on the Method of Moments (MoM) is introduced for numerical treatment. The MoM is applied in such a way, that the notation of exterior calculus is maintained while we still arrive at the same set of algebraic equations as obtained for the case of formulating the theory using the traditional notation of vector calculus. We conclude with an analytic calculation of the radiated electric field of two Hertzian dipole, excited by uncorrelated random currents.

  20. "Domestic Violence" and Different Forms of Conciliation

    Directory of Open Access Journals (Sweden)

    Guita Grin Debert

    2008-01-01

    Full Text Available Alternative conflict resolution based on conciliation have been identified as a possible response to problems of access to courts deriving from the numbers, costs and length of proceedings in the Brazilian's judicial system. This paper focuses on these alternative forms of justice, regarding domestic violence. Using ethnographic studies of Women's Police Stations and at Small Claim Courts, we argue that conciliation can be very different in these two institutions of the judicial system. The contrasts between moral values and the symbols used in different forms by these two institutions offer elements that can further be our understanding of the context in which Maria da Penha Law was created on August 17th of 2006. With the promulgation of this law, cases of domestic violence against women were excluded from Small Claim Courts in Brazil.

  1. Advances in metal forming expert system for metal forming

    CERN Document Server

    Hingole, Rahulkumar Shivajirao

    2015-01-01

    This comprehensive book offers a clear account of the theory and applications of advanced metal forming. It provides a detailed discussion of specific forming processes, such as deep drawing, rolling, bending extrusion and stamping. The author highlights recent developments of metal forming technologies and explains sound, new and powerful expert system techniques for solving advanced engineering problems in metal forming. In addition, the basics of expert systems, their importance and applications to metal forming processes, computer-aided analysis of metalworking processes, formability analysis, mathematical modeling and case studies of individual processes are presented.

  2. Alkylation of Zwitterionic Thiooxalic Acid Derivatives

    Directory of Open Access Journals (Sweden)

    Manfred Michalik

    2001-05-01

    Full Text Available The new S-alkyl thiooxal-1-hydrazono-2-amidrazonium halides 2-4 were synthesized by reaction of the corresponding zwitterionic thiooxalic acid derivatives 1 with alkyl halides in methanol. The structures of compounds 4b and 4d were proven by X-ray structural analysis. Both compounds form an interesting intermolecular network of hydrogen bonds in the solid state.

  3. Two-loop SL(2) form factors and maximal transcendentality

    International Nuclear Information System (INIS)

    Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2016-01-01

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  4. Form factors of the finite quantum XY-chain

    International Nuclear Information System (INIS)

    Iorgov, Nikolai

    2011-01-01

    Explicit factorized formulas for the matrix elements (form factors) of the spin operators σ x and σ y between the eigenvectors of the Hamiltonian of the finite quantum periodic XY-chain in a transverse field were derived. The derivation is based on the relations between three models: the model of quantum XY-chain, Ising model on 2D lattice and N = 2 Baxter-Bazhanov-Stroganov τ (2) -model. Due to these relations we transfer the formulas for the form factors of the latter model recently obtained by the use of separation of variables method to the model of quantum XY-chain. Hopefully, the formulas for the form factors will help in analysis of multipoint dynamic correlation functions at a finite temperature. As an example, we re-derive the asymptotics of the two-point correlation function in the disordered phase without the use of the Toeplitz determinants and the Wiener-Hopf factorization method.

  5. Two-loop SL(2) form factors and maximal transcendentality

    Energy Technology Data Exchange (ETDEWEB)

    Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)

    2016-12-19

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  6. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  7. A compiler for variational forms

    OpenAIRE

    Kirby, Robert C.; Logg, Anders

    2011-01-01

    As a key step towards a complete automation of the finite element method, we present a new algorithm for automatic and efficient evaluation of multilinear variational forms. The algorithm has been implemented in the form of a compiler, the FEniCS Form Compiler FFC. We present benchmark results for a series of standard variational forms, including the incompressible Navier-Stokes equations and linear elasticity. The speedup compared to the standard quadrature-based approach is impressive; in s...

  8. Adaptive Municipal e-forms

    NARCIS (Netherlands)

    Kuiper, P.M.; van Dijk, Elisabeth M.A.G.; Boerma, A.K.; Weibelzahl, S.; Cristea, A.

    2006-01-01

    Adaptation of electronic forms seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer eforms online that can be used to request a municipal product or service. To create adaptive e-forms that satisfy the need of end-users, involvement of

  9. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    Energy Technology Data Exchange (ETDEWEB)

    Safari, L., E-mail: laleh.safari@ist.ac.at [IST Austria (Institute of Science and Technology Austria), Am Campus 1, 3400 Klosterneuburg (Austria); Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Santos, J. P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Amaro, P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Physikalisches Institut, Universität Heidelberg, D-69120 Heidelberg (Germany); Jänkälä, K. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Fratini, F. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Institute of Atomic and Subatomic Physics, TU Wien, Stadionallee 2, 1020 Wien (Austria); Departamento de Física, Instituto de Ciências Exatas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG (Brazil)

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  10. In defense of derivations

    Science.gov (United States)

    Mungan, Carl E.

    2016-05-01

    At the 2015 AAPT Summer Meeting, I presented four derivations of the formula for motional emf. Such physics derivations involve the construction of explanatory frameworks involving diagrams and mathematical models. Although textbooks devote considerable space to such explanations, many teachers and students spend their time on worksheets, end-of-chapter problems, and the like. The book is reduced to a bank of solved (i.e., example) and unsolved (i.e., homework) questions, along with equations in colored boxes that presumably are to be used to answer those questions. Such an approach encourages fragmentation of knowledge, the view that there is only one right answer to a problem with the goal of physics being to find that answer (neatly boxed of course), and the inability to reason about even a slightly different (much less a novel) situation. If we are to develop scientific literacy, significant course time must be devoted to explaining the structure of and support for the models and equations we use.

  11. Forms of organic phosphorus in wetland soils

    Science.gov (United States)

    Cheesman, A. W.; Turner, B. L.; Reddy, K. R.

    2014-12-01

    Phosphorus (P) cycling in freshwater wetlands is dominated by biological mechanisms, yet there has been no comprehensive examination of the forms of biogenic P (i.e., forms derived from biological activity) in wetland soils. We used solution 31P NMR spectroscopy to identify and quantify P forms in surface soils of 28 palustrine wetlands spanning a range of climatic, hydrogeomorphic, and vegetation types. Total P concentrations ranged between 51 and 3516 μg P g-1, of which an average of 58% was extracted in a single-step NaOH-EDTA procedure. The extracts contained a broad range of P forms, including phosphomonoesters (averaging 24% of the total soil P), phosphodiesters (averaging 10% of total P), phosphonates (up to 4% of total P), and both pyrophosphate and long-chain polyphosphates (together averaging 6% of total P). Soil P composition was found to be dependant upon two key biogeochemical properties: organic matter content and pH. For example, stereoisomers of inositol hexakisphosphate were detected exclusively in acidic soils with high mineral content, while phosphonates were detected in soils from a broad range of vegetation and hydrogeomorphic types but only under acidic conditions. Conversely inorganic polyphosphates occurred in a broad range of wetland soils, and their abundance appears to reflect more broadly that of a "substantial" and presumably active microbial community with a significant relationship between total inorganic polyphosphates and microbial biomass P. We conclude that soil P composition varies markedly among freshwater wetlands but can be predicted by fundamental soil properties.

  12. Normal forms of Hopf-zero singularity

    International Nuclear Information System (INIS)

    Gazor, Majid; Mokhtari, Fahimeh

    2015-01-01

    The Lie algebra generated by Hopf-zero classical normal forms is decomposed into two versal Lie subalgebras. Some dynamical properties for each subalgebra are described; one is the set of all volume-preserving conservative systems while the other is the maximal Lie algebra of nonconservative systems. This introduces a unique conservative–nonconservative decomposition for the normal form systems. There exists a Lie-subalgebra that is Lie-isomorphic to a large family of vector fields with Bogdanov–Takens singularity. This gives rise to a conclusion that the local dynamics of formal Hopf-zero singularities is well-understood by the study of Bogdanov–Takens singularities. Despite this, the normal form computations of Bogdanov–Takens and Hopf-zero singularities are independent. Thus, by assuming a quadratic nonzero condition, complete results on the simplest Hopf-zero normal forms are obtained in terms of the conservative–nonconservative decomposition. Some practical formulas are derived and the results implemented using Maple. The method has been applied on the Rössler and Kuramoto–Sivashinsky equations to demonstrate the applicability of our results. (paper)

  13. Normal forms of Hopf-zero singularity

    Science.gov (United States)

    Gazor, Majid; Mokhtari, Fahimeh

    2015-01-01

    The Lie algebra generated by Hopf-zero classical normal forms is decomposed into two versal Lie subalgebras. Some dynamical properties for each subalgebra are described; one is the set of all volume-preserving conservative systems while the other is the maximal Lie algebra of nonconservative systems. This introduces a unique conservative-nonconservative decomposition for the normal form systems. There exists a Lie-subalgebra that is Lie-isomorphic to a large family of vector fields with Bogdanov-Takens singularity. This gives rise to a conclusion that the local dynamics of formal Hopf-zero singularities is well-understood by the study of Bogdanov-Takens singularities. Despite this, the normal form computations of Bogdanov-Takens and Hopf-zero singularities are independent. Thus, by assuming a quadratic nonzero condition, complete results on the simplest Hopf-zero normal forms are obtained in terms of the conservative-nonconservative decomposition. Some practical formulas are derived and the results implemented using Maple. The method has been applied on the Rössler and Kuramoto-Sivashinsky equations to demonstrate the applicability of our results.

  14. Forms of address in Isizulu

    OpenAIRE

    2014-01-01

    M.A. (African Studies) The study deals with forms of address in isiZulu. Therefore, the various aspects of speech that play roles when addressing a person, the factors affecting forms of address in isiZulu and the effect of languages such as English, Afrikaans and other African languages on the forms of address in isiZulu are of interest. Research was conducted on forms of address in isiZulu in parts of Soweto and it was discovered that form of address are determined by different factors i...

  15. The Pricing of Traffic Light Options and other Correlation Derivatives

    DEFF Research Database (Denmark)

    Kokholm, Thomas

    This paper considers the valuation of European style derivatives with payoffs depending on both a stock index and underlying LIBOR rates. The model has the attractive feature that it is based on observable market quantities which makes it very easy to calibrate. A closed form solution is derived...... for the price of the correlation derivative known as the traffic light option under lognormality assumptions for the underlying processes. A pricing approach for more general payoffs is presented, and an illustration is performed with Monte Carlo simulation by the pricing of a specific hybrid derivative...

  16. An intrinsic and exterior form of the Bianchi identities

    Science.gov (United States)

    Do, Thoan; Prince, Geoff

    2017-09-01

    We give an elegant formulation of the structure equations (of Cartan) and the Bianchi identities in terms of exterior calculus without reference to a particular basis and without the exterior covariant derivative. This approach allows both structure equations and the Bianchi identities to be expressed in terms of forms of arbitrary degree. We demonstrate the relationship with both the conventional vector version of the Bianchi identities and to the exterior covariant derivative approach. Contact manifolds, codimension one foliations and the Cartan form of classical mechanics are studied as examples of its flexibility and utility.

  17. Food derived carcinogenic amnoimidazoazaarenes

    DEFF Research Database (Denmark)

    Frandsen, Henrik

    Carcinogenic aminoimidazoazaarenes are formed during cooking of meat and fish. Important factors for the formation of these compounds are meat type, cooking temperature and time. The compounds are genotoxic in bacterial and mammalian cells. In animal feeding studies the compounds tested so far were...... of the exocyclic amino group. Estimations of human cancer risk have indicated that ingestion of food containing aminoimidazoazaarenes are of importance....

  18. 6-Bromocholesterol derivatives

    International Nuclear Information System (INIS)

    Flanagan, R.J.

    1984-01-01

    Novel 6-bromo derivatives of cholesterol have the formula 3-(R-O-),6-BR,17-((H3C-)2-HC-H2C-H2C-H2C-HC(-CH3)-)-ESTR-5-ENE Such compounds are prepared from the known 6-iodocholesterol by treatment with cuprous bromide. These compounds, labelled with radioisotopes of Br-82 or Br-77, are localized in the adrenal, mammary and ovary tissue of female mammals and in the adrenal or prostate tissue of males when administered to such individuals. This provides a method for imaging adrenal, ovary or prostate tissue which is superior to use of the prior art 6-iodo-cholesterol

  19. Algae Derived Biofuel

    Energy Technology Data Exchange (ETDEWEB)

    Jahan, Kauser [Rowan Univ., Glassboro, NJ (United States)

    2015-03-31

    One of the most promising fuel alternatives is algae biodiesel. Algae reproduce quickly, produce oils more efficiently than crop plants, and require relatively few nutrients for growth. These nutrients can potentially be derived from inexpensive waste sources such as flue gas and wastewater, providing a mutual benefit of helping to mitigate carbon dioxide waste. Algae can also be grown on land unsuitable for agricultural purposes, eliminating competition with food sources. This project focused on cultivating select algae species under various environmental conditions to optimize oil yield. Membrane studies were also conducted to transfer carbon di-oxide more efficiently. An LCA study was also conducted to investigate the energy intensive steps in algae cultivation.

  20. SEMANTIC DERIVATION OF BORROWINGS

    Directory of Open Access Journals (Sweden)

    Shigapova, F.F.

    2017-09-01

    Full Text Available The author carried out the contrastive analysis of the word спикер borrowed into Russian from English and the English word speaker. The findings of the analysis include confirm (1 different derivational abilities and functions of the borrowed word and the native word; (2 distinctive features in the definitions, i.e. semantic structures, registered in monolingual non-abridged dictionaries; (3 heterogeneous parameters of frequencies recorded in the National Corpus of the Russian language and the British National Corpus; (4 absence of bilingual equivalent collocations with words спикер and speaker. The collocations with words studied revealed new lexical and connotative senses in the meaning of the word. Relevance of the study conducted is justified by the new facts revealed about the semantic adaptation of the borrowed word in the system of the Russian language and its paradigmatic and syntagmatic connections in the system of the recipient language.

  1. Deriving the bond pricing equation

    Directory of Open Access Journals (Sweden)

    Kožul Nataša

    2014-01-01

    Full Text Available Given the recent focus on Eurozone debt crisis and the credit rating downgrade not only of US debt, but that of other countries and many UK major banking institutions, this paper aims to explain the concept of bond yield, its different measures and bond pricing equation. Yields on capital market instruments are rarely quoted on the same basis, which makes direct comparison between different as investment choices impossible. Some debt instruments are quoted on discount basis, whilst coupon-bearing ones accrue interest differently, offer different compounding opportunities, have different coupon payment frequencies, and manage non-business day maturity dates differently. Moreover, rules governing debt vary across countries, markets and currencies, making yield calculation and comparison a rather complex issue. Thus, some fundamental concepts applicable to debt instrument yield measurement, with focus on bond equation, are presented here. In addition, bond equation expressed in annuity form and used to apply Newton-Raphson algorithm to derive true bond yield is also shown.

  2. Classical gravity with higher derivatives

    International Nuclear Information System (INIS)

    Stelle, K.S.

    1978-01-01

    Inclusion of the four-derivative terms ∫Rsub(μν) Rsup(μν)(-g)sup(1/2) and ∫R 2 (-g)sup(1/2) into the gravitational action gives a class of effectively multimass models of gravity. In addition to the usual massless excitations of the field, there are now, for general amounts of the two new terms, massive spin-two and massive scalar excitations, with a total of eight degrees of freedom. The massive spin-two part of the field has negative energy. Specific ration of the two new terms give models with either the massive tensor or the massive scalar missing, with correspondingly fewer degrees of freedom. The static, linearized solutions of the field equations are combinations of Newtonian and Yukawa potentials. Owing to the Yukawa form of the corrections, observational evidence sets only very weak restrictions on the new masses. The acceptable static metric solutions in the full nonlinear theory are regular at the origin. The dynamical content of the linearized field is analyzed by reducing the fourth-order field equations to separated second-order equations, related by coupling to external sources in a fixed ratio. This analysis is carried out into the various helicity components using the transverse-traceless decomposition of the metric. (author)

  3. The estimation of derived limits

    International Nuclear Information System (INIS)

    Harrison, N.T.; Bryant, P.M.; Clarke, R.H.; Morley, F.

    1979-08-01

    In practical radiation protection, it is often necessary to calculate limits of intake of radionuclides associated with various quantities; such limits are needed, for example, to assess the adequacy of the control of environmental contamination. In publication 26 of the International Commission on Radiological Protection (ICRP), these limits, when related to the basic limits of dose-equivalent by a defined model, are referred to as Derived Limits (DLs). In the present report the principles to be adopted by the Board in calculating DLs to be recommended for general application within the United Kingdom are outlined. DLs will be recommended for a wide range of radionuclides and for circumstances relevant to the workplace, and, more frequently, the general environment. The latter will include DLs in foodstuffs and associated environmental materials, such as soil and grass, and DLs for discharges from stacks. DLs will be related to dose equivalents for workers or members of the public for stochastic or non-stochastic effects as appropriate. Consideration will be given to relevant data on radiosensitivity, metabolism and dosimetry for children and to the physicochemical forms of radionuclides. (author)

  4. WEATHER INDEX- THE BASIS OF WEATHER DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Botos Horia Mircea

    2011-07-01

    Full Text Available This paper approaches the subject of Weather Derivatives, more exactly their basic element the weather index. The weather index has two forms, the Heating Degree Day (HDD and the Cooling Degree Day (CDD. We will try to explain their origin, use and the relationship between the two forms of the index. In our research we started from the analysis of the weather derivatives and what they are based on. After finding out about weather index, we were interested in understanding exactly how they work and how they influence the value of the contract. On the national level the research in the field is scares, but foreign materials available. The study for this paper was based firstly on reading about Weather Derivative, and then going in the meteorogical field and determining the way by which the indices were determined. After this, we went to the field with interest in the indices, such as the energy and gas industries, and figured out how they determined the weather index. For the examples we obtained data from the weather index database, and calculated the value for the period. The study is made on a period of five years, in 8 cities of the European Union. The result of this research is that we can now understand better the importance of the way the indices work and how they influence the value of the Weather Derivatives. This research has an implication on the field of insurance, because of the fact that weather derivative are at the convergence point of the stock markets and the insurance market. The originality of the paper comes from the personal touch given to the theoretical aspect and through the analysis of the HDD and CDD index in order to show their general behaviour and relationship.

  5. Hyperon decay form factors in chiral perturbation theory

    International Nuclear Information System (INIS)

    Lacour, Andre; Kubis, Bastian; Meissner, Ulf-G.

    2007-01-01

    We present a complete calculation of the SU(3)-breaking corrections to the hyperon vector form factors up to O(p 4 ) in covariant baryon chiral perturbation theory. Partial higher-order contributions are obtained, and we discuss chiral extrapolations of the vector form factor at zero momentum transfer. In addition we derive low-energy theorems for the subleading moments in hyperon decays, the weak Dirac radii and the weak anomalous magnetic moments, up to O(p 4 )

  6. Undercuts by Laser Shock Forming

    International Nuclear Information System (INIS)

    Wielage, Hanna; Vollertsen, Frank

    2011-01-01

    In laser shock forming TEA-CO 2 -laser induced shock waves are used to form metal foils, such as aluminum or copper. The process utilizes an initiated plasma shock wave on the target surface, which leads to a forming of the foil. A challenge in forming technologies is the manufacturing of undercuts. By conventional forming methods these special forms are not feasible. In this article, it is presented that undercuts in the micro range can be produced by laser shock deep drawing. Different drawing die diameters, drawing die depths and the material aluminum in the thicknesses 20 and 50 μm were investigated. It will be presented that smaller die diameters facilitate undercuts compared to bigger die diameters. The phenomena can be explained by Barlow's formula. Furthermore, it is shown which maximum undercut depth at different die diameters can be reached. To this end, cross-sections of the different parameter combinations are displayed.

  7. Forming processes and mechanics of sheet metal forming

    NARCIS (Netherlands)

    Burchitz, I.A.

    2004-01-01

    The report is dealing with the numerical analysis of forming processes. Forming processes is the large group of manufacturing processes used to obtain various product shapes by means of plastic deformations. The report is organized as follows. An overview of the deformation processes and the

  8. Confectionery-based dose forms.

    Science.gov (United States)

    Tangso, Kristian J; Ho, Quy Phuong; Boyd, Ben J

    2015-01-01

    Conventional dosage forms such as tablets, capsules and syrups are prescribed in the normal course of practice. However, concerns about patient preferences and market demands have given rise to the exploration of novel unconventional dosage forms. Among these, confectionery-based dose forms have strong potential to overcome compliance problems. This report will review the availability of these unconventional dose forms used in treating the oral cavity and for systemic drug delivery, with a focus on medicated chewing gums, medicated lollipops, and oral bioadhesive devices. The aim is to stimulate increased interest in the opportunities for innovative new products that are available to formulators in this field, particularly for atypical patient populations.

  9. Tectonics: The meaning of form

    DEFF Research Database (Denmark)

    Christiansen, Karl; Brandt, Per Aage

    Tectonics – The meaning of form deals with one of the core topics of architecture: the relationship between form and content. In the world of architecture, form is not only made from brick, glass and wood. Form means something. When a material is processed with sufficient technical skill and insi...... perspectives. You can read the chapters in any order you like – from the beginning, end or the middle. There is no correct order. The project is methodologically inductive: the more essays you read, the broader your knowledge of tectonics get....

  10. Amorphous drugs and dosage forms

    DEFF Research Database (Denmark)

    Grohganz, Holger; Löbmann, K.; Priemel, P.

    2013-01-01

    The transformation to an amorphous form is one of the most promising approaches to address the low solubility of drug compounds, the latter being an increasing challenge in the development of new drug candidates. However, amorphous forms are high energy solids and tend to recry stallize. New...... formulation principles are needed to ensure the stability of amorphous drug forms. The formation of solid dispersions is still the most investigated approach, but additional approaches are desirable to overcome the shortcomings of solid dispersions. Spatial separation by either coating or the use of micro-containers...... before single molecules are available for the formation of crystal nuclei, thus stabilizing the amorphous form....

  11. INFORMATIONAL EFFECT OF A FORM

    Directory of Open Access Journals (Sweden)

    Kovalenko V.F.

    2016-02-01

    Full Text Available The study was conducted by method of light scattering of laser emission. The influence of the form field, mutual influence of mental informational and form torsional fields as well as the following exposure of water samples in the form field after the cease of informational influence on water structure were examined. Paper forms of a pyramid, a cylinder, and a prism were used. The experimental findings show that mechanism of mutual influence on water structure of the form and informational torsional fields depended on the initial conditions of spin restructuring process – the configuration of a form, the type of the form field (internal and external ones, and the initial water structure. The influence of the form field on informational aftereffect was determined, the character of which was defined by ratio of intensities of torsional form field and an informational soliton. The phenomenon of the abnormally large amplification of the informational aftereffect in the internal field of a pyramid demonstrating the attributes of positive reverse connection between the informational soliton and torsional field of water structure and selection of generated cluster sizes were discovered.

  12. Improving the forming capability of laser dynamic forming by using rubber as a forming medium

    Science.gov (United States)

    Shen, Zongbao; Liu, Huixia; Wang, Xiao; Wang, Cuntang

    2016-04-01

    Laser dynamic forming (LDF) is a novel high velocity forming technique, which employs laser-generated shock wave to load the sample. The forming velocity induced by the high energy laser pulse may exceed the critical forming velocity, resulting in the occurrence of premature fracture. To avoid the above premature fracture, rubber is introduced in LDF as a forming medium to prolong the loading duration in this paper. Laser induced shock wave energy is transferred to the sample in different forming stages, so the forming velocity can be kept below the critical forming velocity when the initial laser energy is high for fracture. Bulge forming experiments with and without rubber were performed to study the effect of rubber on loading duration. The experimental results show that, the shock wave energy attenuates during the propagation through the rubber layer, the rubber can avoid the premature fracture. So the plastic deformation can continue, the forming capability of LDF is improved. Due to the severe plastic deformation under rubber compression, adiabatic shear bands (ASB) occur in LDF with rubber. The material softening in ASB leads to the irregular fracture, which is different from the premature fracture pattern (regular fracture) in LDF without rubber. To better understand this deformation behavior, Johnson-Cook model is used to simulate the dynamic response and the evolution of ASB of copper sample. The simulation results also indicate the rubber can prolong the loading duration.

  13. An entropic form for NLFP with coulombic-like potential

    International Nuclear Information System (INIS)

    Grassi, A.

    2012-01-01

    Here it is proposed a new entropy form for which it is possible to obtain a stationary solution of the Non-Linear Fokker–Planck equation (NLFP) with coulombic-like potentials. The general properties of this new entropy form are shown and the results are compared with those obtained by other entropy forms. Finally, the behavior of the stationary solution in presence of two point charges is also shown. -- Highlights: ► In this Letter we have proposed a new form of entropy. ► Starting from this new entropy form a Non-Linear Fokker–Planck equation has been derived. ► The stationary solution of the Non-Linear Fokker–Planck equation is obtained by using an external coulombic-like potential. ► A comparison with other forms of entropies has been proposed in the case of a single or two point charges.

  14. Study of transitory forms of carotenoids

    International Nuclear Information System (INIS)

    Mathis, Paul

    1970-01-01

    In order to explain the biological role of the carotenoids their transitory forms were studied with an apparatus measuring the small (∼10 -3 ) short-lived (100 ns to 1 ms) optical density variations obtained by excitation with a ruby laser. Two forms were studied: a) Triplet state 3 Car. - This state (t 1/2 ∼6 μs) is obtained not by direct excitation but by T-T energy transfer from chlorophyll, in different media (chloroplasts, pigments in solution or in micelle). Two arguments can be advanced to explain in terms of triplet energy transfer an essential biological role of carotenoids, protection against photodynamic effects: - the energy level of 3 Car is lower than that of the singlet of oxygen; - in vivo the T-T transfer from chlorophyll to the carotenoids is very fast: 30 ns.. b) Radical cation Car + . - This form is obtained by electron transfer from carotene to the triplet of Toluidine Blue, in ethanol. Car + (t 1/2 ∼200 μs) shows a strong absorption band at 910 nm. The properties of Car + are discussed in relation to other polyene derivatives and to hydrocarbon ions. Car + could be involved in certain biological electron transfers. (author) [fr

  15. Piroxicam derivatives THz classification

    Science.gov (United States)

    Sterczewski, Lukasz A.; Grzelczak, Michal P.; Nowak, Kacper; Szlachetko, Bogusław; Plinska, Stanislawa; Szczesniak-Siega, Berenika; Malinka, Wieslaw; Plinski, Edward F.

    2016-02-01

    In this paper we report a new approach to linking the terahertz spectral shapes of drug candidates having a similar molecular structure to their chemical and physical parameters. We examined 27 newly-synthesized derivatives of a well-known nonsteroidal anti-inflammatory drug Piroxicam used for treatment of inflammatory arthritis and chemoprevention of colon cancer. The testing was carried out by means of terahertz pulsed spectroscopy (TPS). Using chemometric techniques we evaluated their spectral similarity in the terahertz range and attempted to link the position on the principal component analysis (PCA) score map to the similarity of molecular descriptors. A simplified spectral model preserved 75% and 85.1% of the variance in 2 and 3 dimensions respectively, compared to the input 1137. We have found that in 85% of the investigated samples a similarity of the physical and chemical parameters corresponds to a similarity in the terahertz spectra. The effects of data preprocessing on the generated maps are also discussed. The technique presented can support the choice of the most promising drug candidates for clinical trials in pharmacological research.

  16. NETWORK CODING BY BEAM FORMING

    DEFF Research Database (Denmark)

    2013-01-01

    Network coding by beam forming in networks, for example, in single frequency networks, can provide aid in increasing spectral efficiency. When network coding by beam forming and user cooperation are combined, spectral efficiency gains may be achieved. According to certain embodiments, a method...... cooperating with the plurality of user equipment to decode the received data....

  17. Automated Test-Form Generation

    Science.gov (United States)

    van der Linden, Wim J.; Diao, Qi

    2011-01-01

    In automated test assembly (ATA), the methodology of mixed-integer programming is used to select test items from an item bank to meet the specifications for a desired test form and optimize its measurement accuracy. The same methodology can be used to automate the formatting of the set of selected items into the actual test form. Three different…

  18. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  19. [Galenic forms for oral medication].

    Science.gov (United States)

    El Semman, Ousseid; Certain, Agnès; Bouziane, Faouzia; Arnaud, Philippe

    2012-10-01

    Galenic science is interested in the art and the way of formulating an active principle with an excipient in order for it to be administered to the patient. The pharmaceutical forms envisage different administration routes, including by mouth. Nurses need to handle and sometimes modify the pharmaceutical form of a drug to make it easier for the patient to take. This requires vigilance.

  20. ON WEIGHTED GENERALIZED FUNCTIONS ASSOCIATED WITH QUADRATIC FORMS

    Directory of Open Access Journals (Sweden)

    E. L. Shishkina

    2016-12-01

    Full Text Available In this article we consider certain types of weighted generalized functions associated with nondegenerate quadratic forms. Such functions and their derivatives are used for constructing fundamental solutions of iterated ultra-hyperbolic equations with the Bessel operator and for constructing negative real powers of ultra-hyperbolic operators with the Bessel operator.

  1. Estimation of Ship Motions Using Closed-Form Expressions

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Mansour, A.E.; Olsen, Anders Smærup

    2004-01-01

    A semi-analytical approach is used to derive frequency response functions for the wave-induced motions for monohull ships. The results are given as closed-form expressions and the required input information for the procedure is restricted to the main dimensions: Length, breadth, draught, block...

  2. Δ(1232) Axial Charge and Form Factors from Lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, Constantia; Gregory, Eric B.; Korzec, Tomasz; Koutsou, Giannis; Negele, John W.; Sato, Toru; Tsapalis, Antonios

    2011-01-01

    We present the first calculation on the Δ axial vector and pseudoscalar form factors using lattice QCD. Two Goldberger-Treiman relations are derived and examined. A combined chiral fit is performed to the nucleon axial charge, N to Δ axial transition coupling constant and Δ axial charge.

  3. Oligosaccharides Derived from Sucrose

    Science.gov (United States)

    Monsan, Pierre F.; Ouarné, Francois

    Sucrose is a non-reducing disaccharide, consisting of an α-D-glucopyranosyl residue and a β-D-fructofuranosyl residue linked covalently by their respective anomeric carbons (α-D-glucopyranosyl-1,2-β-D-fructofuranoside). It is not just a simple disaccharide, among others: in fact, the energy of its glycosidic bond is higher than that of a usual glycosidic bond. It is equal to 27.6 kJ/mol, which is similar to the energy of a nucleotide-sugar bond as in UDP-glucose or ADP-glucose. This means that sucrose is a protected and activated form of D-glucose (as well as of D-fructose), which plays a key role in the metabolism of plants, for a wide variety of synthesis reactions.

  4. Canonical form of Euler-Lagrange equations and gauge symmetries

    Energy Technology Data Exchange (ETDEWEB)

    Geyer, B [Naturwissenschaftlich-Theoretisches Zentrum und Institut fuer Theoretische Physik, Universitaet Leipzig, Leipzig (Germany); Gitman, D M [Institute of Physics, University of Sao Paulo, Sao Paulo (Brazil); Tyutin, I V [Lebedev Physics Institute, Moscow (Russian Federation)

    2003-06-13

    The structure of the Euler-Lagrange equations for a general Lagrangian theory (e.g. singular, with higher derivatives) is studied. For these equations we present a reduction procedure to the so-called canonical form. In the canonical form the equations are solved with respect to highest-order derivatives of nongauge coordinates, whereas gauge coordinates and their derivatives enter the right-hand sides of the equations as arbitrary functions of time. The reduction procedure reveals constraints in the Lagrangian formulation of singular systems and, in that respect, is similar to the Dirac procedure in the Hamiltonian formulation. Moreover, the reduction procedure allows one to reveal the gauge identities between the Euler-Lagrange equations. Thus, a constructive way of finding all the gauge generators within the Lagrangian formulation is presented. At the same time, it is proved that for local theories all the gauge generators are local in time operators.

  5. Ineffective higher derivative black hole hair

    Science.gov (United States)

    Goldstein, Kevin; Mashiyane, James Junior

    2018-01-01

    Inspired by the possibility that the Schwarzschild black hole may not be the unique spherically symmetric vacuum solution to generalizations of general relativity, we consider black holes in pure fourth order higher derivative gravity treated as an effective theory. Such solutions may be of interest in addressing the issue of higher derivative hair or during the later stages of black hole evaporation. Non-Schwarzschild solutions have been studied but we have put earlier results on a firmer footing by finding a systematic asymptotic expansion for the black holes and matching them with known numerical solutions obtained by integrating out from the near-horizon region. These asymptotic expansions can be cast in the form of trans-series expansions which we conjecture will be a generic feature of non-Schwarzschild higher derivative black holes. Excitingly we find a new branch of solutions with lower free energy than the Schwarzschild solution, but as found in earlier work, solutions only seem to exist for black holes with large curvatures, meaning that one should not generically neglect even higher derivative corrections. This suggests that one effectively recovers the nonhair theorems in this context.

  6. Experts' understanding of partial derivatives using the Partial Derivative Machine

    OpenAIRE

    Roundy, David; Dorko, Allison; Dray, Tevian; Manogue, Corinne A.; Weber, Eric

    2014-01-01

    Partial derivatives are used in a variety of different ways within physics. Most notably, thermodynamics uses partial derivatives in ways that students often find confusing. As part of a collaboration with mathematics faculty, we are at the beginning of a study of the teaching of partial derivatives, a goal of better aligning the teaching of multivariable calculus with the needs of students in STEM disciplines. As a part of this project, we have performed a pilot study of expert understanding...

  7. Effects of variable transformations on errors in FORM results

    International Nuclear Information System (INIS)

    Qin Quan; Lin Daojin; Mei Gang; Chen Hao

    2006-01-01

    On the basis of studies on second partial derivatives of the variable transformation functions for nine different non-normal variables the paper comprehensively discusses the effects of the transformation on FORM results and shows that senses and values of the errors in FORM results depend on distributions of the basic variables, whether resistances or actions basic variables represent, and the design point locations in the standard normal space. The transformations of the exponential or Gamma resistance variables can generate +24% errors in the FORM failure probability, and the transformation of Frechet action variables could generate -31% errors

  8. Anomaly, mixing and transition form factors of pseudoscalar mesons

    International Nuclear Information System (INIS)

    Klopot, Yaroslav; Oganesian, Armen; Teryaev, Oleg

    2011-01-01

    We derive the exact non-perturbative QCD sum rule for the transition form factors of η and η ′ using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on η,η ′ transition form factors in the range from real to highly virtual photons was obtained.

  9. Anomaly, mixing and transition form factors of pseudoscalar mesons

    Energy Technology Data Exchange (ETDEWEB)

    Klopot, Yaroslav, E-mail: klopot@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Oganesian, Armen, E-mail: armen@itep.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Institute of Theoretical and Experimental Physics, B. Cheremushkinskaya 25, Moscow 117218 (Russian Federation); Teryaev, Oleg, E-mail: teryaev@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation)

    2011-10-15

    We derive the exact non-perturbative QCD sum rule for the transition form factors of {eta} and {eta}{sup Prime} using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on {eta},{eta}{sup Prime} transition form factors in the range from real to highly virtual photons was obtained.

  10. Imulation of polymer forming processes - addressing industrial needs

    International Nuclear Information System (INIS)

    Thibault, F.; DiRaddo, R.

    2011-01-01

    The objective of this paper is to present the development of simulation and design optimization capabilities, for polymer forming processes, in the context of addressing industrial needs. Accomplishments generated from close to twenty years of research in this field, at the National Research Council (NRC), are presented. Polymer forming processes such as extrusion blow moulding, stretch blow moulding and thermoforming have been the focus of the work, yet the research is extendable to similar polymer forming operations such as micro-blow moulding, sheet blow moulding and composites stamping. The research considers material models, process sequence integration and design optimization, derivative processes and 3D finite elements with multi-body contact.

  11. Cold-formed steel design

    CERN Document Server

    Yu, Wei-Wen

    2010-01-01

    The definitive text in the field, thoroughly updated and expanded Hailed by professionals around the world as the definitive text on the subject, Cold-Formed Steel Design is an indispensable resource for all who design for and work with cold-formed steel. No other book provides such exhaustive coverage of both the theory and practice of cold-formed steel construction. Updated and expanded to reflect all the important developments that have occurred in the field over the past decade, this Fourth Edition of the classic text provides you with more of the detailed, up-to-the-minute techni

  12. Differential forms theory and practice

    CERN Document Server

    Weintraub, Steven H

    2014-01-01

    Differential forms are utilized as a mathematical technique to help students, researchers, and engineers analyze and interpret problems where abstract spaces and structures are concerned, and when questions of shape, size, and relative positions are involved. Differential Forms has gained high recognition in the mathematical and scientific community as a powerful computational tool in solving research problems and simplifying very abstract problems through mathematical analysis on a computer. Differential Forms, 2nd Edition, is a solid resource for students and professionals needing a solid g

  13. Waste forms for plutonium disposition

    International Nuclear Information System (INIS)

    Johnson, S.G.; O'Holleran, T.P.; Frank, S.M.; Meyer, M.K.; Hanson, M.; Staples, B.A.; Knecht, D.A.; Kong, P.C.

    1997-01-01

    The field of plutonium disposition is varied and of much importance, since the Department of Energy has decided on the hybrid option for disposing of the weapons materials. This consists of either placing the Pu into mixed oxide fuel for reactors or placing the material into a stable waste form such as glass. The waste form used for Pu disposition should exhibit certain qualities: (1) provide for a suitable deterrent to guard against proliferation; (2) be of minimal volume, i.e., maximize the loading; and (3) be reasonably durable under repository-like conditions. This paper will discuss several Pu waste forms that display promising characteristics

  14. Application of the moving frame method to deformed Willmore surfaces in space forms

    Science.gov (United States)

    Paragoda, Thanuja

    2018-06-01

    The main goal of this paper is to use the theory of exterior differential forms in deriving variations of the deformed Willmore energy in space forms and study the minimizers of the deformed Willmore energy in space forms. We derive both first and second order variations of deformed Willmore energy in space forms explicitly using moving frame method. We prove that the second order variation of deformed Willmore energy depends on the intrinsic Laplace Beltrami operator, the sectional curvature and some special operators along with mean and Gauss curvatures of the surface embedded in space forms, while the first order variation depends on the extrinsic Laplace Beltrami operator.

  15. Conservation form of the equations of fluid dynamics in general nonsteady coordinates

    Science.gov (United States)

    Zhang, H.; Camarero, R.; Kahawita, R.

    1985-11-01

    Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations.

  16. Conservation form of the equations of fluid dynamics in general nonsteady coordinates

    International Nuclear Information System (INIS)

    Zhang, H.; Camarero, R.; Kahawita, R.

    1985-01-01

    Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations. 6 references

  17. Design of two-channel filter bank using nature inspired optimization based fractional derivative constraints.

    Science.gov (United States)

    Kuldeep, B; Singh, V K; Kumar, A; Singh, G K

    2015-01-01

    In this article, a novel approach for 2-channel linear phase quadrature mirror filter (QMF) bank design based on a hybrid of gradient based optimization and optimization of fractional derivative constraints is introduced. For the purpose of this work, recently proposed nature inspired optimization techniques such as cuckoo search (CS), modified cuckoo search (MCS) and wind driven optimization (WDO) are explored for the design of QMF bank. 2-Channel QMF is also designed with particle swarm optimization (PSO) and artificial bee colony (ABC) nature inspired optimization techniques. The design problem is formulated in frequency domain as sum of L2 norm of error in passband, stopband and transition band at quadrature frequency. The contribution of this work is the novel hybrid combination of gradient based optimization (Lagrange multiplier method) and nature inspired optimization (CS, MCS, WDO, PSO and ABC) and its usage for optimizing the design problem. Performance of the proposed method is evaluated by passband error (ϕp), stopband error (ϕs), transition band error (ϕt), peak reconstruction error (PRE), stopband attenuation (As) and computational time. The design examples illustrate the ingenuity of the proposed method. Results are also compared with the other existing algorithms, and it was found that the proposed method gives best result in terms of peak reconstruction error and transition band error while it is comparable in terms of passband and stopband error. Results show that the proposed method is successful for both lower and higher order 2-channel QMF bank design. A comparative study of various nature inspired optimization techniques is also presented, and the study singles out CS as a best QMF optimization technique. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  18. DEVELOPMENT OF DERIVATIVE MARKET IN 2000-2012

    Directory of Open Access Journals (Sweden)

    Evgeniya V. Vasina

    2014-01-01

    Full Text Available At the end of XIX century futures exchange emerged, in the early 70-ies XX century - option exchange of financial derivatives. These exchanges gave a huge boost to the development of market of the operations with derivative financial instruments. In fact, in the 1970-1980-ies a new market segment was actually formed - the stock and financial derivatives. Trade in financial derivatives began in the OTC market, which accounts for most of the trade of derivatives. Today volumes of the OTC market of derivatives are several times greater than the volume of world trade and world GDP. From 2000 to 2007 derivative OTC market grew rapidly. In 2007-2008 there is a decline in trade of derivatives, but already in 2009 the world market of OTC derivatives returned to pre-crisis growth rates. Among all the instruments of the OTC market of derivatives swaps on interest rates stand out in the volumes, which even in the crisis of2007-2008 slightly, but increased. Analysis of indicators of the global OTC market of derivatives reveals the predominance of instruments on interest rates: their share in the total world market in 2012 amounted to about 77%. If we consider the structure of the OTC market of derivatives on type contracts, in 2012 most of the contracts (66% belonged to the swaps. As regards the structure of the world market of exchange derivatives, in 2012 the options had the largest share - 54 %, futures accounted for 46 %. Among all the exchange instruments on interest rates held 92%.

  19. Development Of Derivative Market In 2000-2012

    Directory of Open Access Journals (Sweden)

    Evgeniya V. Vasina

    2014-01-01

    Full Text Available At the end of XIX century futures exchange emerged, in the early 70-ies XX century - option exchange of financial derivatives. These exchanges gave a huge boost to the development of market of the operations with derivative financial instruments. In fact, in the 1970-1980-ies a new market segment was actually formed - the stock and financial derivatives. Trade in financial derivatives began in the OTC market, which accounts for most of the trade of derivatives. Today volumes of the OTC market of derivatives are several times greater than the volume of world trade and world GDP. From 2000 to 2007 derivative OTC market grew rapidly. In 2007-2008 there is a decline in trade of derivatives, but already in 2009 the world market of OTC derivatives returned to pre-crisis growth rates. Among all the instruments of the OTC market of derivatives swaps on interest rates stand out in the volumes, which even in the crisis of2007-2008 slightly, but increased. Analysis of indicators of the global OTC market of derivatives reveals the predominance of instruments on interest rates: their share in the total world market in 2012 amounted to about 77%. If we consider the structure of the OTC market of derivatives on type contracts, in 2012 most of the contracts (66% belonged to the swaps. As regards the structure of the world market of exchange derivatives, in 2012 the options had the largest share - 54 %, futures accounted for 46 %. Among all the exchange instruments on interest rates held 92%.

  20. Myositis ossificans localisata pseudomalignant Form

    International Nuclear Information System (INIS)

    Grunt, J.; Jankovich, E.; Vasovicova, M.

    1994-01-01

    Authors presents computer tomography and angiographic findings of rare pseudomalignant form of myositis ossificans. Correct diagnosis achieved by complex evaluation of ascertain findings, including biopsy, enables proper treatment with excluding too radical therapy. 3 figs., 4 refs

  1. Forming lead-based anodes

    Energy Technology Data Exchange (ETDEWEB)

    Ogorodnichuk, V I; Voitsekhovich, R I

    1972-01-01

    Lead-based anodes can be produced by forming a layer of lead dioxide by chemical treatment in a solution of sulfuric acid in potassium permanganate at 80 to 100/sup 0/. The solution is mixed by compressed air. (RWR)

  2. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.

    1975-09-01

    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  3. Microdomain forming proteins in oncogenesis

    Directory of Open Access Journals (Sweden)

    I. B. Zborovskaya

    2016-01-01

    Full Text Available Lipid rafts are lateral assembles of cholesterol, sphingomyelin, glicosphingolipids and specific proteins within cell plasma membrane. These microdomains are involved into a number of important cellular processes including membrane rearrangement, protein internalization, signal transduction, entry of viruses into the cell. Some of lipid rafts are stabilized by special microdomain-forming proteins such as caveolins, SPFH domain containing superfamily, tetraspanins, galectins, which maintain integrity of rafts and regulate signal transduction via forming of “signalosomes”. Involvement of the different lipid rafts is necessary in many situations such as binding of growth factors with their receptors, integrin regulation, cytoskeleton and extracellular matrix rearrangements, vesicular transport, etc. However, such classes of microdomain-forming proteins are still considered separately from each other. In this review we tried to perform complex analysis of microdomain-forming proteins in regulation of cancer assotiated processes.

  4. Derivative spectrophotometry of cobalt alloys

    International Nuclear Information System (INIS)

    Spitsyn, P.K.

    1985-01-01

    The method of derivative spectrophotometry is briefly described, and derivative absorption spectra are presented for samarium, cobalt, and commercial Sm-Co alloys. It is shown that the use of derivative spectrophotometry not only improves the accuracy and selectivity of element determinations but also simplifies the analysis of alloys. Results of a statistical evaluation of the metrological characteristics of the analytical procedure described here are presented. 8 references

  5. Forms of Approximate Radiation Transport

    CERN Document Server

    Brunner, G

    2002-01-01

    Photon radiation transport is described by the Boltzmann equation. Because this equation is difficult to solve, many different approximate forms have been implemented in computer codes. Several of the most common approximations are reviewed, and test problems illustrate the characteristics of each of the approximations. This document is designed as a tutorial so that code users can make an educated choice about which form of approximate radiation transport to use for their particular simulation.

  6. Flexible forms of working hours

    OpenAIRE

    Knapp, Viktor

    2017-01-01

    66 Abstract - Flexible forms of working hours This diploma thesis deals with the flexible forms of working hours and its goal is to describe this issue in intelligible and comprehensive way. It is being very interesting and current theme which is to a great extent not subject to direct legal regulations and provides its contracting parties with a big amount of freedom of contract. This fact assists in bigger flexibilization of labour market and represents a significant instrument in the fight...

  7. Identities for the electron forms 2 and their 3D representation

    International Nuclear Information System (INIS)

    Minogin, Vladimir G.

    2012-01-01

    New type of identities for products of the electron forms 2 (Fs2) and the bilinear forms (BFs) are derived. The identities are found for both temporal Fs2 describing the electron energy and quasi energy densities and spatial Fs2 describing the linear momentum and quasi linear momentum densities. The identities allow one to transform the quasi energy densities into the energy densities as well as the quasi linear momentum densities into the linear momentum densities. It is shown that by choosing any one of the 16 electron temporal or spatial Fs2 one can represent the remaining 15 temporal or spatial Fs2 as combinations of a chosen form 2 (F2) and the derivatives of a number of BFs. Any one of such 16 sets of identities can be considered as a specific form of an irreducible representation for the temporal or spatial Fs2. Similar to the bilinear identities for BFs the derived identities can be used for reduction different physical quantities describing the electron to the forms defined by the basic physical observables. As an example we consider transformation of the electron energy density to a new fundamental form that presents the energy density through the linear momentum density. - Highlights: ► New type of identities connecting electron forms 2 and bilinear forms is derived.► Identities are found for temporal and spatial forms 2. ► Irreducible representation of the identities is derived. ► New forms of the electron energy density are presented.

  8. Star-forming Filament Models

    International Nuclear Information System (INIS)

    Myers, Philip C.

    2017-01-01

    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  9. Standardized waste form test methods

    International Nuclear Information System (INIS)

    Slate, S.C.

    1984-11-01

    The Materials Characterization Center (MCC) is developing standard tests to characterize nuclear waste forms. Development of the first thirteen tests was originally initiated to provide data to compare different high-level waste (HLW) forms and to characterize their basic performance. The current status of the first thirteen MCC tests and some sample test results is presented: The radiation stability tests (MCC-6 and 12) and the tensile-strength test (MCC-11) are approved; the static leach tests (MCC-1, 2, and 3) are being reviewed for full approval; the thermal stability (MCC-7) and microstructure evaluation (MCC-13) methods are being considered for the first time; and the flowing leach tests methods (MCC-4 and 5), the gas generation methods (MCC-8 and 9), and the brittle fracture method (MCC-10) are indefinitely delayed. Sample static leach test data on the ARM-1 approved reference material are presented. Established tests and proposed new tests will be used to meet new testing needs. For waste form production, tests on stability and composition measurement are needed to provide data to ensure waste form quality. In transportation, data are needed to evaluate the effects of accidents on canisterized waste forms. The new MCC-15 accident test method and some data are presented. Compliance testing needs required by the recent draft repository waste acceptance specifications are described. These specifications will control waste form contents, processing, and performance. 2 references, 2 figures

  10. Standardized waste form test methods

    International Nuclear Information System (INIS)

    Slate, S.C.

    1984-01-01

    The Materials Characterization Center (MCC) is developing standard tests to characterize nuclear waste forms. Development of the first thirteen tests was originally initiated to provide data to compare different high-level waste (HLW) forms and to characterize their basic performance. The current status of the first thirteen MCC tests and some sample test results are presented: the radiation stability tests (MCC-6 and 12) and the tensile-strength test (MCC-11) are approved; the static leach tests (MCC-1, 2, and 3) are being reviewed for full approval; the thermal stability (MCC-7) and microstructure evaluation (MCC-13) methods are being considered for the first time; and the flowing leach test methods (MCC-4 and 5), the gas generation methods (MCC-8 and 9), and the brittle fracture method (MCC-10) are indefinitely delayed. Sample static leach test data on the ARM-1 approved reference material are presented. Established tests and proposed new tests will be used to meet new testing needs. For waste form production, tests on stability and composition measurement are needed to provide data to ensure waste form quality. In transporation, data are needed to evaluate the effects of accidents on canisterized waste forms. The new MCC-15 accident test method and some data are presented. Compliance testing needs required by the recent draft repository waste acceptance specifications are described. These specifications will control waste form contents, processing, and performance

  11. Form 6 - gas balancing agreement

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    In 1988, a special Committee of the Rocky Mountain Mineral Law Foundation undertook a project to draft a model from gas balancing agreement. This project was initiated at the request of a number of Foundation members who felt that a model form gas balancing agreement would facilitate the negotiation of operating agreement, since gas balancing issues had become sticking points in the process. The Committee was composed of attorneys representing a wide cross-section of the oil and gas industry including both major and independent oil companies, production companies with interstate pipeline affiliates, and private practitioners. The Committee attempted to address the more controversial issues in gas balancing with optional provisions in the Form. To facilitate the negotiation process, the number of optional provisions was minimized. This form may be used as an Appendix to the new A.A.P.L. Form 610-1989 Model Form Operating Agreement. This book includes provision of this Form which are: Ownership of gas production; Balancing of production accounts; Cash balancing upon depletion; Deliverability tests; Nominations; Statements; Payment of taxes; Operating expenses; Overproducing allowable; Payment of leasehold burdens; Operator's liability; Successors and assigns; Audits; Arbitration; and Operator's fees

  12. Star-forming Filament Models

    Energy Technology Data Exchange (ETDEWEB)

    Myers, Philip C., E-mail: pmyers@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2017-03-20

    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  13. Airy asymptotics: the logarithmic derivative and its reciprocal

    International Nuclear Information System (INIS)

    Kearney, Michael J; Martin, Richard J

    2009-01-01

    We consider the asymptotic expansion of the logarithmic derivative of the Airy function Ai'(z)/Ai(z), and also its reciprocal Ai(z)/Ai'(z), as |z| → ∞. We derive simple, closed-form solutions for the coefficients which appear in these expansions, which are of interest since they are encountered in a wide variety of problems. The solutions are presented as Mellin transforms of given functions; this fact, together with the methods employed, suggests further avenues for research.

  14. Neural network representation and learning of mappings and their derivatives

    Science.gov (United States)

    White, Halbert; Hornik, Kurt; Stinchcombe, Maxwell; Gallant, A. Ronald

    1991-01-01

    Discussed here are recent theorems proving that artificial neural networks are capable of approximating an arbitrary mapping and its derivatives as accurately as desired. This fact forms the basis for further results establishing the learnability of the desired approximations, using results from non-parametric statistics. These results have potential applications in robotics, chaotic dynamics, control, and sensitivity analysis. An example involving learning the transfer function and its derivatives for a chaotic map is discussed.

  15. Selective Oxidation of Biomass-Derived Chemicals

    DEFF Research Database (Denmark)

    Modvig, Amalie Elise

    . These processes should be able to compete with the established processes based on fossil resources. Glycolaldehyde is an often-observed by-product formed from degradation of larger sugars. Due to competing ecological and economical aspects of the well-established processes for extraction and conversion....... The objective of this dissertation was to develop new, alternative and sustainable methods for oxidative catalytic upgrading of biomass-derived compounds, with focus on oxidation of glycolaldehyde and simple alcohols as model substrates for larger sugars. Supported gold nanoparticle were studied...

  16. Conjoint Forming - Technologies for Simultaneous Forming and Joining

    International Nuclear Information System (INIS)

    Groche, P; Wohletz, S; Mann, A; Krech, M; Monnerjahn, V

    2016-01-01

    The market demand for new products optimized for e. g. lightweight applications or smart components leads to new challenges in production engineering. Hybrid structures represent one promising approach. They aim at higher product performance by using a suitable combination of different materials. The developments of hybrid structures stimulate the research on joining of dissimilar materials. Since they allow for joining dissimilar materials without external heating technologies based on joining by plastic deformation seem to be of special attractiveness. The paper at hand discusses the conjoint forming approach. This approach combines forming and joining in one process. Two or more workpieces are joined while at least one workpiece is plastically deformed. After presenting the fundamental joining mechanisms, the conjoint forming approach is discussed comprehensively. Examples of conjoint processes demonstrate the effectiveness and reveal the underlying phenomena. (paper)

  17. Voice as Form of Life and Life Form

    Directory of Open Access Journals (Sweden)

    Sandra Laugier

    2015-10-01

    Full Text Available This paper studies the concept of form of life as central to ordinary language philosophy (as understood in Wittgenstein’s, Austin’s and Stanley Cavell’s work: philosophy of our language as spoken; pronounced by a human voice within a form of life. Such an approach to Wittgenstein’s later philosophy shifts the question of the common use of language – central to Wittgenstein’s Investigations – to the definition of the subject as voice, and to the reinvention of subjectivity in language. The voice is both a subjective and common expression: it is what makes it possible for my individual voice, or claim, to become shared and for our forms of life to be intertwined with a lifeform.

  18. Unfolding a molecular trefoil derived from a zwitterionic metallopeptide to form self-assembled nanostructures

    KAUST Repository

    Zhang, Ye; Zhou, Ning; Shi, Junfeng; Pochapsky, Susan Sondej; Pochapsky, Thomas C.; Zhang, Bei; Zhang, Xixiang; Xu, Bing

    2015-01-01

    While used extensively by nature to control the geometry of protein structures, and dynamics of proteins, such as self-organization, hydration forces and ionic interactions received less attention for controlling the behaviour of small molecules. Here we describe the synthesis and characterization of a novel zwitterionic metallopeptide consisting of a cationic core and three distal anionic groups linked by self-assembling peptide motifs. 2D NMR spectra, total correlated spectroscopy and nuclear Overhauser effect spectroscopy, show that the molecule exhibits a three-fold rotational symmetry and adopts a folded conformation in dimethyl sulfoxide due to Coulombic forces. When hydrated in water, the molecule unfolds to act as a self-assembling building block of supramolecular nanostructures. By combining ionic interactions with the unique geometry from metal complex and hydrophobic interactions from simple peptides, we demonstrate a new and effective way to design molecules for smart materials through mimicking a sophisticated biofunctional system using a conformational switch.

  19. Unfolding a molecular trefoil derived from a zwitterionic metallopeptide to form self-assembled nanostructures

    KAUST Repository

    Zhang, Ye

    2015-02-19

    While used extensively by nature to control the geometry of protein structures, and dynamics of proteins, such as self-organization, hydration forces and ionic interactions received less attention for controlling the behaviour of small molecules. Here we describe the synthesis and characterization of a novel zwitterionic metallopeptide consisting of a cationic core and three distal anionic groups linked by self-assembling peptide motifs. 2D NMR spectra, total correlated spectroscopy and nuclear Overhauser effect spectroscopy, show that the molecule exhibits a three-fold rotational symmetry and adopts a folded conformation in dimethyl sulfoxide due to Coulombic forces. When hydrated in water, the molecule unfolds to act as a self-assembling building block of supramolecular nanostructures. By combining ionic interactions with the unique geometry from metal complex and hydrophobic interactions from simple peptides, we demonstrate a new and effective way to design molecules for smart materials through mimicking a sophisticated biofunctional system using a conformational switch.

  20. Characterization of deposits formed on catalyst surfaces during hydrotreatment of coal-derived liquids

    Energy Technology Data Exchange (ETDEWEB)

    Furimsky, E.

    1982-04-01

    Loss of catalyst activity is attributed to the formation of polynuclear aromatic structures on the surface. Heavy species containing N and O heteroatoms were also present in deposits. Phenols, aromatic and heterocyclic compounds are considered to be the precursors for the formation of the deposits. (16 refs.)

  1. Containment of Angra 2 - control and correction of form derivative during the assembling

    International Nuclear Information System (INIS)

    Noack, B.J.A.; Leaes, J.

    1990-01-01

    The erection of the containment of Angra 2 has been concluded in JUN, 89. It is a 56m diameter shperical steel vessel, involves the primary circuit and has the purpose to isolate this from the environment. At its construction, besides the aspects of quality of the material and welds, its geometrical shape is relevant. This taking into account that at locations with abrupt changes of the shape may arise stress disturbances and buckling problems. Besides, an adequate shape is a primary condition to have a smooth development of the erection. In a general way, the shape deviations are limited to a value in the range of 50mm, which compared with the 56m diameter of the containment gives an idea about the precautions to be taken during erection. It will be presented the parameters and methods of shape control during erection, the detected shape deviations, the methods applied to correct excessive deviations and the results of complementary stress analysis. (author) [pt

  2. On the derivation of Darboux form for the action- angle dual of trigonometric BCn Sutherland system

    International Nuclear Information System (INIS)

    Görbe, Tamás F

    2014-01-01

    Recently Fehér and the author have constructed the action-angle dual of the trigonometric BC n Sutherland system via Hamiltonian reduction. In this paper a reduction- based calculation is carried out to verify the canonical Poisson bracket relations on the phase space of this dual model. Hence the material serves complementary purposes whilst it can also be regarded as a suitable modification of the hyperbolic case previously sorted out by Pusztai

  3. Higher order derivatives of exponential functions and generalized forms of Kampe de Feriet-Bell polynomials

    International Nuclear Information System (INIS)

    Dattoli, G.; Lorenzutta, S.; Cesarano, C.; Sacchetti, D.

    2000-01-01

    Operational methods are used to provide a different point of view on the theory of Kampe' de Feriet-Bell polynomials. The method here proposed can be exploited to simplify the formalism associated with this family of polynomials and may provide advantages in computation. It suggests their extension to classes of multi-index families, whole role in application is discussed [it

  4. The derivative-free Fourier shell identity for photoacoustics.

    Science.gov (United States)

    Baddour, Natalie

    2016-01-01

    In X-ray tomography, the Fourier slice theorem provides a relationship between the Fourier components of the object being imaged and the measured projection data. The Fourier slice theorem is the basis for X-ray Fourier-based tomographic inversion techniques. A similar relationship, referred to as the 'Fourier shell identity' has been previously derived for photoacoustic applications. However, this identity relates the pressure wavefield data function and its normal derivative measured on an arbitrary enclosing aperture to the three-dimensional Fourier transform of the enclosed object evaluated on a sphere. Since the normal derivative of pressure is not normally measured, the applicability of the formulation is limited in this form. In this paper, alternative derivations of the Fourier shell identity in 1D, 2D polar and 3D spherical polar coordinates are presented. The presented formulations do not require the normal derivative of pressure, thereby lending the formulas directly adaptable for Fourier based absorber reconstructions.

  5. A spatial structural derivative model for ultraslow diffusion

    Directory of Open Access Journals (Sweden)

    Xu Wei

    2017-01-01

    Full Text Available This study investigates the ultraslow diffusion by a spatial structural derivative, in which the exponential function ex is selected as the structural function to construct the local structural derivative diffusion equation model. The analytical solution of the diffusion equation is a form of Biexponential distribution. Its corresponding mean squared displacement is numerically calculated, and increases more slowly than the logarithmic function of time. The local structural derivative diffusion equation with the structural function ex in space is an alternative physical and mathematical modeling model to characterize a kind of ultraslow diffusion.

  6. TRASYS form factor matrix normalization

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1992-01-01

    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  7. Pre-exposure to moving form enhances static form sensitivity.

    Directory of Open Access Journals (Sweden)

    Thomas S A Wallis

    Full Text Available BACKGROUND: Motion-defined form can seem to persist briefly after motion ceases, before seeming to gradually disappear into the background. Here we investigate if this subjective persistence reflects a signal capable of improving objective measures of sensitivity to static form. METHODOLOGY/PRINCIPAL FINDINGS: We presented a sinusoidal modulation of luminance, masked by a background noise pattern. The sinusoidal luminance modulation was usually subjectively invisible when static, but visible when moving. We found that drifting then stopping the waveform resulted in a transient subjective persistence of the waveform in the static display. Observers' objective sensitivity to the position of the static waveform was also improved after viewing moving waveforms, compared to viewing static waveforms for a matched duration. This facilitation did not occur simply because movement provided more perspectives of the waveform, since performance following pre-exposure to scrambled animations did not match that following pre-exposure to smooth motion. Observers did not simply remember waveform positions at motion offset, since removing the waveform before testing reduced performance. CONCLUSIONS/SIGNIFICANCE: Motion processing therefore interacts with subsequent static visual inputs in a way that can improve performance in objective sensitivity measures. We suggest that the brief subjective persistence of motion-defined forms that can occur after motion offsets is a consequence of the decay of a static form signal that has been transiently enhanced by motion processing.

  8. Form Filling with SCC in a Vertical Form

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm

    2004-01-01

    This paper presents the results obtained from two different vertical form filling experiments with SCC that have been completed as part of the experimental work in an ongoing Ph.D project. The project is carried out at the Danish Technological Institute in collaboration with the Technical...

  9. Automorphic Forms and Mock Modular Forms in String Theory

    Science.gov (United States)

    Nazaroglu, Caner

    We study a variety of modular invariant objects in relation to string theory. First, we focus on Jacobi forms over generic rank lattices and Siegel forms that appear in N = 2, D = 4 compactifications of heterotic string with Wilson lines. Constraints from low energy spectrum and modularity are employed to deduce the relevant supersymmetric partition functions entirely. This procedure is applied on models that lead to Jacobi forms of index 3, 4, 5 as well as Jacobi forms over root lattices A2 and A3. These computations are then checked against an explicit orbifold model which can be Higgsed to the models under question. Models with a single Wilson line are then studied in detail with their relation to paramodular group Gammam as T-duality group made explicit. These results on the heterotic string side are then turned into predictions for geometric invariants using TypeII - Heterotic duality. Secondly, we study theta functions for indenite signature lattices of generic signature. Building on results in literature for signature (n-1,1) and (n-2,2) lattices, we work out the properties of generalized error functions which we call r-tuple error functions. We then use these functions to build such indenite theta functions and describe their modular completions.

  10. Central Clearing of OTC Derivatives

    DEFF Research Database (Denmark)

    Cont, Rama; Kokholm, Thomas

    2014-01-01

    netting agreements. When a CCP exists for interest rate derivatives, adding a CCP for credit derivatives is shown to decrease overall exposures. These findings are shown to be robust to the statistical assumptions of the model as well as the choice of risk measure used to quantify exposures....

  11. Form factors of heavy mesons in QCD

    Energy Technology Data Exchange (ETDEWEB)

    Shifman, M A; Vysotsky, M I [Moskovskii Inst. Theoreticheskoj i Ehksperimental' noj Fiziki (USSR)

    1981-08-10

    We discuss logarithmic corrections to form factors of mesons built from heavy quarks. The reactions e/sup +/e/sup -/ ..-->.. etasub(c)..gamma.. and H ..-->.. J/psi..gamma.. are considered as an example. A novel feature as compared to the well-studied problem of the pion form factor is the existence of transitions between the quark-antiquark state canti c and the gluonic one. O(..cap alpha..sub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms (..cap alpha..sub(s)ln(Q/sup 2//m/sup 2/sub(c)))sup(n) is summed up with the help of the operator technique. Apart from results already known for quark operators, we use some new results referring to gluon operator and their mixing with those made from quarks. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second is based on conformal symmetry considerations.

  12. Glass forming ability of calcium aluminosilicate melts

    DEFF Research Database (Denmark)

    Moesgaard, Mette; Yue, Yuanzheng

    2011-01-01

    The glass forming ability (GFA) of two series of calcium aluminosilicate melts is studied by measuring their viscous behavior and crystallization tendency. The first series consists of five compositions on the joining line between the eutectic point of anorthite-wollastonite-tridymite and that of......The glass forming ability (GFA) of two series of calcium aluminosilicate melts is studied by measuring their viscous behavior and crystallization tendency. The first series consists of five compositions on the joining line between the eutectic point of anorthite......-wollastonite-tridymite and that of anorthite-wollastonite-gehlenite. The series includes the eutectic compositions as end members. The second series consists of five compositions on a line parallel to the joining line on the alumina rich side. In the present work, GFA is described in terms of glass stability, i.e., the ability of a glass...... to resist crystallization during reheating. In addition, the fragility index (m) is derived by fitting the viscosity data with the Avramov-Milchev equation. The results show that m is inversely proportional to the glass stability for the two series of melts, implying that m is an indirect measure of GFA...

  13. New forms of man-machine interaction

    International Nuclear Information System (INIS)

    Mattsson, S.E.; Elmqvist, H.; Brueck, D.

    1986-01-01

    The new workstation with high performance graphics offer new possibilities for visualizing and giving a more concrete form to important concepts. In this project, some of these possibilities have been investigated by developing and implementing a prototype simulator for dynamical systems. The attention has been focused on the user interface for model development. In automatic control the notion of system is important and its representation is a key issue. The simulator support hierarchical block diagrams to describe the model decomposition and the interconnection structure. At the highest level the user sees a block diagram of annotated boxes connected with lines. The user can scroll, pan and zoom the block diagram continuously in real-time. Zooming controls the amount of information displayed. When zooming in on a block, it changes from an annotated box into a representation showing internal structure with increasing detail. Since the block diagrams can be hierarchical, it is possible to make the description at each level simple and clear. The simulator is called Hibliz which stands for HIerarchial BLock diagrams with Information Zooming. The user creates and edits his block diagrams in a Mackintosh-like fashion. He can also create overview windows which indicated where he is when he pans and zooms. Hibliz also simplified model development by allowing submodels in the form of ordinary differential and algebraic equations rather than assignment statements for derivatives and algebraic variables. (authors)

  14. Do planets remember how they formed?

    Science.gov (United States)

    Kipping, David

    2018-01-01

    One of the most directly observable features of a transiting multiplanet system is their size-ordering when ranked in orbital separation. Kepler has revealed a rich diversity of outcomes, from perfectly ordered systems, like Kepler-80, to ostensibly disordered systems, like Kepler-20. Under the hypothesis that systems are born via preferred formation pathways, one might reasonably expect non-random size-orderings reflecting these processes. However, subsequent dynamical evolution, often chaotic and turbulent in nature, may erode this information and so here we ask - do systems remember how they formed? To address this, we devise a model to define the entropy of a planetary system's size-ordering, by first comparing differences between neighbouring planets and then extending to accommodate differences across the chain. We derive closed-form solutions for many of the microstate occupancies and provide public code with look-up tables to compute entropy for up to 10-planet systems. All three proposed entropy definitions exhibit the expected property that their credible interval increases with respect to a proxy for time. We find that the observed Kepler multis display a highly significant deficit in entropy compared to a randomly generated population. Incorporating a filter for systems deemed likely to be dynamically packed, we show that this result is robust against the possibility of missing planets too. Put together, our work establishes that Kepler systems do indeed remember something of their younger years and highlights the value of information theory for exoplanetary science.

  15. Induction interview form in EDH

    CERN Multimedia

    Information technology Department, AIS (Administrative Information Services) Group,

    2007-01-01

    As part of the efforts to rationalise administrative procedures, the IT and HR Departments have developed a new EDH form for induction interviews, which can be accessed using the link below. In accordance with Administrative Circular No. 2 ('Recruitment, Appointment and possible developments regarding the contractual position of Staff Members', Rev. 3), the work and training objectives to be achieved during the probation period shall be specified in writing to all new staff members during an induction interview. The interview shall take place between the new staff member and his supervisor within six weeks of him taking up his duties at the latest. https://edh.cern.ch/Document/MAPS/Induction (or from the EDH desktop, by clicking on 'Other Tasks' and going to the 'HR & Training' heading) Please note that this form is to be used exclusively for new staff members. A separate EDH form will be developed for fellows. Information technology Department, AIS (Administrative Information Services) Group Human...

  16. Induction interview form in EDH

    CERN Document Server

    Information technology Department, AIS (Administrative Information Services) Group

    2007-01-01

    As part of the efforts to rationalise administrative procedures, the IT and HR Departments have developed a new EDH form for induction interviews, which can be accessed using the link below. In accordance with Administrative Circular No. 2 ('Recruitment, Appointment and possible developments regarding the contractual position of Staff Members', Rev. 3), the work and training objectives to be achieved during the probation period shall be specified in writing to all new staff members during an induction interview. The interview shall take place between the new staff member and his supervisor within six weeks of his taking up his duties at the latest. https://edh.cern.ch/Document/MAPS/Induction1) (or from the EDH desktop, by clicking on 'Other Tasks' and going to the 'HR & Training' heading) Please note that this form is to be used exclusively for new staff members. A separate EDH form will be developed for fellows.Information technology Department, AIS (Administrative Information Services) Group Human Re...

  17. Mathematics and Forms of Life

    Directory of Open Access Journals (Sweden)

    Severin Schroeder

    2015-10-01

    Full Text Available According to Wittgenstein, mathematics is embedded in, and partly constituting, a form of life. Hence, to imagine different, alternative forms of elementary mathematics, we should have to imagine different practices, different forms of life in which they could play a role. If we tried to imagine a radically different arithmetic we should think either of a strange world (in which objects unaccountably vanish or appear or of people acting and responding in very peculiar ways. If such was their practice, a calculus expressing the norms of representation they applied could not be called false. Rather, our criticism could only be to dismiss such a practice as foolish and to dismiss their norms as too different from ours to be called ‘mathematics’.

  18. Toroidal helical quartz forming machine

    International Nuclear Information System (INIS)

    Hanks, K.W.; Cole, T.R.

    1977-01-01

    The Scyllac fusion experimental machine used 10 cm diameter smooth bore discharge tubes formed into a simple toroidal shape prior to 1974. At about that time, it was discovered that a discharge tube was required to follow the convoluted shape of the load coil. A machine was designed and built to form a fused quartz tube with a toroidal shape. The machine will accommodate quartz tubes from 5 cm to 20 cm diameter forming it into a 4 m toroidal radius with a 1 to 5 cm helical displacement. The machine will also generate a helical shape on a linear tube. Two sets of tubes with different helical radii and wavelengths have been successfully fabricated. The problems encountered with the design and fabrication of this machine are discussed

  19. Substrate system for spray forming

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Men G. (Export, PA); Chernicoff, William P. (Harrisburg, PA)

    2002-01-01

    A substrate system for receiving a deposit of sprayed metal droplets including a movable outer substrate on which the sprayed metal droplets are deposited. The substrate system also includes an inner substrate disposed adjacent the outer substrate where the sprayed metal droplets are deposited on the outer substrate. The inner substrate includes zones of differing thermal conductivity to resist substrate layer porosity and to resist formation of large grains and coarse constituent particles in a bulk layer of the metal droplets which have accumulated on the outer substrate. A spray forming apparatus and associated method of spray forming a molten metal to form a metal product using the substrate system of the invention is also provided.

  20. Hereditary forms of breast cancer

    International Nuclear Information System (INIS)

    Bella, V.

    2009-01-01

    Breast cancer is the most common oncologic disease in the female population. Besides the sporadic occurrence it occurs in the familial and hereditary form. Persons with the occurrence of positive family anamnesis of breast cancer should be actively investigated. In the indicated cases it is necessary to send the woman to genetic examination. In case that the hereditary form of breast cancer is affirmed it is necessary to examine her family relatives. Women with the hereditary form of breast cancer occur in about 5 – 10 % portion from all women diagnosed with breast cancer. Nowadays we already know that 80 % of hereditary breast cancers are due to germ mutations in BRCA 1 and BRCA 2 gene. Persons with detected gene mutations must be dispensarized in the centres intended for it. (author)

  1. New directions in Dirichlet forms

    CERN Document Server

    Jost, Jürgen; Mosco, Umberto; Rockner, Michael; Sturm, Karl-Theodor

    1998-01-01

    The theory of Dirichlet forms brings together methods and insights from the calculus of variations, stochastic analysis, partial differential and difference equations, potential theory, Riemannian geometry and more. This book features contributions by leading experts and provides up-to-date, authoritative accounts on exciting developments in the field and on new research perspectives. Topics covered include the following: stochastic analysis on configuration spaces, specifically a mathematically rigorous approach to the stochastic dynamics of Gibbs measures and infinite interacting particle systems; subelliptic PDE, homogenization, and fractals; geometric aspects of Dirichlet forms on metric spaces and function theory on such spaces; generalized harmonic maps as nonlinear analogues of Dirichlet forms, with an emphasis on non-locally compact situations; and a stochastic approach based on Brownian motion to harmonic maps and their regularity. Various new connections between the topics are featured, and it is de...

  2. FORM version 4.0

    Science.gov (United States)

    Kuipers, J.; Ueda, T.; Vermaseren, J. A. M.; Vollinga, J.

    2013-05-01

    We present version 4.0 of the symbolic manipulation system FORM. The most important new features are manipulation of rational polynomials and the factorization of expressions. Many other new functions and commands are also added; some of them are very general, while others are designed for building specific high level packages, such as one for Gröbner bases. New is also the checkpoint facility, that allows for periodic backups during long calculations. Finally, FORM 4.0 has become available as open source under the GNU General Public License version 3. Program summaryProgram title: FORM. Catalogue identifier: AEOT_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEOT_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU General Public License, version 3 No. of lines in distributed program, including test data, etc.: 151599 No. of bytes in distributed program, including test data, etc.: 1 078 748 Distribution format: tar.gz Programming language: The FORM language. FORM itself is programmed in a mixture of C and C++. Computer: All. Operating system: UNIX, LINUX, Mac OS, Windows. Classification: 5. Nature of problem: FORM defines a symbolic manipulation language in which the emphasis lies on fast processing of very large formulas. It has been used successfully for many calculations in Quantum Field Theory and mathematics. In speed and size of formulas that can be handled it outperforms other systems typically by an order of magnitude. Special in this version: The version 4.0 contains many new features. Most important are factorization and rational arithmetic. The program has also become open source under the GPL. The code in CPC is for reference. You are encouraged to upload the most recent sources from www.nikhef.nl/form/formcvs.php because of frequent bug fixes. Solution method: See "Nature of Problem", above. Additional comments: NOTE: The code in CPC is for reference. You are encouraged

  3. Differential forms on electromagnetic networks

    CERN Document Server

    Balasubramanian, N V; Sen Gupta, D P

    2013-01-01

    Differential Forms on Electromagnetic Networks deals with the use of combinatorial techniques in electrical circuit, machine analysis, and the relationship between circuit quantities and electromagnetic fields. The monograph is also an introduction to the organization of field equations by the methods of differential forms. The book covers topics such as algebraic structural relations in an electric circuit; mesh and node-pair analysis; exterior differential structures; generalized Stoke's theorem and tensor analysis; and Maxwell's electromagnetic equation. Also covered in the book are the app

  4. The Textile Form of Sound

    DEFF Research Database (Denmark)

    Bendixen, Cecilie

    Sound is a part of architecture, and sound is complex. Upon this, sound is invisible. How is it then possible to design visual objects that interact with the sound? This paper addresses the problem of how to get access to the complexity of sound and how to make textile material revealing the form...... goemetry by analysing the sound pattern at a specific spot. This analysis is done theoretically with algorithmic systems and practical with waves in water. The paper describes the experiments and the findings, and explains how an analysis of sound can be catched in a textile form....

  5. Volume-preserving normal forms of Hopf-zero singularity

    International Nuclear Information System (INIS)

    Gazor, Majid; Mokhtari, Fahimeh

    2013-01-01

    A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto–Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple. (paper)

  6. Volume-preserving normal forms of Hopf-zero singularity

    Science.gov (United States)

    Gazor, Majid; Mokhtari, Fahimeh

    2013-10-01

    A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto-Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple.

  7. Advancing Material Models for Automotive Forming Simulations

    International Nuclear Information System (INIS)

    Vegter, H.; An, Y.; Horn, C.H.L.J. ten; Atzema, E.H.; Roelofsen, M.E.

    2005-01-01

    Simulations in automotive industry need more advanced material models to achieve highly reliable forming and springback predictions. Conventional material models implemented in the FEM-simulation models are not capable to describe the plastic material behaviour during monotonic strain paths with sufficient accuracy. Recently, ESI and Corus co-operate on the implementation of an advanced material model in the FEM-code PAMSTAMP 2G. This applies to the strain hardening model, the influence of strain rate, and the description of the yield locus in these models. A subsequent challenge is the description of the material after a change of strain path.The use of advanced high strength steels in the automotive industry requires a description of plastic material behaviour of multiphase steels. The simplest variant is dual phase steel consisting of a ferritic and a martensitic phase. Multiphase materials also contain a bainitic phase in addition to the ferritic and martensitic phase. More physical descriptions of strain hardening than simple fitted Ludwik/Nadai curves are necessary.Methods to predict plastic behaviour of single-phase materials use a simple dislocation interaction model based on the formed cells structures only. At Corus, a new method is proposed to predict plastic behaviour of multiphase materials have to take hard phases into account, which deform less easily. The resulting deformation gradients create geometrically necessary dislocations. Additional micro-structural information such as morphology and size of hard phase particles or grains is necessary to derive the strain hardening models for this type of materials.Measurements available from the Numisheet benchmarks allow these models to be validated. At Corus, additional measured values are available from cross-die tests. This laboratory test can attain critical deformations by large variations in blank size and processing conditions. The tests are a powerful tool in optimising forming simulations prior

  8. Severe forms of food allergy

    Directory of Open Access Journals (Sweden)

    Emanuel Sarinho

    2017-11-01

    Conclusion: Severe food allergy may occur in the form of anaphylaxis and food‐protein‐induced enterocolitis syndrome, which are increasingly observed in the pediatric emergency room; hence, pediatricians must be alert so they can provide the immediate diagnosis and treatment.

  9. Fabrication Aware Form-finding

    DEFF Research Database (Denmark)

    Egholm Pedersen, Ole; Larsen, Niels Martin; Pigram, Dave

    2014-01-01

    This paper describes a design and construction method that combines two distinct material systems with fabrication aware form-finding and file-to-factory workflows. The method enables the fluent creation of complex materially efficient structures comprising high populations of geometrically uniqu...

  10. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  11. Education fees – New forms

    CERN Multimedia

    2015-01-01

    The application forms for the payment of education fees have been updated and are now available in the Admin e-guide (under the “Useful Documents” heading):   Payment of education fees (including language course fees) – AC12A (form to be used by staff members recruited before 1 January 2007, with the exception of former “local staff”).   Payment of education fees – AC12B (form to be used by staff members recruited on or after 1 January 2007, by fellows, scientific associates and guest professors and by former “local staff” whose contracts started before 1 January 2007). The Education Fees service will continue to accept the old forms until the end of the current academic year, i.e. until 31 August 2015. Members of the personnel are reminded that any false declaration or failure to declare information with a view to deceiving others or achieving a gain that would result in a financial loss for CERN or...

  12. Smooth functors vs. differential forms

    NARCIS (Netherlands)

    Schreiber, U.; Waldorf, K.

    2011-01-01

    We establish a relation between smooth 2-functors defined on the path 2-groupoid of a smooth manifold and differential forms on this manifold. This relation can be understood as a part of a dictionary between fundamental notions from category theory and differential geometry. We show that smooth

  13. Green Lubricants for Metal Forming

    DEFF Research Database (Denmark)

    Bay, Niels

    2010-01-01

    The increasing focus on legislation towards diminishing the impact on working environment as well as external environment has driven efforts to develop new, environmentally benign lubricants for metal forming. The present paper gives an overview of these efforts to substitute environmentally...

  14. How Public Opinion is Formed

    Science.gov (United States)

    Block, Edward M.

    1977-01-01

    Investigates the evolution of the definition of public relations by examining cultural and personal determinants of public opinion. Outlines functions of communicators and opinionmakers in forming and influencing public opinion. Available from: Public Relations Review, Ray Hiebert, Dean, College of Journalism, University of Maryland, College Park,…

  15. Models for Textile Composites Forming

    NARCIS (Netherlands)

    Akkerman, Remko; ten Thije, R.H.W.

    2009-01-01

    Drape of dry fabrics or prepregs was recognised as an important feature in composites forming operations from the start. In the 1950s the first mathematical models were developed based on purely kinematic arguments. The assumption of zero fibre strains and trellis deformations led to the socalled

  16. Technetium Immobilization Forms Literature Survey

    Energy Technology Data Exchange (ETDEWEB)

    Westsik, Joseph H.; Cantrell, Kirk J.; Serne, R. Jeffrey; Qafoku, Nikolla

    2014-05-01

    Of the many radionuclides and contaminants in the tank wastes stored at the Hanford site, technetium-99 (99Tc) is one of the most challenging to effectively immobilize in a waste form for ultimate disposal. Within the Hanford Tank Waste Treatment and Immobilization Plant (WTP), the Tc will partition between both the high-level waste (HLW) and low-activity waste (LAW) fractions of the tank waste. The HLW fraction will be converted to a glass waste form in the HLW vitrification facility and the LAW fraction will be converted to another glass waste form in the LAW vitrification facility. In both vitrification facilities, the Tc is incorporated into the glass waste form but a significant fraction of the Tc volatilizes at the high glass-melting temperatures and is captured in the off-gas treatment systems at both facilities. The aqueous off-gas condensate solution containing the volatilized Tc is recycled and is added to the LAW glass melter feed. This recycle process is effective in increasing the loading of Tc in the LAW glass but it also disproportionally increases the sulfur and halides in the LAW melter feed which increases both the amount of LAW glass and either the duration of the LAW vitrification mission or the required supplemental LAW treatment capacity.

  17. Temporal form in interaction design

    DEFF Research Database (Denmark)

    Vallgårda, Anna; Winther, Morten Trøstrup; Mørch, Nina

    2015-01-01

    temporal forms by letting a series of expert designers reflect upon them. We borrow a framework from Boorstin’s film theory in which he distinguishes between the voyeuristic, the vicarious, and the visceral experience. We show how to use rhythms, complexity, gentle or forceful behavior, etc., to create...

  18. Spin-forming Project Report

    Energy Technology Data Exchange (ETDEWEB)

    Switzner, Nathan; Henry, Dick

    2009-03-20

    In a second development order, spin-forming equipment was again evaluated using the test shape, a hemispherical shell. In this second development order, pure vanadium and alloy titanium (Ti-6Al-4V) were spin-formed, as well as additional copper and 21-6-9 stainless. In the first development order the following materials had been spin-formed: copper (alloy C11000 ETP), 6061 aluminum, 304L stainless steel, 21-6-9 stainless steel, and tantalum-2.5% tungsten. Significant challenges included properly adjusting the rotations-per-minute (RPM), cracking at un-beveled edges and laser marks, redressing of notches, surface cracking, non-uniform temperature evolution in the titanium, and cracking of the tailstock. Lessons learned were that 300 RPM worked better than 600 RPM for most materials (at the feed rate of 800 mm/min); beveling the edges to lower the stress reduces edge cracking; notches, laser marks, or edge defects in the preform doom the process to cracking and failure; coolant is required for vanadium spin-forming; increasing the number of passes to nine or more eliminates surface cracking for vanadium; titanium develops a hot zone in front of the rollers; and the tailstock should be redesigned to eliminate the cylindrical stress concentrator in the center.

  19. Nanodiamond particles forming photonic structures

    International Nuclear Information System (INIS)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga

    2008-01-01

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds

  20. Nanodiamond particles forming photonic structures

    Energy Technology Data Exchange (ETDEWEB)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga [International Technology Center, 8100 Brownleigh Drive, Suite 120, Raleigh, NC 27617 (United States)], E-mail: oshenderova@itc-inc.org

    2008-06-04

    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds.