mzML2ISA & nmrML2ISA: generating enriched ISA-Tab metadata files from metabolomics XML data.
Larralde, Martin; Lawson, Thomas N; Weber, Ralf J M; Moreno, Pablo; Haug, Kenneth; Rocca-Serra, Philippe; Viant, Mark R; Steinbeck, Christoph; Salek, Reza M
2017-08-15
Submission to the MetaboLights repository for metabolomics data currently places the burden of reporting instrument and acquisition parameters in ISA-Tab format on users, who have to do it manually, a process that is time consuming and prone to user input error. Since the large majority of these parameters are embedded in instrument raw data files, an opportunity exists to capture this metadata more accurately. Here we report a set of Python packages that can automatically generate ISA-Tab metadata file stubs from raw XML metabolomics data files. The parsing packages are separated into mzML2ISA (encompassing mzML and imzML formats) and nmrML2ISA (nmrML format only). Overall, the use of mzML2ISA & nmrML2ISA reduces the time needed to capture metadata substantially (capturing 90% of metadata on assay and sample levels), is much less prone to user input errors, improves compliance with minimum information reporting guidelines and facilitates more finely grained data exploration and querying of datasets. mzML2ISA & nmrML2ISA are available under version 3 of the GNU General Public Licence at https://github.com/ISA-tools. Documentation is available from http://2isa.readthedocs.io/en/latest/. reza.salek@ebi.ac.uk or isatools@googlegroups.com. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Intelligent Speed Assistance (ISA).
2015-01-01
Intelligent Speed Assistance (ISA) has been a promising type of advanced driver support system for some decades. From a technical point of view, large scale ISA implementation is possible in the short term. The different types of ISA are expected to have different effects on behaviour and traffic
2007-01-01
Isotechnika is developing the immunosuppressive drug ISA 247, a calcineurin inhibitor that is undergoing clinical development for the treatment of psoriasis (phase III) and prevention of organ rejection after transplantation (phase II). Preclinical development for uveitis is also underway. Other autoimmune disease indications that could be explored include arthritis, type I diabetes and Crohn's disease. ISA 247 was being co-developed as R 1524 by Isotechnika and Roche. However, Roche is no longer involved in the development of this compound. Based on analysis of previously collected data, the trans-ISA 247 isomer was found to be more bioavailable and it is expected that this isomer can be administered at a lower dose compared with the previous formulation that consisted of an equivalent mixture of the two geometric isomers (cis and trans). Preclinical observations indicate that ISA 247 has the potential to be more potent and less toxic than other marketed immunosuppressants in its class used for the prevention of transplant rejection. Experiments to date suggest that ISA 247 is about three times as potent as ciclosporin, while genotoxicity studies in animals have shown that the compound has a significantly reduced tendency to cause renal toxicity. The combination of reduced toxicity and improved potency would give ISA 247 a therapeutic benefit over existing calcineurin-based treatments. Isotechnika and Roche entered into a co-development and commercialisation agreement in April 2002, with Roche gaining the exclusive worldwide marketing rights for ISA 247; Isotechnika received milestone payments of $US4 million and $CAN21.9 million in September 2002 and May 2003, respectively. The agreement was restructured in April 2004, under which Isotechnika will now solely manage and fund the clinical development of trans-ISA 247. Upon successful completion of these trials, Isotechnika will conduct at its own expense a phase IIb study in renal transplantation and phase III
LABORATORY DIAGNOSIS OF INFECTIOUS SALMON ANEMIA (ISA)
DEFF Research Database (Denmark)
Schyth, Brian Dall; Olesen, Niels Jørgen; Østergaard, Peter
The first outbreak of ISA on the Faroe Islands was diagnosed in March 2000. Despite intensive surveillance, control and eradication of ISA, the disease has since spread to most of the Faroe Islands affecting about half of the 23 aquaculture farms. Sampling and laboratory diagnosis of ISA is perfo......The first outbreak of ISA on the Faroe Islands was diagnosed in March 2000. Despite intensive surveillance, control and eradication of ISA, the disease has since spread to most of the Faroe Islands affecting about half of the 23 aquaculture farms. Sampling and laboratory diagnosis of ISA...... is performed according to the EU Commission Decision draft on sampling and diagnostic procedures for ISA. Inspection, clinical and gross-pathological examination and tissue sampling is performed by the veterinarians on the islands. Laboratory examination is done in collaboration between the Veterinary...
A new Perspective on ISA-Equipment
DEFF Research Database (Denmark)
Klarborg, Brith; Lahrmann, Harry; Agerholm, Niels
2007-01-01
Intelligent Speed Adaptation [ISA] has proved successful at reducing the speed of normal drivers. However, until now the potential of ISA as an assistive device has been neglected. Two case studies were conducted to test ISA as a support for drivers with acquired brain injury [ABI] in driving wit...
International Nuclear Information System (INIS)
Yamate, Kazuki; Yamada, Takashi; Takanashi, Mitsuhiro; Sasaki, Noriaki
2013-01-01
Integrated Safety Analysis (ISA) procedure for uranium fuel fabrication and enrichment facilities has been developed for aiming at applying risk-informed regulation to these uranium facilities. The development has carried out referring to the ISA (NUREG-1520) by the Nuclear Regulatory Commission (NRC). The paper presents purpose, principles and activities for the development of the ISA procedure, including Risk Level (RL) matrix and grading evaluation method of IROFS (Items Relied on for Safety), as well as general description and features of the procedure. Also described in the paper is current status in application of risk information from the ISA. Japanese four licensees of the uranium facilities have been conducting ISA for their representative processes using the developed procedure as their voluntary safety activities. They have been accumulating experiences and knowledge on the ISA procedure and risk information through the field activities. NISA (Nuclear and Industrial Safety Agency) and JNES (Japan Nuclear Energy Safety Organization) are studying how to use such risk information for the safety regulation of the uranium facilities, taking into account the licensees' experiences and knowledge. (authors)
Controlled study of ISA effects
DEFF Research Database (Denmark)
Harms, Lisbeth; Klarborg, Brith; Lahrmann, Harry
2007-01-01
The present study is a part of the ISA PAYD project being conducted in the County of North Jutland, Denmark. The first part of the study compared background data and attitudes between young ISA-volunteers and non-volunteers. Volunteers and nonvolunteers differed only with respect to their judgeme...
Kuippers, Gina; Boothman, Christopher; Bagshaw, Heath; Ward, Michael; Beard, Rebecca; Bryan, Nicholas; Lloyd, Jonathan R
2018-06-08
Intermediate level radioactive waste (ILW) generally contains a heterogeneous range of organic and inorganic materials, of which some are encapsulated in cement. Of particular concern are cellulosic waste items, which will chemically degrade under the conditions predicted during waste disposal, forming significant quantities of isosaccharinic acid (ISA), a strongly chelating ligand. ISA therefore has the potential to increase the mobility of a wide range of radionuclides via complex formation, including Ni-63 and Ni-59. Although ISA is known to be metabolized by anaerobic microorganisms, the biodegradation of metal-ISA complexes remains unexplored. This study investigates the fate of a Ni-ISA complex in Fe(III)-reducing enrichment cultures at neutral pH, representative of a microbial community in the subsurface. After initial sorption of Ni onto Fe(III)oxyhydroxides, microbial ISA biodegradation resulted in >90% removal of the remaining Ni from solution when present at 0.1 mM, whereas higher concentrations of Ni proved toxic. The microbial consortium associated with ISA degradation was dominated by close relatives to Clostridia and Geobacter species. Nickel was preferentially immobilized with trace amounts of biogenic amorphous iron sulfides. This study highlights the potential for microbial activity to help remove chelating agents and radionuclides from the groundwater in the subsurface geosphere surrounding a geodisposal facility.
International Development Research Centre (IDRC) Digital Library (Canada)
Rosario Quesada
El proyecto “La exposición a plaguicidas y su relación con el neurodesarrollo de bebés de 0 a 2 años: un análisis integrado de la sostenibilidad de sistemas de producción de banano y plátano” denominado Infantes y Salud ambiental (ISA) parte de la necesidad de evaluar y mejorar la sostenibilidad de sistemas de ...
Integrated Science Assessment (ISA) for Sulfur Oxides ...
This draft document provides EPA’s evaluation and synthesis of the most policy-relevant science related to the health effects of sulfur oxides. When final, it will provide a critical part of the scientific foundation for EPA’s decision regarding the adequacy of the current primary (health-based) National Ambient Air Quality Standard (NAAQS) for sulfur dioxide. The references considered for inclusion in or cited in the external review draft ISA are available at https://hero.epa.gov/hero/sulfur-oxides. The intent of the ISA, according to the CAA, is to “accurately reflect the latest scientific knowledge expected from the presence of [a] pollutant in ambient air” (U.S. Code, 1970a, 1970b). It includes an assessment of scientific research from atmospheric sciences, exposure sciences, dosimetry, mode of action, animal and human toxicology, and epidemiology. Key information and judgments formerly found in the Air Quality Criteria Documents (AQCDs) for sulfur oxides (SOx) are included; Annexes provide additional details supporting the ISA. Together, the ISA and Annexes serve to update and revise the last SOx ISA which was published in 2008.
WACANA NARATIF KEHIDUPAN NABI ISA DALAM AL-QURʼAN
Directory of Open Access Journals (Sweden)
Toto Edidarmo
2014-06-01
Full Text Available The Holy Quran contains the faith, worship, Islamic morals, history, promises and threats, and information about Hereafter (eschatology. The narrative style of the Quran is less systematic and intact except the narration of the Prophet Yusuf (Surah Yusuf [12]: 1-111. This paper narrates the verses of the Quran about Prophet Isa's life since his birth, prophetness, until death. The aim is to reconstruct narrative discourse of Prophet Isa's life as a systematical text. The method used is content analysis through verses related analysis in order to classify the meaning and connect the verses with other verses into a systematize form, a unified narrative and chronological discourse. DOI: 10.15408/a.v1i1.1133
Integrated Science Assessment (ISA) for Oxides of Nitrogen ...
This draft ISA document represents a concise synthesis and evaluation of the most policy-relevant science and will ultimately provide the scientific bases for EPA’s decision on retaining or revising the current secondary standards for NO2, SO2, PM 2.5 and PM 10 since the prior release of the assessment. The intent of the ISA, according to the CAA, is to “accurately reflect the latest scientific knowledge expected from the presence of [a] pollutant in ambient air” (U.S. Code, 1970a, 1970b). It includes scientific research from atmospheric sciences, exposure and deposition, biogeochemistry, hydrology, soil science, marine science, plant physiology, animal physiology, and ecology conducted at multiple scales (e.g., population, community, ecosystem, landscape levels). Key information and judgments formerly found in the Air Quality Criteria Documents (AQCDs) for oxides of nitrogen, oxides of nitrogen and particulate matter for ecological effects are included; Appendixes provide additional details supporting the ISA. Together, the ISA and Appendixes serve to update and revise the last oxides of nitrogen and oxides of sulfur ISA which was published in 2008 and the ecological portion of the last particulate matter ISA, which was published in 2009.
Reading the New Standard ISA700
Directory of Open Access Journals (Sweden)
Daniel Botez
2010-12-01
Full Text Available Review of permanent professional standards is a requirement for professional bodies of professional accountants, resulting in broader processes of globalization and harmonization. A set of revised standards on financial audit engagement was published by IFAC in April 2009. International Standard on Auditing (ISA 700 "Forming an opinion and reporting on financial statements” is one of them. This standard deals with the auditor's responsibility to form an opinion on the financial statements and determine the form and content of the auditor's report issued following an audit of financial statements. Even if you do not have major changes, the revised standard contains several provisions that emphasize the important role of the auditor's report and more specifically defines its responsibility.
Pay as You Speed, ISA with incentive for not speeding
DEFF Research Database (Denmark)
Lahrmann, Harry Spaabæk; Agerholm, Niels; Tradisauskas, Nerius
2012-01-01
To simulate a market introduction of Intelligent Speed Adaptation (ISA) and to study the effect of a Pay as You Speed (PAYS) concept, a field trial with 153 drivers was conducted during 2007–2009. The participants drove under PAYS conditions for a shorter or a longer period. The PAYS concept......, with and without incentive crossed with informative ISA present or absent. The results showed that ISA is an efficient tool for reducing speeding particularly on rural roads. The analysis of speed data demonstrated that the proportion of distance driven above the speed where the ISA equipment responded (PDA...... level. Both informative ISA and incentive ISA reduced the PDA, but there was no statistically significant interaction. Informative reduced it more than the incentive....
DEFF Research Database (Denmark)
Nilsson, Jørgen Fischer
2014-01-01
We reconsider the nature and formal properties of the class inclusion relation, IS-A, from the point of view of information modeling and engineering of formal ontologies. In particular we review approaches to the elusive notion of intensionality. We then conduct an analysis adopting a metalogic s...
Directory of Open Access Journals (Sweden)
Seung I Jang
Full Text Available Chickens were immunized subcutaneously with an Eimeria recombinant profilin protein plus Montanide™ ISA 70 VG (ISA 70 or Montanide™ ISA 71 VG (ISA 71 water-in-oil adjuvants, or with profilin alone, and comparative RNA microarray hybridizations were performed to ascertain global transcriptome changes induced by profilin/ISA 70 vs. profilin alone and by profilin/ISA 71 vs. profilin alone. While immunization with profilin/ISA 70 vs. profilin alone altered the levels of more total transcripts compared with profilin/ISA 71 vs. profilin alone (509 vs. 296, the latter was associated with a greater number of unique biological functions, and a larger number of genes within these functions, compared with the former. Further, canonical pathway analysis identified 10 pathways that were associated with genes encoding the altered transcripts in animals immunized with profilin/ISA 71 vs. profilin alone, compared with only 2 pathways in profilin/ISA 70 vs. profilin alone. Therefore, ISA 71 was selected as a candidate adjuvant in conjunction with profilin vaccination for in vivo disease protection studies. Vaccination with profilin/ISA 71 was associated with greater body weight gain following E. acervulina infection, and decreased parasite fecal shedding after E. maxima infection, compared with profilin alone. Anti-profilin antibody levels were higher in sera of E. maxima- and E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. Finally, the levels of transcripts encoding interferon-γ, interleukin (IL-2, IL-10, and IL-17A were increased in intestinal lymphocytes from E. acervulina-, E. maxima-, and/or E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. None of these effects were seen in chickens injected with ISA 71 alone indicating that the adjuvant was not conferring non-specific immune stimulation. These results suggest that profilin plus ISA 71 augments protective immunity
Lillehoj, Hyun S.; Lee, Sung Hyen; Lee, Kyung Woo; Bertrand, François; Dupuis, Laurent; Deville, Sébastien; Ben Arous, Juliette; Lillehoj, Erik P.
2013-01-01
Chickens were immunized subcutaneously with an Eimeria recombinant profilin protein plus Montanide™ ISA 70 VG (ISA 70) or Montanide™ ISA 71 VG (ISA 71) water-in-oil adjuvants, or with profilin alone, and comparative RNA microarray hybridizations were performed to ascertain global transcriptome changes induced by profilin/ISA 70 vs. profilin alone and by profilin/ISA 71 vs. profilin alone. While immunization with profilin/ISA 70 vs. profilin alone altered the levels of more total transcripts compared with profilin/ISA 71 vs. profilin alone (509 vs. 296), the latter was associated with a greater number of unique biological functions, and a larger number of genes within these functions, compared with the former. Further, canonical pathway analysis identified 10 pathways that were associated with genes encoding the altered transcripts in animals immunized with profilin/ISA 71 vs. profilin alone, compared with only 2 pathways in profilin/ISA 70 vs. profilin alone. Therefore, ISA 71 was selected as a candidate adjuvant in conjunction with profilin vaccination for in vivo disease protection studies. Vaccination with profilin/ISA 71 was associated with greater body weight gain following E. acervulina infection, and decreased parasite fecal shedding after E. maxima infection, compared with profilin alone. Anti-profilin antibody levels were higher in sera of E. maxima- and E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. Finally, the levels of transcripts encoding interferon-γ, interleukin (IL)-2, IL-10, and IL-17A were increased in intestinal lymphocytes from E. acervulina-, E. maxima-, and/or E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. None of these effects were seen in chickens injected with ISA 71 alone indicating that the adjuvant was not conferring non-specific immune stimulation. These results suggest that profilin plus ISA 71 augments protective immunity against selective
Thermodynamic model of Ni(II) solubility, hydrolysis and complex formation with ISA
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Siso, Maria Rosa; Duro, Lara; Bruno, Jordi [Amphos21, Barcelona (Spain); Gaona, Xavier; Altmaier, Marcus [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Nuclear Waste Disposal
2018-04-01
the low solubility (<10{sup -7} M) of Ni(II) in hyperalkaline pH conditions representative of cementitious environments (10 ≤ pH ≤ 13), which increases to up to 10{sup -5} M in the presence of 0.2 M NaISA. These results significantly improve source term estimations for Ni(II) in environments relevant for the disposal of low and intermediate level radioactive waste (L/ILW). The chemical and thermodynamic models derived in this work can be implemented in geochemical models/calculations, and provide further confidence in the safety analysis of repositories for the disposal of L/ILW.
Pay as You Speed, ISA with incentives for not speeding
DEFF Research Database (Denmark)
Lahrmann, Harry Spaabæk; Agerholm, Niels; Tradisauskas, Nerius
2012-01-01
The Intelligent Speed Adaptation (ISA) project we describe in this article is based on Pay as You Drive principles. These principles assume that the ISA equipment informs a driver of the speed limit, warns the driver when speeding and calculates penalty points. Each penalty point entails the redu......The Intelligent Speed Adaptation (ISA) project we describe in this article is based on Pay as You Drive principles. These principles assume that the ISA equipment informs a driver of the speed limit, warns the driver when speeding and calculates penalty points. Each penalty point entails...... the reduction of a 30% discount on the driver's car insurance premium, which therefore produced the name, Pay as You Speed. The ISA equipment consists of a GPS-based On Board Unit with a mobile phone connection to a web server. The project was planned for a three-year test period with 300 young car drivers...
Intelligente snelheidsadaptatie ISA : een vergelijking van Nederlandse en Zweedse systemen.
Oei, H.-l.
1998-01-01
An important part within developments in the field of telematics is Intelligent Speed Adaptation (ISA). Especially in Sweden, where the policy objective is to have zero fatalities or seriously injured victims on the road in 2020, research has been conducted on ISA during the last 10 years. In the
International Nuclear Information System (INIS)
Kim, Kyoung-Dong; Chung, Woo-Hyun; Kim, Hyo-Jin; Lee, Kyung-Chang; Roe, Jung-Hye
2010-01-01
Mitochondrial monothiol glutaredoxins that bind Fe-S cluster are known to participate in Fe-S cluster assembly. However, their precise role has not been well understood. Among three monothiol glutaredoxins (Grx3, 4, and 5) in Schizosaccharomyces pombe only Grx5 resides in mitochondria. The Δgrx5 mutant requires cysteine on minimal media, and does not grow on non-fermentable carbon source such as glycerol. We found that the mutant is low in the activity of Fe-S enzymes in mitochondria as well as in the cytoplasm. Screening of multi-copy suppressor of growth defects of the mutant identified isa1 + gene encoding a putative A-type Fe-S scaffold, in addition to mas5 + and hsc1 + genes encoding putative chaperones for Fe-S assembly process. Examination of other scaffold and chaperone genes revealed that isa2 + , but not isu1 + and ssc1 + , complemented the growth phenotype of Δgrx5 mutant as isa1 + did, partly through restoration of Fe-S enzyme activities. The mutant also showed a significant decrease in the amount of mitochondrial DNA. We demonstrated that Grx5 interacts in vivo with Isa1 and Isa2 proteins in mitochondria by observing bimolecular fluorescence complementation. These results indicate that Grx5 plays a central role in Fe-S assembly process through interaction with A-type Fe-S scaffold proteins Isa1 and Isa2, each of which is an essential protein in S. pombe, and supports mitochondrial genome integrity as well as Fe-S assembly.
Onderzoeksopzet praktijkdemo intelligente snelheidsadaptatie ISA.
Polak, P.H. & Roszbach, R.
1999-01-01
A practical experiment with intelligent speed adapters will be carried out in the Dutch borough of Tilburg during the period 1998-2000. The goal of this project is to: develop support and a public acceptance of ISA as a speed control instrument via a practical demonstration; and to gain insight in a
Directory of Open Access Journals (Sweden)
Marie Eugénie Malzac Batista
2006-03-01
Full Text Available Neste artigo apresenta-se o modelo ISA/JP - Indicador de Salubridade Ambiental, para análise intra-urbana por setor censitário e bairro como uma contribuição para a gestão urbana com enfoque para a área de saneamento ambiental. Trata-se de uma adaptação do ISA desenvolvido pelo Conselho Estadual de Saneamento do Estado de São Paulo, em 1999. Foi incorporado ao modelo ISA mais um sub-indicador, o de drenagem urbana. A utilização do modelo ISA/JP em um Sistema de Informação Geográfica - SIG permitiu que fosse explorada a potencialidade da espacialização dos resultados. Possibilitou ainda a representação e modelagem do conhecimento, constituindo um Sistema de Apoio a Decisão Espacial - SADE. É apresentado um estudo de caso nos bairros costeiros da cidade de João Pessoa, Brasil. Foi demonstrada a viabilidade do modelo proposto bem como o avanço na descrição da salubridade ambiental, mostrando a variabilidade das informações relevantes no espaço urbano.This work deals with the ISA/JP model - Indicator of Environmental Health for intra-urban analysis, according to the census sector and suburb, as a contribution to the urban management, with a focus on the area of environmental sanitation. It is an adaptation of ISA developed by São Paulo's State Council of Sanitation, in 1999. One more sub-indicator, that of urban drainage, was incorporated to the ISA model. The use of ISA/JP in a System of Geographic Information - SIG - permitted the exploration of the potentiality of distributing the results in the urban area. It also made possible the representation and modeling of knowledge, thus making up a System of Support to Space Decision - SSSD. A case study in the coastal suburbs of João Pessoa City, Brazil, was presented. The viability of the proposed model as well as the advance in the description of environmental health were demonstrated, thus showing the variability of relevant information in the urban space.
ISA100.11a*: The ISA100.11a extension for supporting energy-harvested I/O devices
Zand, P.; Mathews, E.; Das, Kallol; Dilo, Arta; Havinga, Paul J.M.
Wireless standards developed for industrial applications such as ISA100.11a and WirelessHART, generally use centralized management approaches. However, such centralized approaches cannot cope with network dynamicity in real-time manner. They also incur high management overhead and latency.
Is it reliable that speed-calming solutions as ISA can reach the drivers, who needed it most?
DEFF Research Database (Denmark)
Agerholm, Niels
A significant number of trials with Intelligent Speed Adaptation (ISA) have been carried out within the last two decades. Almost all with a promising result; the drivers reduce their proportion of speeding and are in general positive to ISA. However, two tings question this offhand success story; 1......: there has been no commercial break through for ISA so far, even though estimated has shown that ISA can reduce the n. of fatalities in traffic accidents with up to 59%, and 2: in the only ISA trial included drivers, who not participated voluntary in the trial, ISA had virtually no effect on these drivers...
Vacuum guidelines for ISA insertions
International Nuclear Information System (INIS)
Edwards, D. Jr.
1976-01-01
Vacuum requirements place design restrictions on the ISA insertions. The vacuum tube diameter, given a distance L between pumps, is determined by the desorption of molecules from the wall under the impact of ions created by the beam, whereas the thickness of the tube must be sufficient to prevent collapse. In addition, the entire vacuum chamber must be able to be baked out at approximately 200 0 C
Integrated Science Assessment (ISA) for Carbon Monoxide (Second External Review Draft, Sep 2009)
EPA announced that the Second External Review Draft of the Integrated Science Assessment (ISA) for Carbon Monoxide (CO) and related Annexes was made available for independent peer review and public review. This draft ISA document represents a concise synthesis and evaluation of t...
Evelin Ilvese isa : oleme tütrega ära leppinud / Karoliina Vasli
Vasli, Karoliina
2007-01-01
Proua Evelin Ilvese Helsingis elav isa Lembit Int räägib oma suhetest tütre ja väimehega. Vt. samas: Isa: "Evelinil on kahju, et unistus külalistemajast hetkel soiku jääb." Lembit Int väljendab kahetsust, et Ärma talu enam külalistemajana ei tööta
Presidendi poeg piinab isa poliitilisi vastaseid / Aadu Hiietamm
Hiietamm, Aadu, 1954-
2004-01-01
Pärast Moskva-meelse Ahmad Kadõrovi valimist Tšetšeenia presidendiks valitseb olukord, kus presidendi poeg Ramzan peab vanglat ja tapab isa poliitilisi vastaseid, väidetakse maailma ajakirjanduses
Goldenbeld, C.
2004-01-01
Many road safety experts regard Intelligent Speed Adaptation (ISA) as a powerful instrument for regulating safe driving speeds and achieving more safety. In short, ISA ensures that, while it is in motion, the vehicle `receives' information about the speed limit that applies where it is. When driving
2009-06-04
billion4 contract (September 1997) for Total SA of France and its partners, Gazprom of Russia and Petronas of Malaysia to develop phases 2 and 3 of the 25...companies. On July 12, 2008, Total and Petronas , the original South Pars investors, pulled out of a deal to develop a liquified natural gas (LNG...do not exceed the $20 million in one year threshold for ISA sanctionability. Since the Total/ Petronas /Gazprom project in 1998, no projects have
Taylor, Mark P; Mackay, Alana; Kuypers, Tabitha; Hudson-Edwards, Karen
2009-05-01
This paper examines the environmental risk and impact of trace metals affecting river water and sediment in and around Mount Isa, Queensland, Australia. Bacterial indicator densities are also analysed throughout the catchment to assess the impacts and the potential hazards arising from agricultural activities, sewage treatment plant releases and urban runoff. The area is drained by the ephemeral Leichhardt River, which bisects Mount Isa City and the major Pb, Zn, Cu and Ag Mount Isa Mine. Runoff is captured downstream in Lake Moondarra, with the water being used following natural filtration via a lagoon-reed bed system for potable purposes by the residents of Mount Isa City. During the dry season, the channel is characterised by numerous pools that act as storage zones for sediment and water-soluble metals as well as urban and agriculturally derived nutrients and pathogens. Our results show that sediment and water quality within the Leichhardt River adjacent to and downstream of the mine frequently exceed Australian government sediment guidelines with average values of Cu, Pb and Zn found adjacent to the footprint of the mine being 1550, 510 and 470 mg kg(-1), respectively. Dry season analysis of water-soluble Cu, Pb and Zn concentrations within pools showed that Australian government low trigger guidelines are exceeded in 100, 46 and 100% cases, respectively. The densities of bacterial indicators in remnant pools throughout the Leichhardt River also exceeded acceptable guidelines. Maximum dry season faecal coliform densities of 2000 colony forming units (CFU) per 100 mL and Enterococcus counts of 900 organisms per 100 mL were recorded in dry season remnant pools compared to wet season maximum faecal coliform and Enterococcus densities of 119 000 CFU per 100 mL and 95 000 organisms per 100 mL, respectively. The impacts on biota were also examined by assessing the metal content of the tissue of seven fish from Lake Moondarra for their Cd, Cu, Hg, Pb and Zn
ISA-TAB-Nano: A Specification for Sharing Nanomaterial Research Data in Spreadsheet-based Format
2013-01-01
Background and motivation The high-throughput genomics communities have been successfully using standardized spreadsheet-based formats to capture and share data within labs and among public repositories. The nanomedicine community has yet to adopt similar standards to share the diverse and multi-dimensional types of data (including metadata) pertaining to the description and characterization of nanomaterials. Owing to the lack of standardization in representing and sharing nanomaterial data, most of the data currently shared via publications and data resources are incomplete, poorly-integrated, and not suitable for meaningful interpretation and re-use of the data. Specifically, in its current state, data cannot be effectively utilized for the development of predictive models that will inform the rational design of nanomaterials. Results We have developed a specification called ISA-TAB-Nano, which comprises four spreadsheet-based file formats for representing and integrating various types of nanomaterial data. Three file formats (Investigation, Study, and Assay files) have been adapted from the established ISA-TAB specification; while the Material file format was developed de novo to more readily describe the complexity of nanomaterials and associated small molecules. In this paper, we have discussed the main features of each file format and how to use them for sharing nanomaterial descriptions and assay metadata. Conclusion The ISA-TAB-Nano file formats provide a general and flexible framework to record and integrate nanomaterial descriptions, assay data (metadata and endpoint measurements) and protocol information. Like ISA-TAB, ISA-TAB-Nano supports the use of ontology terms to promote standardized descriptions and to facilitate search and integration of the data. The ISA-TAB-Nano specification has been submitted as an ASTM work item to obtain community feedback and to provide a nanotechnology data-sharing standard for public development and adoption. PMID
EPA has announced that the First External Review Draft of the Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria has been made available for independent peer review and public review. This draft ISA document represents a concise synthesis and evaluatio...
Open architecture design and approach for the Integrated Sensor Architecture (ISA)
Moulton, Christine L.; Krzywicki, Alan T.; Hepp, Jared J.; Harrell, John; Kogut, Michael
2015-05-01
Integrated Sensor Architecture (ISA) is designed in response to stovepiped integration approaches. The design, based on the principles of Service Oriented Architectures (SOA) and Open Architectures, addresses the problem of integration, and is not designed for specific sensors or systems. The use of SOA and Open Architecture approaches has led to a flexible, extensible architecture. Using these approaches, and supported with common data formats, open protocol specifications, and Department of Defense Architecture Framework (DoDAF) system architecture documents, an integration-focused architecture has been developed. ISA can help move the Department of Defense (DoD) from costly stovepipe solutions to a more cost-effective plug-and-play design to support interoperability.
Current status and applications of intergrated safety assessment and simulation code system for ISA
Energy Technology Data Exchange (ETDEWEB)
Izquierdo, J. M.; Hortal, J.; Perea, M. Sanchez; Melendez, E. [Modeling and Simulation Area (MOSI), Nuclear Safety Council (CSN), Madrid (Spain); Queral, E.; Rivas-Lewicky, J. [Energy and Fuels Department, Technical University of Madrid (UPM), Madrid (Spain)
2017-03-15
This paper reviews current status of the unified approach known as integrated safety assessment (ISA), as well as the associated SCAIS (simulation codes system for ISA) computer platform. These constitute a proposal, which is the result of collaborative action among the Nuclear Safety Council (CSN), University of Madrid (UPM), and NFQ Solutions S.L, aiming to allow independent regulatory verification of industry quantitative risk assessments. The content elaborates on discussions of the classical treatment of time in conventional probabilistic safety assessment (PSA) sequences and states important conclusions that can be used to avoid systematic and unacceptable underestimation of the failure exceedance frequencies. The unified ISA method meets this challenge by coupling deterministic and probabilistic mutual influences. The feasibility of the approach is illustrated with some examples of its application to a real size plant.
Vahetuspere isa osutus seksuaalseks ahistajaks / Merje Pors ; kommenteerinud Oliver Kontram
Pors, Merje
2011-01-01
Vahetusõpilase ahistamise juhtumist Argentiinas, kus vahetuspere isa kuritarvitas seksuaalselt vahetusõpilast. Vahetusprogrammide kaudu välismaale õppima minejate arvu vähenemisest, mistõttu on programmid sunnitud ümber orienteeruma ja rohkem välisõpilasi Eestisse tooma
Directory of Open Access Journals (Sweden)
Chester Luis Galvão César
2013-06-01
Full Text Available O objetivo do estudo foi comparar estimativas da prevalência de indicadores de saúde para adultos residentes em Campinas, São Paulo, Brasil, utilizando dados de inquéritos domiciliares realizados em diferentes períodos de tempo (ISA-SP 2001/2002 e ISA-Camp 2008/2009, com amostras de 941 e 2.637 indivíduos de 18 anos e mais, respectivamente. Variáveis sociodemográficas caracterizaram a população estudada. Foram estimadas prevalências e seus respectivos intervalos de 95% de confiança e as comparações foram realizadas pelas razões de prevalência ajustadas por sexo, idade e escolaridade, obtidas pela regressão de Poisson com variância robusta. Diferenças estatisticamente significantes foram observadas para as prevalências de: morbidade referida, uso de medicamentos, percentual dos que nunca fumaram, realização dos exames de Papanicolaou e de mamografia, alguma vez na vida. O acompanhamento de indicadores de saúde por inquéritos repetidos em uma mesma população pode facilitar o monitoramento de objetivos e metas fornecendo subsídios ao planejamento de ações em saúde.El objetivo del estudio fue comparar las estimaciones de prevalencia en los indicadores de salud para los adultos que viven en Campinas, São Paulo, Brasil, con datos de encuestas de diferentes períodos de tiempo (ISA-SP 2001/2002 y ISA-Camp 2008/2009, con muestras de 941 y 2.637 personas de 18 años y más, respectivamente. Las variables sociodemográficas caracterizaron a la población de estudio. Se estimaron la prevalencia y sus respectivos intervalos de confianza del 95% y las comparaciones se realizaron por razones de prevalencia ajustadas por sexo, edad y educación, obtenidas mediante la regresión de Poisson. Se observaron diferencias estadísticas en la prevalencia de morbilidad, uso de medicamentos, el porcentaje de quienes nunca habían fumado, la realización de citologías vaginales y mamografías, en algún momento de sus vidas. El seguimiento
Duncan, Robert J.; Maas, Roland
2014-12-01
Epidote metasomatism affected large areas of tholeiitic metabasalts of the ~1,780 Ma Eastern Creek Volcanics in the Western Fold Belt of the Proterozoic Mount Isa inlier. Hydrothermal epidote generally occurs in quartz veins parallel to or boudinaged within the dominant S2 fabrics which formed during the regional metamorphic peak at ~1,570 Ma associated with the Isan orogeny. Previously published stable isotopic and halogen data suggest that the fluids responsible for epidote formation are metamorphic in origin (with an evaporitic component). Application of the Pb stepwise leaching technique to the epidote does not separate radiogenic Pb4+ and common Pb2+, generating little spread in 206Pb/204Pb (between 16.0 and 30.5). The causes for this relatively low range are twofold: There is little radiogenic Pb in the epidotes (the most radiogenic steps account for leaching data give ages between 150 and 1,500 myrs older than the host rocks and over 450 myrs older than the thermal metamorphic peak. These old ages are attributed to chemical inheritance from the host metabasalts, via radiogenic Pb release by breakdown of phases such as zircon, monazite, titanomagnetite, and ilmenite during metamorphism. This idea is supported by trace element data and chrondrite-normalized rare earth element patterns that are similar to both the metabasalts and epidotes (except for a variable Eu anomaly in the latter). Relatively high fO2 during vein formation (Fe3+ dominates in the epidote crystal lattice) would allow the incorporation of Th4+ and exclusion of U6+ and would explain elevated Th/U ratios (up to 12) in epidote compared with the host metabasalts. Non-incorporation of U would explain the relatively low U/Pb ratios and non-radiogenic character of the epidote. This process may provide a source of metal for the small U deposits around Mount Isa and may also suggest a relationship between U mineralization and regional Cu mobilization during the Isan orogeny. Our work suggests that
ISA-97 Compliant Architecture Testbed (ICAT) Projectry Organizations
1992-03-30
by the System Integracion Directorate of the USAISEC, August 29, 1992. The report discusses the refinement of the ISA-97 Compliant Architecture Model...browser and iconic representations of system objects and resources. When the user is interacting with an application which has multiple compo- nents, it is...computer communications, it is not uncommon for large information systems to be shared by users on multiple machines. The trend towards the desktop
Directory of Open Access Journals (Sweden)
Yimin Wu
2008-07-01
Full Text Available Pfs25 and Pvs25, surface proteins of mosquito stage of the malaria parasites P. falciparum and P. vivax, respectively, are leading candidates for vaccines preventing malaria transmission by mosquitoes. This single blinded, dose escalating, controlled Phase 1 study assessed the safety and immunogenicity of recombinant Pfs25 and Pvs25 formulated with Montanide ISA 51, a water-in-oil emulsion.The trial was conducted at The Johns Hopkins Center for Immunization Research, Washington DC, USA, between May 16, 2005-April 30, 2007. The trial was designed to enroll 72 healthy male and non-pregnant female volunteers into 1 group to receive adjuvant control and 6 groups to receive escalating doses of the vaccines. Due to unexpected reactogenicity, the vaccination was halted and only 36 volunteers were enrolled into 4 groups: 3 groups of 10 volunteers each were immunized with 5 microg of Pfs25/ISA 51, 5 microg of Pvs25/ISA 51, or 20 microg of Pvs25/ISA 51, respectively. A fourth group of 6 volunteers received adjuvant control (PBS/ISA 51. Frequent local reactogenicity was observed. Systemic adverse events included two cases of erythema nodosum considered to be probably related to the combination of the antigen and the adjuvant. Significant antibody responses were detected in volunteers who completed the lowest scheduled doses of Pfs25/ISA 51. Serum anti-Pfs25 levels correlated with transmission blocking activity.It is feasible to induce transmission blocking immunity in humans using the Pfs25/ISA 51 vaccine, but these vaccines are unexpectedly reactogenic for further development. This is the first report that the formulation is associated with systemic adverse events including erythema nodosum.ClinicalTrials.gov NCT00295581.
Electron clearing and dimensional tolerance for the ISA chamber
International Nuclear Information System (INIS)
Herrera, J.C.
1976-01-01
In the straight sections of the ISA ring, the clearing of the low energy electrons produced by the beam-gas collisions will take place by longitudinal motion. Thus, an electron of low energy, which is prevented from escaping transversely by the attractive field of the beam, will receive successive kicks by the circulating protons and thereby acquire sufficient energy to travel longitudinally toward the clearing electrodes. However, a discontinuity or step in the chamber diameter, which occurs within an axial distance equal to a few diameters, gives rise to a potential difference along the chamber axis. In the case of a section of chambers which has a larger diameter, that is, a small cavity, the two steps result in a longitudinal potential well, or attractive region. It is then necessary that the electrons be given additional energy in order to overcome this longitudinal trapping potential. The ISA design envisions the placement of clearing electrodes at the location of significant chamber discontinuities, particularly in the experimental insertions. An estimate of the magnitude of the diameter discontinuity that can be tolerated without a clearing electrode is given
Yano, H.; Fujiwara, A.
After the successful launch in May 2003, the Hayabusa (MUSES-C) mission of JAXA/ISAS will collect surface materials (e.g., regolith) of several hundred mg to several g in total from the S-type near Earth asteroid (25143) Itokawa in late 2005 and bring them back to ground laboratories in the summer of 2007. The retrieved samples will be given initial analysis at the JAXA/ISAS astromaterial curation facility, which is currently in the preparation for its construction, by the Hayabusa Asteroidal Sample Preliminary Examination Team (HASPET). HASPET is consisted of the ISAS Hayabusa team, the international partners from NASA and Australia and all-Japan meteoritic scientists to be selected as outsourcing parts of the initial analyses. The initial analysis to characterize general aspects of returned samples can consume only 15 % of its total mass and must complete the whole analyses including the database building before international AO for detailed analyses within the maximum of 1 year. Confident exercise of non-destructive, micro-analyses whenever possible are thus vital for the HASPET analysis. In the purpose to survey what kinds and levels of micro-analysis techniques in respective fields, from major elements and mineralogy to trace and isotopic elements and organics, are available in Japan at present, ISAS has conducted the HASPET open competitions in 2000-01 and 2004. The initial evaluation was made by multiple domestic peer reviews. Applicants were then provided two kinds of unknown asteroid sample analogs in order to conduct proposed analysis with self-claimed amount of samples in self-claimed duration. After the completion of multiple, international peer reviews, the Selection Committee compiled evaluations and recommended the finalists of each round. The final members of the HASPET will be appointed about 2 years prior to the Earth return. Then they will conduct a test-run of the whole initial analysis procedures at the ISAS astromaterial curation facility and
Development of ISA procedure for uranium fuel fabrication and enrichment facilities
International Nuclear Information System (INIS)
Yamate, Kazuki; Arakawa, Tomoyuki; Yamashita, Masahiro; Sasaki, Noriaki; Hirano, Mitsumasa
2011-01-01
The integrated safety analysis (ISA) procedure has been developed to apply risk-informed regulation to uranium fuel fabrication and enrichment facilities. The major development efforts are as follows: (a) preparing the risk level matrix as an index for items-relied-on-for-safety (IROFS) identification, (b) defining requirements of IROFS, and (c) determining methods of IROFS importance based on the results of risk- and scenario-based analyses. For the risk level matrix, the consequence and likelihood categories have been defined by taking into account the Japanese regulatory laws, rules, and safety standards. The trial analyses using the developed procedure have been performed for several representative processes of the reference uranium fuel fabrication and enrichment facilities. This paper presents the results of the ISA for the sintering process of the reference fabrication facility. The results of the trial analyses have demonstrated the applicability of the procedure to the risk-informed regulation of these facilities. (author)
McGloin, Matthew
2017-01-01
Uranium mineralisation near Mount Isa in northwest Queensland, Australia, is widespread yet poorly understood. Within this region in the Western Fold Belt, one hundred and ninety uranium-rare metal occurrences are known. This uranium mineralisation is similar to worldwide examples of albitite-hosted or sodium-metasomatic uranium deposits, which host albite-carbonate ore zones enriched in incompatible elements. Various metal sources and ore-forming processes have been sugg...
Directory of Open Access Journals (Sweden)
V.F.B. Roll
2008-06-01
Full Text Available This study was carried out throughout a laying period to compare the behaviour and performance of two groups of commercial layers, 180 ISA Brown and 120 Hy line W98, housed at 17 weeks of age in furnished cages with a nest box, perches, dust-bath, and claw shortening device. Based on productive parameters, the model of furnished cages studied is suitable for both, Isa Brown and Hy line hens. The study suggested that strain has a significant effect on feather condition and on some behavioural displays, particularly those related to the use of a dust-bath.Durante um ciclo completo de postura foram avaliados o comportamento e o desempenho de duas linhagens de poedeiras comerciais, 180 ISA Brown e 120 Hy line W98, alojadas com 17 semanas de idade em gaiolas enriquecidas com ninho, poleiros, banho de areia e dispositivos de desgaste de unhas. Em ambas as linhagens, Isa Brown e Hy line W98, o modelo de gaiola estudado foi apropriado em termos de desempenho produtivo. O estudo sugeriu que a linhagem teve efeito significativo sobre a condição da plumagem e sobre alguns aspectos comportamentais, particularmente, aqueles relacionados ao uso do banho de areia.
Isa-ema maa : [luuletused] / Leelo Tungal
Tungal, Leelo, 1947-
2001-01-01
Sisu: Isa-ema maa ; Vahetund ; Päkapikk võis näha ; Kodune jutt ; Koeruse mõõt ; mütsid ; Loomade laul ; Igal sügisel ; Väike jõulusoov ; Millal tuled, jõuluvana ; Paharet ; Suur õun ; Teiste laste mänguasjad ; Oi heldeke! ; Tere-tere ; Kui ma ... ; Magus tähestik ; Pluss ja miinus ; Pinalis ; Esimese klassi õpilane ; Teise klassi õpilane ; Miks on kana vana? ; Hommik ; Seitsme maa ja mere taga ; Köha pere ; Harjad ; Täna sügist mängib suvi ; Toas ; Laps jäi voodis magama ; Klassivennad ; Talvehommik ; Siili elu ; Hiirehernesupp ; Hundi lugemine ; Karu ärkamine ; Unelaul ; Salajutt ; Kooli eel ; Laiskvorsti elu ; Kindel plaan ; Oma kohal ; Puhkama ; Vana vahva lasteaed ; Sama laps ; Tüli
DOCUMENTACIÓN DE UNA PRUEBA DE BIODEGRADACIÓN BAJO DIGESTIÓN ANAEROBIA CON ISA S.88
Directory of Open Access Journals (Sweden)
PAOLA MARCELA CERTUCHE MUÑOZ
2016-12-01
Full Text Available This paper proposes the ISA 88 standard as a tool to standardize a biodegradation test, through systematic documentation of tests, which contributes to the reproducibility and repetitividad of the method. This standard was applied to the ISO 15985 test; after the implementation of the standard, the process model was formed of 3 stages, 14 and 78 shares operations; procedural control model was formed of 3 unit procedures, operations 14 and 78 phases; the physical model, was formed of 4 units with their respective modules and control equipment; the recipe control model was integrated by physical model and procedural model and defines the formulation of materials. The automation level´s cell is determined at level 0 (74% manual, semiautomatic 33% and 6% automatic. The difficulty level of operating phases was identified as (77% under, 17% regulate and 6% higher. Finally, are exposed the advantages of the use for the standard in terms of standardization, frame generation control, flexibility and automation diagnosis.
International Nuclear Information System (INIS)
Moreno Chamorro, P.; Gallego Diaz, C.
2011-01-01
The main objective of this work is to show the current status of the implementation of integrated analysis of safety (ISA) methodology and its SCAIS associated tool (system of simulation codes for ISA) to the sequence analysis of total loss of feedwater in a PWR reactor model Westinghouse of three loops with large, dry containment.
Department of Homeland Security — This dataset contains the online agreement information needs to share Trade information via a Trade VPN. When submitted, the data is sent in an email to the business...
Development of an international standard on instruments setpoints based on ISA S67.04 - 1994
International Nuclear Information System (INIS)
Quinn, E.L.
1996-01-01
This is a summary of the application for and development of an international standard on instrument setpoints, based on the Instrument Society of America (ISA) Standard S67.04 - 1994. The forum this new standard was proposed in is the International Electrotechnique Commission (IEC), based in Geneva, Switzerland, which is the international commission which oversees electrical and instrumentation standards for all applications around the world. The Instrument Society of America (ISA) is a United States based Society for the advancement of instrumentation and controls related science and technology and has 30,000 members. A division within the ISA is the Standard and Practices board which has over 5000 members actively involved in standards development and approval. In 1994, the ISA SP67, Nuclear Power Plant Standards Committee authorized that the IEC be approached to develop and issue an IEC standard on Instrument Setpoints. This application was formally submitted in January, 1995 to the IEC and approved for ballot to member countries in June, 1995. Approval for standard development by IEC was received in October, 1995 and the first draft vas issued in February, 1996, and is currently under review by the IEC working group. It is very important to focus on the approach that the U.S. and other countries are taking toward development of IEC standards that can apply to all nuclear instrumentation applications around the world. By referencing IEC standards in design specification, vendors can be solicited from many different countries, thereby ensuring that the highest quality products can be used. This also offsets the need to specify individual standards in the specification, based on the country that each vendor solicited, represents. In summary, this standard development process, with support from the American National Standards Institute (ANSI) will assist U.S. suppliers in competing in the global market for products and services into the next century. (author)
Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria (Final Report, Sep 2008)
EPA announced the availability of the final report, Integrated Science Assessment (ISA) for Sulfur Oxides – Health Criteria final assessment. This report represents a concise synthesis and evaluation of the most policy-relevant science and will ultimately provide the scien...
Derivatives, forms and vector fields on the κ-deformed Euclidean space
International Nuclear Information System (INIS)
Dimitrijevic, Marija; Moeller, Lutz; Tsouchnika, Efrossini
2004-01-01
The model of κ-deformed space is an interesting example of a noncommutative space, since it allows a deformed symmetry. In this paper, we present new results concerning different sets of derivatives on the coordinate algebra of κ-deformed Euclidean space. We introduce a differential calculus with two interesting sets of one-forms and higher-order forms. The transformation law of vector fields is constructed in accordance with the transformation behaviour of derivatives. The crucial property of the different derivatives, forms and vector fields is that in an n-dimensional spacetime there are always n of them. This is the key difference with respect to conventional approaches, in which the differential calculus is (n + 1)-dimensional. This work shows that derivative-valued quantities such as derivative-valued vector fields appear in a generic way on noncommutative spaces
This study was performed to compare four Clostridium perfringens recombinant proteins as vaccine candidates using the Montanide™ ISA 71 VG adjuvant in an experimental model of necrotic enteritis. Broiler chickens were immunized with clostridial recombinant proteins with ISA 71 VG, and intestinal le...
The in-depth safety assessment (ISA) pilot projects in Ukraine
International Nuclear Information System (INIS)
Kot, C. A.
1998-01-01
Ukraine operates pressurized water reactors of the Soviet-designed type, VVER. All Ukrainian plants are currently operating with annually renewable permits until they update their safety analysis reports (SARs). After approval of the SARS by the Ukrainian Nuclear Regulatory Authority, the plants will be granted longer-term operating licenses. In September 1995, the Nuclear Regulatory Authority and the Government Nuclear Power Coordinating Committee of Ukraine issued a new contents requirement for the safety analysis reports of VVERs in Ukraine. It contains requirements in three major areas: design basis accident (DBA) analysis, probabilistic risk assessment (PRA), and beyond design-basis accident (BDBA) analysis. The DBA requirements are an expanded version of the older SAR requirements. The last two requirements, on PRA and BDBA, are new. The US Department of Energy (USDOE), through the International Nuclear Safety Program (INSP), has initiated an assistance and technology transfer program to Ukraine to assist their nuclear power stations in developing a Western-type technical basis for the new SARS. USDOE sponsored In-Depth Safety Assessments (ISAs) have been initiated at three pilot nuclear reactor units in Ukraine, South Ukraine Unit 1, Zaporizhzhya Unit 5, and Rivne Unit 1. USDOE/INSP have structured the ISA program in such a way as to provide maximum assistance and technology transfer to Ukraine while encouraging and supporting the Ukrainian plants to take the responsibility and initiative and to perform the required assessments
International Nuclear Information System (INIS)
Izquierdo-Rocha, Jose Maria; Sanchez-Perea, Miguel; Cojazzi, Giacomo
2004-01-01
This paper reviews the main features of ISA, a concept developed as a result of previous work on safety assessment and dynamic reliability. The method links the dynamics of the facility with its operating environment, subject to transitions between different time evolutions due to failures and/or system/operator interventions. For situations dominated by Deterministic Transitions (i.e., transitions upon deterministic demands as a result for instance of exceeding automatic-actions/alarm setpoints), the methodology can be considered an extension of PSA and accident analysis techniques that replaces the static event tree with a Deterministic Dynamic Event Tree (DDET) concept based on the Theory of Probabilistic Dynamics. The paper also summarizes some results of an ISA application to the assessment of the Emergency Operating Procedure (EOP) of a PWR-W to mitigate the Steam Generator Tube Rupture (SGTR) initiating event. (author)
Gestión estratégica institucional: Caso ISA
Directory of Open Access Journals (Sweden)
Carlos Eduardo Martínez Fajardo
2003-12-01
Full Text Available Desde la perspectiva histórica neoinstitucional, en el presente artículo se analiza la gestión estratégica de la empresa Interconexión Eléctrica S.A. (ISA, mostrando los principales elementos de los cambios institucionales, estratégicos, de estructura y resultados de la empresa desde mediados de la década de los noventa. Se destaca el desarrollo de capacidades organizacionales que le han permitido tener una clara ventaja competitiva en el sector eléctrico colombiano y una estrategia de desarrollo hacia el exterior, a través de la relativa posición favorable con respecto a empresas de países desarrollados.
Electron clearing and dimensional tolerance for the ISA chamber
International Nuclear Information System (INIS)
Herrera, J.C.
1976-01-01
In the straight sections of the ISA ring, the clearing of the low energy electrons produced by the beam-gas collisions will take place by longitudinal motion. Thus, an electron of low energy, which is prevented from escaping transversely by the attractive field of the beam, will receive successive kicks by the circulating protons and thereby acquire sufficient energy to travel longitudinally toward the clearing electrodes. However, a discontinuity or step in the chamber diameter, which occurs within an axial distance equal to a few diameters, gives rise to a potential difference along the chamber axis. An estimate of the magnitude of the diameter discontinuity that can be tolerated without a clearing electrode is given
Energy Technology Data Exchange (ETDEWEB)
Saviz, K.
1998-05-26
The year 2000 is rapidly approaching, and there is a good chance that computer systems that utilize two digit year dates will experience problems in retrieval of date information. The ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software and computer system has been reviewed for Year 2000 compliance issues.
International Nuclear Information System (INIS)
Saviz, K.
1998-01-01
The year 2000 is rapidly approaching, and there is a good chance that computer systems that utilize two digit year dates will experience problems in retrieval of date information. The ISA Thermoluminescent Dosimetry Data Processing (TL-DP) software and computer system has been reviewed for Year 2000 compliance issues
"Isa kuhu need värvid jäävad ..." : [luuletused] / Jaan Kaplinski
Kaplinski, Jaan, 1941-
2002-01-01
Sisu: "Isa kuhu need värvid jäävad ..." ; Lume ootamine ; "Oh sina paha peavalu ..." ; "Märg on vihmal märg on kastel ..." ; "Peet kisub peeti ..." ; "Küllap väikestel mustadel ..." ; "Mart haigutab ..." ; Kuu ; Teremees Tõnu ; Jalgrataste talveuni ; Kitsu ja kätsu ; Siret siret siterkuuti ; Suve soe silmadesse ; Iirimaal on ilmalapsed ; Miks ; Sügisel ; Täis ; Mis algab ; Aeg ; "Ma koiduajal ärkasin ..."
Efficient I/O Joining and Reliable Data Publication in Energy Harvested ISA100.11a Network
Das, Kallol; Mathews, E.; Zand, P.; Sanchez Ramirez, Andrea; Havinga, Paul J.M.
Energy harvesting technologies have brought a paradigm shift in the industrial automation sector by procreating self-powered wireless input/output (I/O) devices. Unfortunately, current wireless technologies for industrial applications, such as ISA100.11a and WirelessHART, are yet far from supporting
Wagner, Raymond S.; Barton, Richard J.
2011-01-01
Standards-based wireless sensor network (WSN) protocols are promising candidates for spacecraft avionics systems, offering unprecedented instrumentation flexibility and expandability. Ensuring reliable data transport is key, however, when migrating from wired to wireless data gathering systems. In this paper, we conduct a rigorous laboratory analysis of the relative performances of the ZigBee Pro and ISA100.11a protocols in a representative crewed aerospace environment. Since both operate in the 2.4 GHz radio frequency (RF) band shared by systems such as Wi-Fi, they are subject at times to potentially debilitating RF interference. We compare goodput (application-level throughput) achievable by both under varying levels of 802.11g Wi-Fi traffic. We conclude that while the simpler, more inexpensive ZigBee Pro protocol performs well under moderate levels of interference, the more complex and costly ISA100.11a protocol is needed to ensure reliable data delivery under heavier interference. This paper represents the first published, rigorous analysis of WSN protocols in an aerospace environment that we are aware of and the first published head-to-head comparison of ZigBee Pro and ISA100.11a.
The ISA 700 Auditor’s Report and the Audit Expectation Gap – Do Additional Explanations Matter?
Gold, A.H.; Pott, C.; Gronewold, U.
2012-01-01
In this paper we test the effectiveness of explanations as mandated by the revised ISA 700 auditor's report in reducing the audit expectation gap. German auditors and financial statement users participated in an experiment where they read a summary of a firm's financial statements and an auditor's
2010-11-10
... ENVIRONMENTAL PROTECTION AGENCY [FRL-9224-7] Workshop To Review Draft Materials for the Lead (Pb) Integrated Science Assessment (ISA) AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of Workshop... (NAAQS) for Lead (Pb), EPA is announcing that a workshop to evaluate initial draft materials for the Pb...
A Pilot Study of Children's Blood Lead Levels in Mount Isa, Queensland.
Green, Donna; Sullivan, Marianne; Cooper, Nathan; Dean, Annika; Marquez, Cielo
2017-12-13
Mount Isa, Queensland, is one of three Australian cities with significant lead emissions due to nonferrous mining and smelting. Unlike the two other cities with lead mines or smelters, Mount Isa currently has no system of annual, systematic, community-wide blood lead level testing; and testing rates among Indigenous children are low. In previous screenings, this group of children has been shown to have higher average blood lead levels than non-Indigenous children. The first aim of this study was to assess whether parents and children would participate in less invasive, rapid point-of-care capillary testing. The second aim was to measure blood lead levels among a range of children that roughly reflected the percentage of the Indigenous/non-Indigenous population. This pilot study is based on a convenience sample of children between the ages of 12 and 83 months who were recruited to participate by staff at a Children and Family Centre. Over three half-days, 30 children were tested using capillary blood samples and the LeadCare II Point-of-Care testing system. Rapid point-of-care capillary testing was well tolerated by the children. Of 30 children tested, 40% ( n = 12) had blood lead levels ≥5 µg/dL and 10% had levels ≥10 µg/dL. The highest blood lead level measured was 17.3 µg/dL. The percentage of children with blood lead levels ≥5 µg/dL was higher among Indigenous children compared to non-Indigenous (64.2% compared to 18.8%) as was the geometric mean level (6.5 (95% CI, 4.7, 9.2) versus 2.4 (95% CI, 1.8, 3.1)), a statistically significant difference. Though based on a small convenience sample, this study identified 12 children (40%) of the sample with blood lead levels ≥5 µg/dL. Due to historical and ongoing heavy metal emissions from mining and smelting in Mount Isa, we recommend a multi-component program of universal blood lead level testing, culturally appropriate follow-up and intervention for children who are identified with blood lead levels ≥5
Lee, Lindsay; Mann, Graham; Carslaw, Ken; Toohey, Matthew; Aquila, Valentina
2016-04-01
The World Climate Research Program's SPARC initiative has a new international activity "Stratospheric Sulphur and its Role in Climate" (SSiRC) to better understand changes in stratospheric aerosol and precursor gaseous sulphur species. One component of SSiRC involves an intercomparison "ISA-MIP" of composition-climate models that simulate the stratospheric aerosol layer interactively. Within PoEMS each modelling group will run a "perturbed physics ensemble" (PPE) of interactive stratospheric aerosol (ISA) simulations of the Pinatubo eruption, varying several uncertain parameters associated with the eruption's SO2 emissions and model processes. A powerful new technique to quantify and attribute sources of uncertainty in complex global models is described by Lee et al. (2011, ACP). The analysis uses Gaussian emulation to derive a probability density function (pdf) of predicted quantities, essentially interpolating the PPE results in multi-dimensional parameter space. Once trained on the ensemble, a Monte Carlo simulation with the fast Gaussian emulator enabling a full variance-based sensitivity analysis. The approach has already been used effectively by Carslaw et al., (2013, Nature) to quantify the uncertainty in the cloud albedo effect forcing from a 3D global aerosol-microphysics model allowing to compare the sensitivy of different predicted quantities to uncertainties in natural and anthropogenic emissions types, and structural parameters in the models. Within ISA-MIP, each group will carry out a PPE of runs, with the subsequent analysis with the emulator assessing the uncertainty in the volcanic forcings predicted by each model. In this poster presentation we will give an outline of the "PoEMS" analysis, describing the uncertain parameters to be varied and the relevance to further understanding differences identified in previous international stratospheric aerosol assessments.
Directory of Open Access Journals (Sweden)
Margareth Guimarães Lima
2012-12-01
Full Text Available O objetivo foi detectar fatores associados à felicidade na população idosa. O estudo é do tipo transversal, de base populacional, com dados de 1.431 idosos do ISA-Camp 2008. A amostragem foi probabilística, por conglomerado e em dois estágios. Foram estimadas as prevalências do sentimento de felicidade por todo o tempo, segundo variáveis sociais, demográficas, de comportamentos e condições de saúde. Os idosos que se sentem felizes por maior tempo são os casados, os que trabalham, são ativos ou insuficientemente ativos no lazer, ingerem bebida alcoólica ocasionalmente, consomem frutas, legumes e verduras todos os dias, não são obesos, apresentam um tempo de sono The objective was to identify factors associated with happiness in the elderly. A cross-sectional, population-based study was conducted in 1,431 elderly under the ISA-Camp 2008 project. The survey used a two-stage probabilistic cluster sample. Prevalence of happiness was measured over time according to socio-demographics variables, health behaviors, and health conditions. High prevalence of happiness was associated with: marital status (married, active working, activity and insufficient leisure-time activity, occasional consumption of alcoholic beverages, daily consumption of fruit, vegetables, and leafy vegetables, normal body mass index, and sleeping less than 10 hours/night and sleeping well. The highest prevalence of long-term happiness was observed among elderly with no reported illness, with better self-rated health, and with less disability. Happiness was strongly related to health indicators, suggesting the adequacy of complementary use of this indicator for evaluating health promotion programs in the elderly.
Anastasio Vallejos, Carla Arleen; Universidad César Vallejos- Chiclayo
2016-01-01
La investigación lleva como título “Estrategias de marketing mix para aumentar las ventas de servicios educativos en la especialidad de secretariado ejecutivo en el Instituto Superior Tecnológico ISA-chiclayo-2014”, donde se tuvo como principal objetivo proponer estrategias de marketing mix para aumentar las ventas de servicios educativos en la especialidad de secretariado ejecutivo en el Instituto Superior Tecnológico ISA-Chiclayo. Para ello se realizó un estudio de tipo descriptivo – propos...
A Pilot Study of Children’s Blood Lead Levels in Mount Isa, Queensland
Directory of Open Access Journals (Sweden)
Donna Green
2017-12-01
Full Text Available Mount Isa, Queensland, is one of three Australian cities with significant lead emissions due to nonferrous mining and smelting. Unlike the two other cities with lead mines or smelters, Mount Isa currently has no system of annual, systematic, community-wide blood lead level testing; and testing rates among Indigenous children are low. In previous screenings, this group of children has been shown to have higher average blood lead levels than non-Indigenous children. The first aim of this study was to assess whether parents and children would participate in less invasive, rapid point-of-care capillary testing. The second aim was to measure blood lead levels among a range of children that roughly reflected the percentage of the Indigenous/non-Indigenous population. This pilot study is based on a convenience sample of children between the ages of 12 and 83 months who were recruited to participate by staff at a Children and Family Centre. Over three half-days, 30 children were tested using capillary blood samples and the LeadCare II Point-of-Care testing system. Rapid point-of-care capillary testing was well tolerated by the children. Of 30 children tested, 40% (n = 12 had blood lead levels ≥5 µg/dL and 10% had levels ≥10 µg/dL. The highest blood lead level measured was 17.3 µg/dL. The percentage of children with blood lead levels ≥5 µg/dL was higher among Indigenous children compared to non-Indigenous (64.2% compared to 18.8% as was the geometric mean level (6.5 (95% CI, 4.7, 9.2 versus 2.4 (95% CI, 1.8, 3.1, a statistically significant difference. Though based on a small convenience sample, this study identified 12 children (40% of the sample with blood lead levels ≥5 µg/dL. Due to historical and ongoing heavy metal emissions from mining and smelting in Mount Isa, we recommend a multi-component program of universal blood lead level testing, culturally appropriate follow-up and intervention for children who are identified with blood lead
International Nuclear Information System (INIS)
Zabadal, J.; Vilhena, M.T.; Segatto, C.F.; Pazos, R.P.Ruben Panta.
2002-01-01
In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations
Energy Technology Data Exchange (ETDEWEB)
Zabadal, J. E-mail: jorge.zabadal@ufrgs.br; Vilhena, M.T. E-mail: vilhena@mat.ufrgs.br; Segatto, C.F. E-mail: cynthia@mat.ufrgs.br; Pazos, R.P.Ruben Panta. E-mail: rpp@mat.pucrgs.br
2002-07-01
In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations.
Di Blasio, Andrea; Morano, Teresa; Napolitano, Giorgio; Bucci, Ines; Di Santo, Serena; Gallina, Sabina; Cugusi, Lucia; Di Donato, Francesco; D'Arielli, Alberto; Cianchetti, Ettore
2016-12-01
The negative side effects of breast cancer treatments can include upper limb lymphoedema. The growing literature indicates that Nordic walking is an effective discipline against several disease symptoms. The aim of this study was to determine whether introduction to Nordic walking alone is effective against total body extracellular water and upper limb circumferences in breast cancer survivors compared to its combination with a series of specifically created exercises (i.e. the Isa method). 16 breast cancer survivors (49.09 ± 2.24 years) were recruited and randomly assigned to 1 of 2 different training groups. 10 lessons on Nordic walking technique plus the Isa method significantly reduced both extracellular body water and the extracellular-to-total body water ratio (p = 0.01 for both), and also the circumference of the upper limb, (both relaxed arm and forearm circumferences) (p = 0.01 for all), whereas Nordic walking alone did not. Introduction to Nordic walking does not seem to affect lymphoedema in breast cancer survivors. This might be because novice Nordic Walkers do not adequately generate an effective muscular pump through coordination of the alternated bimanual open-close cycle. The Isa method appears to close this gap.
Märt Agu: "Isa vari käib mul kogu aeg kannul" / Märt Agu ; interv. Aigi Viira
Agu, Märt
2006-01-01
1. okt. tähistas oma 30-aastast sünnipäeva ja oma ellukutsuja Mait Agu 55-sünniaastapäeva Tallinna Ülikooli koreograafiaosakond. Sel puhul esitati Estonias Mait Agu tantsulavastus "Kodalased ja kaasaegsed", mille seadis uuesti lavale Märt Agu oma isa loodud koreograafia põhjal
Transportation considerations related to waste forms and canisters for Defense TRU wastes
International Nuclear Information System (INIS)
Schneider, K.J.; Andrews, W.B.; Schreiber, A.M.; Rosenthal, L.J.; Odle, C.J.
1981-09-01
This report identifies and discusses the considerations imposed by transportation on waste forms and canisters for contact-handled, solid transuranic wastes from the US Department of Energy (DOE) activities. The report reviews (1) the existing raw waste forms and potential immobilized waste forms, (2) the existing and potential future DOE waste canisters and shipping containers, (3) regulations and regulatory trends for transporting commercial transuranic wastes on the ISA, (4) truck and rail carrier requirements and preferences for transporting the wastes, and (5) current and proposed Type B external packagings for transporting wastes
Directory of Open Access Journals (Sweden)
Andrzej Krystian Piosik
2016-06-01
Full Text Available The paper addresses the question of the links between implementing ISA 540 and mitigating the practice of smoothing reported net earnings using write-offs of accounts receivable and inventory by reporting entities in Poland. The research question stems from the previous analysis carried out by the author in which evidence was provided that reporting entities in Poland in the period 2000–2010 effectively used write-offs of accounts receivable and inventory in order to mitigate fluctuations of reported net earnings. This paper provides evidence that before implementing ISA 540 reporting entities used write-offs of receivables and inventory for income smoothing in effective manner, however in the period after implementing the standard (2009–2014 no link was observed between the write-offs and reduced fluctuations of reported net earnings. The research has been carried out using Wilcoxon signed-rank test used to check equality of medians of mean deviations of net earnings before write-offs of receivables and inventory and mean deviations of net earnings after write-offs. For the period before implementing ISA 540 there are grounds to reject the hypothesis of equality of medians of mean deviations of net earnings, however in the post-adoption period there is no justification to reject the hypothesis of equality of medians. The research provides evidence of positive impact of ISA 540 mitigating the processes of accounting earnings management. The indicated regularity does not apply to banks, because within this group of companies we have not observed the use of write-offs of loan receivables in order to reduce the variability of net earnings before implementing ISA 540 and in the period following the implementation of the standard.
A novel thiamine-derived pigment, pyrizepine, formed by the Maillard reaction.
Igoshi, Asuka; Noda, Kyoko; Murata, Masatsune
2018-04-26
To find a Maillard pigment derived from thiamine, a solution containing glucose and thiamine was heated and analyzed with high-performance liquid chromatography equipped with diode-array detection. As a result, a unique peak showing an absorption maximum at 380 nm was detected. This peak was then isolated from a reaction solution containing glucose, lysine and thiamine, and was identified as 1-(2-methyl-6,9-dihydro-5H-pyrimido[4,5-e][1,4]diazepin-7-yl)ethan-1-one using instrumental analyses. This compound, named pyrizepine, was a novel yellow pigment having a fused ring consisting of pyrimidine and diazepine. Pyrizepine was a major low-molecular-weight pigment in the reaction solution. The structure suggests that pyrizepine is formed by condensation reaction between a degradation product of thiamine and a tetrosone derivative formed from glucose by the Maillard reaction.
Directory of Open Access Journals (Sweden)
Bellido-Valencia Omar
2017-12-01
Full Text Available Andean grains (i.e. quinoa, amaranth have been increasingly studied in recent times, mainly due to the increase in international consumption. However, Andean tubers other than potatoes have not been so widespread and are mainly studied for their starch, previously extracted. This work studied the morphology of native starch in four of these crops (oca, olluco, isaño and aracacha, during cooking and the evolution of their internal temperature in relation to sensory acceptability. Using scanning electron microscopy, it was determined that the size of crude starch granules was between 9 μm to 38.2 μm for oca, 4.48 to 24.9 μm for olluco, 4.45 to 22.9 μm for isaño, and 5.36 to 23.8 μm for arracacha. Sensorially, it was determined that the optimum cooking temperature for arracacha was 89.1°C, 90.9°C for oca, 91°C for isaño, and 91.4 °C for olluco. All samples had optimal cooking times shorter than potato, with the isaño having the best heat transfer.
Tumor cell-derived microparticles: a new form of cancer vaccine.
Zhang, Huafeng; Huang, Bo
2015-08-01
For cancer vaccines, tumor antigen availability is currently not an issue due to technical advances. However, the generation of optimal immune stimulation during vaccination is challenging. We have recently demonstrated that tumor cell-derived microparticles (MP) can function as a new form of potent cancer vaccine by efficiently activating type I interferon pathway in a cGAS/STING dependent manner.
Barazandeh Tehrani, Maliheh; Namadchian, Melika; Fadaye Vatan, Sedigheh; Souri, Effat
2013-04-10
A derivative spectrophotometric method was proposed for the simultaneous determination of clindamycin and tretinoin in pharmaceutical dosage forms. The measurement was achieved using the first and second derivative signals of clindamycin at (1D) 251 nm and (2D) 239 nm and tretinoin at (1D) 364 nm and (2D) 387 nm.The proposed method showed excellent linearity at both first and second derivative order in the range of 60-1200 and 1.25-25 μg/ml for clindamycin phosphate and tretinoin respectively. The within-day and between-day precision and accuracy was in acceptable range (CVpharmaceutical dosage form.
Photophysical properties of columnar phases formed by triphenylene derivatives
International Nuclear Information System (INIS)
Sigal, Herve
1997-01-01
This research thesis reports the study of the spectroscopic properties and of the migration of excitation energy in the singlet state in columnar phases formed by alkyloxy and alkylthio derivatives of triphenylene. First, the author studied the spectroscopic properties of chromophores in solutions, and characterized excited states by using computation codes (CS-INDO-CIPSI). Then, by using the excitonic theory in the case of the considered triphenylene derivatives, the author studied the influence of molecular movements and of the intra-columnar order on the spectroscopic properties. In some circumstances, the non-radiative transfer of excitation energy is governed by a mechanism displaying a random evolution. This stochastic movement is studied by using Monte Carlo simulations. The author shows that the energy migration is one-dimensional on short times, and then becomes three-dimensional. The evolution of excitation energy in space and in time is determined [fr
Wagner, Raymond S.; Barton, Richard J.
2011-01-01
Wireless Sensor Networks (WSNs) can provide a substantial benefit in spacecraft systems, reducing launch weight and providing unprecedented flexibility by allowing instrumentation capabilities to grow and change over time. Achieving data transport reliability on par with that of wired systems, however, can prove extremely challenging in practice. Fortunately, much progress has been made in developing standard WSN radio protocols for applications from non-critical home automation to mission-critical industrial process control. The relative performances of candidate protocols must be compared in representative aerospace environments, however, to determine their suitability for spaceflight applications. In this paper, we will present the results of a rigorous laboratory analysis of the performance of two standards-based, low power, low data rate WSN protocols: ZigBee Pro and ISA100.11a. Both are based on IEEE 802.15.4 and augment that standard's specifications to build complete, multi-hop networking stacks. ZigBee Pro targets primarily the home and office automation markets, providing an ad-hoc protocol that is computationally lightweight and easy to implement in inexpensive system-on-a-chip components. As a result of this simplicity, however, ZigBee Pro can be susceptible to radio frequency (RF) interference. ISA100.11a, on the other hand, targets the industrial process control market, providing a robust, centrally-managed protocol capable of tolerating a significant amount of RF interference. To achieve these gains, a coordinated channel hopping mechanism is employed, which entails a greater computational complexity than ZigBee and requires more sophisticated and costly hardware. To guide future aerospace deployments, we must understand how well these standards relatively perform in analog environments under expected operating conditions. Specifically, we are interested in evaluating goodput -- application level throughput -- in a representative crewed environment
Kjubrikovo čitanje Bardžisa: Značaj kostima za razumevanje Paklene pomorandže
Dijana Metlić
2016-01-01
Roman Paklena pomorandža Entonija Bardžisa, objavljen 1962. godine, postao je jedno od kultnih književnih dela XX veka, pre svega zahvaljujući istoimenom filmu Stenlija Kjubrika iz 1971. Okarakterisan kao dekadentno i nihilističko ostvarenje, snimljen tako da gledaoci „uživaju“ u scenama nasilja, Kjubrikov film bio je, uz prekide, u distribuciji u Britaniji do 1974. godine kada je povučen na zahtev reditelja zbog optužbi koje su ga implicitno teretile za povećanje stepena delinkventskog nasil...
Synthesis and complex forming property of phosphor acid derivatives
International Nuclear Information System (INIS)
Babaev, B.N.
2004-01-01
Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from
Haga, Wayne; Moreno, Abel; Segall, Mark
2012-01-01
In this paper, we compare the performance of Computer Information Systems (CIS) majors on the Information Systems Analyst (ISA) Certification Exam. The impact that the form of delivery of information systems coursework may have on the exam score is studied. Using a sample that spans three years, we test for significant differences between scores…
Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.
Hotzel, Konrad; Heinze, Thomas
2016-11-03
An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Padmanabhan, P.K.; Page, A.G.
1997-02-01
This volume contains the proceedings of the ISAS (Indian Society of Analytical Scientists) national symposium. The main thrust of the symposium was on new fuel cycle technologies relevant to thorium utilisation programmes. The technologies for different separation processes, techniques for measurements of various process parameters and highly sensitive analytical methods for the determination of the chemical constituents were among the other topics covered. Quality upgradation, standardisation of methods and validation of measurements which are integral parts of product evaluation were also discussed. Papers relevant to INIS are indexed separately
Sharing Data for Production Scheduling Using the ISA-95 Standard
Energy Technology Data Exchange (ETDEWEB)
Harjunkoski, Iiro, E-mail: iiro.harjunkoski@de.abb.com; Bauer, Reinhard [ABB Corporate Research, Industrial Software and Applications, Ladenburg (Germany)
2014-10-21
In the development and deployment of production scheduling solutions, one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment, and other resources are necessary for producing a realistic short-term production plan. Currently, a widely accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data exchange for scheduling solutions.
Sharing Data for Production Scheduling Using the ISA-95 Standard
International Nuclear Information System (INIS)
Harjunkoski, Iiro; Bauer, Reinhard
2014-01-01
In the development and deployment of production scheduling solutions, one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment, and other resources are necessary for producing a realistic short-term production plan. Currently, a widely accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data exchange for scheduling solutions.
Sharing data for production scheduling using the ISA-95 standard
Directory of Open Access Journals (Sweden)
Iiro eHarjunkoski
2014-10-01
Full Text Available In the development and deployment of production scheduling solutions one major challenge is to establish efficient information sharing with industrial production management systems. Information comprising production orders to be scheduled, processing plant structure, product recipes, available equipment and other resources are necessary for producing a realistic short-term production plan. Currently, a widely-accepted standard for information sharing is missing. This often leads to the implementation of costly custom-tailored interfaces, or in the worst case the scheduling solution will be abandoned. Additionally, it becomes difficult to easily compare different methods on various problem instances, which complicates the re-use of existing scheduling solutions. In order to overcome these hurdles, a platform-independent and holistic approach is needed. Nevertheless, it is difficult for any new solution to gain wide acceptance within industry as new standards are often refused by companies already using a different established interface. From an acceptance point of view, the ISA-95 standard could act as a neutral data-exchange platform. In this paper, we assess if this already widespread standard is simple, yet powerful enough to act as the desired holistic data-exchange for scheduling solutions.
The comparison of physical properties derived from gas and dust in a massive star-forming region
Energy Technology Data Exchange (ETDEWEB)
Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)
2014-05-10
We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.
The comparison of physical properties derived from gas and dust in a massive star-forming region
International Nuclear Information System (INIS)
Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve
2014-01-01
We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.
Two forms of Vibrio cholerae O1 El Tor hemolysin derived from identical precursor protein.
Ikigai, H; Ono, T; Nakae, T; Otsuru, H; Shimamura, T
1999-01-08
Vibrio cholerae O1 grown in heart infusion broth produces two forms of El Tor hemolysin (ETH) monomers of 65 and 50 kDa. These monomers form several different sizes of mixed oligomers ranging from 180 to 280 kDa in the liposomal membranes. We found that the N-terminal amino acid sequences, NH2-Trp-Pro-Ala-Pro-Ala-Asn-Ser-Glu, of both the 65- and 50-kDa toxins were identical. We assumed, therefore, that the 65- and 50-kDa toxins were derivatives of the identical precursor protein and the 50-kDa protein was a truncated derivative of 65-kDa ETH. To substantiate this assumption, we treated the 260-kDa oligomer with trypsin and obtained a 190-kDa oligomer. This 190-kDa oligomer consisted of only the 50-kDa subunits. Both 260- and 190-kDa oligomers formed ion channels indistinguishable from each other in planar lipid bilayers. These results suggest that the essential part of the ETH in forming the membrane-damaging aggregate is a 50-kDa protein.
Directory of Open Access Journals (Sweden)
Nicolas Christoforou
Full Text Available The mammalian heart has little capacity to regenerate, and following injury the myocardium is replaced by non-contractile scar tissue. Consequently, increased wall stress and workload on the remaining myocardium leads to chamber dilation, dysfunction, and heart failure. Cell-based therapy with an autologous, epigenetically reprogrammed, and cardiac-committed progenitor cell source could potentially reverse this process by replacing the damaged myocardium with functional tissue. However, it is unclear whether cardiac progenitor cell-derived cardiomyocytes are capable of attaining levels of structural and functional maturity comparable to that of terminally-fated cardiomyocytes. Here, we first describe the derivation of mouse induced pluripotent stem (iPS cells, which once differentiated allow for the enrichment of Nkx2-5(+ cardiac progenitors, and the cardiomyocyte-specific expression of the red fluorescent protein. We show that the cardiac progenitors are multipotent and capable of differentiating into endothelial cells, smooth muscle cells and cardiomyocytes. Moreover, cardiac progenitor selection corresponds to cKit(+ cell enrichment, while cardiomyocyte cell-lineage commitment is concomitant with dual expression of either cKit/Flk1 or cKit/Sca-1. We proceed to show that the cardiac progenitor-derived cardiomyocytes are capable of forming electrically and mechanically coupled large-scale 2D cell cultures with mature electrophysiological properties. Finally, we examine the cell progenitors' ability to form electromechanically coherent macroscopic tissues, using a physiologically relevant 3D culture model and demonstrate that following long-term culture the cardiomyocytes align, and form robust electromechanical connections throughout the volume of the biosynthetic tissue construct. We conclude that the iPS cell-derived cardiac progenitors are a robust cell source for tissue engineering applications and a 3D culture platform for pharmacological
Directory of Open Access Journals (Sweden)
Beatriz Bustos
2012-09-01
Full Text Available La industria salmonera chilena vivió recientemente una crisis de magnitud a partir de la aparición del virus ISA. El artículo examina esta situación, concentrándose en el papel que desempeña la ciencia en las soluciones políticas propuestas, como caso para discutir la capacidad de los mecanismos de gobernanza ambiental neoliberal para solucionar crisis ambientales y económicas. La pregunta que guía el trabajo es: ¿cuál fue el rol de la ciencia en la política ambiental para la industria? El argumento promovido es que la crisis representa un momento de reestructuración de la relación sociedad-naturaleza, en el cual se redefinieron mecanismos de propiedad, control y acceso a recursos naturales, pero en el que, pese al discurso neoliberal de confianza en los expertos y la ciencia como elementos de toma de decisiones, la información científica tuvo escasa relevancia.The Chilean salmon industry recently experienced a crisis due to an outbreak of the ISA virus. The article examines the crisis focusing on the role of science in the policy solutions proposed, to discuss the real capacity of neoliberal environmental governance mechanisms to solve environmental and economic crisis. The question guiding this research is, which was the role of science in environmental policy createdfor the salmon industry? The argument is that the crisis represents a reestructuring of the relationship between society and nature through the redefinition of property rights, control and access to natural resources, but in which, in spite of a neoliberal discourse of trust in experts and science as elements of decision making, scientific information had little relevance.
[The role of science in policy making--EuSANH-ISA project, framework for science advice for health].
Cianciara, Dorota; Piotrowicz, Maria; Bielska-Lasota, Magdalena; Wysocki, Mirosław J
2012-01-01
Governments and other authorities (including MPs) should be well informed on issues of science and technology. This is particularly important in the era of evidence-based practice. This implies the need to get expert advice. The process by which scientific knowledge is transmitted, along with proposals how to solve the problem, is called science advice. The main aim of the article is to discuss the issue of science advice--definitions, interaction between science and policymaking, and its position in contemporary policies. The second aim is to present European Science Advisory Network for Health (EuSANH), EuSANH-ISA project, and framework for science advice for health which was developed by participants. Furthermore, the role of civil society in decision-making process and science advice is also discussed. Interaction between scientists and policy-makers are described in terms of science-push approach (technocratic model), policy-pull (decisionistic) and simultaneous push-pull approach (pragmatic). The position of science advice is described in historical perspective from the 50s, especially in the last two decades. Description relies to USA, Canada and UK. Principles of scientific advice to government (Government Office for Science, UK) are quoted. Some important documents related to science advice in EU and UN are mentioned. EuSANH network is described as well as EuSANH-ISA project, with its objectives and outcomes. According to findings of this project, the process of science advice for health should follow some steps: framing the issue to be covered; planning entire process leading to the conclusion; drafting the report; reviewing the report and revision; publishing report and assessing the impact on policy.
Carneiro, Paula F; do Nascimento, Samara B; Pinto, Antonio V; Pinto, Maria do Carmo F R; Lechuga, Guilherme C; Santos, Dilvani O; dos Santos Júnior, Helvécio M; Resende, Jackson A L C; Bourguignon, Saulo C; Ferreira, Vitor F
2012-08-15
New oxirane derivatives were synthesized using six naphthoquinones as the starting materials. Our biological results showed that these oxiranes acted as trypanocidal agents against Trypanosoma cruzi with minimal cytotoxicity in the VERO cell line compared to naphthoquinones. In particular, oxirane derivative 14 showed low cytotoxicity in a mammalian cell line and exhibited better activity against epimastigote forms of T.cruzi than the current drug used to treat Chagas disease, benznidazole. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Robert D. Wojtyczka
2015-01-01
Full Text Available Microorganisms present in different environments have developed specific mechanisms of settling on various abiotic and biotic surfaces by forming a biofilm. It seems to be well justified to search for new compounds enabling biofilm reduction, which is highly resistant to antibiotics. This study was thus an initial assessment of the antibacterial activity of two new quinoline derivatives of a structure of 3-thioacyl 1-methyl 4-arylaminoquinolinium salts against coagulase-negative staphylococci (CoNS isolated from a hospital environment, in a form of both biofilms and in planktonic form. Thirty-three stains of CoNS isolated from the hospital environment (air, surfaces and seven reference strains from the ATCC collection were selected for the study. The mean MIC value for 1-methyl-3-benzoylthio-4-(4-chlorophenylaminoquinolinum chloride (4-chlorophenylamino derivative was 42.60 ± 19.91 μg/mL, and in the case of strains subjected to 1-methyl-3-benzoylthio-4-(4-fluorophenylaminoquinolinum chloride (4-fluorophenylamino derivative activity, the mean MIC value was 43.20 ± 14.30 μg/mL. The mean concentration of 4-chlorophenylamino derivative that inhibited biofilm formation was 86.18 ± 30.64 μg/mL. The mean concentration of 4-fluorophenylamino derivatives that inhibited biofilm formation was higher and amounted to 237.09 ± 160.57 μg/mL. Based on the results, both derivatives of the examined compounds exhibit high antimicrobial activity towards strains growing both in planktonic and biofilm form.
The objective of this presentation is to introduce the ISAE and to highlight members’ roles in the development and implementation of OIE’s animal welfare standards. Animal welfare science is a young discipline. Originally, welfare science was heavily focused on animal behavior (ethology), but it is ...
International Nuclear Information System (INIS)
Perez Machin, Maikel; Torre Santos, Ana V de la; Perez Ramirez, Kirenia; Marinello, Patricia; Suarez Martinez, Giselle
2009-01-01
Among the best-studied antigenic systems, which have their expression increased in the membrane of tumor cells, are the gangliosides. Several clinical trials with therapeutic vaccines containing N-glycolylated gangliosides have been made in Cuba by the Center Molecular Immunology. One of these studies, it is the trial: 'Specific active immunotherapy with the vaccine preparation NGcGM3 / VSSP / Montanide ISA 51 in the treatment of patients with breast cancer metastatic. Phase II'. In order to assess the major events events related to this product, were reviewed the medical records of total patients in the clinical trial performed in the service Oncology Hospital Universitario 'Celestino Hernandez Robau' Villa Clara. (Author)
Energy Technology Data Exchange (ETDEWEB)
Gomez-Magan, J. J.; Fernandez, I.; Gil, J.; Marrao, H.; Queral, C.; Gonzalez-Cadelo, J.; Montero-Mayorga, J.; Rivas, J.; Ibane-Llano, C.; Izquierdo, J. M.; Sanchez-Perea, M.; Melendez, E.; Hortal, J.
2013-09-01
The Integrated Safety Analysis (ISA) methodology, developed by the Spanish Nuclear Safety council (CSN), has been applied to obtain the dynamic Event Trees (DETs) for full spectrum Loss of Coolant Accidents (LOCAs) of a Westinghouse 3-loop PWR plant. The purpose of this ISA application is to obtain the Damage Exceedance Frequency (DEF) for the LOCA Event Tree by taking into account the uncertainties in the break area and the operator actuation time needed to cool down and de pressurize reactor coolant system by means of steam generator. Simulations are performed with SCAIS, a software tool which includes a dynamic coupling with MAAP thermal hydraulic code. The results show the capability of the ISA methodology to obtain the DEF taking into account the time uncertainty in human actions. (Author)
The Uptake of Eu(III) and Th(IV) by Calcite under Hyperalkaline Conditions
International Nuclear Information System (INIS)
Tits, J.; Wieland, E.; Bradbury, M.H.; Eckert, P.; Schaible, A.
2002-10-01
Calcite is an important component of Valanginian marl, a potential host rock for a low and intermediate level radioactive waste (L/ILW) repository in Switzerland. This mineral also forms an important component of the disturbed zone around a repository, as it remains largely unaffected by the hyperalkaline waters migrating out of the cementitious repository . The sorption behaviour of Eu(III) and Th(IV) on Merck calcite in an artificial cement pore water (ACW) at pH 13.3 has been studied in batch-type sorption experiments. In addition, the effect of α-isosaccharinic acid (ISA) and gluconic acid (GLU) on the sorption of these two cations has been investigated. In the absence of ISA and GLU, a strong interaction of Eu(III) and Th(IV) with Merck calcite was observed. Eu(III) and Th(IV) sorption kinetics were fast and the isotherms indicated a linear adsorption behaviour over the experimentally accessible concentration range. In the case of Eu(III), a decrease of the R d value with increasing solid to liquid (S:L) ratio was observed indicating that, along with adsorption, other processes might influence the immobilisation of this cation by Merck calcite under ACW conditions. In the case of Th(IV), however, changes in the S:L ratio had no effect on the sorption behaviour . High ISA and GLU concentrations in solution significantly affected the sorption of both Eu(III) and Th(IV): R d values for Eu(III) decreased significantly at ISA concentrations higher than 10 -5 M and at GLU concentrations higher than 10 -7 M. The sorption of Th(IV) was reduced at ISA concentrations above 2.10 -5 M and at GLU concentrations above 10 -6 M. The effects of ISA and GLU on the immobilisation of Eu(III) and Th(IV) were interpreted in terms of complex formation in solution. In the case of Eu(III) the metal ligand complexes were found to have a 1 : 1 stoichiometry. Complexation constants derived for the aqueous Eu(III)-ISA. and Eu(III)GLU complexes were determined to be logβ 0 EulSA = -31.1
Montoya López, Jorge Eduardo
2005-01-01
113 p. En el proyecto de investigación se realizó inicialmente una exploración de las bases teóricas y empíricas del uso de la información en la toma de decisiones estratégicas, luego se indagó sobre el uso de la información en las decisiones estratégicas efectuadas recientemente en las empresas colombianas del grupo empresarial ISA, enfocándose en determinar la información utilizada desde un medio electrónico y concluyendo acerca de las reales posibilidades del apoyo de los sistemas de in...
Rout, Simon P; Radford, Jessica; Laws, Andrew P; Sweeney, Francis; Elmekawy, Ahmed; Gillie, Lisa J; Humphreys, Paul N
2014-01-01
The anoxic, alkaline hydrolysis of cellulosic materials generates a range of cellulose degradation products (CDP) including α and β forms of isosaccharinic acid (ISA) and is expected to occur in radioactive waste disposal sites receiving intermediate level radioactive wastes. The generation of ISA's is of particular relevance to the disposal of these wastes since they are able to form complexes with radioelements such as Pu enhancing their migration. This study demonstrates that microbial communities present in near-surface anoxic sediments are able to degrade CDP including both forms of ISA via iron reduction, sulphate reduction and methanogenesis, without any prior exposure to these substrates. No significant difference (n = 6, p = 0.118) in α and β ISA degradation rates were seen under either iron reducing, sulphate reducing or methanogenic conditions, giving an overall mean degradation rate of 4.7 × 10(-2) hr(-1) (SE ± 2.9 × 10(-3)). These results suggest that a radioactive waste disposal site is likely to be colonised by organisms able to degrade CDP and associated ISA's during the construction and operational phase of the facility.
Directory of Open Access Journals (Sweden)
Christophe M Raynaud
Full Text Available Mesenchymal progenitors or stromal cells have shown promise as a therapeutic strategy for a range of diseases including heart failure. In this context, we explored the growth and differentiation potential of mesenchymal progenitors (MPs derived in vitro from human embryonic stem cells (hESCs. Similar to MPs isolated from bone marrow, hESC derived MPs (hESC-MPs efficiently differentiated into archetypical mesenchymal derivatives such as chondrocytes and adipocytes. Upon treatment with 5-Azacytidine or TGF-β1, hESC-MPs modified their morphology and up-regulated expression of key cardiac transcription factors such as NKX2-5, MEF2C, HAND2 and MYOCD. Nevertheless, NKX2-5+ hESC-MP derivatives did not form contractile cardiomyocytes, raising questions concerning the suitability of these cells as a platform for cardiomyocyte replacement therapy. Gene profiling experiments revealed that, although hESC-MP derived cells expressed a suite of cardiac related genes, they lacked the complete repertoire of genes associated with bona fide cardiomyocytes. Our results suggest that whilst agents such as TGF-β1 and 5-Azacytidine can induce expression of cardiac related genes, but treated cells retain a mesenchymal like phenotype.
Digital Workflow for the Conservation of Bahrain Built Heritage: the Sheik Isa Bin ALI House
Barazzetti, L.; Mezzino, D.; Santana Quintero, M.
2017-08-01
Currently, the commercial market offers several tools for digital documentation of historic sites and buildings. Photogrammetry and laser scanning play a fundamental role in the acquisition of metric information, which is then processed to generate reliable records particularly useful also in the built heritage conservation field. Although potentially very fast and accurate, such techniques require expert operators to produce reliable results, especially in the case of complex and large sites. The aim of this paper is to present the digital workflow developed for data acquisition and processing of the Shaikh Isa Bin Ali house in Muharraq, Bahrain. This historic structure is an outstanding example of Bahrain architecture as well as tangible memory of the country history, with strong connotations in the Bahrain cultural identity. The building has been documented employing several digital techniques, including: aerial (drone) and terrestrial photogrammetry, rectifying photography, total station and laser scanning. The documentation project has been developed for the Bahrain Authority for Culture and Antiquities (BACA) by a multidisciplinary team of experts from Carleton Immersive Media Studio (CIMS, Carleton University, Canada) and Gicarus Lab (Politecnico di Milano, Italy).
Increased sexual arousal in patients with movement disorders.
Teive, Hélio A G; Moro, Adriana; Moscovich, Mariana; Munhoz, Renato P
2016-04-01
Increased of sexual arousal (ISA) has been described in different neurological diseases. The purpose of this study was present a case series of ISA in patients with movement disorders. Fifteen patients with different forms of movement disorders (Parkinson's disease, Huntington's disease, Tourette's syndrome, spinocerebellar ataxia type 3), were evaluated in the Movement Disorders Unit of the Federal University of Paraná. Among Parkinson's disease patients there were seven cases with different forms of ISA due to dopaminergic agonist use, levodopa abuse, and deep brain stimulation (DBS). In the group with hyperkinetic disorders, two patients with Huntington's disease, two with Tourette's syndrome, and four with spinocerebellar ataxia type 3 presented with ISA. ISA in this group of patients had different etiologies, predominantly related to dopaminergic treatment or DBS in Parkinson's disease, part of the background clinical picture in Huntington's disease and Tourette's syndrome, and probably associated with cultural aspects in patients with spinocerebellar ataxia type 3.
Directory of Open Access Journals (Sweden)
Simon P Rout
Full Text Available The anoxic, alkaline hydrolysis of cellulosic materials generates a range of cellulose degradation products (CDP including α and β forms of isosaccharinic acid (ISA and is expected to occur in radioactive waste disposal sites receiving intermediate level radioactive wastes. The generation of ISA's is of particular relevance to the disposal of these wastes since they are able to form complexes with radioelements such as Pu enhancing their migration. This study demonstrates that microbial communities present in near-surface anoxic sediments are able to degrade CDP including both forms of ISA via iron reduction, sulphate reduction and methanogenesis, without any prior exposure to these substrates. No significant difference (n = 6, p = 0.118 in α and β ISA degradation rates were seen under either iron reducing, sulphate reducing or methanogenic conditions, giving an overall mean degradation rate of 4.7 × 10(-2 hr(-1 (SE ± 2.9 × 10(-3. These results suggest that a radioactive waste disposal site is likely to be colonised by organisms able to degrade CDP and associated ISA's during the construction and operational phase of the facility.
The Uptake of Eu(III) and Th(IV) by Calcite under Hyperalkaline Conditions
Energy Technology Data Exchange (ETDEWEB)
Tits, J.; Wieland, E.; Bradbury, M.H.; Eckert, P.; Schaible, A
2002-10-01
Calcite is an important component of Valanginian marl, a potential host rock for a low and intermediate level radioactive waste (L/ILW) repository in Switzerland. This mineral also forms an important component of the disturbed zone around a repository, as it remains largely unaffected by the hyperalkaline waters migrating out of the cementitious repository . The sorption behaviour of Eu(III) and Th(IV) on Merck calcite in an artificial cement pore water (ACW) at pH 13.3 has been studied in batch-type sorption experiments. In addition, the effect of {alpha}-isosaccharinic acid (ISA) and gluconic acid (GLU) on the sorption of these two cations has been investigated. In the absence of ISA and GLU, a strong interaction of Eu(III) and Th(IV) with Merck calcite was observed. Eu(III) and Th(IV) sorption kinetics were fast and the isotherms indicated a linear adsorption behaviour over the experimentally accessible concentration range. In the case of Eu(III), a decrease of the R{sub d} value with increasing solid to liquid (S:L) ratio was observed indicating that, along with adsorption, other processes might influence the immobilisation of this cation by Merck calcite under ACW conditions. In the case of Th(IV), however, changes in the S:L ratio had no effect on the sorption behaviour . High ISA and GLU concentrations in solution significantly affected the sorption of both Eu(III) and Th(IV): R{sub d} values for Eu(III) decreased significantly at ISA concentrations higher than 10{sup -5} M and at GLU concentrations higher than 10{sup -7} M. The sorption of Th(IV) was reduced at ISA concentrations above 2.10{sup -5} M and at GLU concentrations above 10{sup -6} M. The effects of ISA and GLU on the immobilisation of Eu(III) and Th(IV) were interpreted in terms of complex formation in solution. In the case of Eu(III) the metal ligand complexes were found to have a 1 : 1 stoichiometry. Complexation constants derived for the aqueous Eu(III)-ISA. and Eu(III)GLU complexes were
International Nuclear Information System (INIS)
Babaev, B.N.
2004-01-01
Full text: The derivatives of acids of phosphorus, due to variety of properties, are a subject of numerous researches. Now it is known, that the derivatives of acids of phosphorus apart from insect, neurotoxic, antienzym and other kinds of physiological activity have also complex forming properties. As extra gents of noble metals particularly are analyzed by the derivatives of dithio phosphor of acids although organ phosphorus compounds with one nuclear of sulfur make extraction properties. Therefore, with the purpose of detection of effective extra gents of ions of argentum the phosphorylated derivatives of heterogeneous ring compounds were synthesized: Ph(RO)P(O)Cl + HOCH(CH 3 )CH 2 -R ' -> Ph(RO)P(O)OCH(CH 3 )CH 2 -R ' + HCl. R C 2 H 5 - C 6 H 13 , R ' = a piperidine, morpholine, anabasine Structure of the obtained connections is confirmed by the results IR -, Pm- and mass- spectrometry. In an IR-spectrum O-hexyl-O - [piperidynoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1260, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In an IR-spectrum O-pentyl-[anabasinoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR about O-pentyl-[morpholyniisopropyl] phenylphosphonate in the field of a weak field (7, 18-7, 29 p.m.) the multiplet about tones of phenyl group is watched. Me tin proton resonate at 4,66 m.d.as multiplet The signals O-CH 2 of protons of morpholinic cycle appear at 3,58 m.d.. 4H) by the way of triplet. The protons N-CH 2 (6H) three methylene groups will derivate a composite multiple at 2, 10-2, 70 m.d.. The signal of metil group's protons (3H) is watched at 1,15m.d.as doublet. Final metal group resonates at 0, 87 p.m. Six of C-CH 2 of groups give a complex signal in the field of 1, 2-1, 8 m.d. The obtained connections
Isolation and characterization of human umbilical cord-derived endothelial colony-forming cells
Zhang, Hao; Tao, Yanling; Ren, Saisai; Liu, Haihui; Zhou, Hui; Hu, Jiangwei; Tang, Yongyong; Zhang, Bin; Chen, Hu
2017-01-01
Endothelial colony-forming cells (ECFCs) are a population of endothelial progenitor cells (EPCs) that display robust proliferative potential and vessel-forming capability. Previous studies have demonstrated that a limited number of ECFCs may be obtained from adult bone marrow, peripheral blood and umbilical cord (UC) blood. The present study describes an effective method for isolating ECFCs from human UC. The ECFCs derived from human UC displayed the full properties of EPCs. Analysis of the growth kinetics, cell cycle and colony-forming ability of the isolated human UC-ECFCs indicated that the cells demonstrated properties of stem cells, including relative stability and rapid proliferation in vitro. Gene expression of Fms related tyrosine kinase 1, kinase insert domain receptor, vascular endothelial cadherin, cluster of differentiation (CD)31, CD34, epidermal growth factor homology domains-2, von Willebrand factor and endothelial nitric oxide synthase was assessed by reverse transcription-polymerase chain reaction. The cells were positive for CD34, CD31, CD73, CD105 and vascular endothelial growth factor receptor-2, and negative for CD45, CD90 and human leukocyte antigen-antigen D related protein according to flow cytometry. 1,1′-dioctadecyl-3,3,3′,3′-tetra-methyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein and fluorescein isothiocyanate-Ulex europaeus-l were used to verify the identity of the UC-ECFCs. Matrigel was used to investigate tube formation capability. The results demonstrated that the reported technique is a valuable method for isolating human UC-ECFCs, which have potential for use in vascular regeneration. PMID:29067104
Theoretical derivation of a simplified form of the OTOR/GOT differential equation
International Nuclear Information System (INIS)
Lovedy Singh, L.; Gartia, R.K.
2013-01-01
A simplified form of the OTOR/GOT differential equation has been derived, which may be employed in the evaluation of TL curves for saturated (N = n o ) and non-saturated cases (N > n o ). The present eqn. is found to be theoretically correct and physically sound in comparison with empirical general order kinetics. It has been found that the TL curve evaluated using the present eqn. matches the TL curves evaluated using differential eqn. formalism, and spans the region from α = n o /(100N) to α = 0.999 (where α is the ratio of the retrapping probability to the recombination probability). The simulated curve resembles a first order kinetics curve when α = n o /(100N) and a second order kinetics curve when α = 0.999. However, comparison with general order kinetics for the intermediate range is not possible as a one- to-one correspondence between α and b cannot be made. Also, calculation in the saturated case is made simpler since only three unknown parameters (E, s and α) are required. -- Highlights: • Theoretically and physically sound general order equation has been derived. • Can be employed in the calculation of saturated and non-saturated cases. • It is found to match with those evaluated using differential equation formalism. • Calculation in the saturated case requires only three unknown parameter
Gao, Fangzheng; Wu, Yuqiang; Zhang, Zhongcai
2015-11-01
This paper investigates the problem of finite-time stabilization by output feedback for a class of nonholonomic systems in chained form with uncertainties. Comparing with the existing relevant literature, a distinguishing feature of the systems under investigation is that the x-subsystem is a feedforward-like rather than feedback-like system. This renders the existing control methods inapplicable to the control problems of the systems. A constructive design procedure for output feedback control is given. The designed controller renders that the states of closed-loop system are regulated to zero in a finite time. Two simulation examples are provided to illustrate the effectiveness of the proposed approach. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Adson Santa Cruz Oliveira
2007-12-01
Full Text Available
The invasive capacity and persistence of this pathogen, crop and ceca in apparently healthy birds of two broiler lines raised without growth promoter antibiotics in ration and originated from eggs inoculated eggshell and in allantoidal cavity with Salmonella Enteritidis. Histological and bacteriological exams from cecal and crop were performed with one, seven, 14 and 21 days of age after hatch in broilers of fast and slow growing rate. Bacterio-logical exams were performed fecal excretion with one, eigth, 22 and 35 days. The Salmonella Enteritidis invaded and colonizated the gastrointestinal tract of the two lines tested, but the the infection reduced with age, and was more persistant in Ross broilers. The results were different for two lines. The pathogen was excreted from just one chick of ISA Label at 22 days of age and four Ross chicks until 35 days of age. In order, Salmonella was detected in 87.5% (14/16 and 38,1% (5/16 of ceca; in 81.2% (13/16 and 12.5% (2/16 of crops; in fast and slow growing rate lines, respectively. In apparent healthy organs, excepted the crop, an inflammatory process with predominance of macrophage and lymphocytes. The slow growing rate line was effective to eliminate bacteria in the organism.
Key-words: Ceca, crop, fecal excretion, inflammation.
Avaliaram-se, neste estudo, a capacidade inva-siva, a persistência e a freqüência de excreção fecal da Salmonella Enteritidis em aves aparentemente saudáveis de duas linhagens de frango de corte, criadas sem antibióticos promotores de crescimento na ração e oriundas de ovos inoculados na casca ou na cavidade alantóide com Salmonella Enteritidis fagotipo 4. Realizaram-se exames bacteriológicos das excretas com um, oito, 22 e 35 dias, e histológicos e bacteriológicos do inglúvio e ceco, com um, sete, quatorze e 21 dias pós-eclosão em frangos de crescimento rápido e lento. Salmonella
Increased sexual arousal in patients with movement disorders
Directory of Open Access Journals (Sweden)
Hélio A. G. Teive
2016-04-01
Full Text Available ABSTRACT Increased of sexual arousal (ISA has been described in different neurological diseases. The purpose of this study was present a case series of ISA in patients with movement disorders. Method Fifteen patients with different forms of movement disorders (Parkinson’s disease, Huntington’s disease, Tourette´s syndrome, spinocerebellar ataxia type 3, were evaluated in the Movement Disorders Unit of the Federal University of Paraná. Results Among Parkinson’s disease patients there were seven cases with different forms of ISA due to dopaminergic agonist use, levodopa abuse, and deep brain stimulation (DBS. In the group with hyperkinetic disorders, two patients with Huntington’s disease, two with Tourette’s syndrome, and four with spinocerebellar ataxia type 3 presented with ISA. Conclusions ISA in this group of patients had different etiologies, predominantly related to dopaminergic treatment or DBS in Parkinson’s disease, part of the background clinical picture in Huntington’s disease and Tourette’s syndrome, and probably associated with cultural aspects in patients with spinocerebellar ataxia type 3.
2017-07-01
Clinical Metastases PRINCIPAL INVESTIGATOR: Rosandra Kaplan CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017...2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases 5a...PRODUCTS: publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will present this work at the Annual
Energy Technology Data Exchange (ETDEWEB)
Sears, Jeremiah Matthew; Boyle, Timothy J.; Dean, Christopher J.
2013-06-01
This report addresses recent developments concerning the identification and handling of potential peroxide forming (PPF) and peroxide yielded derivative (PYD) chemicals. PPF chemicals are described in terms of labeling, shelf lives, and safe handling requirements as required at SNL. The general peroxide chemistry concerning formation, prevention, and identification is cursorily presented to give some perspective to the generation of peroxides. The procedure for determining peroxide concentrations and the proper disposal methods established by the Hazardous Waste Handling Facility are also provided. Techniques such as neutralization and dilution are provided for the safe handling of any PYD chemicals to allow for safe handling. The appendices are a collection of all available SNL documentation pertaining to PPF/PYD chemicals to serve as a single reference.
International Nuclear Information System (INIS)
Usov, A.I.; Dobkina, I.M.
1986-01-01
It has been shown that pyridylamino derivatives are convenient for the identification of various products of the galactans of red algae. Reductive amination with 2-aminopyridine and sodium thiohydroborate has been investigated for the case of several monosaccharides that are common components of the polysaccharide fractions of red seaweeds and also for carrabiose, agarobiose, and oligosaccharides of the neoagarobiose series. Various forms of chromatography and high-voltage paper electrophoresis were used to separate the pyridylamino derivatives, and NMR spectroscopy and mass spectroscopy of the full acetates for structural characterization
2017-07-01
Clinical Metastases PRINCIPAL INVESTIGATOR: Jeffrey Green CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017 TYPE...2016 - 14 June 2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical ...and/or select agents. Nothing to report. 6. PRODUCTS: • publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will
Cranial vasculature in zebrafish forms by angioblast cluster-derived angiogenesis.
Proulx, Kira; Lu, Annie; Sumanas, Saulius
2010-12-01
Formation of embryonic vasculature involves vasculogenesis as endothelial cells differentiate and aggregate into vascular cords and angiogenesis which includes branching from the existing vessels. In the zebrafish which has emerged as an advantageous model to study vasculogenesis, cranial vasculature is thought to originate by a combination of vasculogenesis and angiogenesis, but how these processes are coordinated is not well understood. To determine how angioblasts assemble into cranial vasculature, we generated an etsrp:GFP transgenic line in which GFP reporter is expressed under the promoter control of an early regulator of vascular and myeloid development, etsrp/etv2. By utilizing time-lapse imaging we show that cranial vessels originate by angiogenesis from angioblast clusters, which themselves form by the mechanism of vasculogenesis. The two major pairs of bilateral clusters include the rostral organizing center (ROC) which gives rise to the most rostral cranial vessels and the midbrain organizing center (MOC) which gives rise to the posterior cranial vessels and to the myeloid and endocardial lineages. In Etsrp knockdown embryos initial cranial vasculogenesis proceeds normally but endothelial and myeloid progenitors fail to initiate differentiation, migration and angiogenesis. Such angioblast cluster-derived angiogenesis is likely to be involved during vasculature formation in other vertebrate systems as well. Copyright © 2010 Elsevier Inc. All rights reserved.
Commercial Application of In-Space Assembly
Lymer, John; Hanson, Mark; Tadros, Al; Boccio, Joel; Hollenstein, Bruno; Emerick, Ken; Doughtery, Sean; Doggett, Bill; Dorsey, John T.; King, Bruce D.;
2016-01-01
In-Space assembly (ISA) expands the opportunities for cost effective emplacement of systems in space. Currently, spacecraft are launched into space and deploy into their operational configuration through a carefully choreographed sequence of operations. The deployment operation dictates the arrangement of the primary systems on the spacecraft, limiting the ability to take full advantage of launch vehicles volume and mass capability. ISA enables vastly different spacecraft architectures and emplacement scenarios to be achieved, including optimal launch configurations ranging from single launch and assembly to on-orbit aggregation of multiple launches at different orbital locations and times. The spacecraft can be visited at different orbital locations and times to effect expansion and maintenance of an operational capability. To date, the primary application of ISA has been in large programs funded by government organizations, such as the International Space Station. Recently, Space Systems Loral (SSL) led a study funded by the Defense Advanced Research Projects Agency (DARPA), called Dragonfly, to investigate the commercial applicability and economic advantages of ISA. In the study, it was shown that ISA enables SSL to double the capability of a commercial satellite system by taking advantage of alternate packaging approaches for the reflectors. The study included an ultra-light-weight robotic system, derived from Mars manipulator designs, to complete assembly of portions of the antenna system using a tool derived from DARPA orbital express and National Aeronautics and Space Administration (NASA) automated structural assembly experience. The mechanical connector that enables robotic ISA takes advantage of decades of development by NASA from the 1970's to 1980's during the Space Station Freedom program, the precursor to the ISS. The mechanical connector was originally designed for rapid astronaut assembly while also providing a high quality structural connection
Capturing Weather-related Shocks In Smallholder Agriculture
Murray, S.
2015-12-01
Rainfed agriculture accounts for 93% of total cultivated area in SSA (FAO, 2002) and smallholder is the predominant form of farm organization (33 million with less than 2 ha, representing 80% of all farms). At the same time, 75% of extreme poor live in rural areas and 90% rely on agriculture. A poor harvest can have significant impact on livelihood and welfare of a household with limited coping mechanisms and little savings.This study aims to shed light on how small farmers are affected by growing conditions in a given season and how well these impacts can be predicted using objective measures derived from time-series of remote-sensing data. We investigate the covariate vs idiosyncratic nature of shocks experienced at the household level, using both community-level and household-level observations. We also test the relative efficiency of different metrics in predicting shocks, acknowledging that both spatial resolution and temporal frequency are likely to be limiting factors in the objective measures. To support this analysis we draw on surveys from the Living Standards Measurement Study Integrated Surveys on Agriculture (LSMS-ISA) project. The LSMS-ISA surveys are georeferenced, multi-topic panel surveys with a strong focus on agriculture, conducted in 7 African countries. We combine the LSMS-ISA data on production and agricultural shocks with objective measures (rainfall deficit/surplus, phenological variables, water requirements satisfaction index) derived from various data sources (CHIRPS, MODIS Land Cover Dynamics, NDVI3g). Objective measures will be considered in both absolute terms as well as deviation from mean in the survey season.
Directory of Open Access Journals (Sweden)
Marisela Carmona
Full Text Available Infectious Salmon Anemia is a devastating disease critically affecting world-wide salmon production. Chile has been particularly stricken by this disease which in all cases has been directly related with its causative agent, a novel orthomyxovirus which presents specific and distinctive infective features. Among these, two molecular markers have been directly associated with pathogenicity in two of the eight RNA sub genomic coding units of the virus: an insertion hot spot region present in viral segment 5 and a Highly Polymorphic Region (HPR located in viral segment 6. Here we report the successful adaptation of a PCR-dependent denaturing gel electrophoresis technique (DGGE, which enables differentiation of selected reported HPR epizootic variants detected in Chile. At the same time, the technique allows us to distinguish one nucleotide differences in sequences associated with the intriguing, and still not well-understood, insertion events which tend to occur on RNA Segment 5. Thus, the versatility of the technique opens new opportunities for improved understanding of the complex biology of all ISA variants as well as possible applications to other highly variable pathogens.
Noncommutative differential forms on the kappa-deformed space
International Nuclear Information System (INIS)
Meljanac, Stjepan; Kresic-Juric, Sasa
2009-01-01
We construct a differential algebra of forms on the kappa-deformed space. For a given realization of noncommutative coordinates as formal power series in the Weyl algebra we find an infinite family of one-forms and nilpotent exterior derivatives. We derive explicit expressions for the exterior derivative and one-forms in covariant and noncovariant realizations. We also introduce higher order forms and show that the exterior derivative satisfies the graded Leibniz rule. The differential forms are generally not graded commutative, but they satisfy the graded Jacobi identity. We also consider the star-product of classical differential forms. The star-product is well defined if the commutator between the noncommutative coordinates and one-forms is closed in the space of one-forms alone. In addition, we show that in certain realizations the exterior derivative acting on the star-product satisfies the undeformed Leibniz rule.
Directory of Open Access Journals (Sweden)
Renrong Chen
2012-02-01
Full Text Available Impervious surface area (ISA is considered as an indicator of environment change and is regarded as an important input parameter for hydrological cycle simulation, water management and area pollution assessment. The Pearl River Delta (PRD, the 3rd most important economic district of China, is chosen in this paper to extract the ISA information based on Landsat images of 1998, 2003 and 2008 by using a linear spectral un-mixing method and to monitor impervious surface change by analyzing the multi-temporal Landsat-derived fractional impervious surface. Results of this study were as follows: (1 the area of ISA in the PRD increased 79.09% from 1998 to 2003 and 26.88% from 2003 to 2008 separately; (2 the spatial distribution of ISA was described according to the 1998/2003 percentage respectively. Most of middle and high percentage ISA was located in northwestern and southeastern of the whole delta, and middle percentage ISA was mainly located in the city interior, high percentage ISA was mainly located in the suburban around the city accordingly; (3 the expanding direction and trend of high percentage ISA was discussed in order to understand the change of urban in this delta; High percentage ISA moved from inner city to edge of urban area during 1998–2003 and moved to the suburban area that far from the urban area mixed with jumpily and gradually during 2003–2008. According to the discussion of high percentage ISA spatial expanded direction, it could be found out that high percentage ISA moved outward from the centre line of Pearl River of the whole delta while a high ISA percentage in both shores of the Pearl River Estuary moved toward the Pearl River; (4 combining the change of ISA with social conditions, the driving relationship was analyzed in detail. It was evident that ISA percentage change had a deep relationship with the economic development of this region in the past ten years. Contemporaneous major sport events (16th Asia Games of
Directory of Open Access Journals (Sweden)
Marc Enßle
2012-03-01
Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.
Intelligent Speed Adaptation for involuntary drivers
DEFF Research Database (Denmark)
Agerholm, Niels; Tradisauskas, Nerius; Juhl, Jens
2012-01-01
and warning, the ISA had an incentive in the form of rewards for speeding avoidance and social control - the latter, however, did not work sufficiently. When a key ID was used, the proportion of speeding was low while driving with ISA. Without key ID there was virtually no change in driving behaviour...
Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.
2014-12-01
The growth behavior of anodic oxide films formed via anodizing in glutaric and its derivative acid solutions was investigated based on the acid dissociation constants of electrolytes. High-purity aluminum foils were anodized in glutaric, ketoglutaric, and acetonedicarboxylic acid solutions under various electrochemical conditions. A thin barrier anodic oxide film grew uniformly on the aluminum substrate by glutaric acid anodizing, and further anodizing caused the film to breakdown due to a high electric field. In contrast, an anodic porous alumina film with a submicrometer-scale cell diameter was successfully formed by ketoglutaric acid anodizing at 293 K. However, the increase and decrease in the temperature of the ketoglutaric acid resulted in non-uniform oxide growth and localized pitting corrosion of the aluminum substrate. An anodic porous alumina film could also be fabricated by acetonedicarboxylic acid anodizing due to the relatively low dissociation constants associated with the acid. Acid dissociation constants are an important factor for the fabrication of anodic porous alumina films.
DEFF Research Database (Denmark)
Wigan, Duncan
2013-01-01
Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....
A generalized form of the Bernoulli Trial collision scheme in DSMC: Derivation and evaluation
Roohi, Ehsan; Stefanov, Stefan; Shoja-Sani, Ahmad; Ejraei, Hossein
2018-02-01
The impetus of this research is to present a generalized Bernoulli Trial collision scheme in the context of the direct simulation Monte Carlo (DSMC) method. Previously, a subsequent of several collision schemes have been put forward, which were mathematically based on the Kac stochastic model. These include Bernoulli Trial (BT), Ballot Box (BB), Simplified Bernoulli Trial (SBT) and Intelligent Simplified Bernoulli Trial (ISBT) schemes. The number of considered pairs for a possible collision in the above-mentioned schemes varies between N (l) (N (l) - 1) / 2 in BT, 1 in BB, and (N (l) - 1) in SBT or ISBT, where N (l) is the instantaneous number of particles in the lth cell. Here, we derive a generalized form of the Bernoulli Trial collision scheme (GBT) where the number of selected pairs is any desired value smaller than (N (l) - 1), i.e., Nsel < (N (l) - 1), keeping the same the collision frequency and accuracy of the solution as the original SBT and BT models. We derive two distinct formulas for the GBT scheme, where both formula recover BB and SBT limits if Nsel is set as 1 and N (l) - 1, respectively, and provide accurate solutions for a wide set of test cases. The present generalization further improves the computational efficiency of the BT-based collision models compared to the standard no time counter (NTC) and nearest neighbor (NN) collision models.
Nyberg, E; Stieglitz, R-D; Flury, M; Riecher-Rössler, A
2013-06-01
BACKGROUND AND HYPOTHESES: Domestic violence is common and can lead to severe physical and psychological problems. Thus, we have investigated the frequency of occurrence, forms and risk factors of domestic violence against female patients on a crisis intervention ward. 115 women were screened with the "screening spouse violence" (SPG) and the "index of spouse abuse" (ISA). The life time prevalence concerning spouse violence was 70 %. Out of 74 women who were currently living in a relationship 28 (38 % )were victims of violence in the last 12 months prior to their admission. Women who experienced violence had a significantly lower level of education. Screening for domestic violence in female patients in the field of crisis intervention and psychiatry should become a standard of "good clinical practice". © Georg Thieme Verlag KG Stuttgart · New York.
Wada, Hisashi; Isobe, Midori; Kakimi, Kazuhiro; Mizote, Yu; Eikawa, Shingo; Sato, Eiichi; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Yamasaki, Makoto; Miyata, Hiroshi; Matsushita, Hirokazu; Udono, Heiichiro; Seto, Yasuyuki; Yamada, Kazuhiro; Nishikawa, Hiroyoshi; Pan, Linda; Venhaus, Ralph; Oka, Mikio; Doki, Yuichiro; Nakayama, Eiichi
2014-01-01
We conducted a clinical trial of an NY-ESO-1 cancer vaccine using 4 synthetic overlapping long peptides (OLP; peptides #1, 79-108; #2, 100-129; #3, 121-150; and #4, 142-173) that include a highly immunogenic region of the NY-ESO-1 molecule. Nine patients were immunized with 0.25 mg each of three 30-mer and a 32-mer long NY-ESO-1 OLP mixed with 0.2 KE Picibanil OK-432 and 1.25 mL Montanide ISA-51. The primary endpoints of this study were safety and NY-ESO-1 immune responses. Five to 18 injections of the NY-ESO-1 OLP vaccine were well tolerated. Vaccine-related adverse events observed were fever and injection site reaction (grade 1 and 2). Two patients showed stable disease after vaccination. An NY-ESO-1-specific humoral immune response was observed in all patients and an antibody against peptide #3 (121-150) was detected firstly and strongly after vaccination. NY-ESO-1 CD4 and CD8 T-cell responses were elicited in these patients and their epitopes were identified. Using a multifunctional cytokine assay, the number of single or double cytokine-producing cells was increased in NY-ESO-1-specific CD4 and CD8 T cells after vaccination. Multiple cytokine-producing cells were observed in PD-1 (-) and PD-1 (+) CD4 T cells. In conclusion, our study indicated that the NY-ESO-1 OLP vaccine mixed with Picibanil OK-432 and Montanide ISA-51 was well tolerated and elicited NY-ESO-1-specific humoral and CD4 and CD8 T-cell responses in immunized patients.
Hu, Wuhua; Xiao, Gaoxi; Li, Xiumin
2011-04-01
In this paper, an analytical method is proposed for proportional-integral/proportional-derivative/proportional-integral-derivative (PI/PD/PID) controller tuning with specified gain and phase margins (GPMs) for integral plus time delay (IPTD) processes. Explicit formulas are also obtained for estimating the GPMs resulting from given PI/PD/PID controllers. The proposed method indicates a general form of the PID parameters and unifies a large number of existing rules as PI/PD/PID controller tuning with various GPM specifications. The GPMs realized by existing PID tuning rules are computed and documented as a reference for control engineers to tune the PID controllers. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.
Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M
2014-11-15
Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.
Directory of Open Access Journals (Sweden)
Jinhong Hu
Full Text Available BACKGROUND: The P. falciparum chimeric protein 2.9 (PfCP-2.9 consisting of the sequences of MSP1-19 and AMA-1 (III is a malaria vaccine candidate that was found to induce inhibitory antibodies in rabbits and monkeys. This was a phase I randomized, single-blind, placebo-controlled, dose-escalation study to evaluate the safety and immunogenicity of the PfCP-2.9 formulated with a novel adjuvant Montanide ISA720. Fifty-two subjects were randomly assigned to 4 dose groups of 10 participants, each receiving the test vaccine of 20, 50, 100, or 200 microg respectively, and 1 placebo group of 12 participants receiving the adjuvant only. METHODS AND FINDINGS: The vaccine formulation was shown to be safe and well-tolerated, and none of the participants withdrew. The total incidence of local adverse events (AEs was 75%, distributed among 58% of the placebo group and 80% of those vaccinated. Among the vaccinated, 65% had events that were mild and 15% experienced moderate AEs. Almost all systemic adverse reactions observed in this study were graded as mild and required no therapy. The participants receiving the test vaccine developed detectable antibody responses which were boosted by the repeated vaccinations. Sixty percent of the vaccinated participants had high ELISA titers (>1:10,000 of antigen-specific antibodies which could also recognize native parasite proteins in an immunofluorescence assay (IFA. CONCLUSION: This study is the first clinical trial for this candidate and builds on previous investigations supporting PfCP-2.9/ISA720 as a promising blood-stage malaria vaccine. Results demonstrate safety, tolerability (particularly at the lower doses tested and immunogenicity of the formulation. Further clinical development is ongoing to explore optimizing the dose and schedule of the formulation to decrease reactogenicity without compromising immunogenicity. TRIAL REGISTRATION: Chinese State Food and Drug Administration (SFDA 2002SL0046; Controlled
Directory of Open Access Journals (Sweden)
Máximo Gallignani
2014-10-01
Full Text Available A Fourier transform infrared derivative spectroscopy (FTIR-DS method has been developed for determining furosemide (FUR in pharmaceutical solid dosage form. The method involves the extraction of FUR from tablets with N,N-dimethylformamide by sonication and direct measurement in liquid phase mode using a reduced path length cell. In general, the spectra were measured in transmission mode and the equipment was configured to collect a spectrum at 4 cm−1 resolution and a 13 s collection time (10 scans co-added. The spectra were collected between 1400 cm−1 and 450 cm−1. Derivative spectroscopy was used for data processing and quantitative measurement using the peak area of the second order spectrum of the major spectral band found at 1165 cm−1 (SO2 stretching of FUR with baseline correction. The method fulfilled most validation requirements in the 2 mg/mL and 20 mg/mL range, with a 0.9998 coefficient of determination obtained by simple calibration model, and a general coefficient of variation <2%. The mean recovery for the proposed assay method resulted within the (100±3% over the 80%–120% range of the target concentration. The results agree with a pharmacopoeial method and, therefore, could be considered interchangeable.
Directory of Open Access Journals (Sweden)
K. Fritsch
2013-11-01
Full Text Available The International Symbol of Access (ISA produces, capacitates, and debilitates disability in particular ways and is grounded by a happy affective economy that is embedded within neoliberal capitalism. This production of disability runs counter to the dismantling of ableism and compulsory able-bodiedness. In charting the development of the modern wheelchair, the rise of disability rights in North America, and the emergence of the ISA as a universally acceptable representation of access for disabled people, I argue that this production of disability serves a capacitating function for particular forms of impairment. These capacitated forms are celebrated through a neoliberal economy of inclusion. I conclude by critically approaching the happy affects of the ISA, including the way in which the symbol creates a sense of cruel optimism for disabled people.
Two Forms of Philosophical Argument or Critique
Marshall, James D.
2004-01-01
In this paper the author looks at two forms of philosophical argument or critique. These are derived by himself from the work of the late Kantian scholar, Stephan Korner who, in his book "What is Philosophy?" (1969), draws a number of distinctions between different forms of "philosophical" argument or critique. The two forms of derived argument,…
Zeisberger, Steffen M.; Zoller, Stefan; Riegel, Mariluce; Chen, Shuhua; Krenning, Guido; Harmsen, Martin C.; Sachinidis, Agapios; Zisch, Andreas H.
Establishment of fetal bovine serum (FBS)-free cell culture conditions is essential for transplantation therapies. Blood-derived endothelial colony-forming cells (ECFCs) are potential candidates for regenerative medicine applications. ECFCs were isolated from term umbilical cord blood units and
Directory of Open Access Journals (Sweden)
Jefferson Costa de Siqueira
2009-09-01
Full Text Available O objetivo neste estudo foi avaliar diferentes modelos ajustados às respostas de ganho de peso obtidas em experimento com aves da linhagem ISA Label no período de 1 a 28 dias de idade. Foram utilizados 480 pintos de ambos os sexos, distribuídos em delineamento inteiramente casualizado, em arranjo fatorial 4 X 2 (níveis de lisina X sexo, com três repetições, com 20 aves por unidade experimental. Uma ração basal foi formulada para atender às exigências das aves, exceto em lisina. Essa ração foi suplementada com L-lisina HCl em substituição ao ácido L-glutâmico, resultando em rações experimentais isonitrogênicas e isoenergéticas contendo 0,85; 0,97; 1,09 e 1,21% de lisina digestível. As respostas de ganho de peso foram ajustadas de acordo com os níveis de lisina da ração pelos modelos Linear Reponse Plateau (LRP, segmentado de duas inclinações, polinomial quadrático e exponencial. A primeira intersecção da equação quadrática com o platô do LRP também foi utilizado para estimar o nível ótimo. Os níveis de lisina digestível estimados pelos modelos LRP, segmentado e quadrático, foram 0,999; 1,010 e 1,116%, respectivamente. Na combinação do modelo quadrático com o LRP, a estimativa da exigência de lisina digestível foi de 1,041%. O modelo exponencial proporcionou estimativa de 1,066%, considerando 95% da resposta assintótica. Com base nos custos com alimentação, esse mesmo modelo gerou estimativas de 1,000 e 1,030% quando o custo do quilograma de L-lisina HCl foi R$ 8,50 e R$ 6,50, respectivamente. Considerando as limitações de cada um dos modelos propostos, o procedimento para estimar as exigências de lisina digestível pela primeira intersecção da equação quadrática com o platô do LRP foi o mais adequado para melhorar o ganho de peso das aves quando variáveis econômicas não foram consideradas.The objective of this study was to evaluate different models in the adjustment of weight gain (WG
The derivation of the general form of kinematics with the universal reference system
Szostek, Karol; Szostek, Roman
2018-03-01
In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether - with any transverse contraction. The entire article contains only original research conducted by its authors.
Bello-Espinosa, Luis E
2015-08-01
Analysis of infraslow EEG activity (ISA) has shown potential in the evaluation of patients with epilepsy and in the differentiation between focal and generalized epilepsies. Infraslow EEG activity analysis may also provide insights into the pathophysiology of refractory clinical and subclinical status epilepticus. The purpose of this report is to describe a girl with Sturge-Weber syndrome (SWS) who presented with a 96-h refractory encephalopathy and nonischemic hemiparesis and who was identified to have infraslow status epilepticus (ISSE), which successfully resolved after midazolam administration. The continuous EEG recording of a 5-year-old girl with known structural epilepsy due to Sturge-Weber syndrome is presented. The patient presented to the ED with acute confusion, eye deviation, and right hemiparesis similar to two previous admissions. Despite administration of lorazepam, fosphenytoin, phenobarbital, and valproic loads, the patient showed no improvement in the clinical condition after 48 h. The continuous video-EEG monitoring (VEM) showed continuous severe diffuse nonrhythmic asymmetric slowing but no apparent ictal activity on continuous conventional EEG recording settings. As brain CT, CTA, CTV, and complete MRI scans including DWI obtained within 72 h of presentation failed to demonstrate any ischemic changes, analysis of the EEG infraslow (ISA) activity was undertaken using LFF: 0.01 Hz and HFF: of 0.1 Hz, respectively. Continuous subclinical unilateral rhythmic ictal ISA was identified. This was only evident on the left hemisphere which correlated with the structural changes due to SWS. A trial of continuous 120 to 240 μg/kg/h of IV midazolam resulted in immediate resolution of the contralateral hemiparesis and encephalopathy. Continuous prolonged rhythmic ictal infraslow activity (ISA) can cause super-refractory subclinical focal status epilepticus. This has not been previously reported, and we propose that this be called infraslow status
Directory of Open Access Journals (Sweden)
Douglas Scott
2014-11-01
Full Text Available Knowledge of impervious surface areas (ISA and on their changes in magnitude, location, geometry and morphology over time is significant for a range of practical applications and research alike from local to global scales. Despite this, use of Earth Observation (EO technology in mapping ISAs within some European Union (EU countries, such as the United Kingdom (UK, is to some extent scarce. In the present study, a combination of methods is proposed for mapping ISA based on freely distributed EO imagery from Landsat TM/ETM+ sensors. The proposed technique combines a traditional classifier and a linear spectral mixture analysis (LSMA with a series of Landsat TM/ETM+ images to extract ISA. Selected sites located in Wales, UK, are used for demonstrating the capability of the proposed method. The Welsh study areas provided a unique setting in detecting largely dispersed urban morphology within an urban-rural frontier context. In addition, an innovative method for detecting clouds and cloud shadow layers for the full area estimation of ISA is also presented herein. The removal and replacement of clouds and cloud shadows, with underlying materials is further explained. Aerial photography with a spatial resolution of 0.4 m, acquired over the summer period in 2005 was used for validation purposes. Validation of the derived products indicated an overall ISA detection accuracy in the order of ~97%. The latter was considered as very satisfactory and at least comparative, if not somehow better, to existing ISA products provided on a national level. The hybrid method for ISA extraction proposed here is important on a local scale in terms of moving forward into a biennial program for the Welsh Government. It offers a much less subjectively static and more objectively dynamic estimation of ISA cover in comparison to existing operational products already available, improving the current estimations of international urbanization and soil sealing. Findings of our
Diffusion from cylindrical waste forms
International Nuclear Information System (INIS)
Thomas, G.F.
1985-05-01
The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data
The derivation of the general form of kinematics with the universal reference system
Directory of Open Access Journals (Sweden)
Karol Szostek
2018-03-01
Full Text Available In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether – with any transverse contraction. The entire article contains only original research conducted by its authors. Keywords: Kinematics of bodies, Universal frame of reference, Transformation of time and position, One-way speed of light, Anisotropy of cosmic microwave background
Functional neuromuscular junctions formed by embryonic stem cell-derived motor neurons.
Directory of Open Access Journals (Sweden)
Joy A Umbach
Full Text Available A key objective of stem cell biology is to create physiologically relevant cells suitable for modeling disease pathologies in vitro. Much progress towards this goal has been made in the area of motor neuron (MN disease through the development of methods to direct spinal MN formation from both embryonic and induced pluripotent stem cells. Previous studies have characterized these neurons with respect to their molecular and intrinsic functional properties. However, the synaptic activity of stem cell-derived MNs remains less well defined. In this study, we report the development of low-density co-culture conditions that encourage the formation of active neuromuscular synapses between stem cell-derived MNs and muscle cells in vitro. Fluorescence microscopy reveals the expression of numerous synaptic proteins at these contacts, while dual patch clamp recording detects both spontaneous and multi-quantal evoked synaptic responses similar to those observed in vivo. Together, these findings demonstrate that stem cell-derived MNs innervate muscle cells in a functionally relevant manner. This dual recording approach further offers a sensitive and quantitative assay platform to probe disorders of synaptic dysfunction associated with MN disease.
Chemical reactivity of α-isosaccharinic acid in heterogeneous alkaline systems
International Nuclear Information System (INIS)
Glaus, M. A.; Loon, L. R. Van
2008-11-01
Cellulose degradation under alkaline conditions is of relevance for the mobility of many radionuclides in the near-field of a cementitious repository for radioactive waste, because metal-binding degradation products may be formed. Among these, α-isosaccharinic acid (α-ISA) is the strongest complexant. The prediction of the equilibrium concentration of α-ISA in cement pore water is therefore an important step in the assessment of the influence of cellulose degradation products on the speciation of radionuclides in such environments. The present report focuses on possible chemical transformation reactions of α-ISA in heterogeneous alkaline model systems containing either Ca(OH) 2 or crushed hardened cement paste. The transformation reactions were monitored by measuring the concentration of α-ISA by high performance anion exchange chromatography and the formation of reaction products by high performance ion exclusion chromatography. The overall loss of organic species from solution was monitored by measuring the concentration of non-purgeable organic carbon. The reactions were examined in diluted and compacted suspensions, either at 25 o C or 90 o C, and under anaerobic atmospheres obtained by various methods. It was found that α-ISA was transformed under all conditions tested to some extent. Reaction products, such as glycolate, formate, lactate and acetate, all compounds with less complexing strength than α-ISA, were detected. The amount of reaction products identified by the chromatographic technique applied was ∼50 % of the amount of α-ISA reacted. Sorption of α-ISA to Ca(OH) 2 contributed only to a minor extent to the loss of α-ISA from the solution phase. As the most important conclusion of the present work it was demonstrated that the presence of oxidising agents had a distinctive influence on the turnover of α-ISA. Under aerobic conditions α-ISA was quantitatively converted to reaction products, whereas under strict anaerobic conditions, only
Chemical reactivity of α-isosaccharinic acid in heterogeneous alkaline systems
International Nuclear Information System (INIS)
Glaus, M. A.; Loon, L. R. Van
2009-05-01
Cellulose degradation under alkaline conditions is of relevance for the mobility of many radionuclides in the near-field of a cementitious repository for radioactive waste, because metal-binding degradation products may be formed. Among these, α- isosaccharinic acid (α-ISA) is the strongest complexant. The prediction of the equilibrium concentration of α-ISA in cement pore water is therefore an important step in the assessment of the influence of cellulose degradation products on the speciation of radionuclides in such environments. The present report focuses on possible chemical transformation reactions of α-ISA in heterogeneous alkaline model systems containing either Ca(OH) 2 or crushed hardened cement paste. The transformation reactions were monitored by measuring the concentration of α-ISA by high performance anion exchange chromatography and the formation of reaction products by high performance ion exclusion chromatography. The overall loss of organic species from solution was monitored by measuring the concentration of non-purgeable organic carbon. The reactions were examined in diluted and compacted suspensions, at either 25 o C or 90 o C, and under anaerobic atmospheres obtained by various methods. It was found that α-ISA was transformed under all conditions tested to some extent. Reaction products, such as glycolate, formate, lactate and acetate, all compounds with less complexing strength than α-ISA, were detected. The amount of reaction products identified by the chromatographic technique applied was ∼ 50 % of the amount of α-ISA reacted. Sorption of α-ISA to Ca(OH) 2 contributed only to a minor extent to the loss of α-ISA from the solution phase. As the most important conclusion of the present work it was demonstrated that the presence of oxidising agents had a distinctive influence on the turnover of α-ISA. Under aerobic conditions α-ISA was quantitatively converted to reaction products, whereas under strict anaerobic conditions, only
Background: Emerging evidence suggests novel roles for bacterially-derived vitamin K forms known as menaquinones (MKn) in health and disease which may be attributable in part to anti-inflammatory effects. However, the relevance of MKn produced by gut bacteria to vitamin K requirements and inflammati...
de Fabritus, Lauriane; Nougairède, Antoine; Aubry, Fabien; Gould, Ernest A; de Lamballerie, Xavier
2016-01-01
Large-scale codon re-encoding is a new method of attenuating RNA viruses. However, the use of infectious clones to generate attenuated viruses has inherent technical problems. We previously developed a bacterium-free reverse genetics protocol, designated ISA, and now combined it with large-scale random codon-re-encoding method to produce attenuated tick-borne encephalitis virus (TBEV), a pathogenic flavivirus which causes febrile illness and encephalitis in humans. We produced wild-type (WT) and two re-encoded TBEVs, containing 273 or 273+284 synonymous mutations in the NS5 and NS5+NS3 coding regions respectively. Both re-encoded viruses were attenuated when compared with WT virus using a laboratory mouse model and the relative level of attenuation increased with the degree of re-encoding. Moreover, all infected animals produced neutralizing antibodies. This novel, rapid and efficient approach to engineering attenuated viruses could potentially expedite the development of safe and effective new-generation live attenuated vaccines.
Clearing and settlement of exchange traded derivatives
John McPartland
2009-01-01
Derivatives are a class of financial instruments that derive their value from some underlying commodity, security, index, or other asset. Futures and options are common forms of derivatives. This article explains how clearing and settlement systems for exchange traded derivatives work.
Current algebra constraints on K13 form factors
International Nuclear Information System (INIS)
Simmons, L.D.
1975-01-01
New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences
Differential forms orthogonal to holomorphic functions or forms, and their properties
Aizenberg, L A
1983-01-01
The authors consider the problem of characterizing the exterior differential forms which are orthogonal to holomorphic functions (or forms) in a domain D\\subset {\\mathbf C}^n with respect to integration over the boundary, and some related questions. They give a detailed account of the derivation of the Bochner-Martinelli-Koppelman integral representation of exterior differential forms, which was obtained in 1967 and has already found many important applications. They study the properties of \\overline \\partial-closed forms of type (p, n - 1), 0\\leq p\\leq n - 1, which turn out to be the duals (with respect to the orthogonality mentioned above) to holomorphic functions (or forms) in several complex variables, and resemble holomorphic functions of one complex variable in their properties.
Chemical reactivity of {alpha}-isosaccharinic acid in heterogeneous alkaline systems
Energy Technology Data Exchange (ETDEWEB)
Glaus, M. A.; Loon, L. R. Van
2009-05-15
Cellulose degradation under alkaline conditions is of relevance for the mobility of many radionuclides in the near-field of a cementitious repository for radioactive waste, because metal-binding degradation products may be formed. Among these, {alpha}- isosaccharinic acid ({alpha}-ISA) is the strongest complexant. The prediction of the equilibrium concentration of {alpha}-ISA in cement pore water is therefore an important step in the assessment of the influence of cellulose degradation products on the speciation of radionuclides in such environments. The present report focuses on possible chemical transformation reactions of {alpha}-ISA in heterogeneous alkaline model systems containing either Ca(OH){sub 2} or crushed hardened cement paste. The transformation reactions were monitored by measuring the concentration of {alpha}-ISA by high performance anion exchange chromatography and the formation of reaction products by high performance ion exclusion chromatography. The overall loss of organic species from solution was monitored by measuring the concentration of non-purgeable organic carbon. The reactions were examined in diluted and compacted suspensions, at either 25 {sup o}C or 90 {sup o}C, and under anaerobic atmospheres obtained by various methods. It was found that {alpha}-ISA was transformed under all conditions tested to some extent. Reaction products, such as glycolate, formate, lactate and acetate, all compounds with less complexing strength than {alpha}-ISA, were detected. The amount of reaction products identified by the chromatographic technique applied was {approx} 50 % of the amount of {alpha}-ISA reacted. Sorption of {alpha}-ISA to Ca(OH){sub 2} contributed only to a minor extent to the loss of {alpha}-ISA from the solution phase. As the most important conclusion of the present work it was demonstrated that the presence of oxidising agents had a distinctive influence on the turnover of {alpha}-ISA. Under aerobic conditions {alpha}-ISA was
Sasaki, Tomoyuki; Shoho, Takashi; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi
2014-04-01
A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.
Energy Technology Data Exchange (ETDEWEB)
Sasaki, Tomoyuki, E-mail: sasaki-tomoy@vos.nagaokaut.ac.jp; Shoho, Takashi; Noda, Kohei; Ono, Hiroshi [Department of Electrical Engineering, Nagaoka University of Technology, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Kawatsuki, Nobuhiro [Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo 671-2280 (Japan)
2014-04-21
A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.
Boronate Derivatives of Functionally Diverse Catechols: Stability Studies
Directory of Open Access Journals (Sweden)
Kamal Aziz Ketuly
2010-03-01
Full Text Available Benzeneboronate of catecholic carboxyl methyl esters, N-acetyldopamine, coumarin and catechol estrogens were prepared as crystalline derivatives in high yield. Related catechol compounds with extra polar functional group(s (OH, NH2 do not form or only partially form unstable cyclic boronate derivatives.
Bellastella, Giuseppe; Cooper, Trevor G; Battaglia, Marina; Ströse, Anda; Torres, Inma; Hellenkemper, Barbara; Soler, Carles; Sinisi, Antonio A
2010-11-01
Objective measurements are required for computer-aided sperm morphometric analysis (CASMA) machines to distinguish normal from abnormal sperm heads. The morphometric characteristics of spermatozoa in 72 samples of semen and of spermatozoa from 72 other semen samples after swim-up were quantified by the semi-automated Integrated Sperm Analysis System (ISAS) computer-aided system, which measured the sperm head parameters length (L), width (W), area (A), perimeter (P), acrosomal area (Ac), and the derived values L/W and P/A. For each man a homogeneous population of distributions characterized seminal spermatozoa (7 942 cells: median values L 4.4 μm, W 2.8 μm, A 9.8 μm(2), P 12.5 μm, Ac 47.5%, L/W 1.57, P/A 1.27), and there was no significant difference in within- and among-individual variation. Different men could have spermatozoa of significantly different dimensions. Head dimensions for swim-up spermatozoa from different men (4 812 cells) were similar to those in semen, differing only by 2%-5%. The values of L, W and L/W fell within the limits given by the World Health Organization (WHO). Although these samples were not biologically matched, linear mixed-effects statistical analyses permitted valid comparison of the groups. A subpopulation of 404 spermatozoa considered to fit the stringent criteria of WHO 'normal' seminal spermatozoa from both semen and swim-up were characterized by median values (and 95% confidence intervals) of L, 4.3 μm (3.8-4.9), W, 2.9 μm (2.6-3.3), A, 10.2 μm(2) (8.5-12.2), P, 12.4 μm (11.3-13.9), Ac, 49% (36-60), L/W, 1.49 (1.32-1.67) and P/A, 1.22 (1.11-1.35). These median values fall within the 95th centile confidence limits given by WHO, but the confidence intervals for L and W were larger. Although these differences in head dimensions among men and after swim-up could be detected by CASMA, the small differences make it unlikely that technicians would be able to distinguish them. The values could be used as default sperm head
Kjubrikovo čitanje Bardžisa: Značaj kostima za razumevanje Paklene pomorandže
Directory of Open Access Journals (Sweden)
Dijana Metlić
2016-07-01
Full Text Available Roman Paklena pomorandža Entonija Bardžisa, objavljen 1962. godine, postao je jedno od kultnih književnih dela XX veka, pre svega zahvaljujući istoimenom filmu Stenlija Kjubrika iz 1971. Okarakterisan kao dekadentno i nihilističko ostvarenje, snimljen tako da gledaoci „uživaju“ u scenama nasilja, Kjubrikov film bio je, uz prekide, u distribuciji u Britaniji do 1974. godine kada je povučen na zahtev reditelja zbog optužbi koje su ga implicitno teretile za povećanje stepena delinkventskog nasilja u Engleskoj, neposredno po bioskopskom prikazivanju filma. Ovaj tekst analizira specifičan Kjubrikov pristup adaptaciji književnog predloška, sa pozicije upotrebe filmskog kostima i umetničkih dela pop arta u njegovoj scenografiji, što postaju ključni elementi za konstruisanje nove slike budućeg društva, nastalog u periodu hladnoratovske krize, Vijetnamskog rata i učestalih protesta omladine nezadovoljne uslovima života koji im obezbeđuju njihovi očevi. U pitanju je klasno određen svet, korumpiran i sumoran, ispražnjen i bez vitalnosti. Bardžis predstavlja Englesku neposredno po završetku sukoba između modsa i rokera šezdesetih godina, a pre pojave pank pokreta u drugoj polovini sedamdesetih. Takvoj apokaliptičkoj viziji britanske budućnosti suprotstavlja se jaka i osvešćena individua oličena u harizmatičnom junaku Aleksu Dilarču, koji sa Kjubrikom konačno dobija i svoj „stvarni“, oživotvoreni lik zahvaljujući Malkolmu Mekdauelu koji tumači glavnu ulogu.
THE EFFECT OF ENZYMATIC ADDITIVES ON THE PRODUCTIVITY OF LAYING HENS ISA BROWN
Directory of Open Access Journals (Sweden)
Branislav Gálik
2011-01-01
Full Text Available The aim of this work the influence of enzymatic additives on the productivity of laying hens ISA BROWN was to analyze. The experiment together with the Central Control and Testing Institute of Agriculture was realized. The experiment was conducted 11 months, in 3 phases: from the 22nd to the 28th week, from the 29th to the 46th week and from the 47th to the 68th week of production. Two groups with 1080 (540 in each group animals were examined (control group A, experimental group B. In the experiment diets based on wheat, rye, barley, soybean, minerals and vitamins were used. In group B we administered a feed mixture with endo-1,4-ß-xylanase (activity 7820 TXU.g-1 and endo-1,4-ß-glucanase (activity 2940 TGU.g-1 fortification. After finishing of the last period (68th week of hens´ age were registered parameters in both groups of animals. The body weight at the end of the experiment was positively affected in the second group (containing enzymes: B. This difference was significantly higher (P<0.05. In the B group was also confirmed significant better (P<0.05 feed intake (141.8 and 144.3 g respectively on the same level and non significant (P>0.05 heavier eggs (64.54 and 64.02 g respectively in A and B group. For hens in the control group (without enzymes, was registered significantly lower (P<0.05 body weight (2 239 and 2 307 g of hens, a lower weight of eggs (P>0.05, and higher feed intake (P<0.05. The feeding without enzymes in the A group negatively influenced the quality of eggs. It was higher percentage of total non-standard eggs (7.10 and 6.56 %, cracked eggs (4.0 and 3.64 % and broken eggs (0.52 and 0.39 %. The differences of these parameters are not significant (P>0.05. After the administration of the enzymes in the feed mixture fortification we determined a positive effect on laying hens´ productivity. The application of enzymes positively affected the average body weight of hens.
Derivation of Hamiltonians for accelerators
Energy Technology Data Exchange (ETDEWEB)
Symon, K.R.
1997-09-12
In this report various forms of the Hamiltonian for particle motion in an accelerator will be derived. Except where noted, the treatment will apply generally to linear and circular accelerators, storage rings, and beamlines. The generic term accelerator will be used to refer to any of these devices. The author will use the usual accelerator coordinate system, which will be introduced first, along with a list of handy formulas. He then starts from the general Hamiltonian for a particle in an electromagnetic field, using the accelerator coordinate system, with time t as independent variable. He switches to a form more convenient for most purposes using the distance s along the reference orbit as independent variable. In section 2, formulas will be derived for the vector potentials that describe the various lattice components. In sections 3, 4, and 5, special forms of the Hamiltonian will be derived for transverse horizontal and vertical motion, for longitudinal motion, and for synchrobetatron coupling of horizontal and longitudinal motions. Hamiltonians will be expanded to fourth order in the variables.
Identities for the electron forms 2 and their 3D representation
International Nuclear Information System (INIS)
Minogin, Vladimir G.
2012-01-01
New type of identities for products of the electron forms 2 (Fs2) and the bilinear forms (BFs) are derived. The identities are found for both temporal Fs2 describing the electron energy and quasi energy densities and spatial Fs2 describing the linear momentum and quasi linear momentum densities. The identities allow one to transform the quasi energy densities into the energy densities as well as the quasi linear momentum densities into the linear momentum densities. It is shown that by choosing any one of the 16 electron temporal or spatial Fs2 one can represent the remaining 15 temporal or spatial Fs2 as combinations of a chosen form 2 (F2) and the derivatives of a number of BFs. Any one of such 16 sets of identities can be considered as a specific form of an irreducible representation for the temporal or spatial Fs2. Similar to the bilinear identities for BFs the derived identities can be used for reduction different physical quantities describing the electron to the forms defined by the basic physical observables. As an example we consider transformation of the electron energy density to a new fundamental form that presents the energy density through the linear momentum density. - Highlights: ► New type of identities connecting electron forms 2 and bilinear forms is derived.► Identities are found for temporal and spatial forms 2. ► Irreducible representation of the identities is derived. ► New forms of the electron energy density are presented.
Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa
2013-01-01
Objective: The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells. Methods: Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow–derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O’Driscoll score). Results: The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O’Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. Conclusions: This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated. PMID:26069678
Yoshioka, Tomokazu; Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa
2013-10-01
The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells. Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow-derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O'Driscoll score). The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O'Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated.
Phosphorylated derivatives of anabasine: synthesis, constitution and complex forming properties
International Nuclear Information System (INIS)
Babaev, B.N.
2004-01-01
Full text: With the purpose of detection of new effective extra gents of metals from number of sulphur containing derivatives of acids of phosphorus with different functional groups, analysis of effect of the different factors on selectivity of allocation of metals, installation of optimum conditions of an extraction, the detections of effective extra gents of noble metals from industrial sewage waters, are synthesized phosphorylated derivatives of the anabasine - O-alkyl-O-(anaba-sinoisopropyl)- and O-alkyl-O-(anabasinobutyn-2-yl)phenyl phosphonates and O-(anabasinoisopropyl)- and O-(anabasinobutyn-2-yl)diphenyl phosphonates In an IR-spectrum about O-pentyl-O-[anabasinoisopropyl]phenylphosphonate There are absorption band of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR O-(anabasinobutyn-2-yl)phenylphosphonate in the field of a weak field apart from signals of two phenylic radicals the signals of a b-displaced pyridine, reference for a molecule anabasine are observed: Hαa-8,46 p.m., H α '-8,41 p.m., H γ -7,60 p.m. And H β -7,15 p.m. A double triplet at 4,70 p.m. And triplet at 3,05 p.m. Belong to signals OCH 2 and N-CH 2 of groups, accordingly, separated by acetylene bond. The signals of piperidine cycle of anabasine have the following chemical shifts: H 2a -3,27 p.m., H 6e -2,78 p.m., H 6a -2,45 p.m., and remaining protons (6H, m, CH 2 ) are in resonance in the field of 1,1-1,9 p.m. The analysis of mass-spectrometer decay of the synthesized connections has shown, that the mass-spectrometer fragmentation M * about - O-alkyl-O- (anabasinoisopropyl) phenylphosphonates flows past in different directions and is characterized, as against about O-alkyl-O-(anabasinobutyn-2-yl)phenyl-phosphonates, large number of phosphor containing ions; the availability of the second phenylic radical in molecules anabasincontaining derivatives of a diphenyl phosphinic acid essentially
Development trends of the international derivatives market
Motorniuk, U.; Terebukh, M.; Kharchuk, V.
2016-01-01
The factors forming international derivatives market trends are researched in this article. The history of the formation of the global derivatives market was analyzed, in particular, events which have led to the growth of the derivatives market. Global derivatives market has revealed major changes in its trends and witnessed the gradual transformation of its structure, observed in recent years. Global derivatives market has revealed major changes in its trends and witnessed the gradual transf...
International Nuclear Information System (INIS)
Hu, E; Lasio, G; Yi, B
2014-01-01
Purpose: The Iterative Subtraction Algorithm (ISA) method generates retrospectively a pre-selected motion phase cone-beam CT image from the full motion cone-beam CT acquired at standard rotation speed. This work evaluates ISA method with real lung patient data. Methods: The goal of the ISA algorithm is to extract motion and no- motion components form the full reconstruction CBCT. The workflow consists of subtracting from the full CBCT all of the undesired motion phases and obtain a motion de-blurred single-phase CBCT image, followed by iteration of this subtraction process. ISA is realized as follows: 1) The projections are sorted to various phases, and from all phases, a full reconstruction is performed to generate an image CTM. 2) Generate forward projections of CTM at the desired phase projection angles, the subtraction of projection and the forward projection will reconstruct a CTSub1, which diminishes the desired phase component. 3) By adding back the CTSub1 to CTm, no motion CBCT, CTS1, can be computed. 4) CTS1 still contains residual motion component. 5) This residual motion component can be further reduced by iteration.The ISA 4DCBCT technique was implemented using Varian Trilogy accelerator OBI system. To evaluate the method, a lung patient CBCT dataset was used. The reconstruction algorithm is FDK. Results: The single phase CBCT reconstruction generated via ISA successfully isolates the desired motion phase from the full motion CBCT, effectively reducing motion blur. It also shows improved image quality, with reduced streak artifacts with respect to the reconstructions from unprocessed phase-sorted projections only. Conclusion: A CBCT motion de-blurring algorithm, ISA, has been developed and evaluated with lung patient data. The algorithm allows improved visualization of a single phase motion extracted from a standard CBCT dataset. This study has been supported by National Institute of Health through R01CA133539
Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun
2014-05-06
Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.
Directory of energy data collection forms. Forms in use as of October 1995
Energy Technology Data Exchange (ETDEWEB)
NONE
1996-01-01
This is an authoritative listing of selected public use forms currently used as basic energy information gathering tools by the Department of Energy (DOE). This directory provides an overview of DOE`s energy information collection programs for decisionmakers in Government and industry. Forms designed to collect energy information and used by the Energy Information Administration (EIA) as of October 1995 are included in this directory. For each form listed in this directory, an abstract is included that describes the form`s uses, its respondents, and the data collected. For the reader`s convenience in finding specific types of collections, several indices have been provided in this directory. A listing of the forms grouped by energy source and function begins on page 26. Beginning on page 38 are the publications derived from the collections, and on page 50, are the forms linked to general respondent categories.
Inferring Parametric Energy Consumption Functions at Different Software Levels
DEFF Research Database (Denmark)
Liqat, Umer; Georgiou, Kyriakos; Kerrison, Steve
2016-01-01
The static estimation of the energy consumed by program executions is an important challenge, which has applications in program optimization and verification, and is instrumental in energy-aware software development. Our objective is to estimate such energy consumption in the form of functions...... on the input data sizes of programs. We have developed a tool for experimentation with static analysis which infers such energy functions at two levels, the instruction set architecture (ISA) and the intermediate code (LLVM IR) levels, and reflects it upwards to the higher source code level. This required...... the development of a translation from LLVM IR to an intermediate representation and its integration with existing components, a translation from ISA to the same representation, a resource analyzer, an ISA-level energy model, and a mapping from this model to LLVM IR. The approach has been applied to programs...
Kommende standarder for revisors ydelser - "Efter clarity"
DEFF Research Database (Denmark)
Kiertzner, Lars
2011-01-01
Atiklen præsenterer på et overordnet niveau kommende standarder med videre fra IAASB. Formålet er at give et samlet overblik over, hvad der kan forventes i de kommende år. Den første og største del af artiklen behandler allerede igangsatte projekter, der befinder sig et sted i tilblivelsesprocess...... ISA 700 om revisionspåtegningen ISA 720 om andre oplysninger i regnskaber og ISRE 2400 om review. Andre projekter om vejledninger (IAPS), andre erklæringsopgaver og beslægtede opgaver behandles kun perifert....
Form factors of the finite quantum XY-chain
International Nuclear Information System (INIS)
Iorgov, Nikolai
2011-01-01
Explicit factorized formulas for the matrix elements (form factors) of the spin operators σ x and σ y between the eigenvectors of the Hamiltonian of the finite quantum periodic XY-chain in a transverse field were derived. The derivation is based on the relations between three models: the model of quantum XY-chain, Ising model on 2D lattice and N = 2 Baxter-Bazhanov-Stroganov τ (2) -model. Due to these relations we transfer the formulas for the form factors of the latter model recently obtained by the use of separation of variables method to the model of quantum XY-chain. Hopefully, the formulas for the form factors will help in analysis of multipoint dynamic correlation functions at a finite temperature. As an example, we re-derive the asymptotics of the two-point correlation function in the disordered phase without the use of the Toeplitz determinants and the Wiener-Hopf factorization method.
Form of the manifestly covariant Lagrangian
Johns, Oliver Davis
1985-10-01
The preferred form for the manifestly covariant Lagrangian function of a single, charged particle in a given electromagnetic field is the subject of some disagreement in the textbooks. Some authors use a ``homogeneous'' Lagrangian and others use a ``modified'' form in which the covariant Hamiltonian function is made to be nonzero. We argue in favor of the ``homogeneous'' form. We show that the covariant Lagrangian theories can be understood only if one is careful to distinguish quantities evaluated on the varied (in the sense of the calculus of variations) world lines from quantities evaluated on the unvaried world lines. By making this distinction, we are able to derive the Hamilton-Jacobi and Klein-Gordon equations from the ``homogeneous'' Lagrangian, even though the covariant Hamiltonian function is identically zero on all world lines. The derivation of the Klein-Gordon equation in particular gives Lagrangian theoretical support to the derivations found in standard quantum texts, and is also shown to be consistent with the Feynman path-integral method. We conclude that the ``homogeneous'' Lagrangian is a completely adequate basis for covariant Lagrangian theory both in classical and quantum mechanics. The article also explores the analogy with the Fermat theorem of optics, and illustrates a simple invariant notation for the Lagrangian and other four-vector equations.
Directory of Open Access Journals (Sweden)
Taiki Kobayashi
Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.
Infection studies in mink with seal-derived morbillivirus
DEFF Research Database (Denmark)
Blixenkrone-Møller, M; Svansson, V; Have, P.
1989-01-01
Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper.......Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper....
Two-loop SL(2) form factors and maximal transcendentality
International Nuclear Information System (INIS)
Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang
2016-01-01
Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.
Two-loop SL(2) form factors and maximal transcendentality
Energy Technology Data Exchange (ETDEWEB)
Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)
2016-12-19
Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.
Energy derivatives, experiences in derivative trading from the natural gas industry : back to basics
International Nuclear Information System (INIS)
Dittmer, G.; Coyle, T.
1998-01-01
Some basic facts regarding derivatives in the electric power industry were discussed based on experiences in the natural gas industry. Derivatives were described as financial instruments that have no value of their own but derive their value from other assets, such as commodities. Futures and Options are the two forms of derivatives. Electricity as a commodity was characterized, and a historical parallel was drawn between deregulation in the natural gas and electric power industry. Short term and long term factors impacting the market and market dynamics impacting derivatives were identified. The latter include: (1) volatility, (2) liquidity, (3) correlations, and (4) price discovery. In contrast to the natural gas market, the electricity market is considered as lacking liquidity and in need of moving farther along the maturity timeline. The question of natural gas/ electricity convergence was also addressed refs., tabs., figs
Selective displacement of the tributylstannyl group to form [125I]phenylboronic acid derivatives
International Nuclear Information System (INIS)
Kinsey, B.M.; Kassis, A.I.
1990-01-01
Three radioiodinated phenylboronic acid derivatives (1a, 2a, 3a) were prepared at the no-carrier-added level by selective displacement of the corresponding tributylstannyl group. The tributylstannyl compounds 1b, 2b, and 3b were synthesized from the bromo derivatives 1c, 2c and 3c. Radioiodination was accomplished using Na 125 I and either Chloramine-T or peracetic acid to give 1a, 2a and 3a in radiochemical yields of 46, 26, and 67% respectively after HPLC purification. Compounds 1a, 2a and 3a were concentrated in vitro preferentially in HT-29 human colon carcinoma cells compared to V79 Chinese hamster lung fibroblasts, with 3a having the highest uptake
The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Gutiérrez Peña, Luís Vicente; Carrero, Pablo E; Delgado C, Yelitza J; Picón, David; Paz, Luis A; Vielma, José R; Quintero, Arlenis Y; Gutiérrez, Ever O; Gutiérrez, Iserslis A
2014-01-01
El huevo es una fuente proteica de uso masivo, en consideración a su bajo costo, es consumido con mayor frecuencia por toda la población. Por esta razón, es de gran interés introducir al mercado un tipo de huevo "saludable", que disminuya los riesgos ligados a enfermedades cardiovasculares y que actúe como antioxidante. Por ello, se evaluó la incorporación del Selenio Orgánico (Sel-Plex®, Alltech Inc) en el programa de alimentación de gallinas ponedoras comerciales raza isa brown con el objet...
Terminology for Neuroscience Data Discovery: Multi-tree Syntax and Investigator-Derived Semantics
Goldberg, David H.; Grafstein, Bernice; Robert, Adrian; Gardner, Esther P.
2009-01-01
The Neuroscience Information Framework (NIF), developed for the NIH Blueprint for Neuroscience Research and available at http://nif.nih.gov and http://neurogateway.org, is built upon a set of coordinated terminology components enabling data and web-resource description and selection. Core NIF terminologies use a straightforward syntax designed for ease of use and for navigation by familiar web interfaces, and readily exportable to aid development of relational-model databases for neuroscience data sharing. Datasets, data analysis tools, web resources, and other entities are characterized by multiple descriptors, each addressing core concepts, including data type, acquisition technique, neuroanatomy, and cell class. Terms for each concept are organized in a tree structure, providing is-a and has-a relations. Broad general terms near each root span the category or concept and spawn more detailed entries for specificity. Related but distinct concepts (e.g., brain area and depth) are specified by separate trees, for easier navigation than would be required by graph representation. Semantics enabling NIF data discovery were selected at one or more workshops by investigators expert in particular systems (vision, olfaction, behavioral neuroscience, neurodevelopment), brain areas (cerebellum, thalamus, hippocampus), preparations (molluscs, fly), diseases (neurodegenerative disease), or techniques (microscopy, computation and modeling, neurogenetics). Workshop-derived integrated term lists are available Open Source at http://brainml.org; a complete list of participants is at http://brainml.org/workshops. PMID:18958630
Motion control of planar parallel robot using the fuzzy descriptor system approach.
Vermeiren, Laurent; Dequidt, Antoine; Afroun, Mohamed; Guerra, Thierry-Marie
2012-09-01
This work presents the control of a two-degree of freedom parallel robot manipulator. A quasi-LPV approach, through the so-called TS fuzzy model and LMI constraints problems is used. Moreover, in this context a way to derive interesting control laws is to keep the descriptor form of the mechanical system. Therefore, new LMI problems have to be defined that helps to reduce the conservatism of the usual results. Some relaxations are also proposed to leave the pure quadratic stability/stabilization framework. A comparison study between the classical control strategies from robotics and the control design using TS fuzzy descriptor models is carried out to show the interest of the proposed approach. Copyright © 2012 ISA. Published by Elsevier Ltd. All rights reserved.
Two forms for 3-uniform states of eight-qubits
Zha, Xinwei; Da, Zhang; Ahmed, Irfan; Zhang, Yanpeng
2018-05-01
In this paper, we study the relations between average bipartite entanglement and the n-tangle of eight-qubits. We have derived two forms for 3-uniform states of eight-qubits. One form has the n-tangle equal to zero; the other form has the n-tangle equal to unity.
Conservation form of the equations of fluid dynamics in general nonsteady coordinates
Zhang, H.; Camarero, R.; Kahawita, R.
1985-11-01
Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations.
Conservation form of the equations of fluid dynamics in general nonsteady coordinates
International Nuclear Information System (INIS)
Zhang, H.; Camarero, R.; Kahawita, R.
1985-01-01
Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations. 6 references
Wice, B M; Gordon, J I
1992-01-01
differentiation/translocation up the villus. Immunocytochemical studies reveal that the intestine-specific annexin (ISA) is associated with the plasma membrane of undifferentiated, proliferating crypt epithelial cells as well as differentiated villus enterocytes. In polarized enterocytes, the highest concentrations of ISA are found at the apical compared to basolateral membrane. In vitro studies using an octapeptide derived from residues 2-9 of the primary translation product of ISA mRNA and purified myristoyl-CoA:protein N-myristoyltransferase suggested that it is N-myristoylated. In vivo labeling studies confirmed that myristate is covalently attached to ISA via a hydroxylamine resistant amide linkage. The restricted cellular expression and acylation of ISA distinguish it from other known annexins.(ABSTRACT TRUNCATED AT 400 WORDS)
Energy Technology Data Exchange (ETDEWEB)
Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn
2009-10-02
Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.
Higher derivatives in Type II and M-theory on Calabi-Yau threefolds
Grimm, Thomas W.; Mayer, Kilian; Weissenbacher, Matthias
2018-02-01
The four- and five-dimensional effective actions of Calabi-Yau threefold compactifications are derived with a focus on terms involving up to four space-time derivatives. The starting points for these reductions are the ten- and eleven-dimensional supergravity actions supplemented with the known eight-derivative corrections that have been inferred from Type II string amplitudes. The corrected background solutions are determined and the fluctuations of the Kähler structure of the compact space and the form-field back-ground are discussed. It is concluded that the two-derivative effective actions for these fluctuations only takes the expected supergravity form if certain additional ten- and eleven-dimensional higher-derivative terms for the form-fields are included. The main results on the four-derivative terms include a detailed treatment of higher-derivative gravity coupled to Kähler structure deformations. This is supplemented by a derivation of the vector sector in reductions to five dimensions. While the general result is only given as an expansion in the fluctuations, a complete treatment of the one-Kähler modulus case is presented for both Type II theories and M-theory.
An intrinsic and exterior form of the Bianchi identities
Do, Thoan; Prince, Geoff
2017-09-01
We give an elegant formulation of the structure equations (of Cartan) and the Bianchi identities in terms of exterior calculus without reference to a particular basis and without the exterior covariant derivative. This approach allows both structure equations and the Bianchi identities to be expressed in terms of forms of arbitrary degree. We demonstrate the relationship with both the conventional vector version of the Bianchi identities and to the exterior covariant derivative approach. Contact manifolds, codimension one foliations and the Cartan form of classical mechanics are studied as examples of its flexibility and utility.
Higher-derivative superparticle in AdS3 space
Kozyrev, Nikolay; Krivonos, Sergey; Lechtenfeld, Olaf
2016-03-01
Employing the coset approach we construct component actions for a superparticle moving in AdS3 with N =(2 ,0 ), D =3 supersymmetry partially broken to N =2 , d =1 . These actions may contain higher time-derivative terms, which are chosen to possess the same (super)symmetries as the free superparticle. In terms of the nonlinear-realization superfields, the component actions always take a simpler form when written in terms of covariant Cartan forms. We also consider in detail the reduction to the nonrelativistic case and construct the corresponding action of a Newton-Hooke superparticle and its higher-derivative generalizations. The structure of these higher time-derivative generalizations is completely fixed by invariance under the supersymmetric Newton-Hooke algebra extended by two central charges.
A new derivation of Dirac's magnetic monopole strength
International Nuclear Information System (INIS)
Panat, P V
2003-01-01
A new derivation of the strength of Dirac's magnetic monopole is presented which does not require an explicit form of the magnetic induction in terms of g, the magnetic pole strength. The derivation essentially uses a modification of Faraday's law of induction and quantization of angular momentum
Teng, Jinn-Tsair; Cárdenas-Barrón, Leopoldo Eduardo; Lou, Kuo-Ren; Wee, Hui Ming
2013-05-01
In this article, we first complement an inappropriate mathematical error on the total cost in the previously published paper by Chung and Wee [2007, 'Optimal the Economic Lot Size of a Three-stage Supply Chain With Backlogging Derived Without Derivatives', European Journal of Operational Research, 183, 933-943] related to buyer-distributor-vendor three-stage supply chain with backlogging derived without derivatives. Then, an arithmetic-geometric inequality method is proposed not only to simplify the algebraic method of completing prefect squares, but also to complement their shortcomings. In addition, we provide a closed-form solution to integral number of deliveries for the distributor and the vendor without using complex derivatives. Furthermore, our method can solve many cases in which their method cannot, because they did not consider that a squared root of a negative number does not exist. Finally, we use some numerical examples to show that our proposed optimal solution is cheaper to operate than theirs.
Evaluation of equilibrium constants for deprotonation and lactonisation of α-D-isosaccharinic acid
International Nuclear Information System (INIS)
Rai, Dhanpat; Kitamura, Akira
2016-01-01
A great deal of disagreement exists in the literature regarding the intrinsic deprotonation and lactonisation constants of α-D-isosaccharinic acid (ISA). Based on a combination of nuclear magnetic resonance and interpretations using the specific ion interaction theory (SIT) of extensive experimental Ca(ISA) 2 (cr) solubility data involving α-D-isosaccharinic acid, the reliable value of log 10 K° for [HISA(aq) ⇌ ISA - + H + ] is -3.27 ± 0.01 and for [HISA(aq) ⇌ ISL(α-D-isosaccharinate-1,4-lactone)(aq) + H 2 O] is 0.49 ± 0.09. These data also provide log 10 K° of -3.76 ± 0.09 for the reaction [ISL(aq) + H 2 O ⇌ ISA - + H + ] and -3.88 ± 0.09 for the composite reaction [HISA(aq) + ISL(aq) ⇌ ISA - + H + ]. Reinterpretation of extensive Ca(ISA) 2 (cr) solubility data using the SIT activity coefficient model provides log 10 K° of -6.40 ± 0.09 for [Ca(ISA) 2 (cr) ⇌ Ca 2+ + 2(ISA) - ] and of 1.70 ± 0.09 for [Ca 2+ + ISA - ⇌ CaISA + ] which are consistent with all of the available values. (author)
Directory of Open Access Journals (Sweden)
Samir Chtita
2016-01-01
Full Text Available In a search of newer and potent antileishmanial (against promastigotes and amastigotes form of parasites drug, a series of 60 variously substituted acridines derivatives were subjected to a quantitative structure activity relationship (QSAR analysis for studying, interpreting, and predicting activities and designing new compounds by using multiple linear regression and artificial neural network (ANN methods. The used descriptors were computed with Gaussian 03, ACD/ChemSketch, Marvin Sketch, and ChemOffice programs. The QSAR models developed were validated according to the principles set up by the Organisation for Economic Co-operation and Development (OECD. The principal component analysis (PCA has been used to select descriptors that show a high correlation with activities. The univariate partitioning (UP method was used to divide the dataset into training and test sets. The multiple linear regression (MLR method showed a correlation coefficient of 0.850 and 0.814 for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. Internal and external validations were used to determine the statistical quality of QSAR of the two MLR models. The artificial neural network (ANN method, considering the relevant descriptors obtained from the MLR, showed a correlation coefficient of 0.933 and 0.918 with 7-3-1 and 6-3-1 ANN models architecture for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outsides compounds. The effects of different descriptors in the activities were described and used to study and design new compounds with higher activities compared to the existing ones.
Sigman, Michael E.; Dindal, Amy B.
2003-11-11
Described is a method for producing copolymerized sol-gel derived sorbent particles for the production of copolymerized sol-gel derived sorbent material. The method for producing copolymerized sol-gel derived sorbent particles comprises adding a basic solution to an aqueous metal alkoxide mixture for a pH.ltoreq.8 to hydrolyze the metal alkoxides. Then, allowing the mixture to react at room temperature for a precalculated period of time for the mixture to undergo an increased in viscosity to obtain a desired pore size and surface area. The copolymerized mixture is then added to an immiscible, nonpolar solvent that has been heated to a sufficient temperature wherein the copolymerized mixture forms a solid upon the addition. The solid is recovered from the mixture, and is ready for use in an active sampling trap or activated for use in a passive sampling trap.
Comments on electromagnetic form factors of the nucleon
International Nuclear Information System (INIS)
Sachs, R.G.; Wali, K.C.
1989-01-01
This paper draws the concept of nucleon form factors further to consider the electromagnetic aspect based on the magnetic moment of the nucleon. These are seen as valid physical interpretations of form factors in electron-nucleon interactions. A linear combination of two functions, associated with charge radius, is derived, which agreed well with experimental results. The paper also expands the specific form to include relativistic cases and consider appropriate frames of reference. (UK)
An Improved Scale-Adaptive Simulation Model for Massively Separated Flows
Directory of Open Access Journals (Sweden)
Yue Liu
2018-01-01
Full Text Available A new hybrid modelling method termed improved scale-adaptive simulation (ISAS is proposed by introducing the von Karman operator into the dissipation term of the turbulence scale equation, proper derivation as well as constant calibration of which is presented, and the typical circular cylinder flow at Re = 3900 is selected for validation. As expected, the proposed ISAS approach with the concept of scale-adaptive appears more efficient than the original SAS method in obtaining a convergent resolution, meanwhile, comparable with DES in visually capturing the fine-scale unsteadiness. Furthermore, the grid sensitivity issue of DES is encouragingly remedied benefiting from the local-adjusted limiter. The ISAS simulation turns out to attractively represent the development of the shear layers and the flow profiles of the recirculation region, and thus, the focused statistical quantities such as the recirculation length and drag coefficient are closer to the available measurements than DES and SAS outputs. In general, the new modelling method, combining the features of DES and SAS concepts, is capable to simulate turbulent structures down to the grid limit in a simple and effective way, which is practically valuable for engineering flows.
Application of the moving frame method to deformed Willmore surfaces in space forms
Paragoda, Thanuja
2018-06-01
The main goal of this paper is to use the theory of exterior differential forms in deriving variations of the deformed Willmore energy in space forms and study the minimizers of the deformed Willmore energy in space forms. We derive both first and second order variations of deformed Willmore energy in space forms explicitly using moving frame method. We prove that the second order variation of deformed Willmore energy depends on the intrinsic Laplace Beltrami operator, the sectional curvature and some special operators along with mean and Gauss curvatures of the surface embedded in space forms, while the first order variation depends on the extrinsic Laplace Beltrami operator.
Physical equivalence of the point and instant forms of relativistic dynamics
Energy Technology Data Exchange (ETDEWEB)
Sokolov, S N [Gosudarstvennyj Komitet po Ispol' zovaniyu Atomnoj Ehnergii SSSR, Serpukhov. Inst. Fiziki Vysokikh Ehnergij
1975-01-01
As a proof of total physical equivalence of point and instantaneous forms of dynamics, a unitary transformation is derived which connects these forms of dynamics without changing the scattering matrix.
Two stage neural network modelling for robust model predictive control.
Patan, Krzysztof
2018-01-01
The paper proposes a novel robust model predictive control scheme realized by means of artificial neural networks. The neural networks are used twofold: to design the so-called fundamental model of a plant and to catch uncertainty associated with the plant model. In order to simplify the optimization process carried out within the framework of predictive control an instantaneous linearization is applied which renders it possible to define the optimization problem in the form of constrained quadratic programming. Stability of the proposed control system is also investigated by showing that a cost function is monotonically decreasing with respect to time. Derived robust model predictive control is tested and validated on the example of a pneumatic servomechanism working at different operating regimes. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jelena Rajić
2012-12-01
Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.
Variational problems with fractional derivatives: Euler-Lagrange equations
International Nuclear Information System (INIS)
Atanackovic, T M; Konjik, S; Pilipovic, S
2008-01-01
We generalize the fractional variational problem by allowing the possibility that the lower bound in the fractional derivative does not coincide with the lower bound of the integral that is minimized. Also, for the standard case when these two bounds coincide, we derive a new form of Euler-Lagrange equations. We use approximations for fractional derivatives in the Lagrangian and obtain the Euler-Lagrange equations which approximate the initial Euler-Lagrange equations in a weak sense
Directory of Open Access Journals (Sweden)
N. Kalaivasan
2010-01-01
Full Text Available Polyaniline clay nanocomposite can be prepared by mechano-chemical method in which intercalation of anilinium ion into the clay lattices accomplished by mechanical grinding of sodium montmorillonite (Na+MMT in presence of anilinium hydrochloride at room temperature using mortar & pestle for about 30 min and subsequent grinding with oxidizing agent, ammonium peroxysulfate. The appearance of green colour indicates the formation of polyaniline/clay nanocomposite (PANI/Clay. Similarly aniline derivatives like o-toludine and o-anisidine in the form of HCl salt can form intercalation into the clay lattices. The intercalated aniline derivatives were ground mechanically in presence of oxidizing agent ammonium peroxysulfate lead to formation of substituted polyaniline/ clay nanocomposites. The characteristics of various polyaniline-clay nanocomposites were investigated using UV-Visible, FT-IR, cyclic voltammetry studies.
International Nuclear Information System (INIS)
Pino, I.; Casas, L.
1988-01-01
Greenhouse experiments with a soil derived from volcanic ash were carried out in order to determine the efficiency of triple Superphosphate with different rates and forms of application. Oat (Avena Sativa L.) was used as reference crop. The P 32 labeled fertilizer was applied located 2,5 cm underneath the seeds. At the same time 500 mg P were applied located, mixed and in the surface of the soil. The P in the plant coming from the fertilizer was about 65%. This value was independent from the rates. The A value showed some fluctuations with the utmost rates of P. The fertilizer applied located and in the surface of the soil proved to be the most efficient form of application. The A value useful to compare the different treatments. The fertilizer efficiency was very low in both experiments, being the higher efficiency (5,9%) at the lowest rate which is not associated to a higher production. The best treatment was obtained with 500 mg of P located underneath the seed. (author)
International Nuclear Information System (INIS)
Melánová, Klára; Beneš, Ludvík; Trchová, Miroslava; Svoboda, Jan; Zima, Vítězslav
2013-01-01
A set of layered ester and amide derivatives of titanium(IV) carboxymethylphosphonate was prepared by solvothermal treatment of amorphous titanium(IV) carboxymethylphosphonate with corresponding 1-alkanols, 1,ω-alkanediols, 1-aminoalkanes, 1,ω-diaminoalkanes and 1,ω-amino alcohols and characterized by powder X-ray diffraction, IR spectroscopy and thermogravimetric analysis. Whereas alkyl chains with one functional group form bilayers tilted to the layers, 1,ω-diaminoalkanes and most of 1,ω-alkanediols form bridges connecting the adjacent layers. In the case of amino alcohols, the alkyl chains form bilayer and either hydroxyl or amino group is used for bonding. This simple method for the synthesis of ester and amide derivatives does not require preparation of acid chloride derivative as a precursor or pre-intercalation with alkylamines and can be used also for the preparation of ester and amide derivatives of titanium carboxyethylphosphonate and zirconium carboxymethylphosphonate. - Graphical abstract: Ester and amide derivatives of layered titanium carboxymethylphosphonate were prepared by solvothermal treatment of amorphous solid with alkanol or alkylamine. - Highlights: • Ester and amide derivatives of titanium carboxymethylphosphonate. • Solvothermal treatment of amorphous solid with alkanol or alkylamine. • Ester and amide formation confirmed by IR spectroscopy
Spinors, tensors and the covariant form of Dirac's equation
International Nuclear Information System (INIS)
Chen, W.Q.; Cook, A.H.
1986-01-01
The relations between tensors and spinors are used to establish the form of the covariant derivative of a spinor, making use of the fact that certain bilinear combinations of spinors are vectors. The covariant forms of Dirac's equation are thus obtained and examples in specific coordinate systems are displayed. (author)
Canonical form of Euler-Lagrange equations and gauge symmetries
Energy Technology Data Exchange (ETDEWEB)
Geyer, B [Naturwissenschaftlich-Theoretisches Zentrum und Institut fuer Theoretische Physik, Universitaet Leipzig, Leipzig (Germany); Gitman, D M [Institute of Physics, University of Sao Paulo, Sao Paulo (Brazil); Tyutin, I V [Lebedev Physics Institute, Moscow (Russian Federation)
2003-06-13
The structure of the Euler-Lagrange equations for a general Lagrangian theory (e.g. singular, with higher derivatives) is studied. For these equations we present a reduction procedure to the so-called canonical form. In the canonical form the equations are solved with respect to highest-order derivatives of nongauge coordinates, whereas gauge coordinates and their derivatives enter the right-hand sides of the equations as arbitrary functions of time. The reduction procedure reveals constraints in the Lagrangian formulation of singular systems and, in that respect, is similar to the Dirac procedure in the Hamiltonian formulation. Moreover, the reduction procedure allows one to reveal the gauge identities between the Euler-Lagrange equations. Thus, a constructive way of finding all the gauge generators within the Lagrangian formulation is presented. At the same time, it is proved that for local theories all the gauge generators are local in time operators.
Directory of Open Access Journals (Sweden)
Fabricio Chicaiza
2018-03-01
Full Text Available En la actualidad los sistemas de automatización industrial deben optimizar las técnicas de control y comunicación de sus procesos, para introducir conceptos dados por la Industria 4.0. Para lograr esto se necesita de la introducción de nuevas normas de automatización para obtener sistemas de fabricación ágiles e inteligentes, es por esto que la norma IEC 61499 es considerada como la opción principal. Industria 4.0 en unión con IEC 61499 permitirá la integración de sistemas de adquisición de datos tradicionales y novedosos sistemas de procesamiento inteligente de datos, con el objetivo de extraer información y mejorar el rendimiento general del sistema productivo. El presente trabajo establece un enfoque de arquitectura flexible para el diseño de los Diagramas de Control de Ejecución de los Bloques de Función basado en la norma ISA 88 aplicado a un proceso industrial, lo que permitirá implementar el control industrial bajo IEC 61499 de manera eficiente y rápida permitiendo un diseño se software basado en componentes con independencia de la plataforma hardware usada.
Kupfer, G; Naf, D; Garcia-Higuera, I; Wasik, J; Cheng, A; Yamashita, T; Tipping, A; Morgan, N; Mathew, C G; D'Andrea, A D
1999-04-01
Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with at least eight complementation groups (A-H). Three FA genes, corresponding to complementation groups A, C, and G, have been cloned, but the function of the encoded FA proteins remains unknown. We recently demonstrated that the FANCA and FANCC proteins bind and form a nuclear complex. In the current study, we identified a homozygous mutation in the FANCA gene (3329A>C) in an Egyptian FA patient from a consanguineous family. This mutant FANCA allele is predicted to encode a mutant FANCA protein, FANCA(H1110P), in which histidine 1110 is changed to proline. Initially, we characterized the FANCA(H1110P) protein, expressed in an Epstein Barr virus (EBV)-immortalized lymphoblast line derived from the patient. Unlike wild-type FANCA protein expressed in normal lymphoblasts, FANCA(H1110P) was not phosphorylated and failed to bind to FANCC. To test directly the effect of this mutation on FANCA function, we used retroviral-mediated transduction to express either wild-type FANCA or FANCA(H1110P) protein in the FA-A fibroblast line, GM6914. Unlike wild-type FANCA, the mutant protein failed to complement the mitomycin C sensitivity of these cells. In addition, the FANCA(H1110P) protein was defective in nuclear accumulation in the transduced cells. The characteristics of this mutant protein underscore the importance of FANCA phosphorylation, FANCA/FANCC binding, and nuclear accumulation in the function of the FA pathway.
Cutts, DA; Spyrou, NM; Maguire, RP; Stedman, JD; Leenders, KL
Alzheimer's disease (AD) isa debilitating form of dementia which leads to impaired memory, thinking and behavior. This work examines elemental concentrations between "normal" and AD subjects as well as the hemispherical differences within the brain. Tissue samples from both hemispheres of the
Directory of Open Access Journals (Sweden)
Mehul Patel
2013-01-01
Full Text Available A simple, precise, rapid, and economic method was developed for the simultaneous determination of Ibuprofen and Phenylephrine HCl in bulk and combined dosage form. This method involves first-order derivative spectroscopy using 248 nm and 237 nm as zero crossing points for Ibuprofen and Phenylephrine HCl, respectively. For spectrophotometric method 0.1 N NaOH was used as a solvent. The linearity was established over the concentration range of 12–72 μg/mL and 1.5–22 μg/mL for Ibuprofen and Phenylephrine HCl with correlation coefficient (r2 of 0.9972 and 0.9981, respectively. The mean % recoveries were found to be in the range of 98.88% and 98.54% for Ibuprofen and Phenylephrine HCl, respectively. Interday and intraday studies showed repeatability of the method. The method was found to be specific and robust. The method was successfully applied to pharmaceutical formulation, with no interference from excipients as indicated by the recovery study. Results of analysis were validated statistically and by recovery studies.
Epps, Brenden; Cushman-Roisin, Benoit
2017-11-01
Fluid turbulence is an outstanding unsolved problem in classical physics, despite 120+ years of sustained effort. Given this history, we assert that a new mathematical framework is needed to make a transformative breakthrough. This talk offers one such framework, based upon kinetic theory tied to the statistics of turbulent transport. Starting from the Boltzmann equation and ``Lévy α-stable distributions'', we derive a turbulence model that expresses the turbulent stresses in the form of a fractional derivative, where the fractional order is tied to the transport behavior of the flow. Initial results are presented herein, for the cases of Couette-Poiseuille flow and 2D boundary layers. Among other results, our model is able to reproduce the logarithmic Law of the Wall in shear turbulence.
International Nuclear Information System (INIS)
Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D.M.; Conway, Barbara R.; Timmins, Peter
2007-01-01
We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2 NC(CH 3 ) 3- n (CH 2 OH) n , with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family (n=0, 1, 2), but significantly contrasting structural properties for the member with n=3. - Graphical abstract: Structural properties of a family of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine are discussed and rationalized
On derived groups of division rings II
International Nuclear Information System (INIS)
Mahdavi Hezavehi, M.; Akbari Feyzaabaadi, S.; Mehraabaadi, M.; Hajie Abolhassan, H.
1995-05-01
Let D be a division ring with centre F and denote by D' the derived group (commutator subgroup) of D * = D - {0}. It is shown that if each element of D' is algebraic over F, then D is algebraic over F. It is also proved that each finite separable extension of F in D is of the form F(c) for some element c in the derived group D'. Using these results, it is shown that if each element of the derived group D' is of bounded degree over F, then D is finite dimensional over F. (author). 5 refs
Langmuir-Blodgett Films of Graphene Derivatives
DEFF Research Database (Denmark)
Petersen, Søren Vermehren
The work presented in this PhD thesis can be divided into two main categories: 1) Syn-thesis and Langmuir-Blodgett assembly of graphene derivatives and 2) Application and characterization of graphene derivatives as an interface material in molecular electron-ics. While the first category could...... be divided further, the synthesis and Langmuir-Blodgett results are intertwined in such a way that it would be more confusing to pre-sent them separately. The Langmuir-Blodgett deposition also played a crucial, but more isolated, part in the investigation of graphene derivatives as interface material....... Solution processable graphene in the form of chemically derived graphene has been synthesized through the modified Hummers method with subsequent reduction into reduced graphene oxide with hydrazine. The completeness of oxidation, the effect of the refinement steps and the reduction of the graphene oxide...
Forming of political opinion and decision
International Nuclear Information System (INIS)
Urban, K.
1980-01-01
Taking the SNR-300 reactor in Kalkar as an example, the process of forming of political opinion and decision is reconstructed in order to get a picture of typical consensus- and conflict patterns in the discussion of safety problems. On this basis, it should be possible to derive a freedom of action for the political and administrative managing of safety matters by means of feed back with social groups. As a crucial point the aspects concerning the steps of the forming of political opinion and decision are examined. (DG) [de
Legeay, Samuel; Billat, Pierre-André; Clere, Nicolas; Nesslany, Fabrice; Bristeau, Sébastien; Faure, Sébastien; Mouvet, Christophe
2018-05-01
Chlordecone (CLD) is a chlorinated hydrocarbon insecticide, now classified as a persistent organic pollutant. Several studies have previously reported that chronic exposure to CLD leads to hepatotoxicity, neurotoxicity, raises early child development and pregnancy complications, and increases the risk of liver and prostate cancer. In situ chemical reduction (ISCR) has been identified as a possible way for the remediation of soils contaminated by CLD. In the present study, the objectives were (i) to evaluate the genotoxicity and the mutagenicity of two CLD metabolites formed by ISCR, CLD-5a-hydro, or CLD-5-hydro (5a- or 5- according to CAS nomenclature; CLD-1Cl) and tri-hydroCLD (CLD-3Cl), and (ii) to explore the angiogenic properties of these molecules. Mutagenicity and genotoxicity were investigated using the Ames's technique on Salmonella typhimurium and the in vitro micronucleus micromethod with TK6 human lymphoblastoid cells. The proangiogenic properties were evaluated on the in vitro capillary network formation of human primary endothelial cells. Like CLD, the dechlorinated derivatives of CLD studied were devoid of genotoxic and mutagenic activity. In the assay targeting angiogenic properties, significantly lower microvessel lengths formed by endothelial cells were observed for the CLD-3Cl-treated cells compared to the CLD-treated cells for two of the three tested concentrations. These results suggest that dechlorinated CLD derivatives are devoid of mutagenicity and genotoxicity and have lower proangiogenic properties than CLD.
The Prevalence Of Nasal Trauma In Uch,Ibadan - Nigeria | Isa ...
African Journals Online (AJOL)
Methods:- A one year prospective study of Nasal trauma at the University College Hospital, Ibadan, Nigeria. Results: A total of one thousand three hundred and fifty patients (1,350) with all forms of trauma presenting at UCH, Ibadan during the study period were included. Nasal trauma alone or in association with other ...
Directory of Open Access Journals (Sweden)
Emanuele D'Amico
Full Text Available Immunosuppressive agents (ISA have been used in multiple sclerosis (MS for decades, frequently as off label licensed therapies. Given the new MS treatment landscape, what place do ISA have in combating MS?We conducted a retrospective multicentre study to investigate the frequency of ISA prescription in 17 Italian MS centres, and to describe the clinical factors related to ISA use.Out of 6,447 MS patients, 2,034 (31.6% were treated with ISA, with Azathioprine being the most frequently used ISA overall. MS patients treated with ISA alone were more frequently affected by the progressive course (both primary and secondary of the disease (RRR 5.82, 95% CI 4.14-8.16, p<0.0001, had higher EDSS (RRR 3.69, 95% CI 2.61-5.21, p<0.0001, higher assignment age (RRR 1.04, 95% CI 1.03-1.06, p<0.0001 than patients treated with only disease modifying drugs (DMDs.Progressive course, higher EDSS, higher assignment age were the strongest predictors of ISA prescription and use in our population.
A QQ→QQ planar double box in canonical form
Directory of Open Access Journals (Sweden)
Marco S. Bianchi
2018-02-01
Full Text Available We consider a planar double box with four massive external momenta and two massive internal propagators. We derive the system of differential equations for the relevant master integrals, cast it in canonical form, write it as a dlog form and solve it in terms of iterated integrals up to depth four.
Hedging Yield with Weather Derivatives: A Role for Options
Manfredo, Mark R.; Richards, Timothy J.
2005-01-01
While there are few risk management alternatives available to specialty crop growers, weather derivatives provide an important advancement. As with the use of any derivatives contract, the behavior of the basis will ultimately determine the net-hedged outcome. However, when using weather derivatives to hedge yield risks for specialty crops, growers face a unique form of basis risk because weather (temperature) and yield are nonlinearly related. Using the forecast encompassing principle, this ...
Weather Derivatives – Origin, Types and Application
Directory of Open Access Journals (Sweden)
Piotr Binkowski
2008-01-01
Full Text Available The number of companies that are exposed to the revenues loss risk caused by weather variability is still increasing. The businesses that are mostly exposed to weather risk are following: energy, agriculture, constructions and transport. That situation has initiated dynamic growth of weather derivatives markets as well as the awareness of the weather risk among the market participants. Presently, the weather derivatives markets evaluate rapidly in all the mature economies: USA, Asia and Europe. Constructing weather derivatives relies on qu- antifying climate factors in the form of indexes, what is quite simple task, more difficultly can be gathering precise historical data of required climate factors. Taking into consideration so far development of derivatives especially the financial derivatives based on different types of indexes financial market has at disposal wide range of different types of proved derivatives (futures, forward, options, swaps, which can be successfully utilised on the weather-driven markets both for hedging weather risk and speculating.
Three-Dimensional Numerical Simulation of Plate Forming by Line Heating
DEFF Research Database (Denmark)
Clausen, Henrik Bisgaard
1999-01-01
addressed the problem of simulating the process, and although very few have been successful in gaining accurate results valuable information about the mechanics have been derived. However, the increasing power of computers now allows for numerical simulations of the forming process using a three......Line Heating is the process of forming (steel) plates into shape by means of localised heating often along a line. Though any focussed heat source will do, the inexpensive and widely available oxyacettylene gas torch is commonly applied in ship production.Over the years, many researchers have......-dimensional thermo-mechanical model. Although very few have been successful in gaining accurate results valuable information about the mechanics has been derived. However, the increasing power of computers now allows for numerical simulations of the forming process using a three-dimensional thermo-mechanical model....
Meteorite Dichotomy Implies that Jupiter Formed Early
Kruijer, T. S.; Burkhardt, C.; Budde, G.; Kleine, T.
2018-05-01
Meteorites derive from two distinct nebular reservoirs that co-existed and remained spatially separated between 1 and 3–4 Ma after CAIs. This can most easily be explained if Jupiter acted as a barrier and formed early, within less than 1 Ma.
Volume-preserving normal forms of Hopf-zero singularity
International Nuclear Information System (INIS)
Gazor, Majid; Mokhtari, Fahimeh
2013-01-01
A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto–Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple. (paper)
Volume-preserving normal forms of Hopf-zero singularity
Gazor, Majid; Mokhtari, Fahimeh
2013-10-01
A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto-Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple.
Second derivative spectrophotometric determination of ...
African Journals Online (AJOL)
A new, simple, rapid, wide applicable range and reliable second derivative spectrophotometric method has been developed for determination of cyclophosphamide (CP) in bulk and pharmaceutical dosage forms. Calibration graph is linear in the concentration range of 25 - 200 μg/ml of CP with 10 μg/ml of detection limit and ...
A spatial structural derivative model for ultraslow diffusion
Directory of Open Access Journals (Sweden)
Xu Wei
2017-01-01
Full Text Available This study investigates the ultraslow diffusion by a spatial structural derivative, in which the exponential function ex is selected as the structural function to construct the local structural derivative diffusion equation model. The analytical solution of the diffusion equation is a form of Biexponential distribution. Its corresponding mean squared displacement is numerically calculated, and increases more slowly than the logarithmic function of time. The local structural derivative diffusion equation with the structural function ex in space is an alternative physical and mathematical modeling model to characterize a kind of ultraslow diffusion.
On the fragility of fractional-order PID controllers for FOPDT processes.
Padula, Fabrizio; Visioli, Antonio
2016-01-01
This paper analyzes the fragility issue of fractional-order proportional-integral-derivative controllers applied to integer first-order plus-dead-time processes. In particular, the effects of the variations of the controller parameters on the achieved control system robustness and performance are investigated. Results show that this kind of controllers is more fragile with respect to the standard proportional-integral-derivative controllers and therefore a significant attention should be paid by the user in their tuning. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Sharma, Pankaj; Liu, Rai-Shung
2015-03-16
A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Free Abelian 2-form gauge theory: BRST approach
International Nuclear Information System (INIS)
Malik, R.P.
2008-01-01
We discuss various symmetry properties of the Lagrangian density of a four- (3+1)-dimensional (4D) free Abelian 2-form gauge theory within the framework of Becchi-Rouet-Stora-Tyutin (BRST) formalism. The present free Abelian gauge theory is endowed with a Curci-Ferrari type condition, which happens to be a key signature of the 4D non-Abelian 1-form gauge theory. In fact, it is due to the above condition that the nilpotent BRST and anti-BRST symmetries of our present theory are found to be absolutely anticommuting in nature. For the present 2-form theory, we discuss the BRST, anti-BRST, ghost and discrete symmetry properties of the Lagrangian densities and derive the corresponding conserved charges. The algebraic structure, obeyed by the above conserved charges, is deduced and the constraint analysis is performed with the help of physicality criteria, where the conserved and nilpotent (anti-)BRST charges play completely independent roles. These physicality conditions lead to the derivation of the above Curci-Ferrari type restriction, within the framework of the BRST formalism, from the constraint analysis. (orig.)
Semantic False Memories in the Form of Derived Relational Intrusions Following Training
Guinther, Paul M.; Dougher, Michael J.
2010-01-01
Contemporary behavior analytic research is making headway in characterizing memory phenomena that typically have been characterized by cognitive models, and the current study extends this development by producing "false memories" in the form of functional equivalence responding. A match-to-sample training procedure was administered in order to…
Design of fast kickers for the ISABELLE beam abort system
International Nuclear Information System (INIS)
Nawrocky, R.J.; Montemurro, P.A.; Baron, J.
1981-01-01
The ISA beam abort (extraction) system must be highly efficient, in the sense of producing minimum beam loss, and reliable to prevent serious damage to accelerator components by the circulating high-energy beams. Since the stored beams will be debunched, the low-loss requirement can be met only with ultra-thin extraction septa and/or fast-acting kickers. This paper examines the design of the ISA extraction kickers subject to a set of extraction channel constraints and a given maximum working voltage. Expressions are derived for determining system parameters for both a lumped parameter magnet and a delay-line magnet. Using these relationships, design parameters are worked out for several possible system configurations. The paper also describes the construction of a full-scale prototype module of the kicker and summarizes the preliminary test results obtained with the module
Beam-scanning system for determination of beam profiles and form factors in merged-beam experiments
International Nuclear Information System (INIS)
Keyser, C.J.; Froelich, H.R.; Mitchell, J.B.A.; McGowan, J.W.
1979-01-01
A beam-scanning system for a merged electron-ion beam experiment is described. This system is used to determine the horizontal and vertical beam profiles and the form factors at three different locations along the axis of the beams. Design details of the wedge-shaped scanners and the electronic circuit for obtaining beam profiles and form factors are described. The form factor derivation for merged beams is given and an expression in terms of measured quantities is derived. (author)
Parametric form of QCD travelling waves
Peschanski, R.
2005-01-01
We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.
On isochronous derivatives of the first and second order in space dynamics tasks
Bakshiyan, B. T.; Sukhanov, A. A.
1979-01-01
The first and second isochronous derivatives are calculated from the vector of state of dynamic system using its initial value. Use is made of the method of finding a fundamental solution of conjugate variational equations. This solution and the corresponding universal relationship for isochronous derivatives are found for the two-body problem in a form which is simple and suitable for computer programming. The form of these relationships was obtained for motion which differs from parabolic motion. Formulas are given for isochronous derivatives using the gravitational parameter in the two-body problem.
Form factors of heavy mesons in QCD
International Nuclear Information System (INIS)
Shifman, M.A.; Vysotsky, M.I.
1980-01-01
Logarithmic corrections to form factors of mesons built from heavy quarks are dirived in the framework of quantum chromodynamics. The reactions e + e - → etasub(c)γ and H → J/PSIγ are considered as an example. A novel feature as compared to the well studied problem of the pion form factor is the existence of the transformations between the quark-antiquark state c anti c and the gluonic one. O(αsub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms is summed up with the help of the operator technique. Apart from already known results for quark operators some new results referring to gluon operators and their mixing with the quark ones are used. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second derivation is based on conformal symmetry considerations
Yu, Zhenpeng; Wang, Jiandong
2016-09-01
This paper assesses the performance of feedforward controllers for disturbance rejection in univariate feedback plus feedforward control loops. The structures of feedback and feedforward controllers are confined to proportional-integral-derivative and static-lead-lag forms, respectively, and the effects of feedback controllers are not considered. The integral squared error (ISE) and total squared variation (TSV) are used as performance metrics. A performance index is formulated by comparing the current ISE and TSV metrics to their own lower bounds as performance benchmarks. A controller performance assessment (CPA) method is proposed to calculate the performance index from measurements. The proposed CPA method resolves two critical limitations in the existing CPA methods, in order to be consistent with industrial scenarios. Numerical and experimental examples illustrate the effectiveness of the obtained results. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Recursive parameter estimation for Hammerstein-Wiener systems using modified EKF algorithm.
Yu, Feng; Mao, Zhizhong; Yuan, Ping; He, Dakuo; Jia, Mingxing
2017-09-01
This paper focuses on the recursive parameter estimation for the single input single output Hammerstein-Wiener system model, and the study is then extended to a rarely mentioned multiple input single output Hammerstein-Wiener system. Inspired by the extended Kalman filter algorithm, two basic recursive algorithms are derived from the first and the second order Taylor approximation. Based on the form of the first order approximation algorithm, a modified algorithm with larger parameter convergence domain is proposed to cope with the problem of small parameter convergence domain of the first order one and the application limit of the second order one. The validity of the modification on the expansion of convergence domain is shown from the convergence analysis and is demonstrated with two simulation cases. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Anomaly, mixing and transition form factors of pseudoscalar mesons
International Nuclear Information System (INIS)
Klopot, Yaroslav; Oganesian, Armen; Teryaev, Oleg
2011-01-01
We derive the exact non-perturbative QCD sum rule for the transition form factors of η and η ′ using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on η,η ′ transition form factors in the range from real to highly virtual photons was obtained.
Solubilization of Phenol Derivatives in Polymer Micelles Formed by Cationic Block Copolymer
Directory of Open Access Journals (Sweden)
Irma Fuentes
2017-01-01
Full Text Available The aggregation of cationic block copolymers formed by polystyrene (PS and poly(ethyl-4-vinylpyridine (PS-b-PE4VP was studied in aqueous solution. Diblock copolymers of PS and poly(4-vinylpyridine were synthesized by sequential anionic polymerization using BuLi as initiator. Subsequently, the 4-vinylpyridine units were quaternized with ethyl bromide to obtain cationic PS-b-PE4VP block copolymers with different quaternization degree. The self-aggregation of cationic block copolymers was studied by fluorescence probing, whereas the morphology and size of polymer micelles were determined by transmission electronic microscopy. Results indicate that spherical micelles with sizes lower than 100 nm were formed, whereas their micropolarity decreases with increasing quaternization degree. The partition of phenols between the micellar and aqueous phase was studied by using the pseudo-phase model, and the results show that the partition coefficients increase with increasing length of the side alkyl chain and are larger for star micelles. These results are discussed in terms of three-region model.
Klarborg, Brith; Lahrmann, Harry; NielsAgerholm; Tradisauskas, Nerius; Harms, Lisbeth
2012-09-01
Intelligent speed adaptation (ISA) was tested as an assistive device for drivers with an acquired brain injury (ABI). The study was part of the "Pay as You Speed" project (PAYS) and used the same equipment and technology as the main study (Lahrmann et al., in press-a, in press-b). Two drivers with ABI were recruited as subjects and had ISA equipment installed in their private vehicle. Their speed was logged with ISA equipment for a total of 30 weeks of which 12 weeks were with an active ISA user interface (6 weeks=Baseline 1; 12 weeks=ISA period; 12 weeks=Baseline 2). The subjects participated in two semi-structured interviews concerning their strategies for driving with ABI and for driving with ISA. Furthermore, they gave consent to have data from their clinical journals and be a part of the study. The two subjects did not report any instances of being distracted or confused by ISA, and in general they described driving with ISA as relaxed. ISA reduced the percentage of the total distance that was driven with a speed above the speed limit (PDA), but the subjects relapsed to their previous PDA level in Baseline 2. This suggests that ISA is more suited as a permanent assistive device (i.e. cognitive prosthesis) than as a temporary training device. As ABI is associated with a multitude of cognitive deficits, we developed a conceptual framework, which focused on the cognitive parameters that have been shown to relate to speeding behaviour, namely "intention to speed" and "inattention to speeding". The subjects' combined status on the two independent parameters made up their "speeding profile". A comparison of the speeding profiles and the speed logs indicated that ISA in the present study was more efficient in reducing inattention to speeding than affecting intention to speed. This finding suggests that ISA might be more suited for some neuropsychological profiles than for others, and that customisation of ISA for different neuropsychological profiles may be required
1999-01-01
New Yorgis suri kunstnik ja koomiksite joonistaja, pärastsõja-aegse Ameerika bondage-erootika illustraator Eric Stanton. Paar aastat tagasi avaldas Saksa kirjastus Taschen Stantoni elust ja loomingust raamatu, mille toimetas erootikafotograaf Eric Kroll
A comparison of hydrogen with alternate energy forms from coal and nuclear energy
International Nuclear Information System (INIS)
Cox, K.E.
1976-01-01
Alternate energy forms that can be produced from coal and nuclear energy have been analyzed on efficiency, economic and end-use grounds. These forms include hydrogen, methane, electricity, and EVA-ADAM, a 'chemical heat pipe' approach to energy transmission. The EVA-ADAM system for nuclear heat appears to be economically competitive with the other energy carriers except over very large distances. The cost of hydrogen derived from coal is approximately equal to that of methane derived from the same source when compared on an equal BTU basis. Thermochemically derived hydrogen from nuclear energy shows a break-even range with hydrogen derived from coal at coal costs of from Pound33 to 80/ton depending on the cost of nuclear heat. Electricity and electrolytically derived hydrogen are the most expensive energy carriers and electricity's use should be limited to applications involving work rather than heat. Continued work in thermochemical hydrogen production schemes should be supported as an energy option for the future. (author)
The Pricing of Traffic Light Options and other Correlation Derivatives
DEFF Research Database (Denmark)
Kokholm, Thomas
This paper considers the valuation of European style derivatives with payoffs depending on both a stock index and underlying LIBOR rates. The model has the attractive feature that it is based on observable market quantities which makes it very easy to calibrate. A closed form solution is derived...... for the price of the correlation derivative known as the traffic light option under lognormality assumptions for the underlying processes. A pricing approach for more general payoffs is presented, and an illustration is performed with Monte Carlo simulation by the pricing of a specific hybrid derivative...
Medium modifications of nucleon electromagnetic form factors
Energy Technology Data Exchange (ETDEWEB)
Horikawa, T. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan); Bentz, W. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan)]. E-mail: bentz@keyaki.cc.u-tokai.ac.jp
2005-11-28
We use the Nambu-Jona-Lasinio model as an effective quark theory to investigate the medium modifications of the nucleon electromagnetic form factors. By using the equation of state of nuclear matter derived in this model, we discuss the results based on the naive quark-scalar diquark picture, the effects of finite diquark size, and the meson cloud around the constituent quarks. We apply this description to the longitudinal response function for quasielastic electron scattering. RPA correlations, based on the nucleon-nucleon interaction derived in the same model, are also taken into account in the calculation of the response function.
International Nuclear Information System (INIS)
Kusakabe, Koichi
2009-01-01
To construct an optimization scheme for an extension of the Kohn-Sham approach, I introduce an operator form of the Coulomb interaction. This form is the sum of quadratic form pairs, which can be redefined in a self-consistent calculation of a multi-reference density functional theory. A detailed derivation of the form is given. A fluctuation term introduced in the extended Kohn-Sham scheme is expressed in this form for regularization. The present procedure also provides an exact derivation of effective negative interactions in charge fluctuation channels. Relevance to high-temperature superconductors is discussed.
The COS Method : An Efficient Fourier Method for Pricing Financial Derivatives
Fang, F.
2010-01-01
When valuing and risk-managing financial derivatives, practitioners demand fast and accurate prices and sensitivities. Aside from the pricing of non-standard exotic financial derivatives, so-called plain vanilla European options form the basis for the calibration of financial models. As any pricing
Dispersive analysis of the pion transition form factor
Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.
2014-11-01
We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.
Przybylski, Piotr; Pyta, Krystian; Klich, Katarzyna; Schilf, Wojciech; Kamieński, Bohdan
2014-01-01
(13)C, (15)N CP/MAS, including (1)H-(13)C and (1)H-(15)N short contact time CP/MAS experiments, and FTIR methods were applied for detailed structural characterization of ansa-macrolides as 3-formylrifamycin SV (1) and its derivatives (2-6) in crystal and in powder forms. Although HPLC chromatograms for 2/CH3 OH and 2/CH3 CCl3 were the same for rifampicin crystals dissolved in respective solvents, the UV-vis data recorded for them were different in 300-375 nm region. Detailed solid state (13)C and (15)N CP/MAS NMR and FTIR studies revealed that rifampicin (2), in contrast to 3-formylrifamycin SV (1) and its amino derivatives (3-6), can occur in pure non-ionic or zwitterionic forms in crystal and in pure these forms or a mixture of them in a powder. Multinuclear CP/MAS and FTIR studies demonstrated also that 3-6 derivatives were present exclusively in pure zwitterionic forms, both in powder and in crystal. On the basis of the solid state NMR and FTIR studies, two conformers of 3-formylrifamycin SV were detected in powder form due to the different orientations of carbonyl group of amide moiety. The PM6 molecular modeling at the semi-empirical level of theory, allowed visualization the most energetically favorable non-ionic and zwitterionic forms of 1-6 antibiotics, strongly stabilized via intramolecular H-bonds. FTIR studies indicated that the originally adopted forms of these type antibiotics in crystal or in powder are stable in standard laboratory conditions in time. The results presented point to the fact that because of a possible presence of two forms of rifampicin (compound 2), quantification of the content of this antibiotic in relevant pharmaceuticals needs caution. Copyright © 2013 John Wiley & Sons, Ltd.
Electromagnetic form factors of a massive neutrino
International Nuclear Information System (INIS)
Dvornikov, M.S.; Studenikin, A.I.
2004-01-01
Electromagnetic form factors of a massive neutrino are studied in a minimally extended standard model in an arbitrary R ξ gauge and taking into account the dependence on the masses of all interacting particles. The contribution from all Feynman diagrams to the electric, magnetic, and anapole form factors, in which the dependence of the masses of all particles as well as on gauge parameters is accounted for exactly, are obtained for the first time in explicit form. The asymptotic behavior of the magnetic form factor for large negative squares of the momentum of an external photon is analyzed and the expression for the anapole moment of a massive neutrino is derived. The results are generalized to the case of mixing between various flavors of the neutrino. Explicit expressions are obtained for the electric, magnetic, and electric dipole and anapole transitional form factors as well as for the transitional electric dipole moment
Remarks on the microscopic derivation of the collective model
International Nuclear Information System (INIS)
Toyoda, T.; Wildermuth, K.
1984-01-01
The rotational part of the phenomenological collective model of Bohr and Mottelson and others is derived microscopically, starting with the Schrodinger equation written in projection form and introducing a new set of 'relative Euler angles'. In order to derive the local Schrodinger equation of the collective model, it is assumed that the intrinsic wave functions give strong peaking properties to the overlapping kernels
Enantiomer excesses of rare and common sugar derivatives in carbonaceous meteorites
Cooper, George; Rios, Andro C.
2016-01-01
The majority of biological sugars and their derivatives contain higher abundances of the “d” mirror-image forms relative to the “l” forms. For example, nucleic acids are composed of only d sugars. Carbonaceous meteorites can potentially assist in understanding the long-sought origin of such phenomena; They preserve a record of the earliest (∼4.5 Gy) chemical processes in the Solar System. To date, there have been no systematic studies of d/l (i.e., enantiomer) ratios of meteoritic sugar deriv...
Directory of Open Access Journals (Sweden)
Luca Doglione
2010-01-01
Full Text Available Egg quality traits and some blood parameters of Bianca di Saluzzo hen (BSh were compared to Isa Brown hen (IBh. Birds were reared in free range conditions. Weightofthewholeegg Weight of the whole egg was higher (P≤0.01 for IBh, due to its higher amount of albumen (P≤0.01 whereas BSh egg showed the highest weight and relative percentage of yolk (PP≤0.01. IBh and BSh egg chemical composition was similar.Totalredcellsdidnotshowstatisticaldifferencesbetweengroups,whiletotalleucocytes Total red cells did not show statistical differences between groups, while total leucocytes were lower (P≤0.05 forBShhens. Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P for BSh hens. Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P . Heterophyl/Lymphocyte(H/L ratioof BShwaslower (P Heterophyl/Lymphocyte (H/L ratio of BSh was lower (P (PP≤0.01 than IBh(0.33 IBh (0.33 (0.33 vs. 0.82.IBh 0.82. IBh IBh α-1 acid glycoprotein (AGPmeanconcentrationswereaffectedbytime: (AGP mean concentrations were affected by time: the values registered after 15 d (T1 and 2 months (T2 of observation were similar (345±132 and 279±58 μg/mlrespectively,whileAGPvalueregisteredafter4months(T3weresignificantlyhigher μg/ml respectively,whileAGPvalueregisteredafter4months(T3weresignificantlyhigher , while AGP value registered after 4 months (T3 were significantly higher (700±487 μg/ml;BShdidnotdisplayanyAGPstatisticalvariationovertime.IBhalbuminmeancon- μg/ml; BShdidnotdisplayanyAGPstatisticalvariationovertime.IBhalbuminmeancon- BSh did not display any AGP statistical variation over time. IBh albumin mean con- centration (1.62 g/dL was statistically lower than BSh values (1.89 g/dL; in both groups no effect of time of sampling was recorded. Acutephaseprotein(APPvaluesofBShsuggestedamoreadaptive Acute phase protein (APPvaluesofBShsuggestedamoreadaptive (APP values of BSh suggested a more adaptive attitude to free range conditions and appeared more constant over time. The present
Anomaly, mixing and transition form factors of pseudoscalar mesons
Energy Technology Data Exchange (ETDEWEB)
Klopot, Yaroslav, E-mail: klopot@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Oganesian, Armen, E-mail: armen@itep.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Institute of Theoretical and Experimental Physics, B. Cheremushkinskaya 25, Moscow 117218 (Russian Federation); Teryaev, Oleg, E-mail: teryaev@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation)
2011-10-15
We derive the exact non-perturbative QCD sum rule for the transition form factors of {eta} and {eta}{sup Prime} using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on {eta},{eta}{sup Prime} transition form factors in the range from real to highly virtual photons was obtained.
DEVELOPMENT OF DERIVATIVE MARKET IN 2000-2012
Directory of Open Access Journals (Sweden)
Evgeniya V. Vasina
2014-01-01
Full Text Available At the end of XIX century futures exchange emerged, in the early 70-ies XX century - option exchange of financial derivatives. These exchanges gave a huge boost to the development of market of the operations with derivative financial instruments. In fact, in the 1970-1980-ies a new market segment was actually formed - the stock and financial derivatives. Trade in financial derivatives began in the OTC market, which accounts for most of the trade of derivatives. Today volumes of the OTC market of derivatives are several times greater than the volume of world trade and world GDP. From 2000 to 2007 derivative OTC market grew rapidly. In 2007-2008 there is a decline in trade of derivatives, but already in 2009 the world market of OTC derivatives returned to pre-crisis growth rates. Among all the instruments of the OTC market of derivatives swaps on interest rates stand out in the volumes, which even in the crisis of2007-2008 slightly, but increased. Analysis of indicators of the global OTC market of derivatives reveals the predominance of instruments on interest rates: their share in the total world market in 2012 amounted to about 77%. If we consider the structure of the OTC market of derivatives on type contracts, in 2012 most of the contracts (66% belonged to the swaps. As regards the structure of the world market of exchange derivatives, in 2012 the options had the largest share - 54 %, futures accounted for 46 %. Among all the exchange instruments on interest rates held 92%.
Development Of Derivative Market In 2000-2012
Directory of Open Access Journals (Sweden)
Evgeniya V. Vasina
2014-01-01
Full Text Available At the end of XIX century futures exchange emerged, in the early 70-ies XX century - option exchange of financial derivatives. These exchanges gave a huge boost to the development of market of the operations with derivative financial instruments. In fact, in the 1970-1980-ies a new market segment was actually formed - the stock and financial derivatives. Trade in financial derivatives began in the OTC market, which accounts for most of the trade of derivatives. Today volumes of the OTC market of derivatives are several times greater than the volume of world trade and world GDP. From 2000 to 2007 derivative OTC market grew rapidly. In 2007-2008 there is a decline in trade of derivatives, but already in 2009 the world market of OTC derivatives returned to pre-crisis growth rates. Among all the instruments of the OTC market of derivatives swaps on interest rates stand out in the volumes, which even in the crisis of2007-2008 slightly, but increased. Analysis of indicators of the global OTC market of derivatives reveals the predominance of instruments on interest rates: their share in the total world market in 2012 amounted to about 77%. If we consider the structure of the OTC market of derivatives on type contracts, in 2012 most of the contracts (66% belonged to the swaps. As regards the structure of the world market of exchange derivatives, in 2012 the options had the largest share - 54 %, futures accounted for 46 %. Among all the exchange instruments on interest rates held 92%.
Hyperon decay form factors in chiral perturbation theory
International Nuclear Information System (INIS)
Lacour, Andre; Kubis, Bastian; Meissner, Ulf-G.
2007-01-01
We present a complete calculation of the SU(3)-breaking corrections to the hyperon vector form factors up to O(p 4 ) in covariant baryon chiral perturbation theory. Partial higher-order contributions are obtained, and we discuss chiral extrapolations of the vector form factor at zero momentum transfer. In addition we derive low-energy theorems for the subleading moments in hyperon decays, the weak Dirac radii and the weak anomalous magnetic moments, up to O(p 4 )
Dysphagia due to diffuseidiopathic skeletal hyperostosis (DISH ...
African Journals Online (AJOL)
Diffuse idiopathic skeletal hyperostosis (DISH) or Forestier's disease isa form of degenerative arthritiswith unique spinal and extra spinal manifestations. Dysphagia due to DISH is uncommon but when present DISH should be suspected. Surgical decompression can relieve some of the symptoms. We report a case of a 60 ...
Highly-Integrated Hydraulic Smart Actuators and Smart Manifolds for High-Bandwidth Force Control
Directory of Open Access Journals (Sweden)
Victor Barasuol
2018-06-01
Full Text Available Hydraulic actuation is the most widely used alternative to electric motors for legged robots and manipulators. It is often selected for its high power density, robustness and high-bandwidth control performance that allows the implementation of force/impedance control. Force control is crucial for robots that are in contact with the environment, since it enables the implementation of active impedance and whole body control that can lead to a better performance in known and unknown environments. This paper presents the hydraulic Integrated Smart Actuator (ISA developed by Moog in collaboration with IIT, as well as smart manifolds for rotary hydraulic actuators. The ISA consists of an additive-manufactured body containing a hydraulic cylinder, servo valve, pressure/position/load/temperature sensing, overload protection and electronics for control and communication. The ISA v2 and ISA v5 have been specifically designed to fit into the legs of IIT’s hydraulic quadruped robots HyQ and HyQ-REAL, respectively. The key features of these components tackle 3 of today’s main challenges of hydraulic actuation for legged robots through: (1 built-in controllers running inside integrated electronics for high-performance control, (2 low-leakage servo valves for reduced energy losses, and (3 compactness thanks to metal additive manufacturing. The main contributions of this paper are the derivation of the representative dynamic models of these highly integrated hydraulic servo actuators, a control architecture that allows for high-bandwidth force control and their experimental validation with application-specific trajectories and tests. We believe that this is the first work that presents additive-manufactured, highly integrated hydraulic smart actuators for robotics.
Directory of Open Access Journals (Sweden)
Mansour Arab Chamjangali
2016-06-01
Full Text Available Electrochemical oxidation of the catechols 1a and 1b is studied in the presence of 6-methyl-2-thouracil (3b and 6-propyl-2-thiouracil (3a as nucleophiles in a phosphate buffer (0.15 mol L−1, pH = 6.8/DMF (95:5 solution using cyclic voltammetry and controlled-potential coulometry. The results obtained indicate that the quinones derived from the catechols participate in 1,4-Michael-addition reactions with the nucleophiles to form the corresponding new benzothiazole compounds. In this work, we derive a variety of products with good yields using controlled potential at graphite electrodes in an undivided cell. This work is licensed under a Creative Commons Attribution 4.0 International License.
Fosaprepitant-induced phlebitis: a focus on patients receiving doxorubicin/cyclophosphamide therapy.
Leal, A D; Kadakia, K C; Looker, S; Hilger, C; Sorgatz, K; Anderson, K; Jacobson, A; Grendahl, D; Seisler, D; Hobday, T; Loprinzi, Charles L
2014-05-01
The purpose of this study was to investigate the incidence of fosaprepitant-associated infusion site adverse events (ISAEs) among a cohort of breast cancer patients receiving doxorubicin/cyclophosphamide (AC) chemotherapy. A retrospective review of electronic medical record (EMR) data was performed for all patients who were initiated on AC from January 2011 to April 2012. Data collected included baseline demographics, antiemetic regimen, documentation of ISAEs, and type of intravenous (IV) access. Descriptive statistics (mean and standard deviation or percentages) were summarized overall, by type of IV access and initial antiemetic given. Among the 148 patients included in this analysis, 98 initially received fosaprepitant and 44 received aprepitant. The incidence of ISAEs associated with fosaprepitant administration was 34.7 % (n=34), while the incidence of aprepitant-associated ISAEs was 2.3 % (n=1). All ISAEs were associated with peripheral IV access. The most commonly reported ISAEs were infusion site pain (n=26), erythema (n=22), swelling (n=12), superficial thrombosis (n=8), infusion site hives (n=5), and phlebitis/thrombophlebitis (n=5). Twenty-six patients experienced more than one type of ISAE. The incidence and severity of ISAEs associated with fosaprepitant administration among a group of patients receiving AC chemotherapy are significant and appreciably higher than what has been previously reported.
International Nuclear Information System (INIS)
Loon, L.R. van; Glaus, M.A.
1998-08-01
For more than ten years, cellulose degradation has been regarded as an important process which can adversely effect the sorption of radionuclides on cement in a radioactive waste repository. However, so far, it was not possible to quantify this effect. This study reports new experimental data on alkaline degradation of cellulose, together with a re-evaluation of old literature data. For the first time now, it becomes possible to quantitatively estimate the potential role of cellulose degradation in performance assessment studies. In the first part of this study, a literature overview of other studies on alkaline degradation of cellulose is given, together with a general discussion on the effect of organic ligands on the sorption of radionuclides. Further, an overview of the important mechanisms of alkaline degradation of cellulose and some kinetic aspects of the main reactions taking place is presented. The relevance of the processes for performance assessment is explained in detail. The discussion forms the starting-point for a detailed experimental program for evaluating the role of alkaline degradation of cellulose in performance assessment. In the second part, experimental studies on alkaline degradation are presented. Different cellulosic materials were degraded in an artificial cement pore water, representing the first stage of cement degradation. The most important degradation products (α- and β-isosaccharinic acid) were characterised and the results compared with other studies. Kinetic parameters for the main reactions were measured and discussed. A good agreement was found between the measured values and values extrapolated from the literature. The solubility of the sparingly soluble Ca-salt of α-isosaccharinic acid (ISA) was studied as well as the interaction of ISA with cement. Sorption of ISA on cement can keep the ISA concentration in the pore water of a repository at a low level. The effect of pure ISA and degradation products on the sorption of
Energy Technology Data Exchange (ETDEWEB)
Loon, L.R. van; Glaus, M A
1998-08-01
For more than ten years, cellulose degradation has been regarded as an important process which can adversely effect the sorption of radionuclides on cement in a radioactive waste repository. However, so far, it was not possible to quantify this effect. This study reports new experimental data on alkaline degradation of cellulose, together with a re-evaluation of old literature data. For the first time now, it becomes possible to quantitatively estimate the potential role of cellulose degradation in performance assessment studies. In the first part of this study, a literature overview of other studies on alkaline degradation of cellulose is given, together with a general discussion on the effect of organic ligands on the sorption of radionuclides. Further, an overview of the important mechanisms of alkaline degradation of cellulose and some kinetic aspects of the main reactions taking place is presented. The relevance of the processes for performance assessment is explained in detail. The discussion forms the starting-point for a detailed experimental program for evaluating the role of alkaline degradation of cellulose in performance assessment. In the second part, experimental studies on alkaline degradation are presented. Different cellulosic materials were degraded in an artificial cement pore water, representing the first stage of cement degradation. The most important degradation products ({alpha}- and {beta}-isosaccharinic acid) were characterised and the results compared with other studies. Kinetic parameters for the main reactions were measured and discussed. A good agreement was found between the measured values and values extrapolated from the literature. The solubility of the sparingly soluble Ca-salt of {alpha}-isosaccharinic acid (ISA) was studied as well as the interaction of ISA with cement. Sorption of ISA on cement can keep the ISA concentration in the pore water of a repository at a low level. The effect of pure ISA and degradation products on the
Current interactions from the one-form sector of nonlinear higher-spin equations
Gelfond, O. A.; Vasiliev, M. A.
2018-06-01
The form of higher-spin current interactions in the sector of one-forms is derived from the nonlinear higher-spin equations in AdS4. Quadratic corrections to higher-spin equations are shown to be independent of the phase of the parameter η = exp iφ in the full nonlinear higher-spin equations. The current deformation resulting from the nonlinear higher-spin equations is represented in the canonical form with the minimal number of space-time derivatives. The non-zero spin-dependent coupling constants of the resulting currents are determined in terms of the higher-spin coupling constant η η bar . Our results confirm the conjecture that (anti-)self-dual nonlinear higher-spin equations result from the full system at (η = 0) η bar = 0.
Directory of Open Access Journals (Sweden)
Meta Roestenberg
Full Text Available Plasmodium falciparum Apical Membrane Antigen 1 (PfAMA1 is a candidate vaccine antigen expressed by merozoites and sporozoites. It plays a key role in red blood cell and hepatocyte invasion that can be blocked by antibodies.We assessed the safety and immunogenicity of recombinant PfAMA1 in a dose-escalating, phase Ia trial. PfAMA1 FVO strain, produced in Pichia pastoris, was reconstituted at 10 microg and 50 microg doses with three different adjuvants, Alhydrogel, Montanide ISA720 and AS02 Adjuvant System. Six randomised groups of healthy male volunteers, 8-10 volunteers each, were scheduled to receive three immunisations at 4-week intervals. Safety and immunogenicity data were collected over one year. Transient pain was the predominant injection site reaction (80-100%. Induration occurred in the Montanide 50 microg group, resulting in a sterile abscess in two volunteers. Systemic adverse events occurred mainly in the AS02 groups lasting for 1-2 days. Erythema was observed in 22% of Montanide and 59% of AS02 group volunteers. After the second dose, six volunteers in the AS02 group and one in the Montanide group who reported grade 3 erythema (>50 mm were withdrawn as they met the stopping criteria. All adverse events resolved. There were no vaccine-related serious adverse events. Humoral responses were highest in the AS02 groups. Antibodies showed activity in an in vitro growth inhibition assay up to 80%. Upon stimulation with the vaccine, peripheral mononuclear cells from all groups proliferated and secreted IFNgamma and IL-5 cytokines.All formulations showed distinct reactogenicity profiles. All formulations with PfAMA1 were immunogenic and induced functional antibodies.(Clinicaltrials.gov NCT00730782.
Directory of Open Access Journals (Sweden)
Albratty Mohammed
2017-03-01
Full Text Available 2-Cyano-N-(thiazol-2-yl acetamide (2a and 2-cyano-N-(oxazol- 2-yl acetamide (2b were obtained via the reaction of ethyl cyanoacetate with either 2-aminothiazole (1a or 2-aminooxazole (1b. The formed products were directed toward the reaction with cyclopentanone and elemental sulfur in the presence of triethylamine to give cyclopenta[b]thiophene derivatives (3a,b. The latter products were reacted with either ethyl cyanoacetate or malononitrile to form compounds 4a,b and 5a,b, respectively. Compounds 4a,b were aimed at synthesizing some heterocyclic compounds; thus internal cyclization reactions were introduced to form compounds 6a,b. Also, compounds 4a,b reacted with salicylaldehyde, hydrazine derivatives and either urea or thiourea to produce coumarin derivatives (7a,b, pyrazole derivatives (8a-d and pyrimidine derivatives (9a-d, respectively. Reaction of either benzaldehyde or benzene diazonium chloride (11 with compounds 4a,b afforded compounds 10a,b and 12a,b, respectively. On the other hand, compounds 5a,b underwent internal cyclization to form pyrimidine derivatives 13a,b. Also, when compounds 5a,b reacted with either ethyl cyanoacetate or malononitrile, they gave pyridine derivatives (15a-d through the formation of intermediates (14a-d. Finally, formation of fused pyrimidine derivatives (17a,b was achieved through the reaction of compounds 5a,b and salicylaldehyde applying two different pathways. The first pathway used a catalytic amount of piperidine to form compounds 16a,b; the latter products underwent cyclization to give compounds 17a,b. The second pathway, using a catalytic amount of sodium ethoxide solution directly in one step, afforded compounds 17a,b. Structures of the newly synthesized compounds were established using IR, 1H NMR, 13C NMR and mass spectrometry and their antitumor activity was investigated. Some of these compounds showed promising inhibitory effects on three different cell lines. However, fused pyrimidine
International Nuclear Information System (INIS)
McKenzie, W.F.
1992-08-01
The thermodynamic properties of secondary phases observed to form during nuclear waste glass-water interactions are of particular interest as it is with the application of these properties together with the thermodynamic properties of other solid phases, fluid phases, and aqueous species that one may predict the environmental consequences of introducing radionuclides contained in the glass into groundwater at a high-level nuclear waste repository. The validation of these predicted consequences can be obtained from laboratory experiments and field observations at natural analogue sites. The purpose of this report is to update and expand the previous compilation (McKenzie, 1991) of thermodynamic data retrieved from the literature and/or estimated for secondary phases observed to form (and candidate phases from observed chemical compositions) during nuclear waste glass-water interactions. In addition, this report includes provisionally recommended thermodynamic data of secondary phases
Estimation of Ship Motions Using Closed-Form Expressions
DEFF Research Database (Denmark)
Jensen, Jørgen Juncher; Mansour, A.E.; Olsen, Anders Smærup
2004-01-01
A semi-analytical approach is used to derive frequency response functions for the wave-induced motions for monohull ships. The results are given as closed-form expressions and the required input information for the procedure is restricted to the main dimensions: Length, breadth, draught, block...
Absorption and emission spectroscopic characterization of 10-phenyl-isoalloxazine derivatives
International Nuclear Information System (INIS)
Shirdel, J.; Penzkofer, A.; Prochazka, R.; Daub, J.; Hochmuth, E.; Deutzmann, R.
2006-01-01
The flavoquinone dyes 10-phenyl-isoalloxazine-3-acetic acid ethyl ester (1) and 10-(4-bromo-phenyl)-3-methyl-isoalloxazine (2) in dichloromethane, acetonitrile, and methanol are characterized by absorption and emission spectroscopy. Absorption cross-section spectra, stimulated emission cross-section spectra, fluorescence quantum distributions, quantum yields, lifetimes, and degrees of fluorescence polarization are determined. The blue-light photo-degradation of the dyes is studied. Mass spectroscopic measurements reveal the formation of phenyl-benzo-pteridine (isoalloxazine) derivatives, tetraaza-benzo-aceanthrylene derivatives, dihydro-quinooxaline derivatives, and pyrazino-carbazole derivatives. An enhancement of photo-degradation is observed by the formed photo-fragments
Airy asymptotics: the logarithmic derivative and its reciprocal
International Nuclear Information System (INIS)
Kearney, Michael J; Martin, Richard J
2009-01-01
We consider the asymptotic expansion of the logarithmic derivative of the Airy function Ai'(z)/Ai(z), and also its reciprocal Ai(z)/Ai'(z), as |z| → ∞. We derive simple, closed-form solutions for the coefficients which appear in these expansions, which are of interest since they are encountered in a wide variety of problems. The solutions are presented as Mellin transforms of given functions; this fact, together with the methods employed, suggests further avenues for research.
Imulation of polymer forming processes - addressing industrial needs
International Nuclear Information System (INIS)
Thibault, F.; DiRaddo, R.
2011-01-01
The objective of this paper is to present the development of simulation and design optimization capabilities, for polymer forming processes, in the context of addressing industrial needs. Accomplishments generated from close to twenty years of research in this field, at the National Research Council (NRC), are presented. Polymer forming processes such as extrusion blow moulding, stretch blow moulding and thermoforming have been the focus of the work, yet the research is extendable to similar polymer forming operations such as micro-blow moulding, sheet blow moulding and composites stamping. The research considers material models, process sequence integration and design optimization, derivative processes and 3D finite elements with multi-body contact.
Optimal Mortgage Refinancing: A Closed Form Solution.
Agarwal, Sumit; Driscoll, John C; Laibson, David I
2013-06-01
We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least [Formula: see text] In this formula W (.) is the Lambert W -function, [Formula: see text] ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods.
Acidity and Structure of Isosaccharinate in Aqueous Solution: A Nuclear Magnetic Resonance Study
International Nuclear Information System (INIS)
Cho, Herman M.; Rai, Dhanpat; Hess, Nancy J.; Xia, Yuanxian; Rao, Linfeng
2003-01-01
Dilute aqueous solutions of the calcium and sodium salts of -D-isosaccharinate (ISA) have been analyzed by 13C and 1H NMR spectroscopy. The positions of the six 13C ISA NMR lines show a pH dependence that can be used to infer that the most acidic proton is the one associated with the carboxylate group, with a log k0 of -3.27 - -3.36 for the reaction H(ISA) H+ K ISA-
Alternative Electrochemical Salt Waste Forms, Summary of FY/CY2011 Results
International Nuclear Information System (INIS)
Riley, Brian J.; McCloy, John S.; Crum, Jarrod V.; Rodriguez, Carmen P.; Windisch, Charles F.; Lepry, William C.; Matyas, Josef; Westman, Matthew P.; Rieck, Bennett T.; Lang, Jesse B.; Pierce, David A.
2011-01-01
This report summarizes the 2011 fiscal+calendar year efforts for developing waste forms for a spent salt generated in reprocessing nuclear fuel with an electrochemical separations process. The two waste forms are tellurite (TeO2-based) glasses and sol-gel-derived high-halide mineral analogs to stable minerals found in nature.
Alternative Electrochemical Salt Waste Forms, Summary of FY/CY2011 Results
Energy Technology Data Exchange (ETDEWEB)
Riley, Brian J.; McCloy, John S.; Crum, Jarrod V.; Rodriguez, Carmen P.; Windisch, Charles F.; Lepry, William C.; Matyas, Josef; Westman, Matthew P.; Rieck, Bennett T.; Lang, Jesse B.; Pierce, David A.
2011-12-01
This report summarizes the 2011 fiscal+calendar year efforts for developing waste forms for a spent salt generated in reprocessing nuclear fuel with an electrochemical separations process. The two waste forms are tellurite (TeO2-based) glasses and sol-gel-derived high-halide mineral analogs to stable minerals found in nature.
On some new properties of fractional derivatives with Mittag-Leffler kernel
Baleanu, Dumitru; Fernandez, Arran
2018-06-01
We establish a new formula for the fractional derivative with Mittag-Leffler kernel, in the form of a series of Riemann-Liouville fractional integrals, which brings out more clearly the non-locality of fractional derivatives and is easier to handle for certain computational purposes. We also prove existence and uniqueness results for certain families of linear and nonlinear fractional ODEs defined using this fractional derivative. We consider the possibility of a semigroup property for these derivatives, and establish extensions of the product rule and chain rule, with an application to fractional mechanics.
2010-04-01
... and trading of new derivative securities products by self-regulatory organizations that are not deemed... listing and trading of new derivative securities products by self-regulatory organizations that are not... self-regulatory organization's listing and trading of a new derivative securities product that is not...
Analytical evaluation of atomic form factors: Application to Rayleigh scattering
Energy Technology Data Exchange (ETDEWEB)
Safari, L., E-mail: laleh.safari@ist.ac.at [IST Austria (Institute of Science and Technology Austria), Am Campus 1, 3400 Klosterneuburg (Austria); Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Santos, J. P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Amaro, P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Physikalisches Institut, Universität Heidelberg, D-69120 Heidelberg (Germany); Jänkälä, K. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Fratini, F. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Institute of Atomic and Subatomic Physics, TU Wien, Stadionallee 2, 1020 Wien (Austria); Departamento de Física, Instituto de Ciências Exatas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG (Brazil)
2015-05-15
Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.
Silsesquioxane-derived ceramic fibres
Hurwitz, F. I.; Farmer, S. C.; Terepka, F. M.; Leonhardt, T. A.
1991-01-01
Fibers formed from blends of silsesquioxane polymers were characterized to study the pyrolytic conversion of these precursors to ceramics. The morphology of fibers pyrolyzed to 1400 C revealed primarily amorphous glasses whose conversion to beta-SiC is a function of both blend composition and pyrolysis conditions. Formation of beta-SiC crystallites within the glassy phase is favored by higher than stoichiometric C/Si ratios, while carbothermal reduction of Si-O bonds to form SiC with loss of SiO and CO occurs at higher methyl/phenylpropyl silsesquioxane (lower C/Si) ratios. As the carbothermal reduction is assumed to be diffusion controlled, the fibers can serve as model systems to gain understanding of the silsesquioxane pyrolysis behavior, and therefore are useful in the development of polysilsesquioxane-derived ceramic matrices and coatings as well.
Calculus of tensors and differential forms
Sinha, Rajnikant
2014-01-01
Calculus of tensors and differential forms is an introductory-level textbook. Through this book, students will familiarize themselves with tools they need in order to use for further study on general relativity and research, such as affine tensors, tensor calculus on manifolds, relative tensors, Lie derivatives, wedge products, differential forms, and Stokes' theorem. The treatment is concrete and in detail, so that abstract concepts do not deter even physics and engineering students. This self contained book requires undergraduate-level calculus of several variables and linear algebra as prerequisite. Fubini's theorem in real analysis, to be used in Stokes' theorem, has been proved earlier than Stokes' theorem so that students don't have to search elsewhere.
The integral form of supergravity
Energy Technology Data Exchange (ETDEWEB)
Castellani, L. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy); Catenacci, R. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); Gruppo Nazionale di Fisica Matematica, INdAM,P.le Aldo Moro 5, 00185 Roma (Italy); Grassi, P.A. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy)
2016-10-11
By using integral forms we derive the superspace action of D=3,N=1 supergravity as an integral on a supermanifold. The construction is based on target space picture changing operators, here playing the rôle of Poincaré duals to the lower-dimensional spacetime surfaces embedded into the supermanifold. We show how the group geometrical action based on the group manifold approach interpolates between the superspace and the component supergravity actions, thus providing another proof of their equivalence.
The derivative-free Fourier shell identity for photoacoustics.
Baddour, Natalie
2016-01-01
In X-ray tomography, the Fourier slice theorem provides a relationship between the Fourier components of the object being imaged and the measured projection data. The Fourier slice theorem is the basis for X-ray Fourier-based tomographic inversion techniques. A similar relationship, referred to as the 'Fourier shell identity' has been previously derived for photoacoustic applications. However, this identity relates the pressure wavefield data function and its normal derivative measured on an arbitrary enclosing aperture to the three-dimensional Fourier transform of the enclosed object evaluated on a sphere. Since the normal derivative of pressure is not normally measured, the applicability of the formulation is limited in this form. In this paper, alternative derivations of the Fourier shell identity in 1D, 2D polar and 3D spherical polar coordinates are presented. The presented formulations do not require the normal derivative of pressure, thereby lending the formulas directly adaptable for Fourier based absorber reconstructions.
WEATHER INDEX- THE BASIS OF WEATHER DERIVATIVES
Directory of Open Access Journals (Sweden)
Botos Horia Mircea
2011-07-01
Full Text Available This paper approaches the subject of Weather Derivatives, more exactly their basic element the weather index. The weather index has two forms, the Heating Degree Day (HDD and the Cooling Degree Day (CDD. We will try to explain their origin, use and the relationship between the two forms of the index. In our research we started from the analysis of the weather derivatives and what they are based on. After finding out about weather index, we were interested in understanding exactly how they work and how they influence the value of the contract. On the national level the research in the field is scares, but foreign materials available. The study for this paper was based firstly on reading about Weather Derivative, and then going in the meteorogical field and determining the way by which the indices were determined. After this, we went to the field with interest in the indices, such as the energy and gas industries, and figured out how they determined the weather index. For the examples we obtained data from the weather index database, and calculated the value for the period. The study is made on a period of five years, in 8 cities of the European Union. The result of this research is that we can now understand better the importance of the way the indices work and how they influence the value of the Weather Derivatives. This research has an implication on the field of insurance, because of the fact that weather derivative are at the convergence point of the stock markets and the insurance market. The originality of the paper comes from the personal touch given to the theoretical aspect and through the analysis of the HDD and CDD index in order to show their general behaviour and relationship.
Linking Equilibrium and Nonequilibrium Dynamics in Glass-Forming Systems
DEFF Research Database (Denmark)
Mauro, John C.; Guo, Xiaoju; Smedskjær, Morten Mattrup
, we show that the nonequilibrium glassy dynamics are intimately connected with the equilibrium liquid dynamics. This is accomplished by deriving a new functional form for the thermal history dependence of nonequilibrium viscosity, which is validated against experimental measurements of industrial...
On a quantum version of conservation laws for derivative nonlinear Schrodinger equation
International Nuclear Information System (INIS)
Sen, S.; Chowdhury, A.R.
1988-01-01
The authors derived the quantum mechanical versions of infinite number of conservation laws associated with Derivative Nonlinear Schrodinger equation with the help of a methodology used in string theory. The renormalised version of the conserved quantities are obtained with explicit forms of the counter terms
Effects of variable transformations on errors in FORM results
International Nuclear Information System (INIS)
Qin Quan; Lin Daojin; Mei Gang; Chen Hao
2006-01-01
On the basis of studies on second partial derivatives of the variable transformation functions for nine different non-normal variables the paper comprehensively discusses the effects of the transformation on FORM results and shows that senses and values of the errors in FORM results depend on distributions of the basic variables, whether resistances or actions basic variables represent, and the design point locations in the standard normal space. The transformations of the exponential or Gamma resistance variables can generate +24% errors in the FORM failure probability, and the transformation of Frechet action variables could generate -31% errors
Safeguards and retrievability from waste forms
Energy Technology Data Exchange (ETDEWEB)
Danker, W.
1996-05-01
This report describes issues discussed at a session from the PLutonium Stabilization and Immobilization Workshop related to safeguards and retrievability from waste forms. Throughout the discussion, the group probed the goals of disposition efforts, particularly an understanding of the {open_quotes}spent fuel standard{close_quotes}, since the disposition material form derives from these goals. The group felt strongly that not only the disposition goals but safeguards to meet these goals could affect the material form. Accordingly, the Department was encouraged to explore and apply safeguards as early in the implementation process as possible. It was emphasized that this was particularly true for any planned use of existing facilities. It is much easier to build safeguards approaches into the development of new facilities, than to backfit existing facilities. Accordingly, special safeguards challenges are likely to be encountered, given the cost and schedule advantages offered by use of existing facilities.
Normal forms of Hopf-zero singularity
International Nuclear Information System (INIS)
Gazor, Majid; Mokhtari, Fahimeh
2015-01-01
The Lie algebra generated by Hopf-zero classical normal forms is decomposed into two versal Lie subalgebras. Some dynamical properties for each subalgebra are described; one is the set of all volume-preserving conservative systems while the other is the maximal Lie algebra of nonconservative systems. This introduces a unique conservative–nonconservative decomposition for the normal form systems. There exists a Lie-subalgebra that is Lie-isomorphic to a large family of vector fields with Bogdanov–Takens singularity. This gives rise to a conclusion that the local dynamics of formal Hopf-zero singularities is well-understood by the study of Bogdanov–Takens singularities. Despite this, the normal form computations of Bogdanov–Takens and Hopf-zero singularities are independent. Thus, by assuming a quadratic nonzero condition, complete results on the simplest Hopf-zero normal forms are obtained in terms of the conservative–nonconservative decomposition. Some practical formulas are derived and the results implemented using Maple. The method has been applied on the Rössler and Kuramoto–Sivashinsky equations to demonstrate the applicability of our results. (paper)
Normal forms of Hopf-zero singularity
Gazor, Majid; Mokhtari, Fahimeh
2015-01-01
The Lie algebra generated by Hopf-zero classical normal forms is decomposed into two versal Lie subalgebras. Some dynamical properties for each subalgebra are described; one is the set of all volume-preserving conservative systems while the other is the maximal Lie algebra of nonconservative systems. This introduces a unique conservative-nonconservative decomposition for the normal form systems. There exists a Lie-subalgebra that is Lie-isomorphic to a large family of vector fields with Bogdanov-Takens singularity. This gives rise to a conclusion that the local dynamics of formal Hopf-zero singularities is well-understood by the study of Bogdanov-Takens singularities. Despite this, the normal form computations of Bogdanov-Takens and Hopf-zero singularities are independent. Thus, by assuming a quadratic nonzero condition, complete results on the simplest Hopf-zero normal forms are obtained in terms of the conservative-nonconservative decomposition. Some practical formulas are derived and the results implemented using Maple. The method has been applied on the Rössler and Kuramoto-Sivashinsky equations to demonstrate the applicability of our results.
An entropic form for NLFP with coulombic-like potential
International Nuclear Information System (INIS)
Grassi, A.
2012-01-01
Here it is proposed a new entropy form for which it is possible to obtain a stationary solution of the Non-Linear Fokker–Planck equation (NLFP) with coulombic-like potentials. The general properties of this new entropy form are shown and the results are compared with those obtained by other entropy forms. Finally, the behavior of the stationary solution in presence of two point charges is also shown. -- Highlights: ► In this Letter we have proposed a new form of entropy. ► Starting from this new entropy form a Non-Linear Fokker–Planck equation has been derived. ► The stationary solution of the Non-Linear Fokker–Planck equation is obtained by using an external coulombic-like potential. ► A comparison with other forms of entropies has been proposed in the case of a single or two point charges.
Sol-gel technology applied to alternative high-level waste forms development
International Nuclear Information System (INIS)
Angelini, P.; Stinton, D.P.; Vavruska, J.S.; Caputo, A.J.; Lackey, W.J.
1981-01-01
Sol-gel technology appears applicable to waste solidification. It is attractive for remote operation, and a variety of waste compositions and forms can be produced. Spheres and pellets of gel-derived Synroc waste forms were produced. Spheres of the Synroc-B type were coated with pyrolytic carbon and silicon carbide. Partitioning of actinides in Synroc-B was experimentally determined
Zhang, Jianming
2017-03-01
An improved proportional-integral-derivative (PID) controller based on predictive functional control (PFC) is proposed and tested on the chamber pressure in an industrial coke furnace. The proposed design is motivated by the fact that PID controllers for industrial processes with time delay may not achieve the desired control performance because of the unavoidable model/plant mismatches, while model predictive control (MPC) is suitable for such situations. In this paper, PID control and PFC algorithm are combined to form a new PID controller that has the basic characteristic of PFC algorithm and at the same time, the simple structure of traditional PID controller. The proposed controller was tested in terms of set-point tracking and disturbance rejection, where the obtained results showed that the proposed controller had the better ensemble performance compared with traditional PID controllers. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Electric Charge as a Form of Imaginary Energy
Directory of Open Access Journals (Sweden)
Tianxi Zhang
2008-04-01
Full Text Available Electric charge is considered as a form of imaginary energy. With this consideration, the energy of an electrically charged particle is a complex number. The real part is proportional to the mass, while the imaginary part is proportional to the electric charge. The energy of an antiparticle is given by conjugating the energy of its corresponding particle. Newton's law of gravity and Coulomb's law of electric force are classically unified into a single expression of the interaction between the complex energies of two electrically charged particles. Interaction between real energies (or masses is the gravitational force. Interaction between imaginary energies (or electric charges is the electromagnetic force. Since radiation is also a form of real energy, there are another two types of interactions between real energies: the mass-radiation interaction and the radiation-radiation interaction. Calculating the work done by the mass-radiation interaction on a photon, we can derive the Einsteinian gravitational redshift. Calculating the work done by the radiation-radiation interaction on a photon, we can obtain a radiation redshift. This study suggests the electric charge as a form of imaginary energy, so that classically unifies the gravitational and electric forces and derives the Einsteinian gravitational redshift.
Brain-derived neurotrophic factor and early-life stress
Indian Academy of Sciences (India)
2016-10-24
Oct 24, 2016 ... The brain-derived neurotrophic factor (BDNF) is a key regulator of neural development and ... forms are produced by splicing individual non-coding ..... VII and. IX m. RNA. ↑. mBDNF. ↓. (MS). 5. BDNF expression was unch;.
Directory of Open Access Journals (Sweden)
Cahyorini Kusumawardani
2010-06-01
Full Text Available Ab initio molecular orbital calculations at the Hartree-Fock-Self Consistent Field (HF-SCF have been performed in order to determine the structure and gas phase energies of complex formed by the Lewis bases of H2O, NH3, H2S and their methyl derivatives with the cation Co2+. The relative basicities of the base studied depend on both the substituent. The gas-phase interaction energies computed by the SCF method including electron correlation Møller-Plesset 2 (MP2 dan Configuration Iteration (CI were comparable in accuracy. The binding energies computed by these two methods reach the targeted chemical accuracy. Keywords: ab initio calculation, cobalt complex, structure stability
Genetic modification of glaucoma associated phenotypes between AKXD-28/Ty and DBA/2J mice
Directory of Open Access Journals (Sweden)
Zabaleta Adriana
2001-01-01
Full Text Available Abstract Background Glaucoma is a common disease but its molecular etiology is poorly understood. It involves retinal ganglion cell death and optic nerve damage that is often associated with elevated intraocular pressure. Identifying genes that modify glaucoma associated phenotypes is likely to provide insights to mechanisms of glaucoma. We previously reported glaucoma in DBA/2J mice caused by recessive alleles at two loci, isa and ipd, that cause iris stromal atrophy and iris pigment dispersion, respectively. A approach for identifying modifier genes is to study the effects of specific mutations in different mouse strains. When the phenotypic effect of a mutation is modified upon its introduction into a new strain, crosses between the parental strains can be used to identify modifier genes. The purpose of this study was to determine if the effects of the DBA/2J derived isa and ipd loci are modified in strain AKXD-28/Ty. Results AKXD-28/Ty mice develop glaucoma characterized by intraocular pressure elevation, retinal ganglion loss, and optic nerve excavation. In AKXD-28/Ty, isa causes an iris stromal atrophy phenotype as in DBA/2J. However, the iris pigment dispersion phenotype associated with ipd in DBA/2J does not occur in AKXD-28/Ty. Additionally, a greater severity and speed of retinal and optic nerve damage following intraocular pressure elevation in AKXD-28/Ty compared to DBA/2J mice suggests that AKXD-28/Ty is more susceptible to pressure-induced cell death. Conclusions The consequences of the ipd and isa mutations are modified in the AKXD-28/Ty background. These strains provide a resource for the identification of modifier genes that modulate pigment dispersion and susceptibility to pressure-induced cell death.
Waste forms based on Cs-loaded silicotitanates
International Nuclear Information System (INIS)
Balmer, M.L.; Bunker, B.C.
1995-04-01
Silicotitanate ion exchange materials are being considered for removal of radioactive Cs and Sr from tank wastes at the Hanford site. The phase evolution as a function of heat treatment temperature for several sol gel derived compositions within the Cs 2 O-SiO 2 -TiO 2 system was investigated, in order to determine if an adequate waste form can be achieved by direct thermal conversion. The Cs leach rates and Cs loss during heat treatment of select materials were measured. Some compositions which contain large amounts of Ti melt to form a glass with reasonably low aqueous leach rates. A new Cs-silicotitanate material with a structure isomorphous to pollucite was discovered. This material forms at low temperatures (700--800 C) where Cs volatility is negligible. The silicotitanate-pollucite exhibits extremely low leach rates (1.42 g/m 2 day ) at 90 C, and has been identified as a promising waste form for Cs containment
Alkylation of Zwitterionic Thiooxalic Acid Derivatives
Directory of Open Access Journals (Sweden)
Manfred Michalik
2001-05-01
Full Text Available The new S-alkyl thiooxal-1-hydrazono-2-amidrazonium halides 2-4 were synthesized by reaction of the corresponding zwitterionic thiooxalic acid derivatives 1 with alkyl halides in methanol. The structures of compounds 4b and 4d were proven by X-ray structural analysis. Both compounds form an interesting intermolecular network of hydrogen bonds in the solid state.
Oblique projections and standard-form transformations for discrete inverse problems
DEFF Research Database (Denmark)
Hansen, Per Christian
2013-01-01
This tutorial paper considers a specific computational tool for the numerical solution of discrete inverse problems, known as the standard-form transformation, by which we can treat general Tikhonov regularization problems efficiently. In the tradition of B. N. Datta's expositions of numerical li...... linear algebra, we use the close relationship between oblique projections, pseudoinverses, and matrix computations to derive a simple geometric motivation and algebraic formulation of the standard-form transformation....
2013-04-17
... role in the success of various CBP commercial initiatives, automation efforts, and security programs... communication with importers, the ISA pre-certifiers will provide information on the ISA program and work to... import data that CBP possesses, as well as help to focus the ISA pre-certifier's efforts on the areas for...
Dyadic Short Forms of the Wechsler Adult Intelligence Scale-IV.
Denney, David A; Ringe, Wendy K; Lacritz, Laura H
2015-08-01
Full Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) administration can be time-consuming and may not be necessary when intelligence quotient estimates will suffice. Estimated Full Scale Intelligence Quotient (FSIQ) and General Ability Index (GAI) scores were derived from nine dyadic short forms using individual regression equations based on data from a clinical sample (n = 113) that was then cross validated in a separate clinical sample (n = 50). Derived scores accounted for 70%-83% of the variance in FSIQ and 77%-88% of the variance in GAI. Predicted FSIQs were strongly associated with actual FSIQ (rs = .73-.88), as were predicted and actual GAIs (rs = .80-.93). Each of the nine dyadic short forms of the WAIS-IV was a good predictor of FSIQ and GAI in the validation sample. These data support the validity of WAIS-IV short forms when time is limited or lengthier batteries cannot be tolerated by patients. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ON WEIGHTED GENERALIZED FUNCTIONS ASSOCIATED WITH QUADRATIC FORMS
Directory of Open Access Journals (Sweden)
E. L. Shishkina
2016-12-01
Full Text Available In this article we consider certain types of weighted generalized functions associated with nondegenerate quadratic forms. Such functions and their derivatives are used for constructing fundamental solutions of iterated ultra-hyperbolic equations with the Bessel operator and for constructing negative real powers of ultra-hyperbolic operators with the Bessel operator.
Fennie, Michael W.; Roth, Jessica M.
2016-01-01
In this laboratory experiment, upper-division undergraduate chemistry and biochemistry majors investigate amide-bond-forming reactions from a green chemistry perspective. Using hydrocinnamic acid and benzylamine as reactants, students perform three types of amide-forming reactions: an acid chloride derivative route; a coupling reagent promoted…
Ineffective higher derivative black hole hair
Goldstein, Kevin; Mashiyane, James Junior
2018-01-01
Inspired by the possibility that the Schwarzschild black hole may not be the unique spherically symmetric vacuum solution to generalizations of general relativity, we consider black holes in pure fourth order higher derivative gravity treated as an effective theory. Such solutions may be of interest in addressing the issue of higher derivative hair or during the later stages of black hole evaporation. Non-Schwarzschild solutions have been studied but we have put earlier results on a firmer footing by finding a systematic asymptotic expansion for the black holes and matching them with known numerical solutions obtained by integrating out from the near-horizon region. These asymptotic expansions can be cast in the form of trans-series expansions which we conjecture will be a generic feature of non-Schwarzschild higher derivative black holes. Excitingly we find a new branch of solutions with lower free energy than the Schwarzschild solution, but as found in earlier work, solutions only seem to exist for black holes with large curvatures, meaning that one should not generically neglect even higher derivative corrections. This suggests that one effectively recovers the nonhair theorems in this context.
African Journals Online (AJOL)
Items 201 - 250 of 591 ... Vol 8, No 2 (2010), Effects of dietary levels of roasted flamboyant (Delonix regia) seed meal on milk quality and yield form Savanna Brown does, Abstract .... Vol 5, No 2 (2007), Egg Quality Characteristics Of Isa – Brown Layers Fed Brewers Dried Grains –Based Diets Supplemented With Grandizyme ...
Carnitine derivatives: clinical usefulness.
Malaguarnera, Mariano
2012-03-01
Carnitine and its derivatives are natural substances involved in both carbohydrate and lipid metabolism. This review summarizes the recent progress in the field in relation to the molecular mechanisms. The pool of different carnitine derivatives is formed by acetyl-L-carnitine (ALC), propionyl-L-carnitine (PLC), and isovaleryl-carnitine. ALC may have a preferential effect on the brain tissue. ALC represents a compound of great interest for its wide clinical application in various neurological disorders: it may be of benefit in treating Alzheimer's dementia, depression in the elderly, HIV infection, chronic fatigue syndrome, peripheral neuropathies, ischemia and reperfusion of the brain, and cognitive impairment associated with various conditions. PLC has been demonstrated to replenish the intermediates of the tricarboxylic acid cycle by the propionyl-CoA moiety, a greater affinity for the sarcolemmal carrier, peripheral vasodilator activity, a greater positive inotropism, and more rapid entry into myocytes. Most studies of the therapeutic use of PLC are focused on the prevention and treatment of ischemic heart disease, congestive heart failure, hypertrophic heart disease, and peripheral arterial disease. ALC and PLC are considered well tolerated without significant side-effects. A number of therapeutic effects possibly come from the interaction of carnitine and its derivatives with the elements of cellular membranes.
Distributed order reaction-diffusion systems associated with Caputo derivatives
Saxena, R. K.; Mathai, A. M.; Haubold, H. J.
2014-08-01
This paper deals with the investigation of the solution of an unified fractional reaction-diffusion equation of distributed order associated with the Caputo derivatives as the time-derivative and Riesz-Feller fractional derivative as the space-derivative. The solution is derived by the application of the joint Laplace and Fourier transforms in compact and closed form in terms of the H-function. The results derived are of general nature and include the results investigated earlier by other authors, notably by Mainardi et al. ["The fundamental solution of the space-time fractional diffusion equation," Fractional Calculus Appl. Anal. 4, 153-202 (2001); Mainardi et al. "Fox H-functions in fractional diffusion," J. Comput. Appl. Math. 178, 321-331 (2005)] for the fundamental solution of the space-time fractional equation, including Haubold et al. ["Solutions of reaction-diffusion equations in terms of the H-function," Bull. Astron. Soc. India 35, 681-689 (2007)] and Saxena et al. ["Fractional reaction-diffusion equations," Astrophys. Space Sci. 305, 289-296 (2006a)] for fractional reaction-diffusion equations. The advantage of using the Riesz-Feller derivative lies in the fact that the solution of the fractional reaction-diffusion equation, containing this derivative, includes the fundamental solution for space-time fractional diffusion, which itself is a generalization of fractional diffusion, space-time fraction diffusion, and time-fractional diffusion, see Schneider and Wyss ["Fractional diffusion and wave equations," J. Math. Phys. 30, 134-144 (1989)]. These specialized types of diffusion can be interpreted as spatial probability density functions evolving in time and are expressible in terms of the H-function in compact forms. The convergence conditions for the double series occurring in the solutions are investigated. It is interesting to observe that the double series comes out to be a special case of the Srivastava-Daoust hypergeometric function of two variables
Directory of Open Access Journals (Sweden)
Joana F Guerreiro
2016-01-01
Full Text Available Very high concentrations of acetic acid at low pH induce programmed cell death (PCD in both the experimental model Saccharomyces cerevisiae and in Zygosaccharomyces bailii, the latter being considered the most problematic acidic food spoilage yeast due to its remarkable intrinsic resistance to this food preservative. However, while the mechanisms underlying S. cerevisiae PCD induced by acetic acid have been previously examined, the corresponding molecular players remain largely unknown in Z. bailii. Also, the reason why acetic acid concentrations known to be necrotic for S. cerevisiae induce PCD with an apoptotic phenotype in Z. bailii remains to be elucidated. In this study, a 2-DE-based expression mitochondrial proteomic analysis was explored to obtain new insights into the mechanisms involved in PCD in the Z. bailii derived hybrid strain ISA1307. This allowed the quantitative assessment of expression of protein species derived from each of the parental strains, with special emphasis on the processes taking place in the mitochondria known to play a key role in acetic acid – induced PCD. A marked decrease in the content of proteins involved in mitochondrial metabolism, in particular, in respiratory metabolism (Cor1, Rip1, Lpd1, Lat1 and Pdb1, with a concomitant increase in the abundance of proteins involved in fermentation (Pdc1, Ald4, Dld3 was registered. Other differentially expressed identified proteins also suggest the involvement of the oxidative stress response, protein translation, amino acid and nucleotide metabolism, among other processes, in the PCD response. Overall, the results strengthen the emerging concept of the importance of metabolic regulation of yeast PCD.
The connected prescription for form factors in twistor space
Energy Technology Data Exchange (ETDEWEB)
Brandhuber, A.; Hughes, E.; Panerai, R.; Spence, B.; Travaglini, G. [Centre for Research in String Theory, School of Physics and Astronomy,Queen Mary University of London,Mile End Road, London E1 4NS (United Kingdom)
2016-11-23
We propose a connected prescription formula in twistor space for all tree-level form factors of the stress tensor multiplet operator in N=4 super Yang-Mills, which is a generalisation of the expression of Roiban, Spradlin and Volovich for superamplitudes. By introducing link variables, we show that our formula is identical to the recently proposed four-dimensional scattering equations for form factors. Similarly to the case of amplitudes, the link representation of form factors is shown to be directly related to BCFW recursion relations, and is considerably more tractable than the scattering equations. We also discuss how our results are related to a recent Grassmannian formulation of form factors, and comment on a possible derivation of our formula from ambitwistor strings.
Removal of boron(III) by N-methylglucamine-type cellulose derivatives with higher adsorption rate
International Nuclear Information System (INIS)
Inukai, Yoshinari; Tanaka, Yoshiharu; Matsuda, Toshio; Mihara, Nobutake; Yamada, Kouji; Nambu, Nobuyoshi; Itoh, Osamu; Doi, Takao; Kaida, Yasuhiko; Yasuda, Seiji
2004-01-01
To obtain adsorbents for boron(III) derived from a natural polymer, two forms (powder and fiber) of N-methylglucamine-type cellulose derivatives were newly synthesized. After the graft polymerization of two forms of cellulose with vinyl monomer having epoxy groups, the N-methylglucamine-type cellulose derivatives were obtained by the reaction of the grafted cellulose with N-methylglucamine. The adsorption capacities of the cellulose derivatives for boron(III) were the same levels as that of a commercially available N-methylglucamine-type polystyrene resin. However, the cellulose derivatives adsorbed boron(III) more quickly than the polystyrene resin. The adsorption and desorption of boron(III) with a column method using the cellulose fiber were achieved at a higher flow rate than that using the polystyrene resin. In addition, the boron(III), adsorbed on the cellulose fiber column, was quantitatively recovered with dilute hydrochloric acid in 20- and 200-fold increased concentrations. Consequently, it was found that the cellulose derivatives were superior to the polystyrene resin as adsorbents for boron(III) for treatment of a large quantity of wastewater
Directory of Open Access Journals (Sweden)
Min Huang
2018-05-01
Full Text Available Implying the prosperity and development of the city, impervious surface area (ISA is playing an increasingly important role in ecological processes, microclimate, material and energy flows, and urban flood. The free sub-meter resolution Google Earth image, which is integrated by several high spatial resolution data, appears to have potential for high-resolution ISA extraction, where present study is rare and performances remain to be improved. Due to the high spatial and spectral variation of the urban environment as well as confusion between ISA and soil, the accurate delineating of ISA with traditional (direct methods can be costly and time-consuming, which is in a word resource-intensive. However, this paper presents a novel indirect ISA extraction conceptual model and a new detecting and masking background land cover (DMBLC approach that: uses a freely available, high-resolution dataset; requires a reduced set of training samples; and consists of relatively simple, common, and feasible image processing steps. The key characteristic of DMBLC is to detect the background of ISA (vegetation, soil, and water accurately and obtain the ISA by masking the background. The approach relies on background detection to avoid the predicaments of direct ISA extraction. Water can be directly gained by water body vector data, in DMBLC; mixture tuned matched filtering (MTMF is exploited to detect vegetation and soil, image segmentation is used to mitigate the spectral variation problem within the same land cover, and segment rectangularity reduces the confusion between ISA and soil. From experiments in a core area of Fuzhou, China, the DMBLC approach reached high performance and outperformed the powerful traditional support vector machines (SVM method (overall accuracy of 94.45% and Kappa coefficient of 0.8885, compared to 86.44% and 0.7329, respectively. From the comparison of different levels of complexity within the inner processing steps, it is confirmed
Funding climate adaptation strategies with climate derivatives
Directory of Open Access Journals (Sweden)
L. Richard Little
2015-01-01
Full Text Available Climate adaptation requires large capital investments that could be provided not only by traditional sources like governments and banks, but also by derivatives markets. Such markets would allow two parties with different tolerances and expectations about climate risks to transact for their mutual benefit and, in so doing, finance climate adaptation. Here we calculate the price of a derivative called a European put option, based on future sea surface temperature (SST in Tasmania, Australia, with an 18 °C strike threshold. This price represents a quantifiable indicator of climate risk, and forms the basis for aquaculture industries exposed to the risk of higher SST to finance adaptation strategies through the sale of derivative contracts. Such contracts provide a real incentive to parties with different climate outlooks, or risk exposure to take a market assessment of climate change.
SYNTHESIS OF METHACRYLATES FROM COAL-DERIVED SYNGAS
Energy Technology Data Exchange (ETDEWEB)
Jang, B.W.L.; Spivey, J.J.; Gogate, M.R.; Zoeller, J.R.; Colberg, R.D.; Choi, G.N.
1999-12-01
Research Triangle Institute (RTI), Eastman Chemical Company, and Bechtel have developed a novel process for synthesis of methyl methacrylate (MMA) from coal-derived syngas, under a contract from the US Department of Energy/Fossil Energy Technology Center (DOE/FETC). This project has resulted in five US patents (four already published and one pending publication). It has served as the basis for the technical and economic assessment of the production of this high-volume intermediate from coal-derived synthesis gas. The three-step process consists of the synthesis of a propionate from ethylene carbonylation using coal-derived CO, condensation of the propionate with formaldehyde to form methacrylic acid (MAA); and esterification of MAA with methanol to yield MMA. The first two steps, propionate synthesis and condensation catalysis, are the key technical challenges and the focus of the research presented here.
International Nuclear Information System (INIS)
Nematollahi, D.; Shayani-Jam, H.
2006-01-01
Electrochemical oxidation of 3,5-di-tert-butylcatechol (1) has been studied in ethanol/water mixtures by means of cyclic voltammetry and controlled-potential coulometry. The results revealed that 3,5-di-tert-butyl-1,2-benenzoquinone (2) derived from oxidation of 3,5-di-tert-butylcatechol participate in noncovalently linked interactions with 1 converted to an ortho-benzoquinhydrone (3). The structure of 3 was characterized by MS, IR, 1 H NMR and 13 C NMR. The 1 H NMR studies reveal that the benzoquinhydrone complex 3 is stabilized by one H-bonding interaction. In this work we derived a novel ortho-bezoquinhydrone type complex (3) based on electrochemical oxidation of 3,5-di-tert-butylcatechol at carbon electrode in an undivided cell
Derivative Geometric Modeling of Basic Rotational Solids on CATIA
Institute of Scientific and Technical Information of China (English)
MENG Xiang-bao; PAN Zi-jian; ZHU Yu-xiang; LI Jun
2011-01-01
Hybrid models derived from rotational solids like cylinders, cones and spheres were implemented on CATIA software. Firstly, make the isosceles triangular prism, cuboid, cylinder, cone, sphere, and the prism with tangent conic and curved triangle ends, the cuboid with tangent cylindrical and curved rectangle ends, the cylinder with tangent spherical and curved circular ends as the basic Boolean deference units to the primary cylinders, cones and spheres on symmetrical and some critical geometric conditions, forming a series of variant solid models. Secondly, make the deference units above as the basic union units to the main cylinders, cones, and spheres accordingly, forming another set of solid models. Thirdly, make the tangent ends of union units into oblique conic, cylindrical, or with revolved triangular pyramid, quarterly cylinder and annulus ends on sketch based features to the main cylinders, cones, and spheres repeatedly, thus forming still another set of solid models. It is expected that these derivative models be beneficial both in the structure design, hybrid modeling, and finite element analysis of engineering components and in comprehensive training of spatial configuration of engineering graphics.
Hamiltonian formulation of theory with higher order derivatives
International Nuclear Information System (INIS)
Gitman, D.M.; Lyakhovich, S.L.; Tyutin, I.V.
1983-01-01
A method of ''hamiltonization'' of a special theory with higher order derivatives is described. In a nonspecial case the result coincides with the known Ostrogradsky formulation. It is shown that in the nonspecial theory the lagrange equations of motion are reduced to the normal form
Directory of Open Access Journals (Sweden)
Michele De Marco
2013-10-01
Full Text Available This study was undertaken to investigate the effect of transport and genotype on the welfare and fear response of laying hens through a comparison of three breeds reared in free-range conditions: a commercial strain, the Isa Brown (IBh, and two local chicken breeds, the Bionda Piemontese (BPh and the Bianca di Saluzzo (BSh. After a journey of 67 km (75 min from the farmhouse of origin to the experimental station, ninety hens, divided according to breed, were free-range reared for two months. Body weight (BW, tonic immobility (TI, red and white blood cells, heterophil to lymphocyte (H/L ratio and α1-acid glycoprotein (AGP were assessed at four different sampling times: at the farmhouse of origin (T1, at 1 day (T2, 15 days (T3 and at 2 months (T4 after arrival at the experimental station. No statistical differences were found between the four sampling times for BW, total red and white blood parameters. cells or for AGP. An increase in the H/L ratio (P<0.05 was recorded at time T2 for IBh and BSh, compared to BPh (P<0.05. TI was significantly higher (P<0.05 for the local breeds, BPh and BSh, than for the commercial strain IBh. The results of this study suggest that genetic and adaptive differences can affect both, physiological and ethological parameters.
A multivector derivative approach to Lagrangian field theory
International Nuclear Information System (INIS)
Lasenby, A.; Gull, S.; Doran, C.
1993-01-01
A new calculus, based upon the multivector derivative, is developed for Lagrangian mechanics and field theory, providing streamlined and rigorous derivations of the Euler-Lagrange equations. A more general form of Noether's theorem is found which is appropriate to both discrete and continuous symmetries. This is used to find the conjugate currents of the Dirac theory, where it improves on techniques previously used for analyses of local observables. General formulas for the canonical stress-energy and angular-momentum tensors are derived, with spinors and vectors treated in a unified way. It is demonstrated that the antisymmetric terms in the stress-energy tensor are crucial to the correct treatment of angular momentum. The multivector derivative is extended to provide a functional calculus for linear functions which is more compact and more powerful than previous formalisms. This is demonstrated in a reformulation of the functional derivative with respect to the metric, which is then used to recover the full canonical stress-energy tensor. Unlike conventional formalisms, which result in a symmetric stress-energy tensor, this reformulation retains the potentially important antisymmetric contribution. 23 refs
Energy Technology Data Exchange (ETDEWEB)
Ishida, Kohki [Cardiology Department, Cardiovascular Institute, Hospital Clínic, Institut d' Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), University of Barcelona, Barcelona (Spain); Otsuki, Shuji [Division of Cardiology, Teikyo University Hospital, Tokyo (Japan); Giacchi, Giuseppe; Ortega-Paz, Luis [Cardiology Department, Cardiovascular Institute, Hospital Clínic, Institut d' Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), University of Barcelona, Barcelona (Spain); Shiratori, Yoshitaka [Division of Cardiology, Teikyo University Hospital, Tokyo (Japan); Freixa, Xavier; Martín-Yuste, Victoria; Masotti, Mónica; Sabaté, Manel [Cardiology Department, Cardiovascular Institute, Hospital Clínic, Institut d' Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), University of Barcelona, Barcelona (Spain); Brugaletta, Salvatore, E-mail: sabrugal@clinic.ub.es [Cardiology Department, Cardiovascular Institute, Hospital Clínic, Institut d' Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), University of Barcelona, Barcelona (Spain)
2017-01-15
Background: Incomplete stent apposition (ISA) is related to stent thrombosis, which is a serious adverse event. We aim to assess the time-course of ISA after 2nd generation everolimus-eluting stent (EES) implantation. Methods: In HEAL-EES study, we enrolled 36 patients who underwent percutaneous coronary intervention (PCI) with EES. OCT imaging was performed at baseline and follow-up. Patients were randomized 1:1:1 into 3 groups according to the time in which follow-up was performed: group A (6-month), group B (9-month), and group C (12-month). In this subanalysis, patients who had ISA segments at baseline and/or follow-up OCT were analyzed. Result: At baseline, among 41 lesions in 36 patients, 20 lesions in 18 patients had ISA segments and were analyzed. At baseline, there were 3.0% ISA struts in group A (n = 8), 2.8% in group B (n = 4), and 4.5% in group C (n = 8). At follow-up, ISA struts were present in 0.09%, 0.16% and 0.64%; respectively in groups A, B, and C. At follow-up, there was a significant decrease in the frequency of ISA: group A 3.0% vs. 0.09% (p < 0.001), group B 2.8% vs. 0.16% (p < 0.001), and group C 4.5% vs. 0.64% (p < 0.001). In group A, there was one late acquired ISA at follow-up. Conclusions: In patients undergoing 2nd generation EES implantation, area of acute ISA assessed by OCT, was almost resolved at 6-month follow-up. - Highlights: • Time-course of incomplete stent apposition of everolimus-eluting stent was assessed. • Serial optical coherence tomography images at baseline and follow-up were evaluated. • Acute incomplete stent apposition was almost resolved as early as at 6 months.
Kramer, Guido; Kuniss, Nadine; Kloos, Christof; Lehmann, Thomas; Müller, Nicolle; Wolf, Gunter; Lorkowski, Stefan; Müller, Ulrich A
2016-06-01
Insulin dose self-adjustment (ISA) to different blood glucose levels, carbohydrate intake, exercise or illness is a core element of structured education programmes for people with diabetes mellitus type 1 (DM1). The aim of this study was to register the patients' current principles and frequency of ISA and to check the ability for correct adjustments. 117 people with DM1 (mean HbA1c 7.1%, diabetes duration 24y) were interviewed in a tertiary care centre. The number of ISA was drawn from the last 28days of the patients' diary. The ability to find the correct insulin dose was assessed using five different calculation examples. All patients had participated in a structured education programme. Mean frequency of ISA was 72.1±29.4 per 28days. ISA by adjustment rules was used in 48% (56/117) and by personal experience or feeling in 44% (52/117). Patients adjusting by feeling were older, did less ISA and had lower social status. There were no differences in HbA1c (feeling 7.2±0.8 vs. rules 7.0±0.9, p=0.403), non severe hypoglycaemia (feeling 1.7±1.8 vs. rules 1.9±1.9, p=0.132) and comprehensibility of ISA between both groups. Overall, the participants answered on average 2.8±2.3 of the five calculation examples correctly. Although all people were trained to use a factor for correction for ISA in case of high premeal blood glucose levels, only half of the patients adjusted their insulin dosage using the complex rules from the treatment and education programme. Patients, who performed their ISA based upon feeling, did not show worse metabolic control. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Excretion and toxicity evaluation of 131I-Sennoside A as a necrosis-avid agent.
Yin, Zhiqi; Sun, Lidan; Jin, Qiaomei; Song, Shaoli; Feng, Yuanbo; Liao, Hong; Ni, Yicheng; Zhang, Jian; Liu, Wei
2017-11-01
1. Sennoside A (SA) is a newly identified necrosis-avid agent that shows capability for imaging diagnosis and tumor necrosis targeted radiotherapy. As a water-soluble compound, 131 I-Sennoside A ( 131 I-SA) might be excreted predominately through the kidneys with the possibility of nephrotoxicity. 2. To further verify excretion pathway and examine nephrotoxicity of 131 I-SA, excretion and nephrotoxicity were appraised. The pharmacokinetics, hepatotoxicity and hematotoxicity of 131 I-SA were also evaluated to accelerate its possible clinical translation. All these studies were conducted in mice with ethanol-induced muscular necrosis following a single intravenous administration of 131I-SA at 18.5 MBq/kg or 370 MBq/kg. 3. Excretion data revealed that 131 I-SA was predominately (73.5% of the injected dose (% ID)) excreted via the kidneys with 69.5% ID detected in urine within 72 h post injection. Biodistribution study indicated that 131 I-SA exhibited initial high distribution in the kidneys but subsequently a fast renal clearance, which was further confirmed by the results of autoradiography and single-photon emission computed tomography-computed tomography (SPECT-CT) imaging. The maximum necrotic to normal muscle ratio reached to 7.9-fold at 48 h post injection, which further verified the necrosis avidity of 131 I-SA. Pharmacokinetic parameters showed that 131 I-SA had fast blood clearance with an elimination half-life of 6.7 h. Various functional indexes were no significant difference (p > 0.05) between before administration and 1 d, 8 d, 16 d after administration. Histopathology showed no signs of tissue damage. 4. These data suggest 131 I-SA is a safe and promising necrosis-avid agent applicable in imaging diagnosis and tumor necrosis targeted radiotherapy.
International Nuclear Information System (INIS)
Kirchhoff, L.V.; Gilliam, F.C.
1986-01-01
Considerable information has been generated in recent years about stage-specific surface membrane antigens of a number of protozoa, and this phenomenon has been observed among several stages of TC as well. However, little is known about the surface antigens of IMT, the true infective stage of TC, because of the difficulty of obtaining sufficient numbers of these organisms for analysis. The Tulahuen strain of TC was maintained in the reduviid vector Dipetalogaster maximus by repeated feeding on mice with high parasitemias. IMT collected with insect urine were irradiated (150 krad) and used to immunize a BALB/c mouse for hybridoma production. Supernatants were screened by immunofluorescence assay for the presence of IgG MAb that react with methanol-fixed IMT, epimastogotes (EPI) and culture-derived metacyclic trypomastigoes (CMT). Of 41 MAb obtained, 40 reacted with IMT, 37 with EPI and 38 with CMT. Four MAb immunoprecipitated radioiodinated proteins or protein conjugates of M/sub r/ 80, 72, 45 and 45 from lysates of 125 I surface-labeled EPI. These results indicate that, at least at the epitopic level, there is considerable overlap among IMT, EPI and CMT surface antigens. This finding suggests that analysis of surface proteins of the latter 2 parasite forms may lead to identification of molecules useful for vaccine development
2012-02-15
... programs also is available via facsimile through a 24 hour fax-on-demand service, tel.: (202) 622-0077... credits to a person sanctioned under ISA consistent with section 6(a)(3) of ISA; (ii) with respect to... respect to section 6(a)(7) of ISA, to prohibit any transfers of credit or payments between financial...
Lemen, Georgia S; Giampietro, Natalie C; Hay, Michael B; Wolfe, John P
2009-03-20
Palladium-catalyzed carboamination reactions between N-Boc-O-(but-3-enyl)hydroxylamine derivatives and aryl or alkenyl bromides afford cis-3,5- and trans-4,5-disubstituted isoxazolidines in good yield with up to >20:1 dr. The diastereoselectivity observed in the formation of cis-3,5-disubstituted isoxazolidines is superior to selectivities typically obtained in other transformations, such as 1,3-dipolar cycloaddition reactions, that provide these products. In addition, the stereocontrol in the C-N bond-forming Pd-catalyzed carboamination reactions of N-Boc-O-(but-3-enyl)hydroxylamines is significantly higher than that of related C-O bond-forming carboetherification reactions of N-benzyl-N-(but-3-enyl)hydroxylamine derivatives. This is likely due to a stereoelectronic preference for cyclization via transition states in which the Boc group is placed in a perpendicular orientation relative to the plane of the developing ring, which derives from the conformational equilibria of substituted hydroxylamines.
Modeling and analysis of fractional order DC-DC converter.
Radwan, Ahmed G; Emira, Ahmed A; AbdelAty, Amr M; Azar, Ahmad Taher
2017-07-11
Due to the non-idealities of commercial inductors, the demand for a better model that accurately describe their dynamic response is elevated. So, the fractional order models of Buck, Boost and Buck-Boost DC-DC converters are presented in this paper. The detailed analysis is made for the two most common modes of converter operation: Continuous Conduction Mode (CCM) and Discontinuous Conduction Mode (DCM). Closed form time domain expressions are derived for inductor currents, voltage gain, average current, conduction time and power efficiency where the effect of the fractional order inductor is found to be strongly present. For example, the peak inductor current at steady state increases with decreasing the inductor order. Advanced Design Systems (ADS) circuit simulations are used to verify the derived formulas, where the fractional order inductor is simulated using Valsa Constant Phase Element (CPE) approximation and Generalized Impedance Converter (GIC). Different simulation results are introduced with good matching to the theoretical formulas for the three DC-DC converter topologies under different fractional orders. A comprehensive comparison with the recently published literature is presented to show the advantages and disadvantages of each approach. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
A 'simple' hybrid model for power derivatives
International Nuclear Information System (INIS)
Lyle, Matthew R.; Elliott, Robert J.
2009-01-01
This paper presents a method for valuing power derivatives using a supply-demand approach. Our method extends work in the field by incorporating randomness into the base load portion of the supply stack function and equating it with a noisy demand process. We obtain closed form solutions for European option prices written on average spot prices considering two different supply models: a mean-reverting model and a Markov chain model. The results are extensions of the classic Black-Scholes equation. The model provides a relatively simple approach to describe the complicated price behaviour observed in electricity spot markets and also allows for computationally efficient derivatives pricing. (author)
A Study on Market Efficiency of Selected Commodity Derivatives Traded on NCDEX During 2011
Sajipriya, N.
2012-10-01
The study aims at testing the weak form of Efficient Market Hypothesis in the context of an emerging commodity market - National Commodity Derivatives Exchange (NCDEX), which is considered as the prime commodity derivatives market in India. The study considered daily spot and futures prices of five selected commodities traded on NCDEX over 12 month period (the futures contracts originating and expiring during the period January 2011 to December 2011) The five commodities chosen are Pepper, Crude palm Oil, steel silver and Chana as they account for almost two-thirds of the value of agricultural commodity derivatives traded on NCDEX. The results of Run test indicate that both spot and futures prices are weak form efficient
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
Closed-Form Formula of the Transverse Dynamic Stiffness of a Shallowly Inclined Taut Cable
Directory of Open Access Journals (Sweden)
Dan-hui Dan
2014-01-01
Full Text Available The segmented vibration-governed equations and their general solutions for cables acted upon by intermediate transverse forces are derived by applying Hamilton’s principle. Including the effects of sagging, flexible stiffness, clamped boundary conditions, and inclination angle of the cable, the element-wise dynamic stiffness for each cable segment, split into segments having unique transverse forces, is derived. By using methods from the global stiffness assembly process of FEM, the global level of the cables’ dynamic equilibrium equation is obtained, and, as a result, the final closed-form formula of transverse dynamic stiffness is derived. Additionally, the corresponding analytic form, without considering sagging effects, is also obtained. Case studies are conducted on the aspects of accuracy, rationality of the distribution on the spatial field, and frequency domains of dynamic stiffness calculations. By comparison with the Guyan-based static FEM reduction method, it is shown that the result obtained from the proposed closed-form solution, which includes sagging effects, is exact and rational, thus creating a powerful tool in transverse vibration analysis.
Behaviour of intermediate-level waste forms in an aqueous environment
International Nuclear Information System (INIS)
Amarantos, S.; DeBatist, R.; Brodersen, K.; Glasser, F.P.; Pottier, P.E.; Vejmelka, R.; Zamorani, E.
1985-01-01
Under Action 1 of the Second Community Programme (1980-1984), study continued of the behavoiur of low and medium activity waste matrices using 10 reference waste forms (RWFs) representative of the main waste packages produced in the Community. The aim of this paper is to outline the main results for three types of matrix: cement and derived forms, organic polymers and bitumens. The results include data on diffusion coefficients, leach rates and waste form volume changes and mass losses. They constitute a considerable advance in knowledge of confinement properties but bring to light the need for further study of radionuclide release mechanisms for the purpose of constructing long-term models of waste form behaviour in the presence of water
Coherence factors beyond the BCS expressions—a derivation
International Nuclear Information System (INIS)
Gorohovsky, G; Bettelheim, E
2014-01-01
We present a derivation of a previously announced result for matrix elements between exact eigenstates of the pairing Hamiltonian. Our results, which generalize the well-known Bardeen–Cooper–Schrieffer (BCS) (Bardeen et al 1957 Phys. Rev. 108 1175; 1957 Phys. Rev. 106 162) expressions for what are known as ‘coherence factors’, are derived based on the Slavnov (1989 Theor. Math. Phys. 79 502) formula for overlaps between Bethe-ansatz states, thus making use of the known connection between the exact diagonalization of the BCS Hamiltonian, due to Richardson (1963 Phys. Lett. 3 277; 1964 Nucl. Phys. A 52 221), and the algebraic Bethe ansatz. The resulting formula has a compact form after a suitable parameterization of the energy plane. Although we apply our method here to the pairing Hamiltonian, it may be adjusted to study what is termed the ‘Sutherland limit’ (Sutherland 1995 Phys. Rev. Lett. 74 816) for exactly solvable models, namely where a macroscopic number of rapidities form a large string. (paper)
Kielar, Aneta; Joanisse, Marc F
2011-01-01
Theories of morphological processing differ on the issue of how lexical and grammatical information are stored and accessed. A key point of contention is whether complex forms are decomposed during recognition (e.g., establish+ment), compared to forms that cannot be analyzed into constituent morphemes (e.g., apartment). In the present study, we examined these issues with respect to English derivational morphology by measuring ERP responses during a cross-modal priming lexical decision task. ERP priming effects for semantically and phonologically transparent derived words (government-govern) were compared to those of semantically opaque derived words (apartment-apart) as well as "quasi-regular" items that represent intermediate cases of morphological transparency (dresser-dress). Additional conditions independently manipulated semantic and phonological relatedness in non-derived words (semantics: couch-sofa; phonology: panel-pan). The degree of N400 ERP priming to morphological forms varied depending on the amount of semantic and phonological overlap between word types, rather than respecting a bivariate distinction between derived and opaque forms. Moreover, these effects could not be accounted for by semantic or phonological relatedness alone. The findings support the theory that morphological relatedness is graded rather than absolute, and depend on the joint contribution of form and meaning overlap. Copyright © 2010 Elsevier Ltd. All rights reserved.
POLYPYRROLE AND POLYPYRROLE/WOOD-DERIVED MATERIALS CONDUCTING COMPOSITES: A REVIEW
Directory of Open Access Journals (Sweden)
Davide Beneventi Mail
2011-07-01
Full Text Available Wood and cellulose derivatives, in both fibrous and water-soluble macromolecular form, are emerging as outstanding candidates for organic electronics applications due to their large-scale availability, low cost, and easy processability. Paper and wood fibre-based derivatives are considered to be materials of choice as supports for communication world-wide. The interest in producing inexpensive and universally available conducting polymer/cellulose fibres substrates resides in the possibility of creating new materials that can be used for a broad range of advanced applications. For instance, PPy/cellulose fibres composites can be used for the preparation of energy storage devices thanks to the conjugation of the high specific area of cellulose fibres and the electrochemical properties of PPy. Other possible applications of such composites are in the area of the antistatic materials, sensors, electromagnetic interference shielding materials, smart packaging, and tissues. Concerning the woody polymers, some of them (i.e. cellulose derivatives also exhibit biocompatibility, as well as film-forming properties and transparency. In combination with the electrical properties of PPy, these features make PPy/macromolecular cellulose composites suitable for applications as displays, lighting, and photovoltaics. Due to their chemical structure, macromolecular wood derivatives have been proposed with success as enhancing conductivity additives in Py polymerisation. The aim of the present review is to provide an overview of PPy chemistry and of the most relevant advances attained in the production of PPy/wood derived materials conducting composites.
Earthworm-Derived Pore-Forming Toxin Lysenin and Screening of Its Inhibitors
Directory of Open Access Journals (Sweden)
Neelanun Sukumwang
2013-08-01
Full Text Available Lysenin is a pore-forming toxin from the coelomic fluid of earthworm Eisenia foetida. This protein specifically binds to sphingomyelin and induces erythrocyte lysis. Lysenin consists of 297 amino acids with a molecular weight of 41 kDa. We screened for cellular signal transduction inhibitors of low molecular weight from microorganisms and plants. The purpose of the screening was to study the mechanism of diseases using the obtained inhibitors and to develop new chemotherapeutic agents acting in the new mechanism. Therefore, our aim was to screen for inhibitors of Lysenin-induced hemolysis from plant extracts and microbial culture filtrates. As a result, we isolated all-E-lutein from an extract of Dalbergia latifolia leaves. All-E-lutein is likely to inhibit the process of Lysenin-membrane binding and/or oligomer formation rather than pore formation. Additionally, we isolated tyrosylproline anhydride from the culture filtrate of Streptomyces as an inhibitor of Lysenin-induced hemolysis.
Neural network representation and learning of mappings and their derivatives
White, Halbert; Hornik, Kurt; Stinchcombe, Maxwell; Gallant, A. Ronald
1991-01-01
Discussed here are recent theorems proving that artificial neural networks are capable of approximating an arbitrary mapping and its derivatives as accurately as desired. This fact forms the basis for further results establishing the learnability of the desired approximations, using results from non-parametric statistics. These results have potential applications in robotics, chaotic dynamics, control, and sensitivity analysis. An example involving learning the transfer function and its derivatives for a chaotic map is discussed.
Perturbative QCD and electromagnetic form factors
International Nuclear Information System (INIS)
Carlson, C.E.; Gross, F.
1987-01-01
We calculate nucleon magnetic form factors using perturbative QCD for several distribution amplitudes including a general one given in terms of Appell polynomials. We find that the magnitude and sign of both nucleon magnetic form factors can be explained within perturbative QCD. The observed normalization of G/sub Mp/ requires that the distribution amplitude be broader than its superhigh momentum transfer limit, and the G/sub Mn//G/sub Mp/ data may require the distribution amplitude to be asymmetric, in accord with distribution amplitudes derived from QCD sum rules. Some speculation as to how an asymmetric distribution amplitude can come about is offered. Finally, we show that the soft contributions corresponding to the particular distribution amplitudes we use need not be bigger than the data. 16 refs., 6 figs
Deriving Trading Rules Using Gene Expression Programming
Directory of Open Access Journals (Sweden)
Adrian VISOIU
2011-01-01
Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.
Novel synthesis of a strained para-cyclophane derivative
Institute of Scientific and Technical Information of China (English)
Zhi Hao Shi; Yun Yang Wei
2007-01-01
A [P. Rajakumar, A.M.A. Rasheed, Tetrahedron 61(22) (2005) 5351] para-cyclophane derivative was synthesized via intramolecular esterification of a dipeptide surrogate containing asparagine to form tetrahydropyrimidinone ring. The structures of the product and intermediates were characterized by 1H NMR, 13C NMR and mass spectrum.
D'Amour, Pierre; Räkel, Agnès; Brossard, Jean-Hugues; Rousseau, Louise; Albert, Caroline; Cantor, Tom
2006-01-01
The quantitative evaluation of circulating PTH peaks revealed by PTH assays after HPLC separation constitutes the best way to study the behavior of PTH molecular forms, but it is also impractical. The objective of the study was to investigate the regulation of circulating PTH molecular forms by calcium through the use of PTH fragments/PTH (1-84) ratios derived from PTH assays with different specificities before and after HPLC separation of circulating PTH. CaCl2 and Na citrate were infused in eight volunteers. PTH was measured in serum and HPLC fractions at different calcium concentrations in PTH assays reacting with regions 1-2 (CA), 12-18 (T), and 65-69 (C) of the PTH structure. From hypo- to hypercalcemia, the C/CA ratio had the highest range (1.92 to 9.75; P < 0.001), and the C/T ratio had a higher range (1.69 to 6.11; P < 0.01) than the T/CA ratio (1.15 to 1.86). Human (h) PTH (1-84) represented 32.7 and 4.3% of circulating PTH in hypo- and hypercalcemic HPLC profiles, respectively. These numbers were 5 and 0.9% for amino-terminal (N)-PTH, an amino-terminal form of PTH distinct from hPTH (1-84), 7.3 and 6.8% for non-(1-84) PTH or large C-PTH fragments with a partially preserved N structure, and 54.9 and 88.1% for C-PTH fragments missing a N structure. The HPLC C-PTH fragments to hPTH (1-84) ratio had the most extensive range (1.67 to 20.58). Despite their quantitative differences, all ratios identified identical behavior of PTH fragments relative to PTH (1-84). PTH assay ratios are an adequate tool to investigate the modulation of PTH molecular forms, even if all PTH assays show some undesirable cross-reactivity with certain circulating forms of PTH.
Effects of fullerol on the osteogenic differentiation of adipose-derived mesenchymal stem cells
Directory of Open Access Journals (Sweden)
Yan-ting TANG
2016-09-01
Full Text Available Objective To investigate the effect of fullerol on the osteogenic differentiation of rat adipose-derived mesenchymal stem cells (rADSCs based on hanging drop culture. Methods rADSC spheres were formed by hanging drop culture for 3 days, then the spheres were dissociated to single cell by trypsin (called rADSC sphere-derived cells. The rADSC sphere-derived cells were cultured in 2-D adherent cell cultures for 24 hours, then the ordinary culture medium was replaced by osteogenic induction medium (osteogenic medium, OM. OM without fullerol served as control group (CM; OM with 1.0μmol/L fullerol was used as the experimental group (OM+Ful1.0μmol/L. Two groups were induced to differentiation for 14d and 21d, using two methods of alizarin red staining and quantitative real-time PCR (qPCR to detecte the ability of rADSC sphere-derived cells differentiating into osteoblasts. Results rADSCs could form a uniform size microspheres structure through hanging drop culture for 3 days; rADSC sphere-derived cells were obtained by dissipation of trypsin. Compared with OM group, OM+Ful1.0μmol/L can make rADSC sphere-derived cells form more mineralized calcium nodules, and enhance the expression of the relevant osteogenic gene Runx2, OCN and ColI. Conclusion Fullerol can significantly enhance the osteogenic differentiation of rADSCs based on hanging drop culture, and it is helpful to improve the efficiency of osteogenic induction of rADSCs. DOI: 10.11855/j.issn.0577-7402.2016.08.03
Closed Form Solution of Synchronous Machine Short Circuit Transients
Directory of Open Access Journals (Sweden)
Gibson H.M. Sianipar
2010-05-01
Full Text Available This paper presents the closed form solution of the synchronous machine transients undergoing short circuit. That analytic formulation has been derived based on linearity and balanced conditions of the fault. Even though restrictive, the proposed method will serve somehow or other as a new resource for EMTP productivity. Indisputably superior, the closed-form formulation has some features inimitable by discretization such as continuity, accuracy and absolute numerical stability. Moreover, it enables us to calculate states at one specific instant independent of previous states or a snapshot, which any discretization methods cannot do.
International Nuclear Information System (INIS)
Loon, L.R. van; Glaus, M.A.; Laube, A.; Stallone, S.
1999-01-01
The effect of degradation products of different cellulosic materials on the sorption behaviour of Th(IV), Eu(III) and Ni(II) on feldspar at pH 13.3 was studied. For all three metals, a decrease in sorption could be observed with increasing concentration of organics in solution. For Th(IV), α-ISA is the effective ligand present in the solutions of degraded cellulose, independent on the type of cellulose studied. For Eu(III), α-ISA is the effective ligand in the case of pure cellulose degradation. In the case of other cellulosic materials, unknown ligands cause the sorption reduction. For Ni(II), also unknown ligands cause sorption reduction, independent on the type of cellulose studied. These unknown ligands are not formed during alkaline degradation of cellulose, but are present as impurities in certain cellulosic materials. (orig.)
Relativistic two-fermion equations with form factors and anomalous magnetic moment interactions
International Nuclear Information System (INIS)
Ahmed, S.
1977-04-01
Relativistic equations for two-fermion systems are derived from quantum field theory taking into account the form factors of the particles. When the q 2 dependence of the form factors is disregarded, in the static approximation, the two-fermion equations with Coulomb and anomalous magnetic moment interactions are obtained. Separating the angular variables, a sixteen-component relativistic radial equation are finally given
Havas, Viktoria; Rodriguez-Fornells, Antoni; Clahsen, Harald
2012-01-01
This study investigates brain potentials to derived word forms in Spanish. Two experiments were performed on derived nominals that differ in terms of their productivity and semantic properties but are otherwise similar, an acceptability judgment task and a reading experiment using event-related brain potentials (ERPs) in which correctly and…
Optimal Mortgage Refinancing: A Closed Form Solution
Agarwal, Sumit; Driscoll, John C.; Laibson, David I.
2013-01-01
We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least 1ψ[ϕ+W(−exp(−ϕ))]. In this formula W(.) is the Lambert W-function, ψ=2(ρ+λ)σ,ϕ=1+ψ(ρ+λ)κ∕M(1−τ), ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods. PMID:25843977
DEFF Research Database (Denmark)
Bundgaard, Hans; Steffansen, Bente
1990-01-01
Although it is well-known that N-substituted phthalamic acid derivatives are readily hydrolyzed in acidic aqueous solution due to intramolecular catalysis by the neighbouring carboxy group, sparse information is available on the degradation behaviour in neutral solutions. A recent publication [5]...
Dispersive analysis of the pion transition form factor
Energy Technology Data Exchange (ETDEWEB)
Hoferichter, M. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, ExtreMe Matter Institute EMMI, Darmstadt (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics, Bern (Switzerland); Kubis, B.; Niecknig, F.; Schneider, S.P. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany); Leupold, S. [Uppsala Universitet, Institutionen foer fysik och astronomi, Box 516, Uppsala (Sweden)
2014-11-15
We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the e{sup +}e{sup -} → 3π cross section, generalizing previous studies on ω, φ → 3π decays and γπ → ππ scattering, and verify our result by comparing to e{sup +}e{sup -} → π{sup 0}γ data. We perform the analytic continuation to the space-like region, predicting the poorlyconstrained space-like transition form factor below 1 GeV, and extract the slope of the form factor at vanishing momentum transfer a{sub π} = (30.7 ± 0.6) x 10{sup -3}. We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon. (orig.)
Generalized Lee-Wick formulation from higher derivative field theories
International Nuclear Information System (INIS)
Cho, Inyong; Kwon, O-Kab
2010-01-01
We study a higher derivative (HD) field theory with an arbitrary order of derivative for a real scalar field. The degree of freedom for the HD field can be converted to multiple fields with canonical kinetic terms up to the overall sign. The Lagrangian describing the dynamics of the multiple fields is known as the Lee-Wick (LW) form. The first step to obtain the LW form for a given HD Lagrangian is to find an auxiliary field (AF) Lagrangian which is equivalent to the original HD Lagrangian up to the quantum level. Until now, the AF Lagrangian has been studied only for N=2 and 3 cases, where N is the number of poles of the two-point function of the HD scalar field. We construct the AF Lagrangian for arbitrary N. By the linear combinations of AF fields, we also obtain the corresponding LW form. We find the explicit mapping matrices among the HD fields, the AF fields, and the LW fields. As an exercise of our construction, we calculate the relations among parameters and mapping matrices for N=2, 3, and 4 cases.
MODELING SOLIDIFICATION-INDUCED STRESSES IN CERAMIC WASTE FORMS CONTAINING NUCLEAR WASTES
International Nuclear Information System (INIS)
Solbrig, Charles W.; Bateman, Kenneth J.
2010-01-01
The goal of this work is to produce a ceramic waste form (CWF) that permanently occludes radioactive waste. This is accomplished by absorbing radioactive salts into zeolite, mixing with glass frit, heating to a molten state 915 C to form a sodalite glass matrix, and solidifying for long-term storage. Less long term leaching is expected if the solidifying cooling rate doesn't cause cracking. In addition to thermal stress, this paper proposes that a stress is formed during solidification which is very large for fast cooling rates during solidification and can cause severe cracking. A solidifying glass or ceramic cylinder forms a dome on the cylinder top end. The temperature distribution at the time of solidification causes the stress and the dome. The dome height, ''the length deficit,'' produces an axial stress when the solid returns to room temperature with the inherent outer region in compression, the inner in tension. Large tensions will cause cracking of the specimen. The temperature deficit, derived by dividing the length deficit by the coefficient of thermal expansion, allows solidification stress theory to be extended to the circumferential stress. This paper derives the solidification stress theory, gives examples, explains how to induce beneficial stresses, and compares theory to experimental data.
Initial value formulation of higher derivative gravity
International Nuclear Information System (INIS)
Noakes, D.R.
1983-01-01
The initial value problem is considered for the conformally coupled scalar field and higher derivative gravity, by expressing the equations of each theory in harmonic coordinates. For each theory it is shown that the (vacuum) equations can take the form of a diagonal hyperbolic system with constraints on the initial data. Consequently these theories possess well-posed initial value formulations
A Novel wave-form command shaper for overhead cranes
Directory of Open Access Journals (Sweden)
KHALED ALHAZZA
2013-12-01
Full Text Available In this work, a novel command shaping control strategy for oscillation reduction of simple harmonic oscillators is proposed, and validated experimentally. A wave-form acceleration command shaper is derived analytically. The performance of the proposed shaper is simulated numerically, and validated experimentally on a scaled model of an overhead crane. Amplitude modulation is used to enhance the shaper performance, which results in a modulated wave-form command shaper. It is determined that the proposed wave-form and modulated wave-form command shaper profiles are capable of eliminating travel and residual oscillations. Furthermore, unlike traditional impulse and step command shapers, the proposed command shaper has piecewise smoother acceleration, velocity, and displacement profiles. Experimental results using continuous and discrete commands are presented. Experiments with discrete commands involved embedding a saturation model-based feedback in the algorithm of the command shaper.
Buse, Chris
2013-12-01
Intersectoral action (ISA) has been at the forefront of public health policy discussions since the 1970s. ISA incorporates a broader perspective of public health issues and coordinates efforts to address the social, political, economic and environmental contexts from which health determinants operate and are created. Despite being forwarded as a useful way to address and treat complex or 'wicked' problems, such policy issues are still often addressed within, rather than across, disciplinary silos and ISA has been documented to fail more often than it succeeds. This paper contributes to an understanding of ISA by outlining and applying critical systems heuristics (CSH) theory and methods. CSH theory and methods are described and discussed before applying them to the example of addressing climate change and health equity through public health practice. CSH thinking provides useful tools to engage stakeholders, question relations of power that may exist between collaborating partners, and move beyond power inequalities that guide ISA initiatives. CSH is a compelling framing that can improve an understanding of the collaborative relationships that are a prerequisite for engaging in ISA to address complex or 'wicked' policy problems such as climate change. © 2013 John Wiley & Sons Ltd.
Intelligent speed adaptation as an assistive device for drivers with acquired brain injury
DEFF Research Database (Denmark)
Klarborg, Brith; Lahrmann, Harry Spaabæk; Agerholm, Niels
2012-01-01
Intelligent speed adaptation (ISA) was tested as an assistive device for drivers with an acquired brain injury (ABI). The study was part of the “Pay as You Speed” project (PAYS) and used the same equipment and technology as the main study (Lahrmann et al., in press-a, in press-b). Two drivers......, and in general they described driving with ISA as relaxed. ISA reduced the percentage of the total distance that was driven with a speed above the speed limit (PDA), but the subjects relapsed to their previous PDA level in Baseline 2. This suggests that ISA is more suited as a permanent assistive device (i...
Simpsonite isa / Margit Tõnson
Tõnson, Margit, 1978-
2007-01-01
Joonisfilmi "Simpsonite film" ("The Simpsons Movie") maailmaesilinastuste puhul seriaali looja, Kanada päritolu Matt Groeningist ja tema loodud seriaali populaarsuse fenomenist. Lisaks filmi süzheest "Mees peab oma naist kuulama!" (režissöör David Silverman)
DEFF Research Database (Denmark)
Kulik, Lars; Guting, Ralf Hartmut; Lu, Hua
2012-01-01
Large indoor spaces such as office complexes and shopping malls have become an important part of our daily lives and research into indoor space is increasingly attracting attention from academia and industry. Indoor space differs from outdoor space in several important aspects such as layout...... often involves the third dimension as office buildings and shopping malls typically have several floors....
17 CFR 229.1115 - (Item 1115) Certain derivatives instruments.
2010-04-01
... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1115) Certain derivatives instruments. 229.1115 Section 229.1115 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION STANDARD INSTRUCTIONS FOR FILING FORMS UNDER SECURITIES ACT OF 1933, SECURITIES EXCHANGE ACT OF...
Naskar, Amit K.; Paranthaman, Mariappan Parans; Boota, Muhammad; Gogotsi, Yury
2018-04-10
A method of making a supercapacitor from waste tires, includes the steps of providing rubber pieces and contacting the rubber pieces with a sulfonation bath to produce sulfonated rubber; pyrolyzing the sulfonated rubber to produce a tire-derived carbon composite comprising carbon black embedded in rubber-derived carbon matrix comprising graphitized interface portions; activating the tire-derived carbon composite by contacting the tire-derived carbon composite with a specific surface area-increasing composition to increase the specific surface area of the carbon composite to provide an activated tire-derived carbon composite; and, mixing the activated tire-derived carbon composite with a monomer and polymerizing the monomer to produce a redox-active polymer coated, activated tire-derived carbon composite. The redox-active polymer coated, activated tire-derived carbon composite can be formed into a film. An electrode and a supercapacitor are also disclosed.
Δ(1232) Axial Charge and Form Factors from Lattice QCD
International Nuclear Information System (INIS)
Alexandrou, Constantia; Gregory, Eric B.; Korzec, Tomasz; Koutsou, Giannis; Negele, John W.; Sato, Toru; Tsapalis, Antonios
2011-01-01
We present the first calculation on the Δ axial vector and pseudoscalar form factors using lattice QCD. Two Goldberger-Treiman relations are derived and examined. A combined chiral fit is performed to the nucleon axial charge, N to Δ axial transition coupling constant and Δ axial charge.
DEFF Research Database (Denmark)
Keiding, Tina Bering
2012-01-01
understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...
Chitosan derivatives with antimicrobial, antitumour and antioxidant activities--a review.
Jarmila, Vinsová; Vavríková, Eva
2011-01-01
Chitosan is a linear polysaccharide with a good biodegradability, biocompatibility, and no toxicity, which provide it with huge potential for future development. The chitosan molecule appears to be a suitable polymeric complex for many biomedical applications. This review gathers current findings on the antibacterial, antifungal, antitumour and antioxidant activities of chitosan derivatives and concurs with our previous review presenting data collected up to 2008. Antibacterial activity is based on molecular weight, the degree of deacetylation, the type of substitutents, which can be cationic or easily form cations, and the type of bacterium. In general, high molecular weight chitosan cannot pass through cell membranes and forms a film that protects cells against nutrient transport through the microbial cell membrane. Low molecular weight chitosan derivatives are water soluble and can better incorporate the active molecule into the cell. Gram-negative bacteria, often represented by Escherichia coli, have an anionic bacterial surface on which cationic chitosan derivatives interact electrostatically. Thus, many chitosan conjugates have cationic components such as ammonium, pyridinium or piperazinium substituents introduced into their molecules to increase their positive charge. Gram-positive bacteria like Staphylococcus aureus are inhibited by the binding of lower molecular weight chitosan derivatives to DNA or RNA. Chitosan nanoparticles exhibit an increase in loading capacity and efficacy. Antitumour active compounds such as doxorubicin, paclitaxel, docetaxel and norcantharidin are used as drug carriers. It is evident that chitosan, with its low molecular weight, is a useful carrier for molecular drugs requiring targeted delivery. The antioxidant scavenging activity of chitosan has been established by the strong hydrogen-donating ability of chitosan. The low molecular weight and greater degree of quarternization have a positive influence on the antioxidant activity
An energy-saving nonlinear position control strategy for electro-hydraulic servo systems.
Baghestan, Keivan; Rezaei, Seyed Mehdi; Talebi, Heidar Ali; Zareinejad, Mohammad
2015-11-01
The electro-hydraulic servo system (EHSS) demonstrates numerous advantages in size and performance compared to other actuation methods. Oftentimes, its utilization in industrial and machinery settings is limited by its inferior efficiency. In this paper, a nonlinear backstepping control algorithm with an energy-saving approach is proposed for position control in the EHSS. To achieve improved efficiency, two control valves including a proportional directional valve (PDV) and a proportional relief valve (PRV) are used to achieve the control objectives. To design the control algorithm, the state space model equations of the system are transformed to their normal form and the control law through the PDV is designed using a backstepping approach for position tracking. Then, another nonlinear set of laws is derived to achieve energy-saving through the PRV input. This control design method, based on the normal form representation, imposes internal dynamics on the closed-loop system. The stability of the internal dynamics is analyzed in special cases of operation. Experimental results verify that both tracking and energy-saving objectives are satisfied for the closed-loop system. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Bernard, Samuel; Miele, Philippe
2014-11-21
Boron nitride (BN) is a III-V compound which is the focus of important research since its discovery in the early 19th century. BN is electronic to carbon and thus, in the same way that carbon exists as graphite, BN exists in the hexagonal phase. The latter offers an unusual combination of properties that cannot be found in any other ceramics. However, these properties closely depend on the synthesis processes. This review states the recent developments in the preparation of BN through the chemistry, shaping and ceramic conversion of borazine derivatives. This concept denoted as Polymer-Derived Ceramics (PDCs) route allows tailoring the chemistry of precursors to elaborate complex BN shapes which cannot be obtained by conventional process. The effect of the chemistry of the molecular precursors, i.e. , borazine and trichloroborazine, and their polymeric derivatives i.e. , polyborazylene and poly[tri(methylamino)borazine], in which the specific functional groups and structural motifs determine the shaping potential by conventional liquid-phase process and plastic-forming techniques is discussed. Nanotubes, nano-fibers, coatings, monoliths and fiber-reinforced matrix composites are especially described. This leads to materials which are of significant engineering interest.
Directory of Open Access Journals (Sweden)
Samuel Bernard
2014-11-01
Full Text Available Boron nitride (BN is a III-V compound which is the focus of important research since its discovery in the early 19th century. BN is electronic to carbon and thus, in the same way that carbon exists as graphite, BN exists in the hexagonal phase. The latter offers an unusual combination of properties that cannot be found in any other ceramics. However, these properties closely depend on the synthesis processes. This review states the recent developments in the preparation of BN through the chemistry, shaping and ceramic conversion of borazine derivatives. This concept denoted as Polymer-Derived Ceramics (PDCs route allows tailoring the chemistry of precursors to elaborate complex BN shapes which cannot be obtained by conventional process. The effect of the chemistry of the molecular precursors, i.e., borazine and trichloroborazine, and their polymeric derivatives i.e., polyborazylene and poly[tri(methylaminoborazine], in which the specific functional groups and structural motifs determine the shaping potential by conventional liquid-phase process and plastic-forming techniques is discussed. Nanotubes, nano-fibers, coatings, monoliths and fiber-reinforced matrix composites are especially described. This leads to materials which are of significant engineering interest.
Examining Urban Impervious Surface Distribution and Its Dynamic Change in Hangzhou Metropolis
Directory of Open Access Journals (Sweden)
Longwei Li
2016-03-01
Full Text Available Analysis of urban distribution and its expansion using remote sensing data has received increasing attention in the past three decades, but little research has examined spatial patterns of urban distribution and expansion with buffer zones in different directions. This research selected Hangzhou metropolis as a case study to analyze spatial patterns and dynamic changes based on time-series urban impervious surface area (ISA datasets. ISA was developed from Landsat imagery between 1991 and 2014 using a hybrid approach consisting of linear spectral mixture analysis, decision tree classifiers, and post-processing. The spatial patterns of ISA distribution and its dynamic changes in eight directions—east, southeast, south, southwest, west, northwest, north, and northeast—at the temporal scale were analyzed with a buffer zone-based approach. This research indicated that ISA can be extracted from Landsat imagery with both producer and user accuracies of over 90%. ISA in Hangzhou metropolis increased from 146 km2 in 1991 to 868 km2 in 2014. Annual ISA growth rates were between 15.6 km2 and 48.8 km2 with the lowest growth rate in 1994–2000 and the highest growth rate in 2005–2010. Urban ISA increase before 2000 was mainly due to infilling within the urban landscape, and, after 2005, due to urban expansion in the urban-rural interfaces. Urban expansion in this study area has different characteristics in various directions that are influenced by topographic factors and urban development policies.
Ishii, Misawa Niki; Yamamoto, Koji; Shoji, Masanobu; Asami, Asano; Kawamata, Yuji
2017-08-15
Accurate risk assessment for drug-induced seizure is expected to be performed before entering clinical studies because of its severity and fatal damage to drug development. Induced pluripotent stem cell (iPSC) technology has allowed the use of human neurons and glial cells in toxicology studies. Recently, several studies showed the advantage of co-culture system of human iPSC (hiPSC)-derived neurons with rodent/human primary astrocytes regarding neuronal functions. However, the application of hiPSC-derived neurons for seizure risk assessment has not yet been fully addressed, and not at all when co-cultured with hiPSC-derived astrocytes. Here, we characterized hiPSC-derived neurons co-cultured with hiPSC-derived astrocytes to discuss how hiPSC-derived neurons are useful to assess seizure risk of drugs. First, we detected the frequency of spikes and synchronized bursts hiPSC-derived neurons when co-cultured with hiPSC-derived astrocytes for 8 weeks. This synchronized burst was suppressed by the treatment with 6-cyano-7-nitroquinoxaline-2,3-dione, α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor antagonist, and D-(-)-2-amino-5-phosphonopentanoic acid, an N-Methyl-d-aspartate (NMDA) receptor antagonist. These data suggested that co-cultured hiPSC-derived neurons formed synaptic connections mediated by AMPA and NMDA receptors. We also demonstrated that co-cultured hiPSC-derived neurons showed epileptiform activity upon treatment with gabazine or kaliotoxin. Finally, we performed single-cell transcriptome analysis in hiPSC-derived neurons and found that hiPSC-derived astrocytes activated the pathways involved in the activities of AMPA and NMDA receptor functions, neuronal polarity, and axon guidance in hiPSC-derived neurons. These data suggested that hiPSC-derived astrocytes promoted the development of action potential, synaptic functions, and neuronal networks in hiPSC-derived neurons, and then these functional alterations result in the epileptiform
Identification of rabbit annulus fibrosus-derived stem cells.
Directory of Open Access Journals (Sweden)
Chen Liu
Full Text Available Annulus fibrosus (AF injuries can lead to substantial deterioration of intervertebral disc (IVD which characterizes degenerative disc disease (DDD. However, treatments for AF repair/regeneration remain challenging due to the intrinsic heterogeneity of AF tissue at cellular, biochemical, and biomechanical levels. In this study, we isolated and characterized a sub-population of cells from rabbit AF tissue which formed colonies in vitro and could self-renew. These cells showed gene expression of typical surface antigen molecules characterizing mesenchymal stem cells (MSCs, including CD29, CD44, and CD166. Meanwhile, they did not express negative markers of MSCs such as CD4, CD8, and CD14. They also expressed Oct-4, nucleostemin, and SSEA-4 proteins. Upon induced differentiation they showed typical osteogenesis, chondrogenesis, and adipogenesis potential. Together, these AF-derived colony-forming cells possessed clonogenicity, self-renewal, and multi-potential differentiation capability, the three criteria characterizing MSCs. Such AF-derived stem cells may potentially be an ideal candidate for DDD treatments using cell therapies or tissue engineering approaches.
Scalar potential from higher derivative N=1 superspace
International Nuclear Information System (INIS)
Ciupke, David
2016-05-01
The supersymmetric completion of higher-derivative operators often requires introducing corrections to the scalar potential. In this paper we study these corrections systematically in the context of theories with N=1 global and local supersymmetry in D=4 focusing on ungauged chiral multiplets. In globally supersymmetric theories the most general off-shell effective scalar potential can be captured by a dependence of the Kaehler potential on additional chiral superfields. For supergravity we find a much richer structure of possible corrections. In this context we classify the leading order and next-to-leading order superspace derivative operators and determine the component forms of a subclass thereof. Moreover, we present an algorithm that simplifies the computation of the respective on-shell action. As particular applications we study the structure of the supersymmetric vacua for these theories and comment on the form of the corrections to shift-symmetric no-scale models. These results are relevant for the computation of effective actions for string compactifications and, in turn, for moduli stabilization and string inflation.
Heterogeneity of the radiosensitivity and origins of tissue macrophage colony-forming cells
Energy Technology Data Exchange (ETDEWEB)
Oghiso, Yoichi; Yamada, Yutaka (National Inst. of Radiological Sciences, Chiba (Japan))
1992-12-01
Previous studies suggest that the radiosensitivity and origin of tissue macrophage precursors differ from those of hemopoietic macrophage colony-forming units (CFU-Ms) committed to macrophage-lineage cells. We assessed the origins of tissue macrophage colony-forming cells (M-CFCs) in mice by comparing their kinetics and radiosensitivities in the normal steady state and under the conditions of bone marrow depletion by [sup 89]Sr-administration and/or splenectomy. The results indicate that the radiosensitive peritoneal M-CFCs elicited by thioglycollate are derived from bone marrow macrophage precursors; where as alveolar M-CFCs, which are radioresistant, are self-sustained locally and independent of hemopoietic macrophage precursors. In contrast, highly radiosensitive liver M-CFCs are probably derived from CFU-Ms that appear to be propagated in the spleen in association with hemopoietic responses. (author).
The formation of fat-derived flavour compounds during the ripening of Gouda-type cheese
Alewijn, M.
2006-01-01
Cheese flavour is an important quality attribute, and is mainly formed during cheese ripening. Besides compounds that are formed from protein and carbohydrates, milk fat-derived compounds are essential for cheese flavour. Before, but mainly during ripening, free fatty acids, lactones, ketones,
Seasonal Surface Spectral Emissivity Derived from Terra MODIS Data
Sun-Mack, Sunny; Chen, Yan; Minnis, Patrick; Young, DavidF.; Smith, William J., Jr.
2004-01-01
The CERES (Clouds and the Earth's Radiant Energy System) Project is measuring broadband shortwave and longwave radiances and deriving cloud properties form various images to produce a combined global radiation and cloud property data set. In this paper, simultaneous data from Terra MODIS (Moderate Resolution Imaging Spectroradiometer) taken at 3.7, 8.5, 11.0, and 12.0 m are used to derive the skin temperature and the surface emissivities at the same wavelengths. The methodology uses separate measurements of clear sky temperature in each channel determined by scene classification during the daytime and at night. The relationships between the various channels at night are used during the day when solar reflectance affects the 3.7- m radiances. A set of simultaneous equations is then solved to derive the emissivities. Global monthly emissivity maps are derived from Terra MODIS data while numerical weather analyses provide soundings for correcting the observed radiances for atmospheric absorption. These maps are used by CERES and other cloud retrieval algorithms.
Energy Technology Data Exchange (ETDEWEB)
Ludyk, Guenter [Bremen Univ. (Germany). Physics and Electrical Engineering
2013-11-01
Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.
International Nuclear Information System (INIS)
Ludyk, Guenter
2013-01-01
Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.
Ali, Akbar; Khan, M Masroor A; Uddin, Moin; Naeem, M; Idrees, Mohd; Hashmi, Nadeem; Dar, Tariq Ahmad; Varshney, Lalit
2014-11-04
Eucalyptus citriodora Hook. is highly valued for its citronellal-rich essential oil (EO) extracted from its leaves. Hence, escalated EO production of eucalyptus is the need of hour. Marine polysaccharides (sodium alginate) are processed through gamma radiation of particular intensity, to obtain the irradiated sodium alginate (ISA). A pot experiment was conducted to study the effect of foliar application of ISA on growth, biochemical, physiological, EO yield and composition of E. citriodora. The treatments were applied as: foliar spray of deionized water only (control), seed soaked with ISA (90 mg L(-1)) and foliar spray of ISA with 30, 60, 120 and 240 mg L(-1). The treatment 6 (spray of ISA at 120 mg L(-1)) showed the highest value for most of the parameters studied. It also enhanced the EO content (33.3%), EO yield (86.7%), citronellal content (63.4%) and citronellal yield (205.5%) as compared to the control. Copyright © 2014 Elsevier Ltd. All rights reserved.
Extrapolation of π-meson form factor, zeros in the analyticity domain
International Nuclear Information System (INIS)
Morozov, P.T.
1978-01-01
The problem of a stable extrapolation from the cut to an arbitrary interior of the analyticity domain for the pion form factor is formulated and solved. As it is shown a stable solution can be derived if module representations with the Karleman weight function are used as the analyticity conditions. The case when the form factor has zeros is discussed. If there are zeros in the complex plane they must be taken into account when determining the extrapolation function
Energy Technology Data Exchange (ETDEWEB)
Bayraktur, K.N.; Lawson, G.J.
1984-09-01
Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lowerrank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy.
Energy Technology Data Exchange (ETDEWEB)
Bayraktar, K.N.; Lawson, G.J.
1984-09-01
Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lower-rank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash yield and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy. 38 references.
Cui, Licong; Bodenreider, Olivier; Shi, Jay; Zhang, Guo-Qiang
2018-02-01
We introduce a structural-lexical approach for auditing SNOMED CT using a combination of non-lattice subgraphs of the underlying hierarchical relations and enriched lexical attributes of fully specified concept names. Our goal is to develop a scalable and effective approach that automatically identifies missing hierarchical IS-A relations. Our approach involves 3 stages. In stage 1, all non-lattice subgraphs of SNOMED CT's IS-A hierarchical relations are extracted. In stage 2, lexical attributes of fully-specified concept names in such non-lattice subgraphs are extracted. For each concept in a non-lattice subgraph, we enrich its set of attributes with attributes from its ancestor concepts within the non-lattice subgraph. In stage 3, subset inclusion relations between the lexical attribute sets of each pair of concepts in each non-lattice subgraph are compared to existing IS-A relations in SNOMED CT. For concept pairs within each non-lattice subgraph, if a subset relation is identified but an IS-A relation is not present in SNOMED CT IS-A transitive closure, then a missing IS-A relation is reported. The September 2017 release of SNOMED CT (US edition) was used in this investigation. A total of 14,380 non-lattice subgraphs were extracted, from which we suggested a total of 41,357 missing IS-A relations. For evaluation purposes, 200 non-lattice subgraphs were randomly selected from 996 smaller subgraphs (of size 4, 5, or 6) within the "Clinical Finding" and "Procedure" sub-hierarchies. Two domain experts confirmed 185 (among 223) suggested missing IS-A relations, a precision of 82.96%. Our results demonstrate that analyzing the lexical features of concepts in non-lattice subgraphs is an effective approach for auditing SNOMED CT. Copyright © 2017 Elsevier Inc. All rights reserved.
Frontal infraslow activity marks the motor spasms of anti-LGI1 encephalitis.
Wennberg, Richard; Steriade, Claude; Chen, Robert; Andrade, Danielle
2018-01-01
The clinical and electrographic features of seizures in anti-LGI1 encephalitis are distinct from those seen in other autoimmune encephalitides or non-encephalitic epilepsies. One electroclinical phenomenon specific to the condition consists of lateralized motor spasms, known as faciobrachial dystonic seizures (FBDS). An electrodecremental pattern overriding a "DC shift" has been described as the EEG correlate of these spasms. We sought to further characterize this pre-spasm infraslow activity (ISA). Continuous video-EEG recordings were acquired in four patients with anti-LGI1 encephalitis: each had frequent motor spasms/FBDS as well as frequent subclinical temporal lobe seizures (an independent indicator of anti-LGI1 encephalitis). In artifact-free recordings obtained using clinical amplifiers equipped with a low frequency analog filter of 0.07 Hz, ISA reliably preceded clinical onset of the motor spasms by ∼1.2 s and preceded the electrodecremental pattern by ∼700 ms. Pre-spasm ISA was invariably recorded contralateral to FBDS, with a voltage topographic maximum over the mid frontal region. The pre-movement ISA differed from the Bereitschaftspotential in timing and topography and was an order of magnitude higher in amplitude. Sporadic FBDS that occurred in association with temporal lobe seizures were preceded by identical ISA. The motor spasms of anti-LGI1 encephalitis are preceded by frontal ISA. A paucity of data at the microscale level precludes mechanistic explanations at the macroscale level, or even determination of the relative contributions of neurons and glia in the generation of the ISA. Although fundamental cellular mechanisms await elucidation, the pre-spasm ISA represents a singular and readily identifiable EEG response to this autoimmune brain disorder. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.
Traditional medicine as an alternative form of health care system: A ...
African Journals Online (AJOL)
Traditional medicine as an alternative form of health care system: A preliminary case study of Nangabo sub-county, central Uganda. ... African Journal of Traditional, Complementary and Alternative Medicines ... The findings indicated that most (43%) respondents derive their livelihoods from traditional medicine practices.
On a derivation of the Salam-Weinberg model
International Nuclear Information System (INIS)
Squires, E.J.
1979-01-01
It is shown how the graded Lie-algebra structure of a recent derivation of the Salam-Weinberg model might arise from the form of allowed transformations on the lepton lagrangian in a 6-dimensional space. The possibility that the model might allow two identically coupled leptonic sectors, and others in which the chiralites are reversed, are discussed. (Auth.)
Modeling the degradation of a metallic waste form intended for geologic disposal
International Nuclear Information System (INIS)
Bauer, T.H.; Morris, E.E.
2007-01-01
Nuclear reactors operating with metallic fuels have led to development of robust metallic waste forms intended to immobilize hazardous constituents in oxidizing environments. Release data from a wide range of tests where small waste form samples have been immersed in a variety of oxidizing solutions have been analyzed and fit to a mechanistically-derived 'logarithmic growth' form for waste form degradation. A bounding model is described which plausibly extrapolates these fits to long-term degradation in a geologic repository. The resulting empirically-fit degradation model includes dependence on solution pH, temperature, and chloride concentration as well as plausible estimates of statistical uncertainty. (authors)
Form factors and radiation widths of the giant multipole resonances
International Nuclear Information System (INIS)
Denisov, V.Yu.
1990-01-01
Simple analytic relations for the form factors of inelastic electron scattering in the Born approximation and radiation widths of the isovector and isoscalar giant multipole resonances are derived. The dynamic relationship between the volume and surface density vibrations were taken into account in this calculation. The form factors in the Born approximation were found to be in satisfactory agreement with experimental data in the region of small transferred momenta. The radiation widths of isoscalar multipole resonances increase when the number of nucleons increase as A 1/3 , and for isovector resonances this dependence has the form f(A)A 1/3 , where f(A) is a slowly increasing function of A. Radiation widths well fit the experimental data
Derivation of new 3D discrete ordinate equations
International Nuclear Information System (INIS)
Ahrens, C. D.
2012-01-01
The Sn equations have been the workhorse of deterministic radiation transport calculations for many years. Here we derive two new angular discretizations of the 3D transport equation. The first set of equations, derived using Lagrange interpolation and collocation, retains the classical Sn structure, with the main difference being how the scattering source is calculated. Because of the formal similarity with the classical S n equations, it should be possible to modify existing computer codes to take advantage of the new formulation. In addition, the new S n-like equations correctly capture delta function scattering. The second set of equations, derived using a Galerkin technique, does not retain the classical Sn structure because the streaming term is not diagonal. However, these equations can be cast into a form similar to existing methods developed to reduce ray effects. Numerical investigation of both sets of equations is under way. (authors)
Equations of motion for a (non-linear) scalar field model as derived from the field equations
International Nuclear Information System (INIS)
Kaniel, S.; Itin, Y.
2006-01-01
The problem of derivation of the equations of motion from the field equations is considered. Einstein's field equations have a specific analytical form: They are linear in the second order derivatives and quadratic in the first order derivatives of the field variables. We utilize this particular form and propose a novel algorithm for the derivation of the equations of motion from the field equations. It is based on the condition of the balance between the singular terms of the field equation. We apply the algorithm to a non-linear Lorentz invariant scalar field model. We show that it results in the Newton law of attraction between the singularities of the field moved on approximately geodesic curves. The algorithm is applicable to the N-body problem of the Lorentz invariant field equations. (Abstract Copyright [2006], Wiley Periodicals, Inc.)
A Dynamic Programming Approach for Pricing Weather Derivatives under Issuer Default Risk
Directory of Open Access Journals (Sweden)
Wolfgang Karl Härdle
2017-10-01
Full Text Available Weather derivatives are contingent claims with payoff based on a pre-specified weather index. Firms exposed to weather risk can transfer it to financial markets via weather derivatives. We develop a utility-based model for pricing baskets of weather derivatives under default risk on the issuer side in over-the-counter markets. In our model, agents maximise the expected utility of their terminal wealth, while they dynamically rebalance their weather portfolios over a finite investment horizon. Using dynamic programming approach, we obtain semi-closed forms for the equilibrium prices of weather derivatives and for the optimal strategies of the agents. We give an example on how to price rainfall derivatives on selected stations in China in the universe of a financial investor and a weather exposed crop insurer.
Pharmacokinetic and biopharmaceutic aspects of some psoralen derivatives used in dermatology
International Nuclear Information System (INIS)
Stolk, L.M.L.
1982-01-01
In the present thesis the pharmacokinetic and biopharmaceutic properties of some psoralen derivatives, that are used in photochemotherapy of dermatological diseases like vitiligo and psoriasis, are studied. Photochemotherapy is a combination of oral administration of one of the psoralen derivatives, 8-methoxypsoralen (8-MOP), 5-methoxypsoralen (5-MOP) or 4, 5', 8-trimethylpsoralen (TMP), and irradiation with long wave ultraviolet light, U.V.-A (320-400 nm), two hours later. This treatment is commonly called PUVA (Psoralen-UV-A). The purpose of the investigation was to develop an 8-MOP dosage form with a fast and reproducible absorption. Various dosage forms of 8-MOP were administered to volunteers and patients and 8-MOP concentrations in body fluids determined. Also the pharmacokinetic properties of 5-MOP and TMP were investigated in a pilot study. (Auth.)
Functional Forms, Exogenous Shifts, and Economic Surplus Changes
Xueyan Zhao; John D. Mullen; Gary R. Griffith
1997-01-01
Conditions for exact welfare measures in equilibrium displacement modeling are examined. These relate to the functional form of supply and demand, the nature of the exogenous shift, and the definition of percentage changes. Approximation errors when these conditions are not met in empirical applications are investigated and analytical expressions for the errors derived. Significant errors are possible when a proportional shift is assumed. The assumptions underlying Alston and Wohlgenant's emp...
Solubility of radionuclides in a concrete environment for provisional safety analyses for SGT-E2
International Nuclear Information System (INIS)
Berner, U.
2014-08-01
Within stage 2 of the sectoral plan for deep geological repositories for radioactive waste in Switzerland, safety analyses are carried out. In the case of the repository for long lived intermediate level waste (ILW) retention mechanisms include the concentration limits of safety relevant elements in the pore water of the engineered concrete system. The present work describes the evaluation of solubility limits for the safety relevant elements Be, C, Cl, K, Ca, Co, Ni, Se, Sr, Zr, Nb, Mo, Tc, Pd, Ag, Sn, I, Cs, Sm, Eu, Ho, Pb, Po, Ra, Ac, Th, Pa, U, Np, Pu, Am and Cm in the pore water of a concrete system corresponding to a degradation stage characterised by portlandite saturation and by the absence of (Na,K)OH solutes. The term solubility limit denotes the maximum amount of an element dissolving in the pore solution of the considered chemical reference system. For a given solid phase equilibrium, thermodynamics predicts the amount of substance dissolving in the solution and describes the speciation of the considered element in solution. The principles of chemical equilibrium will be the primary work hypothesis in the present work. Solubility calculations were performed with the most recent version of GEMS/PSI using the PSI/Nagra Chemical Thermodynamic Data Base 12/07. The database was complemented with other datasets for elements that were not considered in the mentioned update. Reference values solubilities as well as lower and upper guideline values are evaluated. For many formation constants of solids and solutes, uncertainties are known and allow conveying lower and upper guideline values. In many cases it is not clear whether the most stable solid is formed. In such cases the (kinetically driven) formation of alternative solid phases is included in the derivation of reference and guideline values. Corresponding justifications are given for the individual elements and are an important part of this work. A similar report for an almost identical chemical
Solubility of radionuclides in a concrete environment for provisional safety analyses for SGT-E2
Energy Technology Data Exchange (ETDEWEB)
Berner, U.
2014-08-15
Within stage 2 of the sectoral plan for deep geological repositories for radioactive waste in Switzerland, safety analyses are carried out. In the case of the repository for long lived intermediate level waste (ILW) retention mechanisms include the concentration limits of safety relevant elements in the pore water of the engineered concrete system. The present work describes the evaluation of solubility limits for the safety relevant elements Be, C, Cl, K, Ca, Co, Ni, Se, Sr, Zr, Nb, Mo, Tc, Pd, Ag, Sn, I, Cs, Sm, Eu, Ho, Pb, Po, Ra, Ac, Th, Pa, U, Np, Pu, Am and Cm in the pore water of a concrete system corresponding to a degradation stage characterised by portlandite saturation and by the absence of (Na,K)OH solutes. The term solubility limit denotes the maximum amount of an element dissolving in the pore solution of the considered chemical reference system. For a given solid phase equilibrium, thermodynamics predicts the amount of substance dissolving in the solution and describes the speciation of the considered element in solution. The principles of chemical equilibrium will be the primary work hypothesis in the present work. Solubility calculations were performed with the most recent version of GEMS/PSI using the PSI/Nagra Chemical Thermodynamic Data Base 12/07. The database was complemented with other datasets for elements that were not considered in the mentioned update. Reference values solubilities as well as lower and upper guideline values are evaluated. For many formation constants of solids and solutes, uncertainties are known and allow conveying lower and upper guideline values. In many cases it is not clear whether the most stable solid is formed. In such cases the (kinetically driven) formation of alternative solid phases is included in the derivation of reference and guideline values. Corresponding justifications are given for the individual elements and are an important part of this work. A similar report for an almost identical chemical
Analysis of cold leg LOCA with failed HPSI by means of integrated safety assessment methodology
International Nuclear Information System (INIS)
Gonzalez-Cadelo, J.; Queral, C.; Montero-Mayorga, J.
2014-01-01
Highlights: • Results of ISA for considered sequences endorse EOPs guidance in an original way. • ISA allows to obtain accurate available times for accident management actions. • RCP-trip adequacy and available time for beginning depressurization are evaluated. • ISA minimizes the necessity of expert judgment to perform safety assessment. - Abstract: The integrated safety assessment (ISA) methodology, developed by the Spanish Nuclear Safety Council (CSN), has been applied to a thermal–hydraulic analysis of cold leg LOCA sequences with unavailable High Pressure Injection System in a Westinghouse 3-loop PWR. This analysis has been performed with TRACE 5.0 patch 1 code. ISA methodology allows obtaining the Damage Domain (the region of space of parameters where a safety limit is exceeded) as a function of uncertain parameters (break area) and operator actuation times, and provides to the analyst useful information about the impact of these uncertain parameters in safety concerns. In this work two main issues have been analyzed: the effect of reactor coolant pump trip and the available time for beginning of secondary-side depressurization. The main conclusions are that present Emergency Operating Procedures (EOPs) are adequate for managing this kind of sequences and the ISA methodology is able to take into account time delays and parameter uncertainties
Directory of Open Access Journals (Sweden)
Wang Hao
2012-11-01
Full Text Available Abstract Background Cyanobacteria can form massive toxic blooms in fresh and brackish bodies of water and are frequently responsible for the poisoning of animals and pose a health risk for humans. Anabaena is a genus of filamentous diazotrophic cyanobacteria commonly implicated as a toxin producer in blooms in aquatic ecosystems throughout the world. The biology of bloom-forming cyanobacteria is poorly understood at the genome level. Results Here, we report the complete sequence and comprehensive annotation of the bloom-forming Anabaena sp. strain 90 genome. It comprises two circular chromosomes and three plasmids with a total size of 5.3 Mb, encoding a total of 4,738 genes. The genome is replete with mobile genetic elements. Detailed manual annotation demonstrated that almost 5% of the gene repertoire consists of pseudogenes. A further 5% of the genome is dedicated to the synthesis of small peptides that are the products of both ribosomal and nonribosomal biosynthetic pathways. Inactivation of the hassallidin (an antifungal cyclic peptide biosynthetic gene cluster through a deletion event and a natural mutation of the buoyancy-permitting gvpG gas vesicle gene were documented. The genome contains a large number of genes encoding restriction-modification systems. Two novel excision elements were found in the nifH gene that is required for nitrogen fixation. Conclusions Genome analysis demonstrated that this strain invests heavily in the production of bioactive compounds and restriction-modification systems. This well-annotated genome provides a platform for future studies on the ecology and biology of these important bloom-forming cyanobacteria.
Chauhan, B.; Kumar, S.; Malik, R. P.
2018-02-01
We derive the off-shell nilpotent (fermionic) (anti-)BRST symmetry transformations by exploiting the (anti-)chiral superfield approach (ACSA) to Becchi-Rouet-Stora-Tyutin (BRST) formalism for the interacting Abelian 1-form gauge theories where there is a coupling between the U(1) Abelian 1-form gauge field and Dirac as well as complex scalar fields. We exploit the (anti-)BRST invariant restrictions on the (anti-)chiral superfields to derive the fermionic symmetries of our present D-dimensional Abelian 1-form gauge theories. The novel observation of our present investigation is the derivation of the absolute anticommutativity of the nilpotent (anti-)BRST charges despite the fact that our ordinary D-dimensional theories are generalized onto the (D,1)-dimensional (anti-) chiral super-submanifolds (of the general (D,2)-dimensional supermanifold) where only the (anti-)chiral super expansions of the (anti-)chiral superfields have been taken into account. We also discuss the nilpotency of the (anti-)BRST charges and (anti-)BRST invariance of the Lagrangian densities of our present theories within the framework of ACSA to BRST formalism.
Spontaneous magnetization of quantum XY-chain from finite chain form-factor
International Nuclear Information System (INIS)
Iorgov, N.Z.
2010-01-01
Using the explicit factorized formulas for matrix elements (form-factors) of the spin operators between vectors of the Hamiltonian of a finite quantum XY-chain in a transverse field, the spontaneous magnetization for σ x and σ y is re-derived in a simple way.
Derived ERLs for inhalation of alpha-emitting aerorols
International Nuclear Information System (INIS)
Macdonald, H.F.
1977-01-01
Derived alpha action levels are expressed as dpm/m 3 and give the airborne concentration of an assumed mixture of α-emitters which if inhaled for a period of 4 hours would result in a dose commitment to members of the critical group in the exposed population equal to the emergency reference levels (ERLs) of dose recommended by the Medical Research Council (1975). The period of 4 hours is chosen as a realistic time during which an assessment of the severity of a release may be made and appropriate countermeasures instituted. The derived α ERLs are set with reference to the potential range of isotopic releases for a specific reactor system and in the case of gas-cooled magnox reactors, a value of 10 3 dpm/m 3 (170 Bqm -3 ) has been used. This level was based upon the lung and GI tract models originally recommended by ICRP 2 (1959:1964) and revised ERLs for the inhalation of α-emitters consequent upon the improved metabolic models subsequently proposed by the ICRP (1966:1972) are evaluated. It is shown that the derived α ERLs for irradiated magnox and AGR fuels are largely independent of the physico-chemical forms of the released material, while variations with cooling time of fuel are also discussed. In addition, the special limits imposed by the chemical toxicity of uranium when inhaled in a soluble, low enriched form are briefly outlined
Electric power transmission system: A new expansion scheme
International Nuclear Information System (INIS)
Unidad de Planeacion Minero Energetica, UPME
2000-01-01
With the purpose of responding to the interconnection requirements among the main cities of the country, a company of public character was created, in charge of the planning and of the development of the national interconnected system (NIS), in such form that their work optimized the use of the available energy resources for the electricity supply and it improved the accounting levels and quality of the service. Starting from 1967, interconnection electric Corp., ISA, a very important task began in the development of methodologies and strategies of expansion of the INS that it allowed, in very short term, to connect the areas of Bogota the Atlantic Cost, Antioquia and the Cauca Valley and to develop important generation projects for the supply of electric power of the country. Then, the electric sector was reformed through the laws 142 and 143 of 1994, in search of the specialization of the business and in that sense, ISA is divided in two companies: ISAGEN that the activities degeneration and electric power commercialization, and ISA, company electric power transport, that it takes charge of the interconnection of the national system assumes. In connection with the execution of the transmission works and in the face of the possibility of lingering courts of energy, the law establishes that ISA will carry out the works that are needed and that the particular initiative doesn't develop. For that same time, it is considered that the planning should be carried out in an integral way, taking into account the requirements of the population's energy and its possibilities of supply and through programs and actions of appropriate use of the available energy resources. The UPME (Unit of Planning Miner Energetic) was created for assumes this work, so with their analyses they already offer signs to the state the investors, about the population's necessities and of the business opportunities, respectively
Deviations of the lepton mapping matrix form the harrison-perkins-scott form
International Nuclear Information System (INIS)
Friedberg, R.; Lee, T.D.
2010-01-01
We propose a simple set of hypotheses governing the deviations of the leptonic mapping matrix from the Harrison-Perkins-Scott (HPS) form. These deviations are supposed to arise entirely from a perturbation of the mass matrix in the charged lepton sector. The perturbing matrix is assumed to be purely imaginary (thus maximally T-violating) and to have a strength in energy scale no greater (but perhaps smaller) than the muon mass. As we shall show,it then follows that the absolute value of the mapping matrix elements pertaining to the tau lepton deviate by no more than O((m μ /m τ ) 2 ) ≅ 3.5 x 10 -3 from their HPS values. Assuming that(m μ /m τ ) 2 can be neglected, we derive two simple constraints on the four parameters θ12, θ23, θ31, and δ of the mapping matrix. These constraints are independent of the details of the imaginary T-violating perturbation of the charged lepton mass matrix. We also show that the e and μ parts of the mapping matrix have a definite form governed by two parameters α and β; any deviation of order m μ /m τ can be accommodated by adjusting these two parameters. (authors)
A comparison of integrated safety analysis and probabilistic risk assessment
International Nuclear Information System (INIS)
Damon, Dennis R.; Mattern, Kevin S.
2013-01-01
The U.S. Nuclear Regulatory Commission conducted a comparison of two standard tools for risk informing the regulatory process, namely, the Probabilistic Risk Assessment (PRA) and the Integrated Safety Analysis (ISA). PRA is a calculation of risk metrics, such as Large Early Release Frequency (LERF), and has been used to assess the safety of all commercial power reactors. ISA is an analysis required for fuel cycle facilities (FCFs) licensed to possess potentially critical quantities of special nuclear material. A PRA is usually more detailed and uses more refined models and data than an ISA, in order to obtain reasonable quantitative estimates of risk. PRA is considered fully quantitative, while most ISAs are typically only partially quantitative. The extension of PRA methodology to augment or supplant ISAs in FCFs has long been considered. However, fuel cycle facilities have a wide variety of possible accident consequences, rather than a few surrogates like LERF or core damage as used for reactors. It has been noted that a fuel cycle PRA could be used to better focus attention on the most risk-significant structures, systems, components, and operator actions. ISA and PRA both identify accident sequences; however, their treatment is quite different. ISA's identify accidents that lead to high or intermediate consequences, as defined in 10 Code of Federal Regulations (CFR) 70, and develop a set of Items Relied on For Safety (IROFS) to assure adherence to performance criteria. PRAs identify potential accident scenarios and estimate their frequency and consequences to obtain risk metrics. It is acceptable for ISAs to provide bounding evaluations of accident consequences and likelihoods in order to establish acceptable safety; but PRA applications usually require a reasonable quantitative estimate, and often obtain metrics of uncertainty. This paper provides the background, features, and methodology associated with the PRA and ISA. The differences between the
Alpert, P. A.; Knopf, D. A.
2015-05-01
Immersion freezing is an important ice nucleation pathway involved in the formation of cirrus and mixed-phase clouds. Laboratory immersion freezing experiments are necessary to determine the range in temperature (T) and relative humidity (RH) at which ice nucleation occurs and to quantify the associated nucleation kinetics. Typically, isothermal (applying a constant temperature) and cooling rate dependent immersion freezing experiments are conducted. In these experiments it is usually assumed that the droplets containing ice nuclei (IN) all have the same IN surface area (ISA), however the validity of this assumption or the impact it may have on analysis and interpretation of the experimental data is rarely questioned. A stochastic immersion freezing model based on first principles of statistics is presented, which accounts for variable ISA per droplet and uses physically observable parameters including the total number of droplets (Ntot) and the heterogeneous ice nucleation rate coefficient, Jhet(T). This model is applied to address if (i) a time and ISA dependent stochastic immersion freezing process can explain laboratory immersion freezing data for different experimental methods and (ii) the assumption that all droplets contain identical ISA is a valid conjecture with subsequent consequences for analysis and interpretation of immersion freezing. The simple stochastic model can reproduce the observed time and surface area dependence in immersion freezing experiments for a variety of methods such as: droplets on a cold-stage exposed to air or surrounded by an oil matrix, wind and acoustically levitated droplets, droplets in a continuous flow diffusion chamber (CFDC), the Leipzig aerosol cloud interaction simulator (LACIS), and the aerosol interaction and dynamics in the atmosphere (AIDA) cloud chamber. Observed time dependent isothermal frozen fractions exhibiting non-exponential behavior with time can be readily explained by this model considering varying ISA. An
Rifamycin Derivatives Are Effective Against Staphylococcal Biofilms In Vitro and Elutable From PMMA
2015-04-21
derivatives was determined by assessing the curing time subsequent to loading of ri- famycins and characterizing the release kinetics of rifamycins...ciprofloxacin, clin- damycin, oxacillin, trimethoprim -sulfamethoxazole, vancomycin, and the rifamycin derivatives rifampin, rifabutin, rifapentine, and... determined by plating 10-lL serial dilutions onto MHB agar at 6 and 24 hours after recovery. Assays were per- formed in triplicate. As a qualitative
Increased numbers of spleen colony forming units in B cell deficient CBA/N mice
International Nuclear Information System (INIS)
Wiktor-Jedrzejczak, W.; Krupienicz, A.; Scher, I.
1986-01-01
The formation of exogenous and endogenous spleen colonies was studied in immune-defective mice expressing the CBA/N X-linked xid gene. Bone marrow and spleen cells of immune deficient mice formed increased numbers of eight-day exogenous spleen colonies when transferred to either normal or B cell deficient lethally irradiated recipients. Moreover, defective mice showed increased formation of five-day endogenous spleen colonies (derived from transient endogenous colony forming units; T-CFU) and of ten-day endogenous spleen colonies (derived from CFU-S). Among the possible mechanisms responsible for the observed effects, the most probable appears the one in which decreased numbers of B cell precursors stimulate stem cell pools through a feedback mechanism. (orig.) [de
Directory of Open Access Journals (Sweden)
A. S. Korzhueva
2008-01-01
Full Text Available Abstract. The article concerns interactions between immunoglobulin A and recombinant P6, P7, P8 polypeptides, designed on the basis of externally localized Bac protein of the Group B streptococci, possessing IgA-binding activity.There is a current demand for immunochemical reagents that are strictly specific for IgA, in order to develop antigenic standards for detection of IgA levels in biological fluids, as well as for affinity purification of IgA and its fragments.To analyze an opportunity of the abovementioned application ways for these proteins, a special study was performed to assay an interaction capability of recombinant P6, P7, P8 polypeptides binding to Fc regions of different IgA forms (serum IgA, secretory IgA, subclasses of serum IgA – IgA1, IgA2. Selectivity of ligand binding was specially confirmed.It was found out that, among three presented polypeptides, the structure of recombinant P6 derivative proved to be optimal for IgA-binding ability of Bac protein.Structural features of IgA-binding fragments of Bac protein, i.e., binding site position on the IgA molecule (proximity to epitopes for three monoclonal antibodies, variability of the site structure, as well as resistance of binding site for P6, P7, P8 in IgA molecule against partial disulfide bonds reduction. (Med. Immunol., vol. 10, N 4-5, pp 327-336.
Synthesis of novel ionic liquids from lignin-derived compounds
Socha, Aaron; Singh, Seema; Simmons, Blake A.; Bergeron, Maxime
2017-09-19
Methods and compositions are provided for synthesizing ionic liquids from lignin derived compounds comprising: contacting a starting material comprising lignin with a depolymerization agent to depolymerize the lignin and form a mixture of aldehyde containing compounds; contacting the mixture of aldehyde containing compounds with an amine under conditions suitable to convert the mixture of aldehyde containing compounds to a mixture of amine containing compounds; and contacting the mixture of amine containing compounds with an acid under conditions suitable to form an ammonium salt, thereby preparing the ionic liquid.
Slowness and sparseness have diverging effects on complex cell learning.
Directory of Open Access Journals (Sweden)
Jörn-Philipp Lies
2014-03-01
Full Text Available Following earlier studies which showed that a sparse coding principle may explain the receptive field properties of complex cells in primary visual cortex, it has been concluded that the same properties may be equally derived from a slowness principle. In contrast to this claim, we here show that slowness and sparsity drive the representations towards substantially different receptive field properties. To do so, we present complete sets of basis functions learned with slow subspace analysis (SSA in case of natural movies as well as translations, rotations, and scalings of natural images. SSA directly parallels independent subspace analysis (ISA with the only difference that SSA maximizes slowness instead of sparsity. We find a large discrepancy between the filter shapes learned with SSA and ISA. We argue that SSA can be understood as a generalization of the Fourier transform where the power spectrum corresponds to the maximally slow subspace energies in SSA. Finally, we investigate the trade-off between slowness and sparseness when combined in one objective function.
Very-low speed control of PMSM based on EKF estimation with closed loop optimized parameters.
Xu, Dong; Zhang, Shaoguang; Liu, Jingmeng
2013-11-01
When calculating the speed from the position of permanent magnet synchronous motor (PMSM), the accuracy and real-time are limited by the precision of the sensor. This problem causes crawling and jitter at very-low speed. Using the angle from the position sensor, an extended Kalman filter (EKF) designed in dq-coordinate is presented to solve this problem. The usage of position sensor simplifies the model and improves the accuracy of speed estimation. Specially, a closed loop optimal (CLO) method is devised to overcome the difficulty to adjust the parameters of the EKF. The EKF is the feedback link of speed control, CLO method is derived from the perspective of the speed step response to optimize the measurement covariance matrix and the system covariance matrix of EKF. Simulation and experimental results, comparing the low-speed performance of the EKF and sensor feedback methods, prove the effectiveness of the method to adjust the parameters of EKF and the advantages in eliminating the low speed jitter. © 2013 ISA. Published by ISA. All rights reserved.
International Nuclear Information System (INIS)
Ibánez, L.; Hortal, J.; Queral, C.; Gómez-Magán, J.; Sánchez-Perea, M.; Fernández, I.; Meléndez, E.; Expósito, A.; Izquierdo, J.M.; Gil, J.; Marrao, H.; Villalba-Jabonero, E.
2016-01-01
The Integrated Safety Assessment (ISA) methodology, developed by the Consejo de Seguridad Nuclear, has been applied to an analysis of Zion NPP for sequences with Loss of the Component Cooling Water System (CCWS). The ISA methodology proposal starts from the unfolding of the Dynamic Event Tree (DET). Results from this first step allow assessing the sequence delineation of standard Probabilistic Safety Analysis results. For some sequences of interest of the outlined DET, ISA then identifies the Damage Domain (DD). This is the region of uncertain times and/or parameters where a safety limit is exceeded, which indicates the occurrence of certain damage situation. This paper illustrates application of this concept obtained simulating sequences with MAAP and with TRACE. From information of simulation results of sequence transients belonging to the DD and the time-density probability distributions of the manual actions and of occurrence of stochastic phenomena, ISA integrates the dynamic reliability equations proposed to obtain the sequence contribution to the global Damage Exceedance Frequency (DEF). Reported results show a slight increase in the DEF for sequences investigated following a power uprate from 100% to 110%. This demonstrates the potential use of the method to help in the assessment of design modifications. - Highlights: • This paper illustrates an application of the ISA methodology to safety margins. • Dynamic Event Trees are useful tool for verifying the standard PSA Event Trees. • The ISA methodology takes into account the uncertainties in human action times. • The ISA methodology shows the Damage Exceedance Frequency increase in power uprates.
Sabnis, Shweta S.; Dhavale, Nilesh D.; Jadhav, Vijay. Y.; Gandhi, Santosh V.
2008-03-01
A new simple, economical, rapid, precise and accurate method for simultaneous determination of rabeprazole sodium and itopride hydrochloride in capsule dosage form has been developed. The method is based on ratio spectra derivative spectrophotometry. The amplitudes in the first derivative of the corresponding ratio spectra at 231 nm (minima) and 260 nm were selected to determine rabeprazole sodium and itopride hydrochloride, respectively. The method was validated with respect to linearity, precision and accuracy.
On form factors and correlation functions in twistor space
International Nuclear Information System (INIS)
Koster, Laura; Mitev, Vladimir; Staudacher, Matthias; Wilhelm, Matthias
2017-01-01
In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N k MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.
On form factors and correlation functions in twistor space
Energy Technology Data Exchange (ETDEWEB)
Koster, Laura [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Mitev, Vladimir [PRISMA Cluster of Excellence, Institut für Physik, WA THEP,Johannes Gutenberg-Universität Mainz,Staudingerweg 7, 55128 Mainz (Germany); Staudacher, Matthias [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark)
2017-03-24
In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N{sup k}MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.
Ansari, Imran Shafique
2012-07-31
Error performance is one of the main performance measures and the derivation of its closed-form expression has proved to be quite involved for certain systems. In this paper, a unified closed-form expression, applicable to different binary modulation schemes, for the bit error rate of dual-branch selection diversity based systems undergoing independent but not necessarily identically distributed generalized-K fading is derived in terms of the extended generalized bivariate Meijer G-function.
A Standard Structure for Bile Acids and Derivatives
Directory of Open Access Journals (Sweden)
Francisco Meijide
2018-02-01
Full Text Available The crystal structures of two ester compounds (a monomer in its methyl ester form, with an amino isophthalic group, and a dimer in which the two steroid units are linked by a urea bridge recrystallized from ethyl acetate/methanol derived from cholic acid are described. Average bond lengths and bond angles from the crystal structures of 26 monomers and four dimers (some of them in several solvents of bile acids and esters (and derivatives are used for proposing a standard steroid nucleus. The hydrogen bond network and conformation of the lateral chain are also discussed. This standard structure was used to compare with the structures of both progesterone and cholesterol.
Directory of Open Access Journals (Sweden)
Ladislav Holík
2011-01-01
Full Text Available Enzyme acid phosphomonoesterase (APM plays an important role in phosphorus mineralization in different type of terrestrial ecosystems. This enzyme is of great agronomic significance because it hydrolyses organic phosphorus to different forms of inorganic phosphorus which are assimilable by plants. APM may also indicate changes in the quantity and quality of phosphorylated substrates in soil and is a good indicator of its biological state as well as presence of pollutants. APM may be produced by plant roots and soil microorganisms and both of these sources may play different role in phosphorus mineralization in different ecosystems. The aim of this work was determine acid phosphomonoesterase (APM activity location in soil of different forest ecosystems. The APM activity location determination was performed on the basis of root-derived and soil-derived APM and expression of proportion of those root-derived in total soil APM up to 13 cm depth. The results of this preliminary study showed that root-derived APM formed 21–34 % of total soil APM in pine and oak forest.
Natural goodness and the political form of human life
Directory of Open Access Journals (Sweden)
Müller Jan
2015-01-01
Full Text Available Ethical Naturalism attempts to explain the objective normativity effective in human practices by reference to the relation between a living individual and the life-form it exhibits. This explanation falls short in the case of human beings (1 - not merely because of their essential rationality, but because the idea of normativity implicit in practice is dependent on the form of normativity’s being made explicit (2. I argue that this explicit form of normativity’s force and claim - the law in general - implies a tension between an explicit norm’s claim to absoluteness and the particularity of the situational case it is applied to. This tension may seem to produce an inherent violence corrupting the very idea of objective normativity inherent in the human form of life (3; in fact, it shows that the human form of life is essentially political. That the human form of life is essentially political does not contradict the idea of objective normativity - provided that this objectivity is not derived from a conception of “natural goodness”, but rather from the actuality of human practice and its principle, justice (4.
Characterization of form variants of Xenorhabdus luminescens.
Gerritsen, L J; de Raay, G; Smits, P H
1992-01-01
From Xenorhabdus luminescens XE-87.3 four variants were isolated. One, which produced a red pigment and antibiotics, was luminescent, and could take up dye from culture media, was considered the primary form (XE-red). A pink-pigmented variant (XE-pink) differed from the primary form only in pigmentation and uptake of dye. Of the two other variants, one produced a yellow pigment and fewer antibiotics (XE-yellow), while the other did not produce a pigment or antibiotics (XE-white). Both were less luminescent, did not take up dye, and had small cell and colony sizes. These two variants were very unstable and shifted to the primary form after 3 to 5 days. It was not possible to separate the primary form and the white variant completely; subcultures of one colony always contained a few colonies of the other variant. The white variant was also found in several other X. luminescens strains. DNA fingerprints showed that all four variants are genetically identical and are therefore derivatives of the same parent. Protein patterns revealed a few differences among the four variants. None of the variants could be considered the secondary form. The pathogenicity of the variants decreased in the following order: XE-red, XE-pink, XE-yellow, and XE-white. The mechanism and function of this variability are discussed. Images PMID:1622273
Kuldeep, B; Singh, V K; Kumar, A; Singh, G K
2015-01-01
In this article, a novel approach for 2-channel linear phase quadrature mirror filter (QMF) bank design based on a hybrid of gradient based optimization and optimization of fractional derivative constraints is introduced. For the purpose of this work, recently proposed nature inspired optimization techniques such as cuckoo search (CS), modified cuckoo search (MCS) and wind driven optimization (WDO) are explored for the design of QMF bank. 2-Channel QMF is also designed with particle swarm optimization (PSO) and artificial bee colony (ABC) nature inspired optimization techniques. The design problem is formulated in frequency domain as sum of L2 norm of error in passband, stopband and transition band at quadrature frequency. The contribution of this work is the novel hybrid combination of gradient based optimization (Lagrange multiplier method) and nature inspired optimization (CS, MCS, WDO, PSO and ABC) and its usage for optimizing the design problem. Performance of the proposed method is evaluated by passband error (ϕp), stopband error (ϕs), transition band error (ϕt), peak reconstruction error (PRE), stopband attenuation (As) and computational time. The design examples illustrate the ingenuity of the proposed method. Results are also compared with the other existing algorithms, and it was found that the proposed method gives best result in terms of peak reconstruction error and transition band error while it is comparable in terms of passband and stopband error. Results show that the proposed method is successful for both lower and higher order 2-channel QMF bank design. A comparative study of various nature inspired optimization techniques is also presented, and the study singles out CS as a best QMF optimization technique. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Peer Effects in Exogenously Formed University Student Groups
Gregory Androushchak; Oleg Poldin; Maria Yudkevich
2012-01-01
We estimate the influence of classmates’ ability characteristics on student achievement in exogenously formed student groups. The study uses administrative data on undergraduate students at a large selective university in Russia. The presence of high-ability classmates has a positive effect on individual academic performance, and students at the top of the ability distribution derive the greatest benefit from their presence. An increase in the proportion of less able students has an insignifi...
Directory of Open Access Journals (Sweden)
Dimal A. Shah
2017-02-01
Full Text Available A simple and accurate method for the analysis of ibuprofen (IBU and famotidine (FAM in their combined dosage form was developed using second order derivative spectrophotometery. IBU and FAM were quantified using second derivative responses at 272.8 nm and 290 nm in the spectra of their solutions in methanol. The calibration curves were linear in the concentration range of 100–600 μg/mL for IBU and 5–25 μg/mL for FAM. The method was validated and found to be accurate and precise. Developed method was successfully applied for the estimation of IBU and FAM in their combined dosage form.
Derivative self-interactions for a massive vector field
Energy Technology Data Exchange (ETDEWEB)
Beltrán Jiménez, Jose, E-mail: jose.beltran@cpt.univ-mrs.fr [CPT, Aix Marseille Université, UMR 7332, 13288 Marseille (France); Heisenberg, Lavinia, E-mail: lavinia.heisenberg@eth-its.ethz.ch [Institute for Theoretical Studies, ETH Zurich, Clausiusstrasse 47, 8092 Zurich (Switzerland)
2016-06-10
In this work we revisit the construction of theories for a massive vector field with derivative self-interactions such that only the 3 desired polarizations corresponding to a Proca field propagate. We start from the decoupling limit by constructing healthy interactions containing second derivatives of the Stueckelberg field with itself and also with the transverse modes. The resulting interactions can then be straightforwardly generalized beyond the decoupling limit. We then proceed to a systematic construction of the interactions by using the Levi–Civita tensors. Both approaches lead to a finite family of allowed derivative self-interactions for the Proca field. This construction allows us to show that some higher order terms recently introduced as new interactions trivialize in 4 dimensions by virtue of the Cayley–Hamilton theorem. Moreover, we discuss how the resulting derivative interactions can be written in a compact determinantal form, which can also be regarded as a generalization of the Born-Infeld lagrangian for electromagnetism. Finally, we generalize our results for a curved background and give the necessary non-minimal couplings guaranteeing that no additional polarizations propagate even in the presence of gravity.
The quadratic-form identity for constructing the Hamiltonian structure of integrable systems
International Nuclear Information System (INIS)
Guo Fukui; Zhang Yufeng
2005-01-01
A usual loop algebra, not necessarily the matrix form of the loop algebra A-tilde n-1 , is also made use of for constructing linear isospectral problems, whose compatibility conditions exhibit a zero-curvature equation from which integrable systems are derived. In order to look for the Hamiltonian structure of such integrable systems, a quadratic-form identity is created in the present paper whose special case is just the trace identity; that is, when taking the loop algebra A-tilde 1 , the quadratic-form identity presented in this paper is completely consistent with the trace identity
Nam, Sungsik
2010-11-01
Previous work on performance analyses of generalized selection combining (GSC) RAKE receivers based on the signal to noise ratio focused on the development of methodologies to derive exact closed-form expressions for various performance measures. However, some open problems related to the performance evaluation of GSC RAKE receivers still remain to be solved such that an assessment of the impact of self-interference on the performance of GSC RAKE receivers. To have a full and exact understanding of the performance of GSC RAKE receivers, the outage probability of GSC RAKE receivers needs to be analyzed as closed-form expressions. The major difficulty in this problem is to derive some joint statistics of ordered exponential variates. With this motivation in mind, we capitalize in this paper on some new order statistics results to derive exact closed-form expressions for outage probability of GSC RAKE receivers subject to self-interference over independent and identically distributed Rayleigh fading channels. © 2010 IEEE.
El-Yazbi, F A; Abdine, H H; Shaalan, R A
1999-06-01
Three sensitive and accurate methods are presented for the determination of benazepril in its dosage forms. The first method uses derivative spectrophotometry to resolve the interference due to formulation matrix. The second method depends on the color formed by the reaction of the drug with bromocresol green (BCG). The third one utilizes the reaction of benazepril, after alkaline hydrolysis, with 3-methylbenzothialozone (MBTH) hydrazone where the produced color is measured at 593 nm. The latter method was extended to develop a stability-indicating method for this drug. Moreover, the derivative method was applied for the determination of benazepril in its combination with hydrochlorothiazide. The proposed methods were applied for the analysis of benazepril in the pure form and in tablets. The coefficient of variation was less than 2%.
DEFF Research Database (Denmark)
Andersen, Torben Juul
approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...
Sen, Sambuddha; Cowan, J A
2017-10-01
Monothiol glutaredoxins (Grx) serve as intermediate cluster carriers in iron-sulfur cluster trafficking. The [2Fe-2S]-bound holo forms of Grx proteins display cysteinyl coordination from exogenous glutathione (GSH), in addition to contact from protein-derived Cys. Herein, we report mechanistic studies that investigate the role of exogenous glutathione in defining cluster chirality, ligand exchange, and the cluster transfer chemistry of Saccharomyces cerevisiae Grx3. Systematic perturbations were introduced to the glutathione-binding site by substitution of conserved charged amino acids that form crucial electrostatic contacts with the glutathione molecule. Native Grx3 could also be reconstituted in the absence of glutathione, with either DTT, BME or free L-cysteine as the source of the exogenous Fe-S ligand contact, while retaining full functional reactivity. The delivery of the [2Fe-2S] cluster to Grx3 from cluster donor proteins such as Isa, Nfu, and a [2Fe-2S](GS) 4 complex, revealed that electrostatic contacts are of key importance for positioning the exogenous glutathione that in turn influences the chiral environment of the cluster. All Grx3 derivatives were reconstituted by standard chemical reconstitution protocols and found to transfer cluster to apo ferredoxin 1 (Fdx1) at rates comparable to native protein, even when using DTT, BME or free L-cysteine as a thiol source in place of GSH during reconstitution. Kinetic analysis of cluster transfer from holo derivatives to apo Fdx1 has led to a mechanistic model for cluster transfer chemistry of native holo Grx3, and identification of the likely rate-limiting step for the reaction.
Design of the RISC-V Instruction Set Architecture
Waterman, Andrew Shell
2016-01-01
The hardware-software interface, embodied in the instruction set architecture (ISA), is arguably the most important interface in a computer system. Yet, in contrast to nearly all other interfaces in a modern computer system, all commercially popular ISAs are proprietary. A free and open ISA standard has the potential to increase innovation in microprocessor design, reduce computer system cost, and, as Moore’s law wanes, ease the transition to more specialized computational devices.In this d...
Effect of amino acids and amino acid derivatives on crystallization of hemoglobin and ribonuclease A
International Nuclear Information System (INIS)
Ito, Len; Kobayashi, Toyoaki; Shiraki, Kentaro; Yamaguchi, Hiroshi
2008-01-01
The effect of the addition of amino acids and amino acid derivatives on the crystallization of hemoglobin and ribonuclease A has been evaluated. The results showed that certain types of additives expand the concentration conditions in which crystals are formed. Determination of the appropriate conditions for protein crystallization remains a highly empirical process. Preventing protein aggregation is necessary for the formation of single crystals under aggregation-prone solution conditions. Because many amino acids and amino acid derivatives offer a unique combination of solubility and stabilizing properties, they open new avenues into the field of protein aggregation research. The use of amino acids and amino acid derivatives can potentially influence processes such as heat treatment and refolding reactions. The effect of the addition of several amino acids, such as lysine, and several amino acid derivatives, such as glycine ethyl ester and glycine amide, on the crystallization of equine hemoglobin and bovine pancreatic ribonuclease A has been examined. The addition of these amino acids and amino acid derivatives expanded the range of precipitant concentration in which crystals formed without aggregation. The addition of such additives appears to promote the crystallization of proteins
Effect of amino acids and amino acid derivatives on crystallization of hemoglobin and ribonuclease A
Energy Technology Data Exchange (ETDEWEB)
Ito, Len, E-mail: len@ksc.kwansei.ac.jp; Kobayashi, Toyoaki [School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Shiraki, Kentaro [Institute of Applied Physics, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8573 (Japan); Yamaguchi, Hiroshi [School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2008-05-01
The effect of the addition of amino acids and amino acid derivatives on the crystallization of hemoglobin and ribonuclease A has been evaluated. The results showed that certain types of additives expand the concentration conditions in which crystals are formed. Determination of the appropriate conditions for protein crystallization remains a highly empirical process. Preventing protein aggregation is necessary for the formation of single crystals under aggregation-prone solution conditions. Because many amino acids and amino acid derivatives offer a unique combination of solubility and stabilizing properties, they open new avenues into the field of protein aggregation research. The use of amino acids and amino acid derivatives can potentially influence processes such as heat treatment and refolding reactions. The effect of the addition of several amino acids, such as lysine, and several amino acid derivatives, such as glycine ethyl ester and glycine amide, on the crystallization of equine hemoglobin and bovine pancreatic ribonuclease A has been examined. The addition of these amino acids and amino acid derivatives expanded the range of precipitant concentration in which crystals formed without aggregation. The addition of such additives appears to promote the crystallization of proteins.
Pathway computation in models derived from bio-science text sources
DEFF Research Database (Denmark)
Andreasen, Troels; Bulskov, Henrik; Jensen, Per Anker
2017-01-01
This paper outlines a system, OntoScape, serving to accomplish complex inference tasks on knowledge bases and bio-models derived from life-science text corpora. The system applies so-called natural logic, a form of logic which is readable for humans. This logic affords ontological representations...
Double layers formed by beam driven ion-acoustic turbulence
International Nuclear Information System (INIS)
Ludwig, G.O.; Ferreira, J.L.; Montes, A.
1987-01-01
Small amplitude steady-state ion-acoustic layers are observed to form in a plasma traversed by a beam of cold electrons. The importance of turbulence in maintaining the double layer is demonstrated. The measured wave spectrum is in approximate agrreement with models derived from renormalized turbulence theory. The general features of the double layer are compared with results from particle simulation studies. (author) [pt
"Domestic Violence" and Different Forms of Conciliation
Directory of Open Access Journals (Sweden)
Guita Grin Debert
2008-01-01
Full Text Available Alternative conflict resolution based on conciliation have been identified as a possible response to problems of access to courts deriving from the numbers, costs and length of proceedings in the Brazilian's judicial system. This paper focuses on these alternative forms of justice, regarding domestic violence. Using ethnographic studies of Women's Police Stations and at Small Claim Courts, we argue that conciliation can be very different in these two institutions of the judicial system. The contrasts between moral values and the symbols used in different forms by these two institutions offer elements that can further be our understanding of the context in which Maria da Penha Law was created on August 17th of 2006. With the promulgation of this law, cases of domestic violence against women were excluded from Small Claim Courts in Brazil.
Differential form representation of stochastic electromagnetic fields
Haider, Michael; Russer, Johannes A.
2017-09-01
In this work, we revisit the theory of stochastic electromagnetic fields using exterior differential forms. We present a short overview as well as a brief introduction to the application of differential forms in electromagnetic theory. Within the framework of exterior calculus we derive equations for the second order moments, describing stochastic electromagnetic fields. Since the resulting objects are continuous quantities in space, a discretization scheme based on the Method of Moments (MoM) is introduced for numerical treatment. The MoM is applied in such a way, that the notation of exterior calculus is maintained while we still arrive at the same set of algebraic equations as obtained for the case of formulating the theory using the traditional notation of vector calculus. We conclude with an analytic calculation of the radiated electric field of two Hertzian dipole, excited by uncorrelated random currents.
Selective Oxidation of Biomass-Derived Chemicals
DEFF Research Database (Denmark)
Modvig, Amalie Elise
. These processes should be able to compete with the established processes based on fossil resources. Glycolaldehyde is an often-observed by-product formed from degradation of larger sugars. Due to competing ecological and economical aspects of the well-established processes for extraction and conversion....... The objective of this dissertation was to develop new, alternative and sustainable methods for oxidative catalytic upgrading of biomass-derived compounds, with focus on oxidation of glycolaldehyde and simple alcohols as model substrates for larger sugars. Supported gold nanoparticle were studied...
Yahata, Yoshio; Masuda, Yoshiko; Komabayashi, Takashi
2017-12-01
The aim of this study was to compare the apical centring ability of incisal-shifted access (ISA) with that of traditional lingual access (TLA). Fifteen three-dimensional printed resin models were prepared from the computed tomography data for a human maxillary central incisor and divided into ISA (n = 7), TLA (n = 7) and control (n = 1) groups. After access preparation, these models were shaped to the working length using K-files up to #40, followed by step-back procedures. An apical portion of the model was removed at 0.5 mm coronal to the working length. Microscopic images of each cutting surface were taken to measure the preparation area and the distance of transportation. TLA created a larger preparation area than ISA (P < 0.05). The distance of transportation (mean ± standard deviation) was 0.4 ± 0.1 mm for ISA and 0.7 ± 0.1 mm for TLA (P < 0.05). Access cavity preparation has a significant effect on apical centring ability. ISA is beneficial to maintaining apical configuration. © 2017 Australian Society of Endodontology Inc.
Higher order alchemical derivatives from coupled perturbed self-consistent field theory.
Lesiuk, Michał; Balawender, Robert; Zachara, Janusz
2012-01-21
We present an analytical approach to treat higher order derivatives of Hartree-Fock (HF) and Kohn-Sham (KS) density functional theory energy in the Born-Oppenheimer approximation with respect to the nuclear charge distribution (so-called alchemical derivatives). Modified coupled perturbed self-consistent field theory is used to calculate molecular systems response to the applied perturbation. Working equations for the second and the third derivatives of HF/KS energy are derived. Similarly, analytical forms of the first and second derivatives of orbital energies are reported. The second derivative of Kohn-Sham energy and up to the third derivative of Hartree-Fock energy with respect to the nuclear charge distribution were calculated. Some issues of practical calculations, in particular the dependence of the basis set and Becke weighting functions on the perturbation, are considered. For selected series of isoelectronic molecules values of available alchemical derivatives were computed and Taylor series expansion was used to predict energies of the "surrounding" molecules. Predicted values of energies are in unexpectedly good agreement with the ones computed using HF/KS methods. Presented method allows one to predict orbital energies with the error less than 1% or even smaller for valence orbitals. © 2012 American Institute of Physics
Primary migration of Jurassic coal-derived oil in Santanghu basin
Energy Technology Data Exchange (ETDEWEB)
Zhang, W.; Zhong, N.; Ren, D. [China University of Mining and Technology, Beijing (China). Dept of Resource Exploitation Engineering
2000-11-01
It is known that the differential evolution of the multiple macerals results in 'oil generation by stage', and that 'early generation, early expulsion' is one of the preconditions for the efficient accumulation of the coal-derived oil. Based upon the study on the evolution of the physical properties, related to the hydrocarbon expulsion, of the Jurassic organic rock in Santanghu basin during the course of maturation, the mechanism of the primary migration of its coal-derived oil was discussed. The rapid loss of the inherent moisture in the organic rock was not accordant with the main generation stage of the coal-derived oil, so it was unrealistic that the oil migrated by dissolution in the expelled water. It is thought that the special forming mechanism of the continuous 'bitumen network' under the condition of over-pressure and an earlier history of primary migration may be essential to the Jurassic coal-derived oil in Santanghu basin. 17 refs., 4 figs.
Incidence Rate of Canonical vs. Derived Medical Terminology in Natural Language.
Topac, Vasile; Jurcau, Daniel-Alexandru; Stoicu-Tivadar, Vasile
2015-01-01
Medical terminology appears in the natural language in multiple forms: canonical, derived or inflected form. This research presents an analysis of the form in which medical terminology appears in Romanian and English language. The sources of medical language used for the study are web pages presenting medical information for patients and other lay users. The results show that, in English, medical terminology tends to appear more in canonical form while, in the case of Romanian, it is the opposite. This paper also presents the service that was created to perform this analysis. This tool is available for the general public, and it is designed to be easily extensible, allowing the addition of other languages.
Finite volume form factors in the presence of integrable defects
International Nuclear Information System (INIS)
Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.
2014-01-01
We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee–Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee–Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found
Jiang, Jianfei; Bakan, Ahmet; Kapralov, Alexandr A; Silva, K Ishara; Huang, Zhentai; Amoscato, Andrew A; Peterson, James; Garapati, Venkata Krishna; Saxena, Sunil; Bayir, Hülya; Atkinson, Jeffrey; Bahar, Ivet; Kagan, Valerian E
2014-06-01
Mitochondria have emerged as the major regulatory platform responsible for the coordination of numerous metabolic reactions as well as cell death processes, whereby the execution of intrinsic apoptosis includes the production of reactive oxygen species fueling oxidation of cardiolipin (CL) catalyzed by cytochrome (Cyt) c. As this oxidation occurs within the peroxidase complex of Cyt c with CL, the latter represents a promising target for the discovery and design of drugs with antiapoptotic mechanisms of action. In this work, we designed and synthesized a new group of mitochondria-targeted imidazole-substituted analogs of stearic acid TPP-n-ISAs with various positions of the attached imidazole group on the fatty acid (n = 6, 8, 10, 13, and 14). By using a combination of absorption spectroscopy and EPR protocols (continuous wave electron paramagnetic resonance and electron spin echo envelope modulation) we demonstrated that TPP-n-ISAs indeed were able to potently suppress CL-induced structural rearrangements in Cyt c, paving the way to its peroxidase competence. TPP-n-ISA analogs preserved the low-spin hexa-coordinated heme-iron state in Cyt c/CL complexes whereby TPP-6-ISA displayed a significantly more effective preservation pattern than TPP-14-ISA. Elucidation of these intermolecular stabilization mechanisms of Cyt c identified TPP-6-ISA as an effective inhibitor of the peroxidase function of Cyt c/CL complexes with a significant antiapoptotic potential realized in mouse embryonic cells exposed to ionizing irradiation. These experimental findings were detailed and supported by all-atom molecular dynamics simulations. Based on the experimental data and computation predictions, we identified TPP-6-ISA as a candidate drug with optimized antiapoptotic potency. Copyright © 2014 Elsevier Inc. All rights reserved.
Approximate *-derivations and approximate quadratic *-derivations on C*-algebras
Directory of Open Access Journals (Sweden)
Park Choonkil
2011-01-01
Full Text Available Abstract In this paper, we prove the stability of *-derivations and of quadratic *-derivations on Banach *-algebras. We moreover prove the superstability of *-derivations and of quadratic *-derivations on C*-algebras. 2000 Mathematics Subject Classification: 39B52; 47B47; 46L05; 39B72.
International Nuclear Information System (INIS)
Nazareth, J. L.
1979-01-01
1 - Description of problem or function: OCOPTR and DRVOCR are computer programs designed to find minima of non-linear differentiable functions f: R n →R with n dimensional domains. OCOPTR requires that the user only provide function values (i.e. it is a derivative-free routine). DRVOCR requires the user to supply both function and gradient information. 2 - Method of solution: OCOPTR and DRVOCR use the variable metric (or quasi-Newton) method of Davidon (1975). For OCOPTR, the derivatives are estimated by finite differences along a suitable set of linearly independent directions. For DRVOCR, the derivatives are user- supplied. Some features of the codes are the storage of the approximation to the inverse Hessian matrix in lower trapezoidal factored form and the use of an optimally-conditioned updating method. Linear equality constraints are permitted subject to the initial Hessian factor being chosen correctly. 3 - Restrictions on the complexity of the problem: The functions to which the routine is applied are assumed to be differentiable. The routine also requires (n 2 /2) + 0(n) storage locations where n is the problem dimension
Study of transitory forms of carotenoids
International Nuclear Information System (INIS)
Mathis, Paul
1970-01-01
In order to explain the biological role of the carotenoids their transitory forms were studied with an apparatus measuring the small (∼10 -3 ) short-lived (100 ns to 1 ms) optical density variations obtained by excitation with a ruby laser. Two forms were studied: a) Triplet state 3 Car. - This state (t 1/2 ∼6 μs) is obtained not by direct excitation but by T-T energy transfer from chlorophyll, in different media (chloroplasts, pigments in solution or in micelle). Two arguments can be advanced to explain in terms of triplet energy transfer an essential biological role of carotenoids, protection against photodynamic effects: - the energy level of 3 Car is lower than that of the singlet of oxygen; - in vivo the T-T transfer from chlorophyll to the carotenoids is very fast: 30 ns.. b) Radical cation Car + . - This form is obtained by electron transfer from carotene to the triplet of Toluidine Blue, in ethanol. Car + (t 1/2 ∼200 μs) shows a strong absorption band at 910 nm. The properties of Car + are discussed in relation to other polyene derivatives and to hydrocarbon ions. Car + could be involved in certain biological electron transfers. (author) [fr
Method development and validation of potent pyrimidine derivative by UV-VIS spectrophotometer.
Chaudhary, Anshu; Singh, Anoop; Verma, Prabhakar Kumar
2014-12-01
A rapid and sensitive ultraviolet-visible (UV-VIS) spectroscopic method was developed for the estimation of pyrimidine derivative 6-Bromo-3-(6-(2,6-dichlorophenyl)-2-(morpolinomethylamino) pyrimidine4-yl) -2H-chromen-2-one (BT10M) in bulk form. Pyrimidine derivative was monitored at 275 nm with UV detection, and there is no interference of diluents at 275 nm. The method was found to be linear in the range of 50 to 150 μg/ml. The accuracy and precision were determined and validated statistically. The method was validated as a guideline. The results showed that the proposed method is suitable for the accurate, precise, and rapid determination of pyrimidine derivative. Graphical Abstract Method development and validation of potent pyrimidine derivative by UV spectroscopy.
Stolarczyk, Mariusz; Maślanka, Anna; Apola, Anna; Rybak, Wojciech; Krzek, Jan
2015-09-05
Fast, accurate and precise method for the determination of zofenopril and fluvastatin was developed using spectrophotometry of the first (D1), second (D2), and third (D3) order derivatives in two-component mixtures and in pharmaceutical preparations. It was shown, that the developed method allows for the determination of the tested components in a direct manner, despite the apparent interference of the absorption spectra in the UV range. For quantitative determinations, "zero-crossing" method was chosen, appropriate wavelengths for zofenopril were: D1 λ=270.85 nm, D2 λ=286.38 nm, D3 λ=253.90 nm. Fluvastatin was determined at wavelengths: D1 λ=339.03 nm, D2 λ=252.57 nm, D3 λ=258.50 nm, respectively. The method was characterized by high sensitivity and accuracy, for zofenopril LOD was in the range of 0.19-0.87 μg mL(-1), for fluvastatin 0.51-1.18 μg mL(-1), depending on the class of derivative, and for zofenopril and fluvastatin LOQ was 0.57-2.64 μg mL(-1) and 1.56-3.57 μg mL(-1), respectively. The recovery of individual components was within the range of 100±5%. For zofenopril, the linearity range was estimated between 7.65 μg mL(-1) and 22.94 μg mL(-1), and for fluvastatin between 5.60 μg mL(-1) and 28.00 μg mL(-1). Copyright © 2015 Elsevier B.V. All rights reserved.
Square well model and the functional form for the resonance integral
International Nuclear Information System (INIS)
Raina, V.; Srivastava, P.K.; Sane, K.V.
1975-01-01
It is shown that the relation β = eta(Z 1 Z 2 )/sup 1/2/ exp/broken bracket/ -X(Z 1 + Z 2 )R/broken bracket//R can be derived by assuming that the effective potential in π-electron systems can be approximated by a three-dimensional square well form. (U.S.)
Velocity form of the Kohn-Sham frequency-dependent polarizability equations
International Nuclear Information System (INIS)
Bartolotti, L.J.
1987-01-01
A single equation is derived for the determination of the first-order correction to the frequency-dependent density, due to the perturbation of a time-varying electric field. This new expression for the first-order correction to the frequency-dependent Kohn-Sham amplitudes depends explicitly upon the velocity form of the dipole-moment operator and the square of the Kohn-Sham Hamiltonian
Generalized Faraday law derived from classical forces in a rotating frame
International Nuclear Information System (INIS)
Choi, Taeseung
2010-01-01
We show that an additional spin-dependent classical force due to the rotation of an electron spin's rest frame is essential to derive a spin-Faraday law that has the same form as the usual Faraday law. We show that the contribution of the additional spin-dependent force to the spin-Faraday law is the same as the time derivative of the spin geometric phase. With this observations, the spin-Faraday law is generalized to include both an Aharonov-Casher (AC) effect and a scalar AC effect in a unified manner.
Differential form representation of stochastic electromagnetic fields
Directory of Open Access Journals (Sweden)
M. Haider
2017-09-01
Full Text Available In this work, we revisit the theory of stochastic electromagnetic fields using exterior differential forms. We present a short overview as well as a brief introduction to the application of differential forms in electromagnetic theory. Within the framework of exterior calculus we derive equations for the second order moments, describing stochastic electromagnetic fields. Since the resulting objects are continuous quantities in space, a discretization scheme based on the Method of Moments (MoM is introduced for numerical treatment. The MoM is applied in such a way, that the notation of exterior calculus is maintained while we still arrive at the same set of algebraic equations as obtained for the case of formulating the theory using the traditional notation of vector calculus. We conclude with an analytic calculation of the radiated electric field of two Hertzian dipole, excited by uncorrelated random currents.
Constraints on the ωπ form factor from analyticity and unitarity
International Nuclear Information System (INIS)
Ananthanarayan, B.; Caprini, I.; Kubis, B.
2014-01-01
Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)
Constraints on the ωπ form factor from analyticity and unitarity
Energy Technology Data Exchange (ETDEWEB)
Ananthanarayan, B. [Indian Institute of Science, Centre for High Energy Physics, Bangalore (India); Caprini, I. [Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O.B. MG-6, Magurele (Romania); Kubis, B. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen-und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany)
2014-12-01
Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)
Directory of Open Access Journals (Sweden)
Yulia Yelnikova
2016-11-01
Full Text Available Under conditions of intensive strengthening of globalization of world financial markets and deepening of the crisis, the main source of which are financial markets, financial derivatives market is rapidly developing. In such circumstances, we observe very active growing demand for tools, the main purpose of which is to reduce the financial risk – derivatives. Outlined trend has also involved Ukraine. In this connection, there is an objective need to develop estimate the interconnection of the money and stock markets and derivatives market. It should be kept in mind that achieving the outlined goal is possible only under condition of the full understanding of the scientific and methodological principles of the development of these markets. Purpose is to estimate the interconnection of the money and stock markets and derivatives market by building a mathematical model of system of structural equations that will promote the compilation of scientifically based program of derivatives market. Methodology. By using methods of economic-mathematical modelling were estimated the degree of influence of studied markets factors on financial derivatives market development and by changing this or that factor were predicted future trends of its operations. Results of the survey showed the current state and problems of derivatives market functioning. At the same time, our study allowed us to talk, that factors of the money and stock markets have a different impact on the derivatives market. So, the majority of money market factors have a reverse influence on the development of derivatives market. Instead, the stock market has a direct influence. Practical implications. The proposed scientific and methodical approach to evaluating the impact of factors on the derivatives market allows: influenced by different factors; to conduct a qualitative interpretation of the quantitative changes in the level of market development; to form a complete system of state
Lutidine-derived Ru-CNC hydrogenation pincer catalysts with versatile coordination properties
Filonenko, Georgy A.; Cosimi, Elena; Lefort, Laurent; Conley, Matthew P.; Copéret, Christophe; Lutz, Martin; Hensen, Emiel J M; Pidko, Evgeny A.
2014-01-01
Lutidine-derived bis-N-heterocyclic carbene (NHC) ruthenium CNC-pincer complexes (Ru-CNC's) were prepared. Depending on the synthetic procedure, normal (1, 2) or mixed normal/abnormal NHC-complexes (3) are formed. In the presence of phosphazene base, Ru-CNC complexes activate nitriles to give
A conformational study of proline derivatives
Directory of Open Access Journals (Sweden)
M.E. Kamwaya
2002-12-01
Full Text Available From the study of the structures and molecular conformations of a number of proline derivatives, some conclusions were drawn. The widening effect of angle Cα-C'-N' is caused by steric repulsion between a hydrogen atom at Cα of the preceding prolyl residue with any other at either Cα or Cδ of the pyrrolidine ring cis to it. This effect is influenced by the distance between the said hydrogen atoms: the nearer this distance is, the greater is the steric repulsion and the wider is the angle of steric repulsion. The ratio of the angle of steric repulsion to the distance between Cα and the following Cα (or Cδ cis to it is approximately 40 and 41 for peptides with trans and cis configurations, respectively. The torsion angle ranges for χ1, χ3, χ 4, θ and φ in these derivatives are widened more than usual. The highest vibration, which more often takes place at either the Cβ or Cγ of the pyrrolidine ring, does so not necessarily at the one that is puckered. A Δ&psi -relationship is established, for the determination of α-helixity or collageneity, also in small peptides and amino acids that contain proline. The Δ&psi-relationship is versatile and gives about +180o and –180o for the two categories, respectively. The distance between the carbonyl and hydroxyl (or otherwise terminal end atoms is minimal (2.2 Å and constant, for all peptides. The ratios of the angles at the carbonyl carbons (O'-C'-N' or (O'-C'-O' to this distance is also constant: 56 and 57 for the cis and trans confirgurations, respectively; i.e. a proline O'-C'-N'- (or O'-C'-O'-test, hereinafter called the CT-test, has been established for the determination of cis and trans configurations. It is also established in these proline derivatives, that whereas puckering takes place at Cβ for the CS form, it does so at Cγ for the C2 form.
Experiment and exploration forms of world-disclosure : from epistemology to Bildung
Ahrens, Sönke
2014-01-01
This book deals with contemporary epistemological questions, connecting Educational Philosophy with the field of Science- and Technology Studies. It can be understood as a draft of a general theory of world-disclosure, which is in its core a distinction between two forms of world-disclosure: experiment and exploration. These two forms have never been clearly distinguished before. The focus lies on the experimental form of world-disclosure, which is described in detail and in contrast to the explorational form along the line of twenty-one characteristics, which are mainly derived from empirical studies of experimental work in the field of natural sciences. It can also be understood as an attempt to integrate elements of the Anglo-Saxon Philosophy of Science with elements of the German tradition of Educational Philosophy. This is also reflected in the style of writing. In accordance to the content-level of the book, the argument for experimental forms of world-disclosure is written in an essayistic, readable st...
African Journals Online (AJOL)
Items 1 - 50 of 81 ... Idrus, N. M. · Idrus, Z · Ighilhariz, Z. Ihsan, Y.N. · Illarionov, V.V. · Illarionova, T.V. · Imani, K · Inal, MK · Inalkaeva, K.S. · Inaloo, R · Inaloo, R. Inayah, A.A. · Indera, N.I. · Irandoost, M. Irandoust, M. Iranshahi, D. Mehrdad · Iravan Masoudi Asl, B · Ireana Yusra, A.F. · Irwan, Z · Isa, E.D.M. · Isa, K.N.A · Isa, M.F.M.
Faria, T.; Magalhaes, L. T.
The paper addresses, for retarded functional differential equations (FDEs), the computation of normal forms associated with the flow on a finite-dimensional invariant manifold tangent to invariant spaces for the infinitesimal generator of the linearized equation at a singularity. A phase space appropriate to the computation of these normal forms is introduced, and adequate nonresonance conditions for the computation of the normal forms are derived. As an application, the general situation of Bogdanov-Takens singularity and its versal unfolding for scalar retarded FDEs with nondegeneracy at second order is considered, both in the general case and in the case of differential-delay equations of the form ẋ( t) = ƒ( x( t), x( t-1)).
Molecular Recognition Involving Anthraquinone Derivatives and Molecular Clips
Alaparthi, Madhubabu
In the past, we have demonstrated that 1,8-anthraquinone-18-crown-5 (1) and its heterocyclic derivatives act as luminescent hosts for a variety of cations of environmental and clinical concern. We report here a series of heteroatom-substituted macrocycles containing an anthraquinone moiety as a fluorescent signaling unit and a cyclic polyheteroether chain as the receptor. Sulfur, selenium, and tellurium derivatives of 1,8-anthraquinone-18-crown-5 (1) were synthesized by reacting sodium sulfide (Na2S), sodium selenide (Na2Se) and sodium telluride (Na2Te) with 1,8-bis(2-bromoethylethyleneoxy)anthracene - 9,10-dione in a 1:1 ratio (2,3, and 6). These sensors bind metal ions in a 1:1 ratio (7 and 8), and the optical properties of the new complexes were examined and the sulfur and selenium analogues show that selectivity for Pb(II) is markedly improved as compared to the oxygen analogue 1 which was competitive for Ca(II) ion. Selective reduction of 1 yields secondary alcohols where either one or both of the anthraquinone carbonyl groups has been reduced ( 15 and 9). A new mechanism for the fluorescence detection of metal cations in solution is introduced involving a unique keto-enol tautomerization. Reduction of 1 yields the doubly reduced secondary alcohol, 9. 9 acts as a chemodosimeter for Al(III) ion producing a strong blue emission due to the formation of the anthracene fluorophore, 10, via dehydration of the internal secondary alcohol in DMSO/aqueous solution. The enol form is not the most thermodynamically stable form under these conditions however, and slowly converts to the keto form 11.. Currently we are focusing on cucurbituril derivatives, also described as molecular clips due to their folded geometry used as molecular recognition hosts. We first investigated the synthesis and characterization of aromatic methoxy/catechol terminated cucurbituril units that act as hosts for small solvent molecules, such as CH2Cl2, CH3CN, DMF, and MeOH, through dual pi...H-C T
Spatially-Aggregated Temperature Derivatives: Agricultural Risk Management in China
Directory of Open Access Journals (Sweden)
Lu Zong
2016-09-01
Full Text Available In this paper, a new form of weather derivative contract, namely the climatic zone-based growth degree-day (GDD contract, is introduced. The objective is to increase the risk management efficiency in the agricultural sector of China and to reduce the model dimension of multi-regional temperature-based weather derivatives pricing. Since the proposed contract serves as a risk management tool for all of the cities in the same climatic zone, we compare the risk hedging power between the climatic zone-based and the city-based GDD contracts. As a result, we find that the differences between the two types of temperature-based weather contracts are maintained within a certain range.
Revisiting the pion's scalar form factor in chiral perturbation theory
Juttner, Andreas
2012-01-01
The quark-connected and the quark-disconnected Wick contractions contributing to the pion's scalar form factor are computed in the two and in the three flavour chiral effective theory at next-to-leading order. While the quark-disconnected contribution to the form factor itself turns out to be power-counting suppressed its contribution to the scalar radius is of the same order of magnitude as the one of the quark-connected contribution. This result underlines that neglecting quark-disconnected contributions in simulations of lattice QCD can cause significant systematic effects. The technique used to derive these predictions can be applied to a large class of observables relevant for QCD-phenomenology.
The effective action of warped M-theory reductions with higher derivative terms — part I
Energy Technology Data Exchange (ETDEWEB)
Grimm, Thomas W.; Pugh, Tom G.; Weissenbacher, Matthias [Max Planck Institute for Physics,Föhringer Ring 6, 80805 Munich (Germany)
2016-01-25
M-theory accessed via eleven-dimensional supergravity admits globally consistent warped solutions with eight-dimensional compact spaces if background fluxes and higher derivative terms are considered. The internal background is conformally Kähler with vanishing first Chern class. We perturb these solutions including a finite number of Kähler deformations of the metric and vector deformations of the M-theory three-form. Special emphasis is given to the field-dependence of the warp-factor and the higher-derivative terms. We show that the three-dimensional two-derivative effective action takes a surprisingly simple form in terms of a single higher-curvature building block due to numerous non-trivial cancellations. Both the ansatz and the effective action admit a moduli dependent scaling symmetry of the internal metric. Furthermore, we find that the required departure from Ricci-flatness and harmonicity of the zero-mode eigenforms does not alter the effective theory.
Karl, J Philip; Meydani, Mohsen; Barnett, Junaidah B; Vanegas, Sally M; Barger, Kathryn; Fu, Xueyan; Goldin, Barry; Kane, Anne; Rasmussen, Helen; Vangay, Pajau; Knights, Dan; Jonnalagadda, Satya S; Saltzman, Edward; Roberts, Susan B; Meydani, Simin N; Booth, Sarah L
2017-10-01
Background: Emerging evidence suggests novel roles for bacterially derived vitamin K forms known as menaquinones in health and disease, which may be attributable in part to anti-inflammatory effects. However, the relevance of menaquinones produced by gut bacteria to vitamin K requirements and inflammation is undetermined. Objective: This study aimed to quantify fecal menaquinone concentrations and identify associations between fecal menaquinone concentrations and serum vitamin K concentrations, gut microbiota composition, and inflammation. Design: Fecal and serum menaquinone concentrations, fecal microbiota composition, and plasma and fecal cytokine concentrations were measured in 80 men and postmenopausal women (48 men, 32 women, age 40-65 y) enrolled in a randomized, parallel-arm, provided-food trial. After consuming a run-in diet for 2 wk, participants were randomly assigned to consume a whole grain-rich (WG) or a refined grain-based (RG) diet for 6 wk. Outcomes were measured at weeks 2 and 8. Results: The median total daily excretion of menaquinones in feces was 850 nmol/d but was highly variable (range: 64-5358 nmol/d). The total median (IQR) fecal concentrations of menaquinones decreased in the WG diet compared with the RG diet [-6.8 nmol/g (13.0 nmol/g) dry weight for WG compared with 1.8 nmol/g (12.3 nmol/g) dry weight for RG; P < 0.01)]. However, interindividual variability in fecal menaquinone concentrations partitioned individuals into 2 distinct groups based on interindividual differences in concentrations of different menaquinone forms rather than the diet group or the time point. The relative abundances of several gut bacteria taxa, Bacteroides and Prevotella in particular, differed between these groups, and 42% of identified genera were associated with ≥1 menaquinone form. Menaquinones were not detected in serum, and neither fecal concentrations of individual menaquinones nor the menaquinone group was associated with any marker of inflammation
Amphiphilic chitosan derivatives as carrier agents for rotenone
Kamari, Azlan; Aljafree, Nurul Farhana Ahmad
2017-08-01
In the present study, the feasibility of amphiphilic chitosan derivatives, namely oleoyl carboxymethyl chitosan (OCMCs), N,N-dimethylhexadecyl carboxymethyl chitosan (DCMCs) and deoxycholic acid carboxymethyl chitosan (DACMCs) as carrier agents for rotenone in water-insoluble pesticide formulations was investigated. Fourier Transform Infrared (FTIR) Spectrometer, CHN-O Elemental Analyser (CHN-O) and Transmission Electron Microscope (TEM) were used to characterise amphiphilic chitosan derivatives. The critical micelle concentration (CMC) of amphiphilic chitosan derivatives was determined using a Fluorescence Spectrometer. A High Performance Liquid Chromatography (HPLC) was used to determine the ability of OCMCs, DCMCs and DACMCs to load and release rotenone in an in vitro system. Based on TEM analysis, results have shown that amphiphilic chitosan derivatives formed self-assembly and exhibited spherical shape. The CMC values determined for OCMCs, DCMCs and DACMCs were 0.093, 0.098 and 0.468 mg/mL, respectively. The encapsulation efficiency (EE) values for the materials were more than 97.0%, meanwhile the loading capacity (LC) values were greater than 0.90%. OCMCs, DCMCs and DACMCs micelles exhibited an excellent ability to control the release of rotenone, of which 90.0% of rotenone was released within 40 to 52 h. In conclusion, OCMCs, DCMCs and DACMCs possess several key features to act as effective carrier agents for rotenone. Overall, amphiphilic chitosan derivatives produced in this study were successfully increased the solubility of rotenone by 49.0 times higher than free rotenone.
Karasakal, Ayça; Ulu, Sevgi Tatar
2013-08-01
A simple, accurate and highly sensitive spectrofluorimetric method has been developed for determination of nizatidine in pure form and in pharmaceutical dosage forms. The method is based on the reaction between nizatidine and 1-dimethylaminonaphthalene-5-sulphonyl chloride in carbonate buffer, pH 10.5, to yield a highly fluorescent derivative peaking at 513 nm after excitation at 367 nm. Various factors affecting the fluorescence intensity of nizatidin-dansyl derivative were studied and conditions were optimized. The method was validated as per ICH guidelines. The fluorescence concentration plot was rectilinear over the range of 25-300 ng/mL. Limit of detection and limit of quantification were calculated as 11.71 and 35.73 ng/mL, respectively. The proposed method was successfully applied to pharmaceutical preparations.
2013-01-01
Abstact Infectious salmon anaemia (ISA) is a serious disease of marine-farmed Atlantic salmon (Salmo salar) caused by ISA virus (ISAV), which belongs to the genus Isavirus, family Orthomyxoviridae. ISA is caused by virulent ISAV strains with deletions in a highly polymorphic region (HPR) of the hemagglutinin-esterase (HE) protein (designated virulent ISAV-HPR∆). This study shows the historic dynamics of ISAV-HPR∆ and ISAV-HPR0 in Chile, the genetic relationship among ISAV-HPR0 reported worldwide and between ISAV-HPR0 and ISAV-HPR∆ in Chile, and reports the 2013 ISA outbreak in Chile. The first ISA outbreak in Chile occurred from mid-June 2007 to 2010 and involved the virulent ISAV-HPR7b, which was then replaced by a low pathogenic ISAV-HPR0 variant. We analyzed this variant in 66 laboratory-confirmed ISAV-HPR0 cases in Chile in comparison to virulent ISAV-HPR∆ that caused two new ISA outbreaks in April 2013. Multiple alignment and phylogenetic analysis of HE sequences from all ISAV-HPR0 viruses allowed us to identify three genomic clusters, which correlated with three residue patterns of ISAV-HPR0 (360PST362, 360PAN362 and 360PAT362) in HPR. The virus responsible for the 2013 ISAV-HPR∆ cases in Chile belonged to ISAV-HPR3 and ISAV-HPR14, and in phylogenetic analyses, both clustered with the ISAV-HPR0 found in Chile. The ISAV-HPR14 had the ISAV-HPR0 residue pattern 360PAT362, which is the only type of ISAV-HPR0 variant found in Chile. This suggested to us that the 2013 ISAV-HPR∆ re-emerged from ISAV-HPR0 that is enzootic in Chilean salmon aquaculture and were not new introductions of virulent ISAV-HPR∆ to Chile. The clinical presentations and diagnostic evidence of the 2013 ISA cases indicated a mixed infection of ISAV with the ectoparasite Caligus rogercresseyi and the bacterium Piscirickettsia salmonis, which underscores the need for active ISAV surveillance in areas where ISAV-HPR0 is enzootic, to ensure early detection and control of new ISA
Loetscher, Y; Albiker, D; Stephan, R; Kreuzer, M; Messikommer, R E
2015-02-01
The valorization of spent hens via the food chain has some major limitations, which include low meat yield and tough meat. The latter issue can be overcome by producing convenience foods; the first may be alleviated by employing a genotype with higher meatiness. To quantitatively compare two common layer genotypes in production performance, meat yield and sausage quality, 2200 57 weeks old Institut de Sélection Animale (ISA) Warren and Dekalb White hens each were investigated during the last 60 days of egg laying. The hens were housed in an aviary system in 2×10 compartments (10 compartments/each genotype). Measurements included feed intake, laying performance, egg weight and feed conversion ratio as measured per compartment. BW was determined twice on 10 animals per compartment. Finally, two sub-groups of five hens per compartment were slaughtered, meat yield was recorded and bratwurst-type sausages were produced (n=20 per genotype). Fat proportion, cooking loss, connective tissue properties and Kramer shear energy were measured. After 1, 4, 7 and 10 months of frozen storage, oxidative stability (thiobarbituric acid reactive substances (TBARS)) and microbiological status were determined as shelf-life related criteria. ANOVA was performed considering genotype as the main effect. The ISA Warren hens were inferior in laying performance (-11%) and feed conversion ratio (+10%) compared with Dekalb White, but had the same feed intake. The ISA Warren had higher BW and carcass weight than the Dekalb White. Carcass yield was higher by 5.9%. There were 80 g (23%) more meat available for sausage production from ISA Warren compared with Dekalb White. Sausages prepared from meat of ISA Warren hens contained less fat than those from Dekalb White, but showed the same cooking loss. Although the collagen proportion of the sausages produced from ISA Warren was lower than from Dekalb White, collagen solubility was lower and shear energy was higher. During the 10 months of frozen
Controls of oxygen isotope ratios of nitrate formed during nitrification in soils
International Nuclear Information System (INIS)
Mayer, B.; Bollwerk, S.M.; Vorhoff, B.; Mansfeldt, T.; Veizer, J.
1999-01-01
The isotopic composition of nitrate is increasingly used to determine sources and transformations of nitrogen in terrestrial and aquatic ecosystems. Oxygen isotope ratios of nitrate appear to be particularly useful, since they allow the differentiation between nitrate from atmospheric deposition (δ 18 O nitrate between +25 and +70 per mille), nitrate from fertilizers (δ 18 O nitrate +23 per mille), and nitrate derived from nitrification processes in soils (δ 18 O nitrate 3 molecule derive from H 2 O (with negative δ 18 O values dependent upon location) and one oxygen derives from atmospheric O 2 (δ 18 O = +23.5 per mille).. The objective of this study was to experimentally determine the extent to which water oxygen controls the δ 18 O value of nitrate, which is formed during nitrification in soils
Rout, Simon P; Charles, Christopher J; Garratt, Eva J; Laws, Andrew P; Gunn, John; Humphreys, Paul N
2015-01-01
The contamination of surface environments with hydroxide rich wastes leads to the formation of high pH (>11.0) soil profiles. One such site is a legacy lime works at Harpur Hill, Derbyshire where soil profile indicated in-situ pH values up to pH 12. Soil and porewater profiles around the site indicated clear evidence of the presence of the α and β stereoisomers of isosaccharinic acid (ISA) resulting from the anoxic, alkaline degradation of cellulosic material. ISAs are of particular interest with regards to the disposal of cellulosic materials contained within the intermediate level waste (ILW) inventory of the United Kingdom, where they may influence radionuclide mobility via complexation events occurring within a geological disposal facility (GDF) concept. The mixing of uncontaminated soils with the alkaline leachate of the site resulted in ISA generation, where the rate of generation in-situ is likely to be dependent upon the prevailing temperature of the soil. Microbial consortia present in the uncontaminated soil were capable of surviving conditions imposed by the alkaline leachate and demonstrated the ability to utilise ISAs as a carbon source. Leachate-contaminated soil was sub-cultured in a cellulose degradation product driven microcosm operating at pH 11, the consortia present were capable of the degradation of ISAs and the generation of methane from the resultant H2/CO2 produced from fermentation processes. Following microbial community analysis, fermentation processes appear to be predominated by Clostridia from the genus Alkaliphilus sp, with methanogenesis being attributed to Methanobacterium and Methanomassiliicoccus sp. The study is the first to identify the generation of ISA within an anthropogenic environment and advocates the notion that microbial activity within an ILW-GDF is likely to influence the impact of ISAs upon radionuclide migration.
Directory of Open Access Journals (Sweden)
Simon P Rout
Full Text Available The contamination of surface environments with hydroxide rich wastes leads to the formation of high pH (>11.0 soil profiles. One such site is a legacy lime works at Harpur Hill, Derbyshire where soil profile indicated in-situ pH values up to pH 12. Soil and porewater profiles around the site indicated clear evidence of the presence of the α and β stereoisomers of isosaccharinic acid (ISA resulting from the anoxic, alkaline degradation of cellulosic material. ISAs are of particular interest with regards to the disposal of cellulosic materials contained within the intermediate level waste (ILW inventory of the United Kingdom, where they may influence radionuclide mobility via complexation events occurring within a geological disposal facility (GDF concept. The mixing of uncontaminated soils with the alkaline leachate of the site resulted in ISA generation, where the rate of generation in-situ is likely to be dependent upon the prevailing temperature of the soil. Microbial consortia present in the uncontaminated soil were capable of surviving conditions imposed by the alkaline leachate and demonstrated the ability to utilise ISAs as a carbon source. Leachate-contaminated soil was sub-cultured in a cellulose degradation product driven microcosm operating at pH 11, the consortia present were capable of the degradation of ISAs and the generation of methane from the resultant H2/CO2 produced from fermentation processes. Following microbial community analysis, fermentation processes appear to be predominated by Clostridia from the genus Alkaliphilus sp, with methanogenesis being attributed to Methanobacterium and Methanomassiliicoccus sp. The study is the first to identify the generation of ISA within an anthropogenic environment and advocates the notion that microbial activity within an ILW-GDF is likely to influence the impact of ISAs upon radionuclide migration.
Energy Technology Data Exchange (ETDEWEB)
Safigholi, H; Soliman, A; Song, W [Sunnybrook Research Institute, Sunnybrook Health Sciences Centre, U of T, Toronto, Ontario (Canada); Meigooni, A Soleimani [Comprehensive Cancer Center of Nevada, Las Vegas, Nevada (United States); Han, D [Sunnybrook Research Institute, Sunnybrook Health Sciences Centre, U of T, Toronto, Ontario (Canada); University of California, San Diego, La Jolla, CA (United States)
2015-06-15
Purpose: Brachytherapy treatment planning systems based on TG-43 protocol calculate the dose in water and neglects the heterogeneity effect of seeds in multi-seed implant brachytherapy. In this research, the accuracy of a novel analytical model that we propose for the inter-seed attenuation effect (ISA) for 103-Pd seed model is evaluated. Methods: In the analytical model, dose perturbation due to the ISA effect for each seed in an LDR multi-seed implant for 103-Pd is calculated by assuming that the seed of interest is active and the other surrounding seeds are inactive. The cumulative dosimetric effect of all seeds is then summed using the superposition principle. The model is based on pre Monte Carlo (MC) simulated 3D kernels of the dose perturbations caused by the ISA effect. The cumulative ISA effect due to multiple surrounding seeds is obtained by a simple multiplication of the individual ISA effect by each seed, the effect of which is determined by the distance from the seed of interest. This novel algorithm is then compared with full MC water-based simulations (FMCW). Results: The results show that the dose perturbation model we propose is in excellent agreement with the FMCW values for a case with three seeds separated by 1 cm. The average difference of the model and the FMCW simulations was less than 8%±2%. Conclusion: Using the proposed novel analytical ISA effect model, one could expedite the corrections due to the ISA dose perturbation effects during permanent seed 103-Pd brachytherapy planning with minimal increase in time since the model is based on multiplications and superposition. This model can be applied, in principle, to any other brachytherapy seeds. Further work is necessary to validate this model on a more complicated geometry as well.
Densified waste form and method for forming
Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina
2015-08-25
Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.
Fisher, Travis C.; Carpenter, Mark H.; Nordstroem, Jan; Yamaleev, Nail K.; Swanson, R. Charles
2011-01-01
Simulations of nonlinear conservation laws that admit discontinuous solutions are typically restricted to discretizations of equations that are explicitly written in divergence form. This restriction is, however, unnecessary. Herein, linear combinations of divergence and product rule forms that have been discretized using diagonal-norm skew-symmetric summation-by-parts (SBP) operators, are shown to satisfy the sufficient conditions of the Lax-Wendroff theorem and thus are appropriate for simulations of discontinuous physical phenomena. Furthermore, special treatments are not required at the points that are near physical boundaries (i.e., discrete conservation is achieved throughout the entire computational domain, including the boundaries). Examples are presented of a fourth-order, SBP finite-difference operator with second-order boundary closures. Sixth- and eighth-order constructions are derived, and included in E. Narrow-stencil difference operators for linear viscous terms are also derived; these guarantee the conservative form of the combined operator.
Post, J.; Baud, I.S.A.; Baud, I.S.A.; Furedy, C.; Post, J.
2004-01-01
-Post, Johan and Isa Baud (2004) Government, market and community in urban solid waste management; problems and potentials in the transition to sustainable development? in: Baud, Isa., Johan. Post and Christine Furedy (2004) Solid Waste Management and Rec
Urban Land-Cover Change and Its Impact on the Ecosystem Carbon Storage in a Dryland City
Directory of Open Access Journals (Sweden)
Yan Yan
2015-12-01
Full Text Available Lack of research into the complexity in urban land conversion, and paucity of observational data of soil organic carbon (SOC beneath impervious surface area (ISA limit our understanding of the urbanization effects on carbon (C pools in dryland cities. Employing Landsat TM images acquired in 1990 and 2010, a hybrid classification method consisting of Linear Spectral Mixture Analysis and decision tree classification was applied to retrieve the land cover (water, ISA, greenspace, cropland, and remnant desert of the largest dryland city in China—Urumqi. Based on vegetation carbon (VEGC and SOC density data determined through field observations and literature reviews, we developed Urumqi’s C pool maps in 1990 and 2010, and assessed the urbanization impacts on ecosystem C. Our results showed that ISA tripled from 1990 to 2010 displacing remnant desert and cropland. The urban landscape, especially the greenspaces, became obviously fragmented. In 2010, more than 95% of the urban ecosystem C was SOC, 48% of which under the ISA. The city lost 19% of C stock from 1990 to 2010. About 82% of the ecosystem C loss was caused by the conversion of remnant desert and cropland into ISA, mainly in the northern city.
Austin, Rickey W.
In Einstein's theory of Special Relativity (SR), one method to derive relativistic kinetic energy is via applying the classical work-energy theorem to relativistic momentum. This approach starts with a classical based work-energy theorem and applies SR's momentum to the derivation. One outcome of this derivation is relativistic kinetic energy. From this derivation, it is rather straight forward to form a kinetic energy based time dilation function. In the derivation of General Relativity a common approach is to bypass classical laws as a starting point. Instead a rigorous development of differential geometry and Riemannian space is constructed, from which classical based laws are derived. This is in contrast to SR's approach of starting with classical laws and applying the consequences of the universal speed of light by all observers. A possible method to derive time dilation due to Newtonian gravitational potential energy (NGPE) is to apply SR's approach to deriving relativistic kinetic energy. It will be shown this method gives a first order accuracy compared to Schwarzschild's metric. The SR's kinetic energy and the newly derived NGPE derivation are combined to form a Riemannian metric based on these two energies. A geodesic is derived and calculations compared to Schwarzschild's geodesic for an orbiting test mass about a central, non-rotating, non-charged massive body. The new metric results in high accuracy calculations when compared to Einsteins General Relativity's prediction. The new method provides a candidate approach for starting with classical laws and deriving General Relativity effects. This approach mimics SR's method of starting with classical mechanics when deriving relativistic equations. As a compliment to introducing General Relativity, it provides a plausible scaffolding method from classical physics when teaching introductory General Relativity. A straight forward path from classical laws to General Relativity will be derived. This derivation
Learning course adjustments during arm movements with reversed sensitivity derivatives
Directory of Open Access Journals (Sweden)
Tweed Douglas B
2010-11-01
Full Text Available Abstract Background To learn, a motor system needs to know its sensitivity derivatives, which quantify how its neural commands affect motor error. But are these derivatives themselves learned, or are they known solely innately? Here we test a recent theory that the brain's estimates of sensitivity derivatives are revisable based on sensory feedback. In its simplest form, the theory says that each control system has a single, adjustable estimate of its sensitivity derivatives which affects all aspects of its task, e.g. if you learn to reach to mirror-reversed targets then your revised estimate should reverse not only your initial aiming but also your online course adjustments when the target jumps in mid-movement. Methods Human subjects bent a joystick to move a cursor to a target on a computer screen, but the cursor's motion was reversed relative to the joystick's. The target jumped once during each movement. Subjects had up to 4000 trials to practice aiming and responding to target jumps. Results All subjects learned to reverse both initial aiming and course adjustments. Conclusions Our study confirms that sensitivity derivatives can be relearned. It is consistent with the idea of a single, all-purpose estimate of those derivatives; and it suggests that the estimate is a function of context, as one would expect given that the true sensitivity derivatives may vary with the state of the controlled system, the target, and the motor commands.
Multimerized CHR-derived peptides as HIV-1 fusion inhibitors.
Nomura, Wataru; Hashimoto, Chie; Suzuki, Takaharu; Ohashi, Nami; Fujino, Masayuki; Murakami, Tsutomu; Yamamoto, Naoki; Tamamura, Hirokazu
2013-08-01
To date, several HIV-1 fusion inhibitors based on the carboxy-terminal leucine/isoleucine heptad repeat (CHR) region of an HIV-1 envelope protein gp41 have been discovered. We have shown that a synthetic peptide mimetic of a trimer form of the CHR-derived peptide C34 has potent inhibitory activity against the HIV-1 fusion mechanism, compared to a monomer C34 peptide. The present study revealed that a dimeric form of C34 is evidently structurally critical for fusion inhibitors, and that the activity of multimerized CHR-derived peptides in fusion inhibition is affected by the properties of the unit peptides C34, SC34EK, and T20. The fluorescence-based study suggested that the N36-interactive sites of the C34 trimer, including hydrophobic residues, are exposed outside the trimer and that trimerization of C34 caused a remarkable increase in fusion inhibitory activity. The present results could be useful in the design of fusion inhibitors against viral infections which proceed via membrane fusion with host cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Computation of 3D form factors in complex environments
International Nuclear Information System (INIS)
Coulon, N.
1989-01-01
The calculation of radiant interchange among opaque surfaces in a complex environment poses the general problem of determining the visible and hidden parts of the environment. In many thermal engineering applications, surfaces are separated by radiatively non-participating media and may be idealized as diffuse emitters and reflectors. Consenquently the net radiant energy fluxes are intimately related to purely geometrical quantities called form factors, that take into account hidden parts: the problem is reduced to the form factor evaluation. This paper presents the method developed for the computation of 3D form factors in the finite-element module of the system TRIO, which is a general computer code for thermal and fluid flow analysis. The method is derived from an algorithm devised for synthetic image generation. A comparison is performed with the standard contour integration method also implemented and suited to convex geometries. Several illustrative examples of finite-element thermal calculations in radiating enclosures are given
Secondary Waste Cast Stone Waste Form Qualification Testing Plan
Energy Technology Data Exchange (ETDEWEB)
Westsik, Joseph H.; Serne, R. Jeffrey
2012-09-26
The Hanford Tank Waste Treatment and Immobilization Plant (WTP) is being constructed to treat the 56 million gallons of radioactive waste stored in 177 underground tanks at the Hanford Site. The WTP includes a pretreatment facility to separate the wastes into high-level waste (HLW) and low-activity waste (LAW) fractions for vitrification and disposal. The LAW will be converted to glass for final disposal at the Integrated Disposal Facility (IDF). Cast Stone – a cementitious waste form, has been selected for solidification of this secondary waste stream after treatment in the ETF. The secondary-waste Cast Stone waste form must be acceptable for disposal in the IDF. This secondary waste Cast Stone waste form qualification testing plan outlines the testing of the waste form and immobilization process to demonstrate that the Cast Stone waste form can comply with the disposal requirements. Specifications for the secondary-waste Cast Stone waste form have not been established. For this testing plan, Cast Stone specifications are derived from specifications for the immobilized LAW glass in the WTP contract, the waste acceptance criteria for the IDF, and the waste acceptance criteria in the IDF Permit issued by the State of Washington. This testing plan outlines the testing needed to demonstrate that the waste form can comply with these waste form specifications and acceptance criteria. The testing program must also demonstrate that the immobilization process can be controlled to consistently provide an acceptable waste form product. This testing plan also outlines the testing needed to provide the technical basis for understanding the long-term performance of the waste form in the disposal environment. These waste form performance data are needed to support performance assessment analyses of the long-term environmental impact of the secondary-waste Cast Stone waste form in the IDF
Bu, Xiangwei; Wu, Xiaoyan; Tian, Mingyan; Huang, Jiaqi; Zhang, Rui; Ma, Zhen
2015-09-01
In this paper, an adaptive neural controller is exploited for a constrained flexible air-breathing hypersonic vehicle (FAHV) based on high-order tracking differentiator (HTD). By utilizing functional decomposition methodology, the dynamic model is reasonably decomposed into the respective velocity subsystem and altitude subsystem. For the velocity subsystem, a dynamic inversion based neural controller is constructed. By introducing the HTD to adaptively estimate the newly defined states generated in the process of model transformation, a novel neural based altitude controller that is quite simpler than the ones derived from back-stepping is addressed based on the normal output-feedback form instead of the strict-feedback formulation. Based on minimal-learning parameter scheme, only two neural networks with two adaptive parameters are needed for neural approximation. Especially, a novel auxiliary system is explored to deal with the problem of control inputs constraints. Finally, simulation results are presented to test the effectiveness of the proposed control strategy in the presence of system uncertainties and actuators constraints. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Multiple incipient sensor faults diagnosis with application to high-speed railway traction devices.
Wu, Yunkai; Jiang, Bin; Lu, Ningyun; Yang, Hao; Zhou, Yang
2017-03-01
This paper deals with the problem of incipient fault diagnosis for a class of Lipschitz nonlinear systems with sensor biases and explores further results of total measurable fault information residual (ToMFIR). Firstly, state and output transformations are introduced to transform the original system into two subsystems. The first subsystem is subject to system disturbances and free from sensor faults, while the second subsystem contains sensor faults but without any system disturbances. Sensor faults in the second subsystem are then formed as actuator faults by using a pseudo-actuator based approach. Since the effects of system disturbances on the residual are completely decoupled, multiple incipient sensor faults can be detected by constructing ToMFIR, and the fault detectability condition is then derived for discriminating the detectable incipient sensor faults. Further, a sliding-mode observers (SMOs) based fault isolation scheme is designed to guarantee accurate isolation of multiple sensor faults. Finally, simulation results conducted on a CRH2 high-speed railway traction device are given to demonstrate the effectiveness of the proposed approach. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
New large-Nc relations for the electromagnetic nucleon-to-Δ form factors
International Nuclear Information System (INIS)
Vladimir Pascalutsa; Marc Vanderhaeghen
2006-01-01
We establish relations which express the three N → Δ transition form factors in terms of the nucleon form factors. These relations are based on the known large-N c relation between the N → Δ electric quadrupole moment and the neutron charge radius, and a newly derived large-N c relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N c limit we find C2=E2. We show that these relations provide predictions for the N → Δ electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers. They also provide constraints for the N → Δ GPDs
Involvement of multiple myeloma cell-derived exosomes in osteoclast differentiation
Raimondi, Lavinia; De Luca, Angela; Amodio, Nicola; Manno, Mauro; Raccosta, Samuele; Taverna, Simona; Bellavia, Daniele; Naselli, Flores; Fontana, Simona; Schillaci, Odessa; Giardino, Roberto; Fini, Milena; Tassone, Pierfrancesco; Santoro, Alessandra; De Leo, Giacomo; Giavaresi, Gianluca; Alessandro, Riccardo
2015-01-01
Bone disease is the most frequent complication in multiple myeloma (MM) resulting in osteolytic lesions, bone pain, hypercalcemia and renal failure. In MM bone disease the perfect balance between bone-resorbing osteoclasts (OCs) and bone-forming osteoblasts (OBs) activity is lost in favour of OCs, thus resulting in skeletal disorders. Since exosomes have been described for their functional role in cancer progression, we here investigate whether MM cell-derived exosomes may be involved in OCs differentiation. We show that MM cells produce exosomes which are actively internalized by Raw264.7 cell line, a cellular model of osteoclast formation. MM cell-derived exosomes positively modulate pre-osteoclast migration, through the increasing of CXCR4 expression and trigger a survival pathway. MM cell-derived exosomes play a significant pro-differentiative role in murine Raw264.7 cells and human primary osteoclasts, inducing the expression of osteoclast markers such as Cathepsin K (CTSK), Matrix Metalloproteinases 9 (MMP9) and Tartrate-resistant Acid Phosphatase (TRAP). Pre-osteoclast treated with MM cell-derived exosomes differentiate in multinuclear OCs able to excavate authentic resorption lacunae. Similar results were obtained with exosomes derived from MM patient's sera. Our data indicate that MM-exosomes modulate OCs function and differentiation. Further studies are needed to identify the OCs activating factors transported by MM cell-derived exosomes. PMID:25944696
Form factors of heavy mesons in QCD
Energy Technology Data Exchange (ETDEWEB)
Shifman, M A; Vysotsky, M I [Moskovskii Inst. Theoreticheskoj i Ehksperimental' noj Fiziki (USSR)
1981-08-10
We discuss logarithmic corrections to form factors of mesons built from heavy quarks. The reactions e/sup +/e/sup -/ ..-->.. etasub(c)..gamma.. and H ..-->.. J/psi..gamma.. are considered as an example. A novel feature as compared to the well-studied problem of the pion form factor is the existence of transitions between the quark-antiquark state canti c and the gluonic one. O(..cap alpha..sub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms (..cap alpha..sub(s)ln(Q/sup 2//m/sup 2/sub(c)))sup(n) is summed up with the help of the operator technique. Apart from results already known for quark operators, we use some new results referring to gluon operator and their mixing with those made from quarks. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second is based on conformal symmetry considerations.
2012-05-31
...-3119; email: [email protected] . SUPPLEMENTARY INFORMATION: I. Introduction By letter dated..., organization and administration, integrated safety analysis (ISA) and ISA summary, radiation protection..., you can access the NRC's ADAMS, which provides text and image files of NRC's public documents. The...
Production bananière durable et recours aux pesticides au Costa Rica
International Development Research Centre (IDRC) Digital Library (Canada)
ISA) : final technical report (April 2009 - April 2013); executive summary. Téléchargez le PDF. Rapports. Programa infantes y salud ambiental con un enfoque ecosistémico (ISA) : informe técnico final (abril 2009 - abril 2013); resumen ejecutivo.
Automated feedback to foster safe driving in young drivers : Phase 2.
2015-12-01
Intelligent Speed Adaptation (ISA) represents a promising approach to reduce speeding. A core principle for ISA systems is that they provide real-time feedback to drivers, prompting them to reduce speed when some threshold at or above the limit is re...
Etien, Erik
2013-05-01
This paper deals with the design of a speed soft sensor for induction motor. The sensor is based on the physical model of the motor. Because the validation step highlight the fact that the sensor cannot be validated for all the operating points, the model is modified in order to obtain a fully validated sensor in the whole speed range. An original feature of the proposed approach is that the modified model is derived from stability analysis using automatic control theory. Copyright © 2012 ISA. Published by Elsevier Ltd. All rights reserved.
Osama Al-Sehail
2017-01-01
This paper argues for sustainability as a necessity in the evolution of tall architecture. It provides a different mode for dealing with sustainability in tall architecture, taking into consideration the speciality of its typology. To this end, the article develops a Biomimetic Structural Form as a paradigm to attain Vital Sustainability. A Biomimetic Structural Form, which is derived from the amalgamation of biomimicry as an approach for sustainability defining nature as source of knowledge ...
Mason, J; Al-Qaisieh, B; Bownes, P; Henry, A; Thwaites, D
2013-03-01
In permanent seed implant prostate brachytherapy the actual dose delivered to the patient may be less than that calculated by TG-43U1 due to interseed attenuation (ISA) and differences between prostate tissue composition and water. In this study the magnitude of the ISA effect is assessed in a phantom and in clinical prostate postimplant cases. Results are compared for seed models 6711 and 9011 with 0.8 and 0.5 mm diameters, respectively. A polymethyl methacrylate (PMMA) phantom was designed to perform ISA measurements in a simple eight-seed arrangement and at the center of an implant of 36 seeds. Monte Carlo (MC) simulation and experimental measurements using a MOSFET dosimeter were used to measure dose rate and the ISA effect. MC simulations of 15 CT-based postimplant prostate treatment plans were performed to compare the clinical impact of ISA on dose to prostate, urethra, rectum, and the volume enclosed by the 100% isodose, for 6711 and 9011 seed models. In the phantom, ISA reduced the dose rate at the MOSFET position by 8.6%-18.3% (6711) and 7.8%-16.7% (9011) depending on the measurement configuration. MOSFET measured dose rates agreed with MC simulation predictions within the MOSFET measurement uncertainty, which ranged from 5.5% to 7.2% depending on the measurement configuration (k = 1, for the mean of four measurements). For 15 clinical implants, the mean ISA effect for 6711 was to reduce prostate D90 by 4.2 Gy (3%), prostate V100 by 0.5 cc (1.4%), urethra D10 by 11.3 Gy (4.4%), rectal D2cc by 5.5 Gy (4.6%), and the 100% isodose volume by 2.3 cc. For the 9011 seed the mean ISA effect reduced prostate D90 by 2.2 Gy (1.6%), prostate V100 by 0.3 cc (0.7%), urethra D10 by 8.0 Gy (3.2%), rectal D2cc by 3.1 Gy (2.7%), and the 100% isodose volume by 1.2 cc. Differences between the MC simulation and TG-43U1 consensus data for the 6711 seed model had a similar impact, reducing mean prostate D90 by 6 Gy (4.2%) and V100 by 0.6 cc (1.8%). ISA causes the delivered dose
Form of prior for constrained thermodynamic processes with uncertainty
Aneja, Preety; Johal, Ramandeep S.
2015-05-01
We consider the quasi-static thermodynamic processes with constraints, but with additional uncertainty about the control parameters. Motivated by inductive reasoning, we assign prior distribution that provides a rational guess about likely values of the uncertain parameters. The priors are derived explicitly for both the entropy-conserving and the energy-conserving processes. The proposed form is useful when the constraint equation cannot be treated analytically. The inference is performed using spin-1/2 systems as models for heat reservoirs. Analytical results are derived in the high-temperatures limit. An agreement beyond linear response is found between the estimates of thermal quantities and their optimal values obtained from extremum principles. We also seek an intuitive interpretation for the prior and the estimated value of temperature obtained therefrom. We find that the prior over temperature becomes uniform over the quantity kept conserved in the process.
International Nuclear Information System (INIS)
Zhang, Xiao; Wei, Chaozhen; Liu, Yingming; Luo, Maokang
2014-01-01
In this paper we use Dirac function to construct a fractional operator called fractional corresponding operator, which is the general form of momentum corresponding operator. Then we give a judging theorem for this operator and with this judging theorem we prove that R–L, G–L, Caputo, Riesz fractional derivative operator and fractional derivative operator based on generalized functions, which are the most popular ones, coincide with the fractional corresponding operator. As a typical application, we use the fractional corresponding operator to construct a new fractional quantization scheme and then derive a uniform fractional Schrödinger equation in form. Additionally, we find that the five forms of fractional Schrödinger equation belong to the particular cases. As another main result of this paper, we use fractional corresponding operator to generalize fractional quantization scheme by using Lévy path integral and use it to derive the corresponding general form of fractional Schrödinger equation, which consequently proves that these two quantization schemes are equivalent. Meanwhile, relations between the theory in fractional quantum mechanics and that in classic quantum mechanics are also discussed. As a physical example, we consider a particle in an infinite potential well. We give its wave functions and energy spectrums in two ways and find that both results are the same
Massive three-loop form factor in the planar limit
Energy Technology Data Exchange (ETDEWEB)
Henn, Johannes [PRISMA Cluster of Excellence, Johannes Gutenberg University,Staudingerweg 9, 55099 Mainz (Germany); Smirnov, Alexander V. [Research Computing Center, Moscow State University,119991 Moscow (Russian Federation); Smirnov, Vladimir A. [Skobeltsyn Institute of Nuclear Physics of Moscow State University,119991 Moscow (Russian Federation); Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany); Steinhauser, Matthias [Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany)
2017-01-17
We compute the three-loop QCD corrections to the massive quark-anti-quark-photon form factors F{sub 1} and F{sub 2} in the large-N{sub c} limit. The analytic results are expressed in terms of Goncharov polylogarithms. This allows for a straightforward numerical evaluation. We also derive series expansions, including power suppressed terms, for three kinematic regions corresponding to small and large invariant masses of the photon momentum, and small velocities of the heavy quarks.
DEFF Research Database (Denmark)
Foss, Kirsten; Foss, Nicolai Juul; Klein, Peter G.
2007-01-01
Recent work links entrepreneurship to the economic theory of the firm, using the concept of entrepreneurship as judgment introduced by Frank Knight. When judgment is complementary to other assets, it makes sense for entrepreneurs to hire labour and to own assets. The entrepreneur's role, then...... to subordinates, who exercise derived judgment. We call these employees `proxy-entrepreneurs', and ask how the firm's organizational structure - its formal and informal systems of rewards and punishments, rules for settling disputes and renegotiating agreements, means of evaluating performance and so on - can...... be designed to encourage forms of proxy entrepreneurship that increase firm value while discouraging actions that destroy value. Building on key ideas from the entrepreneurship literature, Austrian economics and the economic theory of the firm, we develop a framework for analysing the trade-off between...
Inverse Problems for a Parabolic Integrodifferential Equation in a Convolutional Weak Form
Directory of Open Access Journals (Sweden)
Kairi Kasemets
2013-01-01
Full Text Available We deduce formulas for the Fréchet derivatives of cost functionals of several inverse problems for a parabolic integrodifferential equation in a weak formulation. The method consists in the application of an integrated convolutional form of the weak problem and all computations are implemented in regular Sobolev spaces.
17 CFR 240.16a-13 - Change in form of beneficial ownership.
2010-04-01
... exercise or conversion of a derivative security or deposit into or withdrawal from a voting trust, that... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Change in form of beneficial ownership. 240.16a-13 Section 240.16a-13 Commodity and Securities Exchanges SECURITIES AND EXCHANGE...
Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI
DEFF Research Database (Denmark)
O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine
2013-01-01
of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...
Konrad Skotnicki; Julio R. De la Fuente; Alvaro Cañete; Krzysztof Bobrowski
2014-01-01
The kinetics and spectral characteristics of the transients formed in the reactions of •OH and •N3 with quinoxalin-2(1H)-one (Q), its methyl derivative, 3-methylquinoxalin-2(1H)-one (3-MeQ) and pyrazin-2-one (Pyr) were studied by pulse radiolysis in aqueous solutions at pH 7. The transient absorption spectra recorded in the reactions of •OH with Q and 3-MeQ consisted of an absorption band with λmax = 470 nm assigned to the OH-adducts on the benzene ring, and a second band with λmax = 390 nm (...
Solid-state NMR studies of form I of atorvastatin calcium.
Wang, Wei David; Gao, Xudong; Strohmeier, Mark; Wang, Wei; Bai, Shi; Dybowski, Cecil
2012-03-22
Solid-state (13)C, (19)F, and (15)N magic angle spinning NMR studies of Form I of atorvastatin calcium are reported, including chemical shift tensors of all resolvable carbon sites and fluorine sites. The complete (13)C and (19)F chemical shift assignments are given based on an extensive analysis of (13)C-(1)H HETCOR and (13)C-(19)F HETCOR results. The solid-state NMR data indicate that the asymmetric unit of this material contains two atorvastatin molecules. A possible structure of Form I of atorvastatin calcium (ATC-I), derived from solid-state NMR data and density functional theory calculations of various structures, is proposed for this important active pharmaceutical ingredient (API).
Two-Point Incremental Forming with Partial Die: Theory and Experimentation
Silva, M. B.; Martins, P. A. F.
2013-04-01
This paper proposes a new level of understanding of two-point incremental forming (TPIF) with partial die by means of a combined theoretical and experimental investigation. The theoretical developments include an innovative extension of the analytical model for rotational symmetric single point incremental forming (SPIF), originally developed by the authors, to address the influence of the major operating parameters of TPIF and to successfully explain the differences in formability between SPIF and TPIF. The experimental work comprised the mechanical characterization of the material and the determination of its formability limits at necking and fracture by means of circle grid analysis and benchmark incremental sheet forming tests. Results show the adequacy of the proposed analytical model to handle the deformation mechanics of SPIF and TPIF with partial die and demonstrate that neck formation is suppressed in TPIF, so that traditional forming limit curves are inapplicable to describe failure and must be replaced by fracture forming limits derived from ductile damage mechanics. The overall geometric accuracy of sheet metal parts produced by TPIF with partial die is found to be better than that of parts fabricated by SPIF due to smaller elastic recovery upon unloading.
Energy Technology Data Exchange (ETDEWEB)
Walstrom, Peter Lowell [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-08-24
A numerical algorithm for computing the field components Br and Bz and their r and z derivatives with open boundaries in cylindrical coordinates for circular current loops is described. An algorithm for computing the vector potential is also described. For the convenience of the reader, derivations of the final expressions from their defining integrals are given in detail, since their derivations (especially for the field derivatives) are not all easily found in textbooks. Numerical calculations are based on evaluation of complete elliptic integrals using the Bulirsch algorithm cel. Since cel can evaluate complete elliptic integrals of a fairly general type, in some cases the elliptic integrals can be evaluated without first reducing them to forms containing standard Legendre forms. The algorithms avoid the numerical difficulties that many of the textbook solutions have for points near the axis because of explicit factors of 1=r or 1=r2 in the some of the expressions.