25 CFR 115.711 - How is money in a trust account invested?
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false How is money in a trust account invested? 115.711 Section 115.711 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FINANCIAL ACTIVITIES TRUST FUNDS... § 115.711 How is money in a trust account invested? OTFM manages trust fund investments and its...
Identification of new IS711 insertion sites in Brucella abortus field isolates.
Mancilla, Marcos; Ulloa, Marcos; López-Goñi, Ignacio; Moriyón, Ignacio; María Zárraga, Ana
2011-08-03
Brucellosis is a zoonosis caused by Brucella spp., a group of highly homogeneous bacteria. The insertion sequence IS711 is characteristic of these bacteria, and occurs in variable numbers and positions, but always constant within a given species. This species-associated polymorphism is used in molecular typing and identification. Field isolates of B. abortus, the most common species infecting cattle, typically carry seven IS711 copies (one truncated). Thus far, IS711 transposition has only been shown in vitro and only for B. ovis and B. pinnipedialis, two species carrying a high number of IS711 copies, but never in other Brucella species, neither in vitro nor in field strains. We found several B. abortus strains isolated from milk and aborted fetuses that carried additional IS711 copies in two hitherto undescribed insertion sites: one in an intergenic region near to the 3' end of a putative lactate permease gene and the other interrupting the sequence of a marR transcriptional regulator gene. Interestingly, the second type of insertion was identified in isolates obtained repeatedly from the same herd after successive brucellosis outbreaks, an observation that proves the stability and virulence of the new genotype under natural conditions. Sequence analyses revealed that the new copies probably resulted from the transposition of a single IS711 copy common to all Brucella species sequenced so far. Our results show that the replicative transposition of IS711 can occur under field conditions. Therefore, it represents an active mechanism for the emergence of genetic diversity in B. abortus thus contributing to intra-species genetic polymorphism.
Identification of new IS711 insertion sites in Brucella abortus field isolates
Directory of Open Access Journals (Sweden)
Moriyón Ignacio
2011-08-01
Full Text Available Abstract Background Brucellosis is a zoonosis caused by Brucella spp., a group of highly homogeneous bacteria. The insertion sequence IS711 is characteristic of these bacteria, and occurs in variable numbers and positions, but always constant within a given species. This species-associated polymorphism is used in molecular typing and identification. Field isolates of B. abortus, the most common species infecting cattle, typically carry seven IS711 copies (one truncated. Thus far, IS711 transposition has only been shown in vitro and only for B. ovis and B. pinnipedialis, two species carrying a high number of IS711 copies, but never in other Brucella species, neither in vitro nor in field strains. Results We found several B. abortus strains isolated from milk and aborted fetuses that carried additional IS711 copies in two hitherto undescribed insertion sites: one in an intergenic region near to the 3' end of a putative lactate permease gene and the other interrupting the sequence of a marR transcriptional regulator gene. Interestingly, the second type of insertion was identified in isolates obtained repeatedly from the same herd after successive brucellosis outbreaks, an observation that proves the stability and virulence of the new genotype under natural conditions. Sequence analyses revealed that the new copies probably resulted from the transposition of a single IS711 copy common to all Brucella species sequenced so far. Conclusions Our results show that the replicative transposition of IS711 can occur under field conditions. Therefore, it represents an active mechanism for the emergence of genetic diversity in B. abortus thus contributing to intra-species genetic polymorphism.
2010-04-01
... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Employment. 711.140 Section 711.140 Foreign... CORPORATION § 711.140 Employment. No qualified individual with handicaps shall, on the basis of handicap, be subject to discrimination in employment under any program or activity conducted by the agency. The...
22 CFR 711.110 - Self-evaluation.
2010-04-01
... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Self-evaluation. 711.110 Section 711.110 Foreign... CORPORATION § 711.110 Self-evaluation. (a) The agency shall, by September 6, 1989, evaluate its current... participate in the self-evaluation process by submitting comments (both oral and written). (c) The agency...
12 CFR 711.6 - General exemption.
2010-01-01
... 12 Banks and Banking 6 2010-01-01 2010-01-01 false General exemption. 711.6 Section 711.6 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING CREDIT UNIONS MANAGEMENT... are members of a minority group or women; (3) Is a depository institution that has been chartered for...
International Nuclear Information System (INIS)
Sri Murniasih; Muzakky
2007-01-01
The analysis of Fe, Sr, Zr and Ca elements concentration of granular sediment from upstream to downstream of Code river has been done. The aim of this research is to know the influence of particle size on the concentration of Fe, Sr, Zr and Ca elements in the Code river sediments from upstream to downstream and its distribution pattern. The instrument used was x-ray fluorescence with Si(Li) detector. Analysis results show that more Fe and Sr elements are very much found in 150 - 90 μm particle size, while Zr and Ca elements are very much found in < 90 μm particle size. Distribution pattern of Fe, Sr, Zr and Ca elements distribution in Code river sediments tends to increase relatively from upstream to downstream following its conductivity. The concentration of Fe, Sr, Zr and Ca elements are 1.49 ± 0.03 % - 5.93 ± 0.02 % ; 118.20 ± 10.73 ppm - 468.21 ± 20.36 ppm; 19.81 ppm ± 0.86 ppm - 76.36 ± 3.02 ppm and 3.22 ± 0.25 % - 11.40 ± 0.31 % successively. (author)
15 CFR 711.3 - Compliance review.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Compliance review. 711.3 Section 711.3 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL WEAPONS CONVENTION REGULATIONS GENERAL INFORMATION...
38 CFR 3.711 - Improved pension elections.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Improved pension elections. 3.711 Section 3.711 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Concurrent Benefits and Elections...
15 CFR 711.6 - Where to obtain forms.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Where to obtain forms. 711.6 Section 711.6 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL WEAPONS CONVENTION REGULATIONS GENERAL...
40 CFR 90.711 - Suspension and revocation of certificates of conformity.
2010-07-01
... certificates of conformity. 90.711 Section 90.711 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... conformity. (a) The certificate of conformity is suspended with respect to any engine failing pursuant to... suspend the certificate of conformity for an engine family which is determined to be in noncompliance...
15 CFR 711.4 - Assistance in determining your obligations.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Assistance in determining your obligations. 711.4 Section 711.4 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL WEAPONS CONVENTION REGULATIONS...
15 CFR 711.5 - Numerical precision of submitted data.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Numerical precision of submitted data. 711.5 Section 711.5 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL WEAPONS CONVENTION REGULATIONS...
2010-01-01
... Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS RECRUITMENT, SELECTION, AND PLACEMENT (GENERAL) Interagency Career Transition Assistance Plan for Displaced Employees § 330.711... Displaced Employees and may conduct reviews of agency activity at any time. ...
47 CFR 24.711 - Installment payments for licenses for frequency Block C.
2010-10-01
... Block C. 24.711 Section 24.711 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON....711 Installment payments for licenses for frequency Block C. Installment payments. Each eligible licensee of frequency Block C may pay the remaining 90 percent of the net auction price for the license in...
Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L
2017-07-18
Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.
Lindström, Erik; Rizoska, Biljana; Tunblad, Karin; Edenius, Charlotte; Bendele, Alison M; Maul, Don; Larson, Michael; Shah, Neha; Yoder Otto, Valerie; Jerome, Chris; Grabowska, Urszula
2018-03-09
MIV-711 is a highly potent and selective cathepsin K inhibitor. The current article summarizes the therapeutic effects of MIV-711 on joint pathology in rabbits subjected to anterior cruciate ligament transection (ACLT), and the prophylactic effects on joint pathology in dogs subjected to partial medial meniscectomy, two surgical models of osteoarthritis (OA). Starting 1 week after surgery, rabbits were dosed daily via oral gavage with either MIV-711 or vehicle (n = 7/group) for 7 weeks. The four treatment groups were: (1) sham + vehicle; (2) ACLT + vehicle; (3) ACLT + MIV-711, 30 µmol/kg and (4) ACLT + MIV-711, 100 µmol/kg. Subchondral bone and articular cartilage structures were assessed by µCT, histomorphometry, and scoring. Dogs subjected to partial medial meniscectomy received either MIV-711 (30 µmol/kg) or vehicle (n = 15/group) via oral gavage once daily, starting 1 day before meniscectomy, for 28 days. Cartilage degradation was assessed at the macroscopic and microscopic levels. The exposures of MIV-711 were assessed in both studies and biomarkers reflecting bone resorption (HP-1 in rabbits, CTX-I in dogs) and cartilage degradation (CTX-II) were measured. In ACLT rabbits, MIV-711 decreased HP-1 levels by up to 72% (p subchondral bone plate and reduced trabecular bone volume in the femur and tibia. These effects were reversed by MIV-711. ACLT resulted in cartilage thickening, which was attenuated by MIV-711. MIV-711 did not affect osteophyte formation or Mankin scores. In dogs, MIV-711 reduced CTX-I and CTX-II levels by 86% (p subchondral bone loss and partially attenuates cartilage pathology in two animal models of OA. These beneficial effects of MIV-711 on joint pathology are observed in conjunction with decreases in bone and cartilage biomarkers that have been shown to be clinically attainable in human. The data support the further development of MIV-711 for the treatment of OA.
Molecular hydrogen mapping of Herbig-Haro 7-11; a filamentary bullet
International Nuclear Information System (INIS)
Lightfoot, J.F.; Glencross, W.M.
1986-01-01
A map is presented of the Q-branch H 2 line emission associated with Herbig-Haro 7-11. The molecules are shock-excited and the emitting area stretches 4 arcmin north-west from HH7-11 in a fairly sharp and straight line. The evidence suggests that the emission occurs where a spine of dense molecular gas is being struck by a jet from the young star SVS13. The origin of the Herbig-Haro objects is discussed. It is suggested that HH7-11 are the bow-shocks formed around a helical filament of dense gas moving at 200 km s -1 through the molecular cloud. The filament could be produced by a well-collimated precessing jet from SVS13. HH2. HH12 and HH101 may be explained in a similar way. (author)
2010-04-01
... AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL COLOR ADDITIVE PETITIONS General Provisions § 71.1 Petitions. (a) Any interested person may propose the listing of a color additive... submitted in triplicate (quadruplicate, if intended uses include uses in meat, meat food product, or poultry...
15 CFR 711.2 - Who submits declarations, reports, and advance notifications.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Who submits declarations, reports, and advance notifications. 711.2 Section 711.2 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL WEAPONS...
42 CFR 456.711 - Educational program.
2010-10-01
... Management System for Outpatient Drug Claims § 456.711 Educational program. The State plan must provide for... electronic reminders containing patient-specific or drug-specific information (or both) and suggested changes... ensure the privacy of patient-related information. (c) Face-to-face discussions, with follow up...
15 CFR 711.7 - Where to submit declarations, reports and advance notifications.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Where to submit declarations, reports and advance notifications. 711.7 Section 711.7 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE CHEMICAL...
15 CFR 711.1 - Overviews of declaration, reporting, and advance notification requirements.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Overviews of declaration, reporting, and advance notification requirements. 711.1 Section 711.1 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE...
13 CFR 134.711 - Will the Judge permit discovery and oral hearings?
2010-01-01
... Appeals From Women-Owned Small Business Concern (WOSB) and Economically Disadvantaged WOSB Concern (EDWOSB... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Will the Judge permit discovery and oral hearings? 134.711 Section 134.711 Business Credit and Assistance SMALL BUSINESS...
DARHT-II Downstream Transport Beamline
International Nuclear Information System (INIS)
Westenskow, G A; Bertolini, L R; Duffy, P T; Paul, A C
2001-01-01
This paper describes the mechanical design of the downstream beam transport line for the second axis of the Dual Axis Radiographic Hydrodynamic Test (DARHT II) Facility. The DARHT-II project is a collaboration between LANL, LBNL and LLNL. DARHT II is a 18.4-MeV, 2000-Amperes, 2-(micro)sec linear induction accelerator designed to generate short bursts of x-rays for the purpose of radiographing dense objects. The downstream beam transport line is approximately 22-meter long region extending from the end of the accelerator to the bremsstrahlung target. Within this proposed transport line there are 12 conventional solenoid, quadrupole and dipole magnets; as well as several specialty magnets, which transport and focus the beam to the target and to the beam dumps. There are two high power beam dumps, which are designed to absorb 80-kJ per pulse during accelerator start-up and operation. Aspects of the mechanical design of these elements are presented
22 CFR 71.1 - Protection of Americans abroad.
2010-04-01
... ESTATES PROTECTION AND WELFARE OF CITIZENS AND THEIR PROPERTY General Activities § 71.1 Protection of Americans abroad. Officers of the Foreign Service shall perform such duties in connection with the...
22 CFR 711.150 - Program accessibility: Existing facilities.
2010-04-01
... result in a fundamental alteration in the nature of a program or activity or in undue financial and....150 Section 711.150 Foreign Relations OVERSEAS PRIVATE INVESTMENT CORPORATION ADMINISTRATIVE PROVISIONS ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY...
Directory of Open Access Journals (Sweden)
Wu Long-Jun
2010-01-01
Full Text Available Abstract The downstream regulatory element antagonist modulator (DREAM, a multifunctional Ca2+-binding protein, binds specifically to DNA and several nucleoproteins regulating gene expression and with proteins outside the nucleus to regulate membrane excitability or calcium homeostasis. DREAM is highly expressed in the central nervous system including the hippocampus and cortex; however, the roles of DREAM in hippocampal synaptic transmission and plasticity have not been investigated. Taking advantage of transgenic mice overexpressing a Ca2+-insensitive DREAM mutant (TgDREAM, we used integrative methods including electrophysiology, biochemistry, immunostaining, and behavior tests to study the function of DREAM in synaptic transmission, long-term plasticity and fear memory in hippocampal CA1 region. We found that NMDA receptor but not AMPA receptor-mediated current was decreased in TgDREAM mice. Moreover, synaptic plasticity, such as long-term depression (LTD but not long-term potentiation (LTP, was impaired in TgDREAM mice. Biochemical experiments found that DREAM interacts with PSD-95 and may inhibit NMDA receptor function through this interaction. Contextual fear memory was significantly impaired in TgDREAM mice. By contrast, sensory responses to noxious stimuli were not affected. Our results demonstrate that DREAM plays a novel role in postsynaptic modulation of the NMDA receptor, and contributes to synaptic plasticity and behavioral memory.
Spatial distribution of neutron flux for the A-711 neutron generator
International Nuclear Information System (INIS)
Essiet, A. E.; Owolabi, S. A.; Adesanmi, C. A.; Balogun, F. A.
1996-01-01
The spatial distribution of neutron flux for the Kaman sciences A-711 neutron generator recently installed at the Centre for Energy Research and Development (CERD), Ile-Ife Nigeria has been determined. At an operational tube current of 2.0 mA and high voltage power supply (HVPS) of 158 kV, the neutron flux increases from 1.608 ± 0.021*10 8 n/cm 2 s at the top of the irradiated plastic vial to 2.640 ± 0.022*10 8 n/cm 2 s at the centre, and then decreases to 1.943 ± 0.02* 8 n/cm 2 s at the bottom. The flux density is strongly dependent on the diameter of deuteron at the tritium target, and within this range a source strength of 10 8 n/s has been measured for the A-711 neutron generator
Propagation of temperature disturbances in bounded flows downstream of a nozzle block
International Nuclear Information System (INIS)
Krebs, L.
1979-12-01
The early detection of cooling disturbances in a fuel element of a sodium cooled reactor is a must for safety reasons. One possibility of achieving this goal is by measuring and analyzing the coolant temperature at the fuel element outlet. Assessment of the potential of this method requires knowledge of the flow phenomena downstream of the fuel element. As a fluid dynamics model of a fuel element a nozzle block is used, the bores of which correspond to the subchannels between the fuel rods. The studies are conducted in water which has kinematic properties comparable to those of sodium. The velocity and temperature fields downstream of the nozzle block are examined for two REYNOLDS numbers. To simulate a disturbed cooling condition, water with a temperature higher by ΔT anti T = 10 K is injected through one subchannel of the nozzle block. At the same time, the volume injected is varied. The central channel and one side channel close to the wall are selected as injection sites. Statisticl analysis of the measured velocity and temperature signals covers the following parameters: Linear averages, intensities, probability densities, spectral power densities, autocorrelation functions, integral turbulence lengths, dissipation lengths, dissipation, skewness and flatness values. On the basis of FOURIER's differential equation of heat conduction a theoretical model is developed to describe both the average temperature field and the intensity field in the flow downstream of the nozzle block. Comparison of measurements and calculations furnishes good agreement and indicates that extrapolation of the model to sodium as a fluid is possible. Supplementary to the measurements and calculations details of the water test rig and the anemometer measuring system used for velocity and temperature measurements are shown in the Appendix. (orig.) 891 GL/orig. 892 KN [de
5 CFR 838.711 - Maximum former spouse survivor annuity.
2010-01-01
... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Maximum former spouse survivor annuity... Orders Awarding Former Spouse Survivor Annuities Limitations on Survivor Annuities § 838.711 Maximum former spouse survivor annuity. (a) Under CSRS, payments under a court order may not exceed the amount...
Energy Technology Data Exchange (ETDEWEB)
Rojas, Anabel; De Val, Sarah; Heidt, Analeah B.; Xu, Shan-Mei; Bristow, James; Black, Brian L.
2005-05-20
The GATA family of zinc-finger transcription factors plays key roles in the specification and differentiation of multiple cell types during development. GATA4 is an early regulator of gene expression during the development of endoderm and mesoderm, and genetic studies in mice have demonstrated that GATA4 is required for embryonic development.Despite the importance of GATA4 in tissue specification and differentiation, the mechanisms by which Gata4 expression is activated and the transcription factor pathways upstream of GATA4 remain largely undefined. To identify transcriptional regulators of Gata4 in the mouse,we screened conserved noncoding sequences from the mouse Gata4 gene for enhancer activity in transgenic embryos. Here, we define the regulation of a distal enhancer element from Gata4 that is sufficient to direct expression throughout the lateral mesoderm, beginning at 7.5 days of mouse embryonic development. The activity of this enhancer is initially broad but eventually becomes restricted to the mesenchyme surrounding the liver. We demonstrate that the function of this enhancer in transgenic embryos is dependent upon highly conserved Forkhead and GATA transcription factor binding sites, which are bound by FOXF1 and GATA4,respectively. Furthermore, the activity of the Gata4 lateral mesoderm enhancer is attenuated by the BMP antagonist Noggin, and the enhancer is not activated in Bmp4-null embryos. Thus, these studies establish that Gata4 is a direct transcriptional target of Forkhead and GATA transcription factors in the lateral mesoderm, and demonstrate that Gata4lateral mesoderm enhancer activation requires BMP4, supporting a model in which GATA4 serves as a downstream effector of BMP signaling in the lateral mesoderm.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false How to request authorization from BIS to make electronic submissions of declarations or reports. 711.8 Section 711.8 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY...
23 CFR 750.711 - Structures which have never displayed advertising material.
2010-04-01
... 23 Highways 1 2010-04-01 2010-04-01 false Structures which have never displayed advertising... RIGHT-OF-WAY AND ENVIRONMENT HIGHWAY BEAUTIFICATION Outdoor Advertising Control § 750.711 Structures which have never displayed advertising material. Structures, including poles, which have never displayed...
Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.
Marincola, Gabriella; Wolz, Christiane
2017-06-02
In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Czech Academy of Sciences Publication Activity Database
Hatina, J.; Jansa, Petr; Reischig, J.
2002-01-01
Roč. 22, - (2002), s. 741-749 ISSN 1079-9907 R&D Projects: GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mouse MHC Class I Gene, Intragenic Downstream Regulatory Element Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.885, year: 2002
Energy Technology Data Exchange (ETDEWEB)
Fondeur, F. F. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jones, D. H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-08-30
The Savannah River National Laboratory (SRNL) received one set of Solvent Hold Tank (SHT) samples (MCU-16-701, MCU-16-702 and MCU-16-703), pulled on 05/23/2016, and another set of SHT samples (MCU-16-710, MCU-16-711, and MCU-16-712) were pulled on 05/28/2016 after the solvent was superwashed with 300 mM sodium hydroxide for analysis. Samples MCU-16-701, MCU-16-702, and MCU-16-703 were combined into one sample (MCU-16-701-702-703) and samples MCU-16-710, MCU- 16-711, and MCU-16-712 were combined into one sample (MCU-16-710-711-712). Of the two composite samples MCU-16-710-711-712 represents the current chemical state of the solvent at MCU. All analytical conclusions are based on the chemical analysis of MCU-16-710-711-712. There were no chemical differences between MCU-16-701-702-703 and superwashed MCU-16-710-711-712. Analysis of the composited sample MCU-16-710-712-713 indicated the Isopar™L concentration is above its nominal level (102%). The modifier (CS-7SB) is 16% below its nominal concentration, while the TiDG and MaxCalix concentrations are at and above their nominal concentrations, respectively. The TiDG level has begun to decrease, and it is 7% below its nominal level as of May 28, 2016. Based on this current analysis, the levels of TiDG, Isopar™L, MaxCalix, and modifier are sufficient for continuing operation but are expected to decrease with time. Periodic characterization and trimming additions to the solvent are recommended.
5 X 5 rod bundle flow field measurements downstream a PWR spacer grid
Energy Technology Data Exchange (ETDEWEB)
Castro, Higor F.P.; Silva, Vitor V A.; Santos, André A.C.; Veloso, Maria A.F., E-mail: higorfabiano@gmail.com, E-mail: mdora@nuclear.ufmg.br, E-mail: vitors@cdtn.br, E-mail: aacs@cdtn.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil); Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2017-07-01
The spacer grids are structures present in nuclear fuel assembly of Pressurized Water Reactors (PWR). They play an important structural role and also assist in heat removal through the assembly by promoting increased turbulence of the flow. Understanding the flow dynamics downstream the spacer grid is paramount for fuel element design and analysis. This paper presents water flow velocity profiles measurements downstream a spacer grid in a 5 x 5 rod bundle test rig with the objective of highlighting important fluid dynamic behavior near the grid and supplying data for CFD simulation validation. These velocity profiles were obtained at two different heights downstream the spacer grid using a LDV (Laser Doppler Velocimetry) through the top of test rig. The turbulence intensities and patterns of the swirl and cross flow were evaluated. The tests were conducted for Reynolds numbers ranging from 1.8 x 10{sup 4} to 5.4 x 10{sup 4}. This experimental research was carried out in thermo-hydraulics laboratory of Nuclear Technology Development Center – CDTN. Results show great repeatability and low uncertainties (< 1.24 %). Details of the flow field show how the mixture and turbulence induced by the spacer grid quickly decays downstream the spacer grid. It is shown that the developed methodology can supply high resolution low uncertainty results that can be used for validation of CFD simulations. (author)
5 X 5 rod bundle flow field measurements downstream a PWR spacer grid
International Nuclear Information System (INIS)
Castro, Higor F.P.; Silva, Vitor V A.; Santos, André A.C.; Veloso, Maria A.F.
2017-01-01
The spacer grids are structures present in nuclear fuel assembly of Pressurized Water Reactors (PWR). They play an important structural role and also assist in heat removal through the assembly by promoting increased turbulence of the flow. Understanding the flow dynamics downstream the spacer grid is paramount for fuel element design and analysis. This paper presents water flow velocity profiles measurements downstream a spacer grid in a 5 x 5 rod bundle test rig with the objective of highlighting important fluid dynamic behavior near the grid and supplying data for CFD simulation validation. These velocity profiles were obtained at two different heights downstream the spacer grid using a LDV (Laser Doppler Velocimetry) through the top of test rig. The turbulence intensities and patterns of the swirl and cross flow were evaluated. The tests were conducted for Reynolds numbers ranging from 1.8 x 10"4 to 5.4 x 10"4. This experimental research was carried out in thermo-hydraulics laboratory of Nuclear Technology Development Center – CDTN. Results show great repeatability and low uncertainties (< 1.24 %). Details of the flow field show how the mixture and turbulence induced by the spacer grid quickly decays downstream the spacer grid. It is shown that the developed methodology can supply high resolution low uncertainty results that can be used for validation of CFD simulations. (author)
High velocity molecular gas near Herbig-Haro objects HH 7--11
International Nuclear Information System (INIS)
Snell, R.L.; Edwards, S.
1981-01-01
Observations of the J = 2-1 and J = 1-0 transitions of 12 CO and 13 CO reveal the presence of high velocity molecular gas associated with a low luminosity infrared source in the vicinity of the Herbig-Haro objects HH 7--11. The blueshifted and redshifted wings show peak intensities spatially separated by 1X5 (0.2 pc), suggesting an energetic bipolar outflow of gas from a young low mass star. The mass loss rate implied by these observations is 8 x 10 -6 M/sub sun/ yr -1
Hydraulic elements in reduction of vibrations in mechanical systems
Białas, K.; Buchacz, A.
2017-08-01
This work presents non-classical method of design of mechanic systems with subsystem reducing vibrations. The purpose of this paper is also introduces synthesis of mechanic system with reducing vibrations understand as design of this type of systems. The synthesis may be applied to modify the already existing systems in order to achieve a desired result. Elements which reduce vibrations can be constructed with passive, semi-active or active components. These considerations systems have selected active items. A hallmark of active elements it is possible to change the parameters on time of these elements and their power from an external source. The implementation of active elements is very broad. These elements can be implemented through the use of components of electrical, pneumatic, hydraulic, etc. The system was consisted from mechanical and hydraulic elements. Hydraulic elements were used as subsystem reducing unwanted vibration of mechanical system. Hydraulic elements can be realized in the form of hydraulic cylinder. In the case of an active vibration reduction in the form of hydraulic cylinder it is very important to find the corresponding values of hydraulic components. The values of these elements affect the frequency of vibrations of this sub-system which is related to the effective vibration reduction [7,11].
Exploration on feasibility of mining under pressure in depth at uranium mine No.711
International Nuclear Information System (INIS)
Xie Jun
1993-01-01
Through the analysis of mining practice in the mine No.711, it was found that it was technically feasible to mine the depth of the deposit suffering plenty underground hot water under pressure, and good economic benefits and environmental effects were obtained
Shielded regeneration heating element for a particulate filter
Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI
2011-01-04
An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.
Long-Term Downstream Effects of a Dam on a Lowland River Flow Regime: Case Study of the Upper Narew
Directory of Open Access Journals (Sweden)
Paweł Marcinkowski
2017-10-01
Full Text Available Most European riverine ecosystems suffer from the negative influence of impoundments on flow regime. Downstream effects of dams lead to a number of environmental and socioeconomic risks and, therefore, should be thoroughly examined in specific contexts. Our study aims to quantify the downstream effects of the Siemianówka Reservoir (Upper Narew, Poland, using statistical analysis of key elements of the river’s flow regime, such as the flow duration and recurrence of floods and droughts. In a comparative study on control catchments not influenced by impoundments (the Supraśl and Narewka Rivers, we revealed the following downstream effects of the analyzed dam: significant shortening of spring floods, reduction of the duration and depth of summer droughts, decrease of the maximum discharge, and homogenization of the discharge hydrographs. Although we determined a significant decrease in the duration of summer floods in the “before” and “after” dam function periods, we showed that this issue is regional, climate-related, and replicated in control catchments, rather than an evident downstream effect of the dam. We conclude that significant hydrological downstream effects of the Siemianówka dam–reservoir system could have been the main driver inducing the deterioration of the anastomosing stretch of the Narew River downstream of the dam.
Trace element analysis of common salt using neutron activation analysis
International Nuclear Information System (INIS)
Usman, K.
1993-01-01
Instrumental Fast Neutron Activation Analysis (IFNAA) technique has been used in the qualitative and quantitative determination of the impurity elements in common salt. Samples of the different types of common salt processed in Nigeria and some of those imported into the country were used. The type A711 KAMAN neutron generator and a high-purity Germanium (HpGe) gamma spectrometer available at the Centre for Energy Research and Training, Ahmadu Bello University, Zaria has been used. The ORTEC ADCAM 100 Emulation Software (Maestro) was used in the qualitative measurement of the detected elements. The G.R.G Activation Analysis System by G. R. Gilmore, 1987, was used in the quantitative determination of the elements detected by relative method. Aluminium and arsenic were detected and measured
The downstream industry compared to market; L'aval face au marche. Quelques elements de contexte
Energy Technology Data Exchange (ETDEWEB)
Chevallier, B.
2010-02-15
J.L. Schilansky introduces here the difficult question of the downstream industry compared to market in recalling the recent structural changes (behaviour of customers, behaviour of the USA- and China-governments), the increase of the European and French regulations, the climatic change and the conjectural impact of the crisis on the refining industry. (O.M.)
Downstream-based Scheduling for Energy Conservation in Green EPONs
Chen, Shen
2012-05-01
Maximizing the optical network unit’s (ONU) sleep time is an effective approach for achieving maximum energy conservation in green Ethernet passive optical networks (EPONs). While overlapping downstream and upstream ONU transmissions can maximize the ONU sleep time, it jeopardizes the quality of service (QoS) performance of the network, especially for downstream traffic in case the overlapping is based on the upstream time slot. In this paper, we study the downstream traffic performance in green EPONs under the limited service discipline and the upstream-based overlapped time window. Specifically, we first derive the expected mean packet delay, and then present a closed-form expression of the ONU sleep time, setting identical upstream/downstream transmission cycle times based on a maximum downstream traffic delay re-quirement. With the proposed system model, we present a novel downstream bandwidth allocation scheme for energy conservation in green EPONs. Simulation results verify the proposed model and highlight the advantages of our scheme over conventional approaches.
A new small-angle X-ray scattering set-up on the crystallography beamline I711 at MAX-lab
DEFF Research Database (Denmark)
Knaapila, M.; Svensson, C.; Barauskas, J.
2009-01-01
A small-angle X-ray scattering (SAXS) set-up has recently been developed at beamline I711 at the MAX II storage ring in Lund (Sweden). An overview of the required modifications is presented here together with a number of application examples. The accessible q range in a SAXS experiment is 0.009-0...
Directory of Open Access Journals (Sweden)
Xiaoyun eLiu
2014-10-01
Full Text Available Recent advances in rice flowering studies have shown that the accurate control of flowering by photoperiod is regulated by key mechanisms that involve the regulation of flowering genes including Hd1, Ehd1, Hd3a, and RFT1. The chromatin mechanism involved in the regulation of rice flowering genes is presently not well known. Here we show that the rice E(z genes SDG711 and SDG718, which encode the Polycomb Repressive Complex2 (PRC2 key subunit that is required for trimethylation of histone H3 lysine 27 (H3K27me3, are respectively involved in long day (LD and short day (SD regulation of key flowering genes. The expression of SDG711 and SDG718 is induced by LD and SD, respectively. Over-expression and down-regulation of SDG711 respectively repressed and promoted flowering in LD, but had no effect in SD. By contrast, down-regulation of SDG718 had no effect in LD but delayed flowering in SD. SDG711 and SDG718 repressed OsLF (a repressor of Hd1 respectively in LD and SD, leading to a higher expression of Hd1 thus late flowering in LD and early flowering in SD. SDG711 was also found to be involved in the repression of Ehd1 in LD. SDG711 was shown to directly target to OsLF and Ehd1 loci to mediate H3K27me3 and gene repression. The function of the rice E(z genes in LD repression and SD promotion of flowering suggests that PRC2-mediated epigenetic repression of gene expression is involved in the accurate photoperiod control of rice flowering.
Control of Delta Avulsion by Downstream Sediment Sinks
Salter, Gerard; Paola, Chris; Voller, Vaughan R.
2018-01-01
Understanding how fluxes are partitioned at delta bifurcations is critical for predicting patterns of land loss and gain in deltas worldwide. Although the dynamics of river deltas are influenced from both upstream and downstream, previous studies of bifurcations have focused on upstream controls. Using a quasi-1-D bifurcation model, we show that flow switching in bifurcations is strongly influenced by downstream sediment sinks. We find that coupling between upstream and downstream feedbacks can lead to oscillations in water and sediment flux partitioning. The frequency and initial rate of growth/decay of the oscillations depend on both upstream and downstream conditions, with dimensionless bifurcate length and bypass fraction emerging as key downstream parameters. With a strong offshore sink, causing bypass in the bifurcate branches, we find that bifurcation dynamics become "frozen"; that is, the bifurcation settles on a permanent discharge ratio. In contrast, under depositional conditions, we identify three dynamical regimes: symmetric; soft avulsion, where both branches remain open but the dominant branch switches; and full avulsion. Finally, we show that differential subsidence alters these regimes, with the difference in average sediment supply to each branch exactly compensating for the difference in accommodation generation. Additionally, the model predicts that bifurcations with shorter branches are less asymmetric than bifurcations with longer branches, all else equal, providing a possible explanation for the difference between backwater length distributaries, which tend to be avulsive, and relatively stable mouth-bar-scale networks. We conclude that bifurcations are sensitive both quantitatively and qualitatively to downstream sinks.
Continuous downstream processing of biopharmaceuticals.
Jungbauer, Alois
2013-08-01
Continuous manufacturing has been applied in many different industries but has been pursued reluctantly in biotechnology where the batchwise process is still the standard. A shift to continuous operation can improve productivity of a process and substantially reduce the footprint. Continuous operation also allows robust purification of labile biomolecules. A full set of unit operations is available to design continuous downstream processing of biopharmaceuticals. Chromatography, the central unit operation, is most advanced in respect to continuous operation. Here, the problem of 'batch' definition has been solved. This has also paved the way for implementation of continuous downstream processing from a regulatory viewpoint. Economic pressure, flexibility, and parametric release considerations will be the driving force to implement continuous manufacturing strategies in future. Copyright © 2013 Elsevier Ltd. All rights reserved.
Philippines' downstream sector poised for growth
International Nuclear Information System (INIS)
Anon.
1992-01-01
This paper reports that the Philippines' downstream sector is poised for sharp growth. Despite a slip in refined products demand in recent years, Philippines products demand will rebound sharply by 2000, East-West Center (EWC), Honolulu, predicts. Philippines planned refinery expansions are expected to meet that added demand, EWC Director Fereidun Fesharaki says. Like the rest of the Asia-Pacific region, product specifications are changing, but major refiners in the area expect to meet the changes without major case outlays. At the same time, Fesharaki says, push toward deregulation will further bolster the outlook for the Philippines downstream sector
Downstream-based Scheduling for Energy Conservation in Green EPONs
Chen, Shen; Dhaini, Ahmad R.; Ho, Pin-Han; Shihada, Basem; Shen, Gangxiang; Lin, Chih-Hao
2012-01-01
the ONU sleep time, it jeopardizes the quality of service (QoS) performance of the network, especially for downstream traffic in case the overlapping is based on the upstream time slot. In this paper, we study the downstream traffic performance in green
Kobayashi, Kaori; Guilliam, Thomas A; Tsuda, Masataka; Yamamoto, Junpei; Bailey, Laura J; Iwai, Shigenori; Takeda, Shunichi; Doherty, Aidan J; Hirota, Kouji
2016-08-02
PrimPol is a DNA damage tolerance enzyme possessing both translesion synthesis (TLS) and primase activities. To uncover its potential role in TLS-mediated IgVλ hypermutation and define its interplay with other TLS polymerases, PrimPol(-/-) and PrimPol(-/-)/Polη(-/-)/Polζ (-/-) gene knockouts were generated in avian cells. Loss of PrimPol had no significant impact on the rate of hypermutation or the mutation spectrum of IgVλ. However, PrimPol(-/-) cells were sensitive to methylmethane sulfonate, suggesting that it may bypass abasic sites at the IgVλ segment by repriming DNA synthesis downstream of these sites. PrimPol(-/-) cells were also sensitive to cisplatin and hydroxyurea, indicating that it assists in maintaining / restarting replication at a variety of lesions. To accurately measure the relative contribution of the TLS and primase activities, we examined DNA damage sensitivity in PrimPol(-/-) cells complemented with polymerase or primase-deficient PrimPol. Polymerase-defective, but not primase-deficient, PrimPol suppresses the hypersensitivity of PrimPol(-/-) cells. This indicates that its primase, rather than TLS activity, is pivotal for DNA damage tolerance. Loss of TLS polymerases, Polη and Polζ has an additive effect on the sensitivity of PrimPol(-/-) cells. Moreover, we found that PrimPol and Polη-Polζ redundantly prevented cell death and facilitated unperturbed cell cycle progression. PrimPol(-/-) cells also exhibited increased sensitivity to a wide variety of chain-terminating nucleoside analogs (CTNAs). PrimPol could perform close-coupled repriming downstream of CTNAs and oxidative damage in vitro. Together, these results indicate that PrimPol's repriming activity plays a central role in reinitiating replication downstream from CTNAs and other specific DNA lesions.
DEFF Research Database (Denmark)
Kleine-Kohlbrecher, Daniela; Christensen, Jesper; Vandamme, Julien
2010-01-01
X-linked mental retardation (XLMR) is an inherited disorder that mostly affects males and is caused by mutations in genes located on the X chromosome. Here, we show that the XLMR protein PHF8 and a C. elegans homolog F29B9.2 catalyze demethylation of di- and monomethylated lysine 9 of histone H3 (H......3K9me2/me1). The PHD domain of PHF8 binds to H3K4me3 and colocalizes with H3K4me3 at transcription initiation sites. Furthermore, PHF8 interacts with another XMLR protein, ZNF711, which binds to a subset of PHF8 target genes, including the XLMR gene JARID1C. Of interest, the C. elegans PHF8 homolog...... is highly expressed in neurons, and mutant animals show impaired locomotion. Taken together, our results functionally link the XLMR gene PHF8 to two other XLMR genes, ZNF711 and JARID1C, indicating that MR genes may be functionally linked in pathways, causing the complex phenotypes observed in patients...
Wave and particle evolution downstream of quasi-perpendicular shocks
Mckean, M. E.; Omidi, N.; Krauss-Varban, D.; Karimabadi, H.
1995-01-01
Distributions of ions heated in quasi-perpendicular bow shocks have large perpendicular temperature anisotropies that provide free energy for the growth of Alfven ion cyclotron (AIC) and mirror waves. These modes are often obsreved in the Earth's magnetosheath. Using two-dimensional hybrid simulations, we show that these waves are produced near the shock front and convected downstream rather than being produced locally downstream. The wave activity reduces the proton anisotropy to magnetosheath levels within a few tens of gyroradii of the shock but takes significantly longer to reduce the anisotropy of He(++) ions. The waves are primarily driven by proton anisotropy and the dynamics of the helium ions is controlled by the proton waves. Downstream of high Mach number shocks, mirror waves compete effectively with AIC waves. Downstream of low Mach number shocks, AIC waves dominate.
Critical effects of downstream boundary conditions on vortex breakdown
Kandil, Osama; Kandil, Hamdy A.; Liu, C. H.
1992-01-01
The unsteady, compressible, full Navier-Stokes (NS) equations are used to study the critical effects of the downstream boundary conditions on the supersonic vortex breakdown. The present study is applied to two supersonic vortex breakdown cases. In the first case, quasi-axisymmetric supersonic swirling flow is considered in a configured circular duct, and in the second case, quasi-axisymmetric supersonic swirling jet, that is issued from a nozzle into a supersonic jet of lower Mach number, is considered. For the configured duct flow, four different types of downstream boundary conditions are used, and for the swirling jet flow from the nozzle, two types of downstream boundary conditions are used. The solutions are time accurate which are obtained using an implicit, upwind, flux-difference splitting, finite-volume scheme.
Cladding Heatup Prediction between Spacer Grids for the Downstream Effect Evaluation
International Nuclear Information System (INIS)
Park, J. Y.; Kim, M. W.
2009-01-01
Since a recirculation sump clogging issue by debris generated from high energy pipe line break had been invoked as GSI-191 in the US, many researches on this issue have been undertaken. Previous researches on this topic are well summarized in Bang et al. Due to comprehensive nature of the issue, it includes many area of research and one of them is the area of downstream effect evaluation. The downstream effect is involved with adverse effects of debris passing the sump screen on the downstream systems, components and piping including core and it can be further divided into an ex-vessel downstream effect and an in-vessel downstream effect. In the ex-vessel downstream effect, focus is laid on plugging of spray nozzle, wearing and abrasion of moving parts of pump and valve and etc. Otherwise, a debris effect on reactor core is focused in the in-vessel downstream effect. Since debris can be ingested in the core or the systems of downstream of sump screen during recirculation, basically the downstream effect influences long-term core cooling phase. With respect to the in-vessel downstream effect, an up-to-date evaluation methodology is well summarized in a topical report submitted to the US nuclear regulatory commission by the pressurized water reactor owners group (PWROG). The report evaluates various aspects of debris ingestion in the core such as blockage at the core inlet, collection of debris on fuel grids, plating-out of fuel, chemical precipitants, protective coatings effect and etc. Most of them are evaluated qualitative manner based on previous research results and geometrical consideration on fuel rod bundles but some of them are also backed up by quantitative calculations to corroborate the qualitative decisions. One of them is a cladding heatup calculation between spacer grids. This is done to demonstrate that the cladding temperature of a fuel rod between grids with debris deposited on the clad surface in a post- LOCA recirculation environment is below
Mercury exposure in terrestrial birds far downstream of an historical point source
Energy Technology Data Exchange (ETDEWEB)
Jackson, Allyson K., E-mail: allyson.jackson@briloon.org [Biodiversity Research Institute, 19 Flaggy Meadow Road, Gorham, ME 04038 (United States); Institute for Integrative Bird Behavior Studies, Department of Biology, College of William and Mary, PO Box 8795, Williamsburg, VA 23187 (United States); Evers, David C.; Folsom, Sarah B. [Biodiversity Research Institute, 19 Flaggy Meadow Road, Gorham, ME 04038 (United States); Condon, Anne M. [U.S. Fish and Wildlife Service, 6669 Short Lane, Gloucester, VA 23061 (United States); Diener, John; Goodrick, Lizzie F. [Biodiversity Research Institute, 19 Flaggy Meadow Road, Gorham, ME 04038 (United States); McGann, Andrew J. [Institute for Integrative Bird Behavior Studies, Department of Biology, College of William and Mary, PO Box 8795, Williamsburg, VA 23187 (United States); Schmerfeld, John [U.S. Fish and Wildlife Service, 6669 Short Lane, Gloucester, VA 23061 (United States); Cristol, Daniel A. [Institute for Integrative Bird Behavior Studies, Department of Biology, College of William and Mary, PO Box 8795, Williamsburg, VA 23187 (United States)
2011-12-15
Mercury (Hg) is a persistent environmental contaminant found in many freshwater and marine ecosystems. Historical Hg contamination in rivers can impact the surrounding terrestrial ecosystem, but there is little known about how far downstream this contamination persists. In 2009, we sampled terrestrial forest songbirds at five floodplain sites up to 137 km downstream of an historical source of Hg along the South and South Fork Shenandoah Rivers (Virginia, USA). We found that blood total Hg concentrations remained elevated over the entire sampling area and there was little evidence of decline with distance. While it is well known that Hg is a pervasive and long-lasting aquatic contaminant, it has only been recently recognized that it also biomagnifies effectively in floodplain forest food webs. This study extends the area of concern for terrestrial habitats near contaminated rivers for more than 100 km downstream from a waterborne Hg point source. - Highlights: > We report blood mercury levels for terrestrial songbirds downstream of contamination. > Blood mercury levels remain elevated above reference for at least 137 km downstream. > Trends vary based on foraging guild and migration strategy. > Mercury affects terrestrial biota farther downstream than previously documented. - Blood mercury levels of forest songbirds remain elevated above reference levels for at least 137 km downstream of historical point source.
Model for collimated outflows in molecular clouds and the case of HH 7-11
Energy Technology Data Exchange (ETDEWEB)
Silvestro, G; Ferrari, A; Rosner, R; Trussoni, E; Tsinganos, K
1987-01-15
Modelling is carried out for collimated outflows of high-velocity gas in molecular clouds, which is often observed to be associated with linear chains of optical emission knots. A wind-flow model is proposed to account for the phenomenon, based on the structural similarities between the outflows and jets from active galactic nuclei and quasars. The chain of Herbig-Haro objects HH7-11 is used to illustrate the proposal. The model is based on flows in a channel of variable cross-sectional area due to Kelvin-Helmholtz instabilities between the flow and the ambient medium. Solutions of the Mach number equation for such a channel are presented, which possess multiple critical points and shocks identified with observed optical knots. (U.K.).
International Nuclear Information System (INIS)
Yang Chaowen; Wang Benyi; Ding Tongsen; Zhong Pingru; Liao Yongbing; Li Xiaochu; Lu Guohua
1994-01-01
The barium chloride-sludge recycle-fractional neutralization process for disposal of acidic mine water at Uranium Mine No. 711 was checked through laboratory and enlarged tests and one-year industrial trial-run. The results showed that the presented technology can meet the requirements of production and environmental protection
Mercury exposure in terrestrial birds far downstream of an historical point source
International Nuclear Information System (INIS)
Jackson, Allyson K.; Evers, David C.; Folsom, Sarah B.; Condon, Anne M.; Diener, John; Goodrick, Lizzie F.; McGann, Andrew J.; Schmerfeld, John; Cristol, Daniel A.
2011-01-01
Mercury (Hg) is a persistent environmental contaminant found in many freshwater and marine ecosystems. Historical Hg contamination in rivers can impact the surrounding terrestrial ecosystem, but there is little known about how far downstream this contamination persists. In 2009, we sampled terrestrial forest songbirds at five floodplain sites up to 137 km downstream of an historical source of Hg along the South and South Fork Shenandoah Rivers (Virginia, USA). We found that blood total Hg concentrations remained elevated over the entire sampling area and there was little evidence of decline with distance. While it is well known that Hg is a pervasive and long-lasting aquatic contaminant, it has only been recently recognized that it also biomagnifies effectively in floodplain forest food webs. This study extends the area of concern for terrestrial habitats near contaminated rivers for more than 100 km downstream from a waterborne Hg point source. - Highlights: → We report blood mercury levels for terrestrial songbirds downstream of contamination. → Blood mercury levels remain elevated above reference for at least 137 km downstream. → Trends vary based on foraging guild and migration strategy. → Mercury affects terrestrial biota farther downstream than previously documented. - Blood mercury levels of forest songbirds remain elevated above reference levels for at least 137 km downstream of historical point source.
Rare earth industries: Downstream business
International Nuclear Information System (INIS)
2011-01-01
The value chain of the rare earths business involves mining, extraction, processing, refining and the manufacture of an extensive range of downstream products which find wide applications in such industries including aerospace, consumer electronics, medical, military, automotive, renewable wind and solar energy and telecommunications. In fact the entire gamut of the high-tech industries depends on a sustainable supply of rare earths elements. The explosive demand in mobile phones is an excellent illustration of the massive potential that the rare earths business offers. In a matter of less than 20 years, the number of cell phones worldwide has reached a staggering 5 billion. Soon, going by the report of their growth in sales, the world demand for cell phones may even exceed the global population. Admittedly, the rare earths business does pose certain risks. Top among the risks are the health and safety risks. The mining, extraction and refining of rare earths produce residues and wastes which carry health and safety risks. The residues from the extraction and refining are radioactive, while their effluent waste streams do pose pollution risks to the receiving rivers and waterways. But, as clearly elaborated in a recent report by IAEA experts, there are technologies and systems available to efficiently mitigate such risks. The risks are Rare Earth manageable. However, it is crucial that the risk and waste management procedures are strictly followed and adhered to. This is where effective monitoring and surveillance throughout the life of all such rare earths facilities is crucial. Fortunately, Malaysia's regulatory standards on rare earths follow international standards. In some areas, Malaysia's regulatory regime is even more stringent than the international guidelines. (author)
DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS
Energy Technology Data Exchange (ETDEWEB)
Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)
2016-03-01
Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.
Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field
Directory of Open Access Journals (Sweden)
Nicole L. Key
2014-01-01
Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.
The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon.
Lorenzen, Marcé D; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W
2008-07-22
Maternal-Effect Dominant Embryonic Arrest ("Medea") factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea(1) activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea(1) reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations.
The role of headwater streams in downstream water quality
Alexander, R.B.; Boyer, E.W.; Smith, R.A.; Schwarz, G.E.; Moore, R.B.
2007-01-01
Knowledge of headwater influences on the water-quality and flow conditions of downstream waters is essential to water-resource management at all governmental levels; this includes recent court decisions on the jurisdiction of the Federal Clean Water Act (CWA) over upland areas that contribute to larger downstream water bodies. We review current watershed research and use a water-quality model to investigate headwater influences on downstream receiving waters. Our evaluations demonstrate the intrinsic connections of headwaters to landscape processes and downstream waters through their influence on the supply, transport, and fate of water and solutes in watersheds. Hydrological processes in headwater catchments control the recharge of subsurface water stores, flow paths, and residence times of water throughout landscapes. The dynamic coupling of hydrological and biogeochemical processes in upland streams further controls the chemical form, timing, and longitudinal distances of solute transport to downstream waters. We apply the spatially explicit, mass-balance watershed model SPARROW to consider transport and transformations of water and nutrients throughout stream networks in the northeastern United States. We simulate fluxes of nitrogen, a primary nutrient that is a water-quality concern for acidification of streams and lakes and eutrophication of coastal waters, and refine the model structure to include literature observations of nitrogen removal in streams and lakes. We quantify nitrogen transport from headwaters to downstream navigable waters, where headwaters are defined within the model as first-order, perennial streams that include flow and nitrogen contributions from smaller, intermittent and ephemeral streams. We find that first-order headwaters contribute approximately 70% of the mean-annual water volume and 65% of the nitrogen flux in second-order streams. Their contributions to mean water volume and nitrogen flux decline only marginally to about 55% and
Upgrade of the LHC Beam Dumping Protection Elements
Weterings, W; Balhan, B; Borburgh, J; Goddard, B; Maglioni, C; Versaci, R
2012-01-01
The Beam Dumping System for the Large Hadron Collider comprises for each ring a set of horizontally deflecting extraction kicker magnets, vertically deflecting steel septa, dilution kickers and finally, a couple of hundred meters further downstream, an absorber block. A mobile diluter (TCDQ) protects the superconducting quadrupole immediately downstream of the extraction as well as the arc at injection energy and the triplet aperture at top energy from bunches with small impact parameters, in case of a beam dump that is not synchronized with the particle free gap or a spontaneous firing of the extraction kickers. Simulations have shown that an asynchronous dump of a 7 TeV nominal beam into the TCDQ absorber blocks could damage it. This paper describes the proposed changes to this device in order to maintain the protection for the downstream elements while reducing the risk of damaging the TCDQ in case of such a beam loss.
Analysis of Petroleum Downstream Industry Potential in Riau Province
Directory of Open Access Journals (Sweden)
Tomi Erfando
2017-06-01
Full Text Available Petroleum downstream industry in Riau Province is still not optimal. The data shows that from 98,892,755 barrels lifting oil each year only 62,050,000 barrels could be processed in refinery unit II Dumai operated by PT Pertamina. There is a potential of 35-40% of downstream industry. Indonesian Government through The Ministry of Energy and Mineral Resources declared the construction of a mini refinery to boost oil processing output in the downstream sector. A feasibility study of development plan mini refinery is needed. The study includes production capacity analysis, product analysis, development & operational refinery analysis and economic analysis. The results obtained by the mini refinery capacity is planned to process crude oil 6000 BOPD with the products produced are gasoline, kerosene, diesel and oil. Investment cost consist of is capital cost US $ 104419784 and operating cost US $ 13766734 each year with net profit earned US $ 12330063/year and rate of return from investment 11.63%
Downstream anastomotic hyperplasia. A mechanism of failure in Dacron arterial grafts.
LoGerfo, F W; Quist, W C; Nowak, M D; Crawshaw, H M; Haudenschild, C C
1983-01-01
The precise location and progression of anastomotic hyperplasia and its possible relationship to flow disturbances was investigated in femoro-femoral Dacron grafts in 28 dogs. In 13 grafts, the outflow from the end-to-side downstream anastomosis was bidirectional (BDO), and in 15 it was unidirectional (UDO) (distally). Grafts were electively removed at intervals of two to 196 days or at the time of thrombosis. Each anastomosis and adjacent artery was perfusion-fixed and sectioned sagittally. The mean sagittal section was projected onto a digitized pad, and the total area of hyperplasia internal to the arterial internal elastic lamina and within the adjacent graft was integrated by computer. The location of the hyperplasia was compared with previously established sites of flow separation and stagnation. The observation was made that hyperplasia is significantly greater at the downstream, as compared with the upstream, anastomosis in both groups (BDO = p less than 0.001 and UDO = p less than 0.001) (analysis of variance for independent groups). Furthermore, this downstream hyperplasia was progressive with time (BDO p less than 0.01) (UDO p less than 0.01); Spearman Rank Correlation. There was no significant increase in the extent of downstream hyperplasia where flow separation was known to be greater (BDO). Five grafts failed (three BDO, two UDO), as a result of complete occlusion of the downstream anastomosis by fibrous hyperplasia. Transmission electron microscopy showed the hyperplasia to consist of collagen-producing smooth muscle cells. Anastomotic hyperplasia is significantly greater at the downstream anastomosis, is progressive with time, and is the primary cause of failure of Dacron arterial grafts in this model. Quantitative analysis of downstream anastomotic hyperplasia may be a valuable measure of the biocompatibility of Dacron grafts. Images Fig. 2. Fig. 3. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:6219641
Operational optimization in the downstream; Otimizacao operacional no downstream
Energy Technology Data Exchange (ETDEWEB)
Silberman, Luis; Cunha, Filipe Silveira Ramos da [Petroleo Ipiranga, Porto Alegre, RS (Brazil)
2004-07-01
On the present competitive down stream's market, there is a great necessity of optimization aiming to guarantee the best price and quality of our clients. Our goal is to attend these expectations while we guarantee an efficient operation. The greatest question is how far we are from the ideal model. This way, a lot of projects have been executed during the last years aiming the operational optimization of all our activities. We divide the projects in 4 areas: Logistic (new modals distribution), Transport (transport optimization - quality and more deliveries with less trucks), Client Support (Internet Ipiranga and Support Center), Distribution Terminals Productivity (automation and environment). This work intend to present our ideal, perfect and complete Downstream Operation model. We will talk about how close we are of this ideal model and we will present the projects that we had already developed and implanted on the automation of the terminals and the logistics area. (author)
From gravel to sand. Downstream fining of bed sediments in the lower river Rhine
Frings, R.M.
2007-01-01
A common characteristic of many rivers is the tendency for bed sediments to become finer in downstream direction. This phenomenon, which is generally known as downstream fining, has a strong effect on the morphologic and hydrodynamic behaviour of a river. The fundamental causes of downstream
Upstream-downstream cooperation approach in Guanting Reservoir watershed.
Yang, Zhi-Feng; Zhang, Wen-Guo
2005-01-01
A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.
A floating trap for sampling downstream migrant fishes.
Carl E. McLemore; Fred H. Everest; William R. Humphreys; Mario F. Solazzi
1989-01-01
Fishery scientists and managers are interested in obtaining information about downstream movements of fish species for biological and economic reasons. Different types of nets and traps have been used for this purpose with only partial success. The floating, self-cleaning downstream migrant trap described here proved successful for sampling several salmoniform and...
Altshuler, Lori L.; Kupka, Ralph W.; Hellemann, Gerhard; Frye, Mark A.; Sugar, Catherine A.; McElroy, Susan L.; Nolen, Willem A.; Grunze, Heinz; Leverich, Gabriele S.; Keck, Paul E.; Zermeno, Melanie
Objective: The authors assessed gender differences in the proportion of clinical visits spent depressed, manic, or euthymic in patients with bipolar disorder. Method: Data were analyzed from 711 patients with bipolar I or II disorder who were followed prospectively over 7 years (13,191 visits). The
MARK/Par1 Kinase Is Activated Downstream of NMDA Receptors through a PKA-Dependent Mechanism.
Directory of Open Access Journals (Sweden)
Laura P Bernard
Full Text Available The Par1 kinases, also known as microtubule affinity-regulating kinases (MARKs, are important for the establishment of cell polarity from worms to mammals. Dysregulation of these kinases has been implicated in autism, Alzheimer's disease and cancer. Despite their important function in health and disease, it has been unclear how the activity of MARK/Par1 is regulated by signals from cell surface receptors. Here we show that MARK/Par1 is activated downstream of NMDA receptors in primary hippocampal neurons. Further, we show that this activation is dependent on protein kinase A (PKA, through the phosphorylation of Ser431 of Par4/LKB1, the major upstream kinase of MARK/Par1. Together, our data reveal a novel mechanism by which MARK/Par1 is activated at the neuronal synapse.
Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb
2017-08-01
Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.
Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean
2010-11-01
The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.
DEFF Research Database (Denmark)
van der Ploeg, J; Willemsen, M; Van Hall, Gerrit
1995-01-01
B gene. In mutant GJ10M50, a DNA fragment (designated IS1247) had copied itself from a position on the chromosome that was not linked to the dhlB region to a site immediately upstream of dhlB, resulting in a 1,672-bp insertion. IS1247 was found to encode an open reading frame corresponding to 464 amino...... acids which showed similarity to putative transposases from two other insertion elements. In most of the other MBA-resistant mutants of GJ10, IS1247 was also present in one more copy than in the wild type, which had two copies located within 20 kb. After insertion to a site proximal to dhlB, IS1247...... was able to transpose itself together with the dhlB gene to a plasmid, without the requirement of a second insertion element being present downstream of dhlB. The results show that IS1247 causes bromoacetate resistance by overexpression and mobilization of the haloacid dehalogenase gene, which mimics steps...
A novel virtual hub approach for multisource downstream service integration
Previtali, Mattia; Cuca, Branka; Barazzetti, Luigi
2016-08-01
A large development of downstream services is expected to be stimulated starting from earth observations (EO) datasets acquired by Copernicus satellites. An important challenge connected with the availability of downstream services is the possibility for their integration in order to create innovative applications with added values for users of different categories level. At the moment, the world of geo-information (GI) is extremely heterogeneous in terms of standards and formats used, thus preventing a facilitated access and integration of downstream services. Indeed, different users and data providers have also different requirements in terms of communication protocols and technology advancement. In recent years, many important programs and initiatives have tried to address this issue even on trans-regional and international level (e.g. INSPIRE Directive, GEOSS, Eye on Earth and SEIS). However, a lack of interoperability between systems and services still exists. In order to facilitate the interaction between different downstream services, a new architectural approach (developed within the European project ENERGIC OD) is proposed in this paper. The brokering-oriented architecture introduces a new mediation layer (the Virtual Hub) which works as an intermediary to bridge the gaps linked to interoperability issues. This intermediation layer de-couples the server and the client allowing a facilitated access to multiple downstream services and also Open Data provided by national and local SDIs. In particular, in this paper an application is presented integrating four services on the topic of agriculture: (i) the service given by Space4Agri (providing services based on MODIS and Landsat data); (ii) Gicarus Lab (providing sample services based on Landsat datasets) and (iii) FRESHMON (providing sample services for water quality) and services from a several regional SDIs.
Hydrodynamic properties and distribution of bait downstream of a zooplankton trap
DEFF Research Database (Denmark)
Selander, Erik; Heuschele, Jan; Larsson, Ann I.
2017-01-01
The flow regime around a chemically baited trap is crucial for the trapping process and distribution of bait downstream of traps. We measured the flow field downstream of a trap prototype in flume experiments and mapped the distribution of bait using laser induced fluorescence. The trap produced ...
Directory of Open Access Journals (Sweden)
Ramya Pai
2015-01-01
Full Text Available Aim: To determine the prevalence of child behavior management problems (BMP and to analyze the influence and predictive power of nondental and dental background variables on BMP. Study Design: Prospective analytical study. Materials and Methods: The study group included 165 children aged 7-11 years who received comprehensive dental treatment, after obtaining written informed consent. Parents/guardians were interviewed using standardized questionnaire to obtain background information. Each child′s treatment was carried out and was recorded with a fixed digital video (DV recorder. The treatments were classified into three levels of invasiveness: Noninvasive (NI, moderately invasive (MI, and highly invasive (HI. The entire DV record of each treatment was observed, and child′s dental behavior was rated independently by two precalibrated examiners using modified Venham′s behavior rating scale. Then, the background factors obtained through the questionnaire data were analyzed for its association with child′s dental behavior. Results: Statistical tests used were Chi-square test and multiple logistic regression analysis to determine the relationship of multiple variables with dental behavior. Comparison of child′s behavior during different visits was done by Wilcoxan matched pairs test. The prevalence of BMP in children aged 7-11 years in the study sample was 0%, 4.2%, and 15.76% for NI, MI, and HI procedures, respectively. Three variables were significant predictors of behavior; order of birth that is, first born, history of hospitalization, and unpleasant past dental experience (P < 0.05. Conclusions: Direct conditioning pathway is the major factor in determining child′s behavior. Dental experiences, duration of treatment, and complexity of treatment have greater impact on how the child behaves in a dental setup.
Investigation on the intense fringe formation phenomenon downstream hot-image plane.
Hu, Yonghua; Li, Guohui; Zhang, Lifu; Huang, Wenti; Chen, Shuming
2015-11-30
The propagation of a high-power flat-topped Gaussian beam, which is modulated by three parallel wirelike scatterers, passing through a downstream Kerr medium slab and free spaces is investigated. A new phenomenon is found that a kind of intense fringe with intensity several times that of the incident beam can be formed in a plane downstream the Kerr medium. This kind of intense fringe is another result in the propagation process of nonlinear imaging and it locates scores of centimeters downstream the predicted hot image plane. Moreover, the intensity of this fringe can achieve the magnitude of that of hot image in corresponding single-scatterer case, and this phenomenon can arise only under certain conditions. As for the corresponding hot images, they are also formed but largely suppressed. The cause of the formation of such an intense fringe is analyzed and found related to interference in the free space downstream the Kerr medium. Moreover, the ways it is influenced by some important factors such as the wavelength of incident beam and the properties of scatterers and Kerr medium are discussed, and some important properties and relations are revealed.
DEFF Research Database (Denmark)
Pedersen, S. B.; Varbo, A.; Langsted, A.
2018-01-01
and community. Methods: A total of 108 711 individuals from the Copenhagen General Population Study were grouped as unlikely chylomicronemia (nonfasting triglycerides ....4%) and sedentary lifestyle (PAF: 6.0%). Conclusions: Obesity and type 2 diabetes were the most important modifiable chylomicronemia risk factors in women and men, both for the individual and community. This could influence chylomicronemia prevention and help design randomized trials aimed at reducing triglycerides......Background: Hypertriglyceridemia prevalence is increasing as more individuals become obese, and chylomicronemia risk factors for the individual and community have not been described previously. Objective: To describe chylomicronemia risk factors in the general population for individuals...
International Nuclear Information System (INIS)
2003-08-01
25 contributed papers to the 30th European Physical Society Conference on Controlled Fusion and Plasma Physics (St. Petersburg, Russia, 7-11 July 2003) from the activity of NIFS are collected in this report. (author)
Odor, L.; Wanty, R.B.; Horvath, I.; Fugedi, U.; ,
1999-01-01
Regional geochemical baseline values have been established for Hungary by the use of low-density stream-sediment surveys of flood-plain deposits of large drainage basins and of the fine fraction of stream sediments. The baseline values and anomaly thresholds thus produced helped to evaluate the importance of high toxic element concentrations found in soils in a valley downstream of a polymetallic vein-type base-metal mine. Erosion of the mine dumps and flotation dump, losses of metals during filtering, storage and transportation, human neglects, and operational breakdowns, have all contributed to the contamination of a small catchment basin in a procession of releases of solid waste. The sulfide-rich waste material weathers to a yellow color; this layer of 'yellow sand' blankets a narrow strip of the floodplain of Toka Creek in the valley near the town of Gyongyosoroszi. Contamination was spread out in the valley by floods. Metals present in the yellow sand include Pb, As, Cd, Cu, Zn, and Sb. Exposure of the local population to these metals may occur through inhalation of airborne particulates or by ingestion of these metals that are taken up by crops grown in the valley. To evaluate the areal extent and depth of the contamination, active stream sediment, flood-plain deposits, lake or reservoir sediments, soils, and surface water were sampled along the erosion pathways downstream of the mine and dumps. The flood-plain profile was sampled in detail to see the vertical distribution of elements and to relate the metal concentrations to the sedimentation and contamination histories of the flood plain. Downward migration of mobile Zn and Cd from the contaminated upper layers under supergene conditions is observed, while vertical migration of Pb, As, Hg and Sb appears to be insignificant. Soil profiles of 137Cs which originated from above-ground atomic bomb tests and the Chernobyl accident, provide good evidence that the upper 30-40 cm of the flood-plain sections, which
Investigation of wall mass transfer characteristics downstream of an orifice
International Nuclear Information System (INIS)
El-Gammal, M.; Ahmed, W.H.; Ching, C.Y.
2012-01-01
Highlights: ► Numerical simulations were performed for the mass transfer downstream of an orifice. ► The Low Reynolds Number K-ε turbulence model was used. ► The numerical results were in good agreement with existing experimental results. ► The maximum Sherwood number downstream of the orifice was significantly affected by the Reynolds number. ► The Sherwood number profile was well correlated with the turbulence kinetic energy profile close to the wall. - Abstract: Numerical simulations were performed to determine the effect of Reynolds number and orifice to pipe diameter ratio (d o /d) on the wall mass transfer rate downstream of an orifice. The simulations were performed for d o /d of 0.475 for Reynolds number up to 70,000. The effect of d o /d was determined by performing simulations at a Reynolds number of 70,000 for d o /d of 0.375, 0.475 and 0.575. The momentum and mass transport equations were solved using the Low Reynolds Number (LRN) K-ε turbulence model. The Sherwood number (Sh) profile downstream of the orifice was in relatively good agreement with existing experimental results. The Sh increases sharply downstream of the orifice, reaching a maximum within 1–2 diameters downstream of the orifice, before relaxing back to the fully developed pipe flow value. The Sh number well downstream of the orifice was in good agreement with results for fully developed pipe flow estimated from the correlation of . The peak Sh numbers from the simulations were higher than that predicted from and .
Lateral and vertical distribution of downstream migrating juvenile sea lamprey
Sotola, V. Alex; Miehls, Scott M.; Simard, Lee G.; Marsden, J. Ellen
2018-01-01
Sea lamprey is considered an invasive and nuisance species in the Laurentian Great Lakes, Lake Champlain, and the Finger Lakes of New York and is a major focus of control efforts. Currently, management practices focus on limiting the area of infestation using barriers to block migratory adults, and lampricides to kill ammocoetes in infested tributaries. No control efforts currently target the downstream-migrating post-metamorphic life stage which could provide another management opportunity. In order to apply control methods to this life stage, a better understanding of their downstream movement patterns is needed. To quantify spatial distribution of downstream migrants, we deployed fyke and drift nets laterally and vertically across the stream channel in two tributaries of Lake Champlain. Sea lamprey was not randomly distributed across the stream width and lateral distribution showed a significant association with discharge. Results indicated that juvenile sea lamprey is most likely to be present in the thalweg and at midwater depths of the stream channel. Further, a majority of the catch occurred during high flow events, suggesting an increase in downstream movement activity when water levels are higher than base flow. Discharge and flow are strong predictors of the distribution of out-migrating sea lamprey, thus managers will need to either target capture efforts in high discharge areas of streams or develop means to guide sea lamprey away from these areas.
Ion energy characteristics downstream of a high power helicon
International Nuclear Information System (INIS)
Prager, James; Winglee, Robert; Ziemba, Tim; Roberson, B Race; Quetin, Gregory
2008-01-01
The High Power Helicon eXperiment operates at higher powers (37 kW) and lower background neutral pressure than other helicon experiments. The ion velocity distribution function (IVDF) has been measured at multiple locations downstream of the helicon source and a mach 3-6 flowing plasma was observed. The helicon antenna has a direct effect in accelerating the plasma downstream of the source. Also, the IVDF is affected by the cloud of neutrals from the initial gas puff, which keeps the plasma speed low at early times near the source.
Ion energy characteristics downstream of a high power helicon
Energy Technology Data Exchange (ETDEWEB)
Prager, James; Winglee, Robert; Ziemba, Tim; Roberson, B Race; Quetin, Gregory [University of Washington, Johnson Hall 070, Box 351310, 4000 15th Avenue NE, Seattle, WA 98195-1310 (United States)], E-mail: jprager@u.washington.edu
2008-05-01
The High Power Helicon eXperiment operates at higher powers (37 kW) and lower background neutral pressure than other helicon experiments. The ion velocity distribution function (IVDF) has been measured at multiple locations downstream of the helicon source and a mach 3-6 flowing plasma was observed. The helicon antenna has a direct effect in accelerating the plasma downstream of the source. Also, the IVDF is affected by the cloud of neutrals from the initial gas puff, which keeps the plasma speed low at early times near the source.
Analytical prediction of the unsteady lift on a rotor caused by downstream struts
Taylor, A. C., III; Ng, W. F.
1987-01-01
A two-dimensional, inviscid, incompressible procedure is presented for predicting the unsteady lift on turbomachinery blades caused by the upstream potential disturbance of downstream flow obstructions. Using the Douglas-Neumann singularity superposition potential flow computer program to model the downstream flow obstructions, classical equations of thin airfoil theory are then employed, to compute the unsteady lift on the upstream rotor blades. The method is applied to a particular geometry which consists of a rotor, a downstream stator, and downstream struts which support the engine casing. Very good agreement between the Douglas-Neumann program and experimental measurements was obtained for the downstream stator-strut flow field. The calculations for the unsteady lift due to the struts were in good agreement with the experiments in showing that the unsteady lift due to the struts decays exponentially with increased axial separation of the rotor and the struts. An application of the method showed that for a given axial spacing between the rotor and the strut, strut-induced unsteady lift is a very weak function of the axial or circumferential position of the stator.
Hata, Shoji; Hirayama, Jun; Kajiho, Hiroaki; Nakagawa, Kentaro; Hata, Yutaka; Katada, Toshiaki; Furutani-Seiki, Makoto; Nishina, Hiroshi
2012-06-22
Yes-associated protein (YAP) is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes. Although cytoplasmic retention of YAP is known to be mediated by Hippo pathway-dependent phosphorylation, post-translational modifications that regulate YAP in the nucleus remain unclear. Here we report the discovery of a novel cycle of acetylation/deacetylation of nuclear YAP induced in response to S(N)2 alkylating agents. We show that after treatment of cells with the S(N)2 alkylating agent methyl methanesulfonate, YAP phosphorylation mediated by the Hippo pathway is markedly reduced, leading to nuclear translocation of YAP and its acetylation. This YAP acetylation occurs on specific and highly conserved C-terminal lysine residues and is mediated by the nuclear acetyltransferases CBP (CREB binding protein) and p300. Conversely, the nuclear deacetylase SIRT1 is responsible for YAP deacetylation. Intriguingly, we found that YAP acetylation is induced specifically by S(N)2 alkylating agents and not by other DNA-damaging stimuli. These results identify a novel YAP acetylation cycle that occurs in the nucleus downstream of the Hippo pathway. Intriguingly, our findings also indicate that YAP acetylation is involved in responses to a specific type of DNA damage.
Hata, Shoji; Hirayama, Jun; Kajiho, Hiroaki; Nakagawa, Kentaro; Hata, Yutaka; Katada, Toshiaki; Furutani-Seiki, Makoto; Nishina, Hiroshi
2012-01-01
Yes-associated protein (YAP) is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes. Although cytoplasmic retention of YAP is known to be mediated by Hippo pathway-dependent phosphorylation, post-translational modifications that regulate YAP in the nucleus remain unclear. Here we report the discovery of a novel cycle of acetylation/deacetylation of nuclear YAP induced in response to SN2 alkylating agents. We show that after treatment of cells with the SN2 alkylating agent methyl methanesulfonate, YAP phosphorylation mediated by the Hippo pathway is markedly reduced, leading to nuclear translocation of YAP and its acetylation. This YAP acetylation occurs on specific and highly conserved C-terminal lysine residues and is mediated by the nuclear acetyltransferases CBP (CREB binding protein) and p300. Conversely, the nuclear deacetylase SIRT1 is responsible for YAP deacetylation. Intriguingly, we found that YAP acetylation is induced specifically by SN2 alkylating agents and not by other DNA-damaging stimuli. These results identify a novel YAP acetylation cycle that occurs in the nucleus downstream of the Hippo pathway. Intriguingly, our findings also indicate that YAP acetylation is involved in responses to a specific type of DNA damage. PMID:22544757
India's Downstream Petroleum Sector
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-07-01
This study provides a holistic examination of pricing and investment dynamics in India's downstream petroleum sector. It analyses the current pricing practices, highlights the tremendous fiscal cost of current pricing and regulatory arrangements, and examines the sectoral investment dynamics. It also looks at potential paths towards market-based reform along which the Indian government may move, while at the same time protecting energy market access for India's large poor population.
«Qui patrie excidium intulerunt». Hispania 711: Desperate explanations for an unexpected collapse
Directory of Open Access Journals (Sweden)
Pablo C. Díaz
2016-09-01
Full Text Available The fall of the Visigothic Kingdom of Toledo from the Muslim incursion in the year 711 has been generally explained by specialists as an inevitable consequence of a disintegration process in the Visigothic power structures. Historians have associated this situation to a confrontation – either direct or indirect – between Hispanic-Visigothic monarchy and aristocracy, being the standstill of the kingdom (caused by its administrative, military and judicial institutional incapacity also considered. In this paper, as opposed to the fatalistic perspective where the idea of an inevitable end was irrationally imposed, a different explanation is proposed based on the multiple power dynamics, the Kingdom’s defense mechanisms and the last Visigothic monarchs’ legislative activity. All these ideas will be framed into the context of the (unstable normality and the efficacy of the Visigothic institutional machinery.
Downstream Yangtze River levels impacted by Three Gorges Dam
International Nuclear Information System (INIS)
Wang, Jida; Sheng, Yongwei; Gleason, Colin J; Wada, Yoshihide
2013-01-01
Changes in the Yangtze River level induced by large-scale human water regulation have profound implications on the inundation dynamics of surrounding lakes/wetlands and the integrity of related ecosystems. Using in situ measurements and hydrological simulation, this study reveals an altered Yangtze level regime downstream from the Three Gorges Dam (TGD) to the Yangtze estuary in the East China Sea as a combined result of (i) TGD’s flow regulation and (ii) Yangtze channel erosion due to reduced sediment load. During the average annual cycle of TGD’s regular flow control in 2009–2012, downstream Yangtze level variations were estimated to have been reduced by 3.9–13.5% at 15 studied gauging stations, manifested as evident level decrease in fall and increase in winter and spring. The impacts on Yangtze levels generally diminished in a longitudinal direction from the TGD to the estuary, with a total time lag of ∼9–12 days. Chronic Yangtze channel erosion since the TGD closure has lowered water levels in relation to flows at most downstream stations, which in turn counteracts the anticipated level increase by nearly or over 50% in winter and spring while reinforcing the anticipated level decrease by over 20% in fall. Continuous downstream channel erosion in the near future may further counteract the benefit of increased Yangtze levels during TGD’s water supplement in winter and accelerate the receding of inundation areas/levels of downstream lakes in fall. (letter)
Directory of Open Access Journals (Sweden)
Samad Esmaeilzadeh
2013-01-01
Full Text Available The purpose of this study was to evaluate cardiorespiratory fitness (CRF, activity level, some health-related anthropometric variables, sedentary behaviour and socioeconomic status (SES of 7-11 year old boys in the city of Ardabil, Iran. Of 21 253 school boys aged 7-11 years, 766 participated in this study using the cluster sampling method. Subjects underwent standard anthropometry. One-mile test was used to evaluate ·VO2max. BMI cut-off points were used to identify weight status. Child’s TV watching and video playing daily time (TVVPT was taken for sedentary behaviour evaluation. SES and activity level were measured by standard questionnaires. Of all participants, 8.9�0(N=68 of students had CRF lower than normal and 58.6�0(N=449 of them had inadequate physical activity. There was a significant adverse relationship between ·VO2max and body mass index (BMI, waist to height ratio (WHtR, waist circumference (WC, and fat mass (FM (p<0.05. A significant direct association between SES and both FM and TVVPT was observed (p<0.05. Significantly lower physical activity and ·VO2max, and higher TVVPT were observed in the obese boys than their counterparts (p<0.05. The results of this study indicated a significant relationship between CRF and physical activity, and health-related anthropometric variables in a selected sample of 7-11 year boys. Moreover, the obese subjects had not only lower physical activity but also longer sedentary behaviour time than their counterparts.
Methylation of Hg downstream from the Bonanza Hg mine, Oregon
Gray, John E.; Hines, Mark E.; Krabbenhoft, David P.; Thoms, Bryn
2012-01-01
from the mine that varied from <0.02 to 0.22ng/L. Aquatic snails collected downstream from the mine were elevated in Hg indicating significant bioavailability and uptake of Hg by these snails. Results for sediment and water indicated significant methyl-Hg formation in the ecosystem downstream from the Bonanza mine, which is enhanced by the temperate climate, high precipitation in the area, and high organic matter.
Mortality of zebra mussel, Dreissena polymorpha, veligers during downstream transport
Horvath, T.G.; Lamberti, G.A.
1999-01-01
1. Streams flowing from lakes which contain zebra mussels, Dreissena polymorpha, provide apparently suitable habitats for mussel colonization and downstream range expansion, yet most such streams contain few adult mussels. We postulated that mussel veligers experience high mortality during dispersal via downstream transport. They tested this hypothesis in Christiana Creek, a lake-outlet stream in south-western Michigan, U.S.A., in which adult mussel density declined exponentially with distance downstream. 2. A staining technique using neutral red was developed and tested to distinguish quickly live and dead veligers. Live and dead veligers were distinguishable after an exposure of fresh samples to 13.3 mg L-1 of neutral red for 3 h. 3. Neutral red was used to determine the proportion of live veligers in samples taken longitudinally along Christiana Creek. The proportion of live veligers (mean ?? SE) declined from 90 ?? 3% at the lake outlet to 40 ?? 8% 18 km downstream. 4. Veligers appear to be highly susceptible to damage by physical forces (e.g. shear), and therefore, mortality in turbulent streams could be an important mechanism limiting zebra mussel dispersal to downstream reaches. Predictions of zebra mussel spread and population growth should consider lake-stream linkages and high mortality in running waters.
Modelling the role of transmission companies in the downstream European gas market
International Nuclear Information System (INIS)
Boots, M.A.; Rijkers, F.A.M.
2000-07-01
This paper describes the empirical model GASTALE and shows several analyses of the European gas market using this model. These analyses are mainly focused on the role of the downstream transmission companies. Producers of natural gas are assumed to form an oligopoly throughout the paper. Considering an oligopolistic transmission structure our model results show that the level of transmitters' profits strongly depends on the possibilities of discrimination on the border prices. If price discrimination by producers is allowed, these producers collect the main part of the margins on end-use prices. Without price discrimination the transmission companies collect most of the margins. Assuming an oligopolistic downstream structure, end-use prices converge to prices corresponding to perfect competition when the number of transmitters increases. Given the oligopolistic structure of the upstream industry, it is of importance to prevent (or abolish) monopolistic structures in the downstream gas market. In the case where oligopolistic competition between downstream gas companies cannot be prevented, vertical integration should be supported (or at least not be discouraged). 14 refs
Imaging for monitoring downstream processing of fermentation broths
DEFF Research Database (Denmark)
Moiseyenko, Rayisa; Baum, Andreas; Jørgensen, Thomas Martini
In relation to downstream processing of a fermentation broth coagulation/flocculation is a typical pretreatment method for separating undesirable particles/impurities from the wanted product. In the coagulation process the negatively charged impurities are destabilized by adding of a clarifying...
Directory of Open Access Journals (Sweden)
Christopher A Lavender
2016-08-01
Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.
Scleroglucan: Fermentative Production, Downstream Processing and Applications
Directory of Open Access Journals (Sweden)
Shrikant A. Survase
2007-01-01
Full Text Available Exopolysaccharides produced by a variety of microorganisms find multifarious industrial applications in foods, pharmaceutical and other industries as emulsifiers, stabilizers, binders, gelling agents, lubricants, and thickening agents. One such exopolysaccharide is scleroglucan, produced by pure culture fermentation from filamentous fungi of genus Sclerotium. The review discusses the properties, fermentative production, downstream processing and applications of scleroglucan.
Hydrological Effects of Chashm Dam on the Downstream of Talar River Watershed
Directory of Open Access Journals (Sweden)
Mohammad Reza Khaleghi
2017-02-01
Full Text Available Introduction: In the last century, dams have constructed with the objective of water supplies for agriculture, drinking water and industry. However, the results from the performance review of dams show adverse effects on the downstream environment and the availability of water resources. The purpose of the Chashm dam construction on the TalarRiver's tributaries is the water supply for Semnan city. Materials and Methods: This study was conducted in TalarRiver watershed. TalarRiveroriginatesfrom AlborzMountains in Mazandaran province, in the southern Caspian Sea basin, in north of Iran and flows parallel with the Firouzkooh-Ghaemshahr road and it arrives to the Caspian beach area in the Malek Kala village. In order to supply the water requirements of Semnan city, the construction of Chashm dam on the TalarRiver's tributaries placed on the agenda of the Ministry of Energy. However, because of the uncontrolled exploitation of agricultural streams and invasion of privacy riverbed, the TalarRiver has acute and critical conditions from the point of hydrologic and environmental. To study the hydrological impacts of Chashm dam, Talar watershed was considered with an area of approximately 1057 square kilometers of the Pole Sefid gauging station using a rainfall-runoff model. Results and Discussion: Simulation of the study area hydrological behavior shows that the Chashm Dam average water discharge is near to 8.6 million m3. This figure will be significant changes during wet and droughtperiods. The minimum and maximum monthly discharge of the Chashm Dam watershed in August and February is equal to 0.31 and 0.55 m3/s respectively. The minimum and maximum monthly water demand in turn in October and August is equal to 0.015 and 0.4 m3/s respectively and this shows that the river discharge in June is lower than the downstream water demand. Based on confirmed studies of the Kamandab Consulting Engineers, drinking water requirement of Semnan province, water
Hobo, T; Asada, M; Kowyama, Y; Hattori, T
1999-09-01
ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.
Zhang, Peng-Jun; Li, Wei-Di; Huang, Fang; Zhang, Jin-Ming; Xu, Fang-Cheng; Lu, Yao-Bin
2013-05-01
Phloem-feeding whiteflies in the species complex Bemisia tabaci cause extensive crop damage worldwide. One of the reasons for their "success" is their ability to suppress the effectual jasmonic acid (JA) defenses of the host plant. However, little is understood about the mechanisms underlying whitefly suppression of JA-regulated defenses. Here, we showed that the expression of salicylic acid (SA)-responsive genes (EDS1 and PR1) in Arabidopsis thaliana was significantly enhanced during feeding by whitefly nymphs. Whereas upstream JA-responsive genes (LOX2 and OPR3) also were induced, the downstream JA-responsive gene (VSP1) was repressed, i.e., whiteflies only suppressed downstream JA signaling. Gene-expression analyses with various Arabidopsis mutants, including NahG, npr-1, ein2-1, and dde2-2, revealed that SA signaling plays a key role in the suppression of downstream JA defenses by whitefly feeding. Assays confirmed that SA activation enhanced whitefly performance by suppressing downstream JA defenses.
Trace element concentrations of wild saltwater crocodile eggs
International Nuclear Information System (INIS)
Manolis, S.C.; Webb, G.J.; Britton, A.R.; Jeffree, R.A.; Markich, S.J.
2002-01-01
Saltwater crocodiles (Crocodylus porosus) accumulate trace elements from the environment into their flesh and bones (Jeffree et al., 2001a). Elevated levels of metals (e.g. Hg, Zn, Pb), organochlorines (e.g. DDT) and radionuclides (e.g. radiocesium) have been recorded in blood, tissues and eggs of several crocodilian species (Manolis et al., this volume). In this study the concentrations of various elements (including metals) were measured in the yolk of C. porosus eggs collected from the Finniss River and two other distant nesting sites (Melacca Swamp, a spring-fed freshwater swamp; Adelaide River, a tidal river) during the 2000- 01 nesting season. Infertile eggs from 30 clutches (Adelaide 12, Melacca 8, Finniss 10) were opened and the yolk contents removed (after Webb et al., 1987) and frozen. Samples of yolk were then oven-dried, digested in nitric acid and hydrogen peroxide. The digest solutions were then analysed for 20 elements (see Table 1) using inductively coupled plasma mass spectroscopy. Similarities between the elemental composition of eggs from the three areas suggests that downstream contamination from Rum Jungle Mine is not apparent in C. porosus nesting in the Finniss River. These nesting areas are some 60 km downstream of the mine site, and contaminants are probably greatly diluted during the wet season. C. porosus were also intensively hunted in the Finniss River area during the 1950s and 1960s, until their protection in 1971 (Webb et al. 1984). Some females would have been recruited into the population after the period of mining. Long-term effects of the mine may be apparent in areas with Australian freshwater crocodiles (C. johnstoni), mainly upstream of C. porosus nesting areas and up to the mine. Examination of tissues and eggs of C. johnstoni may provide more information on the historical effects of the mine
Natural Origin Lycopene and Its "Green" Downstream Processing.
Papaioannou, Emmanouil H; Liakopoulou-Kyriakides, Maria; Karabelas, Anastasios J
2016-01-01
Lycopene is an abundant natural carotenoid pigment with several biological functions (well-known for its antioxidant properties) which is under intensive investigation in recent years. Lycopene chemistry, its natural distribution, bioavailability, biological significance, and toxicological effects are briefly outlined in the first part of this review. The second, major part, deals with various modern downstream processing techniques, which are assessed in order to identify promising approaches for the recovery of lycopene and of similar lipophilic compounds. Natural lycopene is synthesized in plants and by microorganisms, with main representatives of these two categories (for industrial production) tomato and its by-products and the fungus Blakeslea trispora, respectively. Currently, there is a great deal of effort to develop efficient downstream processing for large scale production of natural-origin lycopene, with trends strongly indicating the necessity for "green" and mild extraction conditions. In this review, emphasis is placed on final product safety and ecofriendly processing, which are expected to totally dominate in the field of natural-origin lycopene extraction and purification.
Ashton, Gabrielle H.; Morton, Jennifer P.; Myant, Kevin; Phesse, Toby J.; Ridgway, Rachel A.; Marsh, Victoria; Wilkins, Julie A.; Athineos, Dimitris; Muncan, Vanesa; Kemp, Richard; Neufeld, Kristi; Clevers, Hans; Brunton, Valerie; Winton, Douglas J.; Wang, Xiaoyan; Sears, Rosalie C.; Clarke, Alan R.; Frame, Margaret C.; Sansom, Owen J.
2012-01-01
SUMMARY The intestinal epithelium has a remarkable capacity to regenerate after injury and DNA damage. Here, we show that the integrin effector protein Focal Adhesion Kinase (FAK) is dispensable for normal intestinal homeostasis and DNA damage signaling, but is essential for intestinal regeneration following DNA damage. Given Wnt/c-Myc signaling is activated following intestinal regeneration, we investigated the functional importance of FAK following deletion of the Apc tumor suppressor protein within the intestinal epithelium. Following Apc loss, FAK expression increased in a c-Myc-dependent manner. Codeletion of Apc and Fak strongly reduced proliferation normally induced following Apc loss, and this was associated with reduced levels of phospho-Akt and suppression of intestinal tumorigenesis in Apc heterozygous mice. Thus, FAK is required downstream of Wnt Signaling, for Akt/mTOR activation, intestinal regeneration, and tumorigenesis. Importantly, this work suggests that FAK inhibitors may suppress tumorigenesis in patients at high risk of developing colorectal cancer. PMID:20708588
Directory of Open Access Journals (Sweden)
Zhenqing Wang
2018-05-01
Full Text Available A high-order finite difference method was used to simulate the hypersonic flow field over a blunt cone with different height roughness elements. The unsteady flow field induced by pulse disturbances was analyzed and compared with that under continuous disturbances. The temporal and spatial evolution characteristics of disturbances in the boundary layer were investigated and the propagation of different disturbance modes in the boundary layer was researched through the fast Fourier transform (FFT method. The effect of the roughness element on the receptivity characteristic of the hypersonic boundary layer under pulse entropy disturbances was explored. The results showed that the different mode disturbances near roughness in the boundary layer were enlarged in the upstream half of the roughness element and suppressed in the downstream half. However, the effect of roughness weakened gradually as the disturbance frequency increased in the boundary layer. A phenomenon of mode competition in the downstream region of the roughness element exited. As the disturbances propagated downstream, the fundamental mode gradually became the dominant mode. A certain promotion effect on the mode competition was induced by the roughness element and the effect was enhanced with the increase in the roughness element height.
Patents and Downstream Innovation Suppression - Facts or Fiction?
DEFF Research Database (Denmark)
Howells, John
the value of Kitch's prospect theory of patents, a theory that the social value of patents is that they enable the efficient coordination of technological development. I re-examine history and legal sources bearing on Merges and Nelson's illustrative cases and find no case to illustrate downstream...
DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY
Miah Muhammad Adel
2012-01-01
Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...
Dead zone area at the downstream flow of barrages
Directory of Open Access Journals (Sweden)
Mohamed F. Sauida
2016-12-01
Full Text Available Flow separation is a natural phenomenon encountered at some cases downstream of barrages. The main flow is divided into current and dead zone flows. The percentage area of dead zone flow must be taken into consideration downstream of barrages, due to its negative effect on flow characteristics. Experimental studies were conducted in the Hydraulic Research Institute (HRI, on a physical regulator model with five vents. Theoretically the separation zone is described as a part of an ellipse which is practically verified by plotting velocity vectors. The results show that the percentage area of dead zone to the area through length of separation depends mainly on the expansion ratio [channel width to width of opened vents], with maximum value of 81% for operated side gates. A statistical analysis was derived, to predict the percentage area of dead zone flow to the area through length of separation.
Flow behavior of droplets downstream of the spacer
International Nuclear Information System (INIS)
Kodama, Eiichiro; Morishita, Kiyohide; Aritomi, Masanori; Yano, Takashi
1998-01-01
The fuel spacer, of which role is to maintain an appropriate rod-to-rod clearance, is one of the components of a Boiling Water Reactor (BWR) fuel rod bundles. The fuel spacer influences flow characteristics of the liquid film in fuel rod bundles, so that its geometry influences greatly thermal hydraulics such as critical power and pressure drop therein. The purpose of this study is to clarify the effect of the spacer geometry on the core flow split downstream of the spacer. Phase Doppler Anemometry (PDA) was used for their meausrement under the conditions of a small amount of droplets in mist flows. From the experimental results, the normalized droplet velocity profiles with a spacer were split by the spacer and were different between a wider and a narrower regions in the channel, however, they became uniform at the distance far 100mm from the spacer. In the case without a spacer, the velocity was monotonously increasing nearer the rod surface with going toward the center of the channel. In the case with a spacer, the velocity profile downstream of the spacer changed in the narrower region of the channel. This tendency became more remarkable with thickening the spacer and widening clearance between the spacer and the wall. In this paper, 'drift' velocity effect was applied for the spacer model, due to the gas flows were split by the spacer which is based on the momentum balance between the narrower and wider channels. This model was confirmed from the experimental results that the droplet flowed from a wider region to a narrower one. This drift effect appeared more strongly as the spacer became thicker and the clearance did narrower. The analytical results explained qualitatively the measured ones. It is clarified that the drift effect proposed in this work was a dominant factor on droplet deposition downstream of the spacer
International Nuclear Information System (INIS)
1985-11-01
Environmental Standard Review Plan (ESRP) 7.1.1 provides guidance to the staff for preparation of environmental assessments of ''Radiological Impacts - Releases to Groundwater,'' an input to the staff's environmental statement which addresses the groundwater pathway consequences from postulated reactor core-melt accidents. The ESRP lists the type of information which should be collected, references that may be useful, and provides a procedure for uniform staff review of applicant analyses. The ESRP is applicable to both Construction Permit and Operating License Stage reviews
Photoperiod control of downstream movements of Atlantic salmon Salmo salar smolts
Zydlewski, Gayle B.; Stich, Daniel S.; McCormick, Stephen D.
2014-01-01
This study provides the first direct observations that photoperiod controls the initiation of downstream movement in Atlantic salmon Salmo salar smolts. Under simulated natural day length (LDN) conditions and seasonal increases in temperature, smolts increased their downstream movements five-fold for a period of 1 month in late spring. Under the same conditions, parr did not show changes in downstream movement behaviour. When given a shortened day length (10L:14D) beginning in late winter, smolts did not increase the number of downstream movements. An early increase in day length (16L:8D) in late winter resulted in earlier initiation and termination of downstream movements compared to the LDN group. Physiological status and behaviour were related but not completely coincident: gill Na+/K+-ATPase activity increased in all treatments and thyroid hormone was elevated prior to movement in 16L:8D treatment. The most parsimonious model describing downstream movement of smolts included synergistic effects of photoperiod treatment and temperature, indicating that peak movements occurred at colder temperatures in the 16L:8D treatment than in LDN, and temperature did not influence movement of smolts in the 10L:14D treatment. The complicated interactions of photoperiod and temperature are not surprising since many organisms have evolved to rely on correlations among environmental cues and windows of opportunity to time behaviours associated with life-history transitions. These complicated interactions, however, have serious implications for phenological adjustments and persistence ofS. salar populations in response to climate change.
Extreme wave phenomena in down-stream running modulated waves
Andonowati, A.; Karjanto, N.; van Groesen, Embrecht W.C.
Modulational, Benjamin-Feir, instability is studied for the down-stream evolution of surface gravity waves. An explicit solution, the soliton on finite background, of the NLS equation in physical space is used to study various phenomena in detail. It is shown that for sufficiently long modulation
Downstream Processability of Crystal Habit-Modified Active Pharmaceutical Ingredient
DEFF Research Database (Denmark)
Pudasaini, Nawin; Upadhyay, Pratik Pankaj; Parker, Christian Richard
2017-01-01
Efficient downstream processing of active pharmaceutical ingredients (APIs) can depend strongly on their particulate properties, such as size and shape distributions. Especially in drug products with high API content, needle-like crystal habit of an API may show compromised flowability and tablet......Efficient downstream processing of active pharmaceutical ingredients (APIs) can depend strongly on their particulate properties, such as size and shape distributions. Especially in drug products with high API content, needle-like crystal habit of an API may show compromised flowability...
The downstream externalities of harvesting rainwater in semi-arid watersheds: an Indian case study
Bouma, J.A.; Biggs, T.W.; Bouwer, L.M.
2011-01-01
Water-related investment projects affect downstream water availability, and therefore should account for these externalities. Few projects do, however, owing to lack of awareness, lack of data and difficulty in linking upstream investments to downstream effects. This article assesses the downstream
Energy-saving scheme based on downstream packet scheduling in ethernet passive optical networks
Zhang, Lincong; Liu, Yejun; Guo, Lei; Gong, Xiaoxue
2013-03-01
With increasing network sizes, the energy consumption of Passive Optical Networks (PONs) has grown significantly. Therefore, it is important to design effective energy-saving schemes in PONs. Generally, energy-saving schemes have focused on sleeping the low-loaded Optical Network Units (ONUs), which tends to bring large packet delays. Further, the traditional ONU sleep modes are not capable of sleeping the transmitter and receiver independently, though they are not required to transmit or receive packets. Clearly, this approach contributes to wasted energy. Thus, in this paper, we propose an Energy-Saving scheme that is based on downstream Packet Scheduling (ESPS) in Ethernet PON (EPON). First, we design both an algorithm and a rule for downstream packet scheduling at the inter- and intra-ONU levels, respectively, to reduce the downstream packet delay. After that, we propose a hybrid sleep mode that contains not only ONU deep sleep mode but also independent sleep modes for the transmitter and the receiver. This ensures that the energy consumed by the ONUs is minimal. To realize the hybrid sleep mode, a modified GATE control message is designed that involves 10 time points for sleep processes. In ESPS, the 10 time points are calculated according to the allocated bandwidths in both the upstream and the downstream. The simulation results show that ESPS outperforms traditional Upstream Centric Scheduling (UCS) scheme in terms of energy consumption and the average delay for both real-time and non-real-time packets downstream. The simulation results also show that the average energy consumption of each ONU in larger-sized networks is less than that in smaller-sized networks; hence, our ESPS is better suited for larger-sized networks.
Gaeuman, D. A.; Dickenson, S.; Pyles, M.
2009-12-01
Gravel augmentations are being implemented in a number of streams where natural recruitment of gravel is impeded by dams. Uncertainties relevant to the management of gravel augmentations include the quantities of gravel needed to achieve habitat benefits at downstream locations and the temporal and spatial scales over which those benefits that will be realized. The solution to such questions depends to a large extent on how gravel slugs evolve as the material is transported downstream, i.e., whether the gravel translates downstream as a coherent wave or whether it tends to disperse. A number of recent studies conducted in laboratory flumes or by numerical simulation that gravels slugs tend to disperse rather than translate. However, these studies do not consider the influence of channel morphology on slug behavior. Initial monitoring results based from 2 California streams suggest that natural channel morphology suppresses slug dispersion because the gravel tends to accumulate in discrete deposition zones. Field mapping and about 200 tracer stones implanted with passive integrated transponder (PIT) tags show that gravel recruitment piles of about 80 tons each placed in Grass Valley Creek in 2007 and 2008 were deposited as 2 new bars immediately downstream. The more upstream of the 2 bars formed during the 2007 winter and spring flood season, whereas the more downstream bar did not appear until the following year. A sharp deposition front and an absence of tracers in the reaches downstream strongly suggest that none of the added gravel was transported downstream beyond the area of bar formation in either year. A relatively small proportion of the mobilized tracer particles (59%) were located following the 2007 flood season, probably due to deep burial in the newly deposited bar and to radio interference caused by the high concentration of tracers in a small area. The proportion of newly introduced or previously-located tracers that were relocated in 2009 was
Determination of Major and Minor Elements in the Code River Sediments
International Nuclear Information System (INIS)
Sri Murniasih; Sukirno; Bambang Irianto
2007-01-01
Analyze major and minor elements in the Code river sediments has been done. The aim of this research is to determine the concentration of major and minor elements in the Code river sediments from upstream to downstream. The instrument used were X-ray Fluorescence using Si(Li) detector. The results show that major elements were Fe (1.66 ± 0.1% - 4.20 ± 0.7%) and Ca (4.43 ± 0.6% - 9.08 ± 1.3%); while minor elements were Ba (178.791 ± 21.1 ppm - 616.56 ± 59.4 ppm); Sr (148.22 ± 21.9 ppm - 410.25 ± 30.5 ppm); and Zr (9.71 ± 1.1 ppm - 22.11 ± 3.4 ppm). ANAVA method (confidence level of α 0.05 ) for statistic test was used. It was showed that there were significant influence of the sampling location difference on the concentration of major and minor elements in the sediment samples. (author)
The downstream industry compared to market
International Nuclear Information System (INIS)
Chevallier, B.
2010-01-01
J.L. Schilansky introduces here the difficult question of the downstream industry compared to market in recalling the recent structural changes (behaviour of customers, behaviour of the USA- and China-governments), the increase of the European and French regulations, the climatic change and the conjectural impact of the crisis on the refining industry. (O.M.)
Kasper, Daniele; Forsberg, Bruce R; Amaral, João H F; Leitão, Rafael P; Py-Daniel, Sarah S; Bastos, Wanderley R; Malm, Olaf
2014-01-21
The river downstream from a dam can be more contaminated by mercury than the reservoir itself. However, it is not clear how far the contamination occurs downstream. We investigated the seasonal variation of methylmercury levels in the Balbina reservoir and how they correlated with the levels encountered downstream from the dam. Water, plankton, and fishes were collected upstream and at sites between 0.5 and 250 km downstream from the dam during four expeditions in 2011 and 2012. Variations in thermal stratification of the reservoir influenced the methylmercury levels in the reservoir and in the river downstream. Uniform depth distributions of methylmercury and oxygen encountered in the poorly stratified reservoir during the rainy season collections coincided with uniformly low methylmercury levels along the river downstream from the dam. During dry season collections, the reservoir was strongly stratified, and anoxic hypolimnion water with high methylmercury levels was exported downstream. Methylmercury levels declined gradually to 200 km downstream. In general, the methylmercury levels in plankton and fishes downstream from the dam were higher than those upstream. Higher methylmercury levels observed 200-250 km downstream from the dam during flooding season campaigns may reflect the greater inflow from tributaries and flooding of natural wetlands that occurred at this time.
Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.
2011-01-01
Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310
Enhancer elements upstream of the SHOX gene are active in the developing limb.
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-05-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.
Kramberger, Petra; Urbas, Lidija; Štrancar, Aleš
2015-01-01
Downstream processing of nanoplexes (viruses, virus-like particles, bacteriophages) is characterized by complexity of the starting material, number of purification methods to choose from, regulations that are setting the frame for the final product and analytical methods for upstream and downstream monitoring. This review gives an overview on the nanoplex downstream challenges and chromatography based analytical methods for efficient monitoring of the nanoplex production. PMID:25751122
International Nuclear Information System (INIS)
Centeno, L.M.; Faure, G.; Lee, G.; Talnagi, J.
2004-01-01
Water draining from abandoned open-pit coal mines in southeastern Ohio typically has a low pH and high concentrations of Fe, Al and Mn, as well as of trace metals (Pb, Cu, Zn, Ni, Co, etc.) and of the rare earth elements (REEs). The cations of different elements are sorbed selectively by Fe and Al hydroxide precipitates which form with increasing pH. As a result, the trace elements are separated from each other when the hydroxide precipitates are deposited in the channel of a flowing stream. Therefore, the low-energy environment of a stream contaminated by mine effluent is a favorable site for the chemical fractionation of the REEs and of other groups of elements with similar chemical properties. The interpretation of chemical analyses of water collected along a 30-km-stretch of Rush Creek near the town of New Lexington, Perry County, Ohio, indicates that the abundances of the REEs in the water appear to change downstream when they are normalized to the REE concentrations of the mine effluent. In addition, the Ce/La ratios (and those of all REEs) in the water decrease consistently downstream. The evidence indicates that the REEs which remain in solution are enriched La and Ce because the other REEs are sorbed more efficiently. The solid Fe(OH) 3 precipitates in the channel of Rush Creek upstream of New Lexington also contain radioactive 226 Ra that was sorbed from the water. This isotope of Ra is a decay product of 238 U which occurs in the Middle Pennsylvanian (Upper Carboniferous) coal and in the associated shale of southeastern Ohio. The activity of 226 Ra of the Fe(OH) 3 precipitates increases with rising pH, but then declines farther downstream as the concentration of Ra remaining in the water decreases
International Nuclear Information System (INIS)
Serizawa, Hiroyuki; Kikuchi, Hironobu; Iwai, Takashi; Arai, Yasuo; Kurosawa, Makoto; Mimura, Hideaki; Abe, Jiro
2005-07-01
A high-temperature ultrasonic measuring system had been designed and installed in a glovebox (711-DGB) to study a mechanical property of nuclear fuel containing trans-uranium (TRU) elements. A figuration apparatus for the cylinder-type sample preparation had also been modified and installed in an established glovebox (142-D). The system consists of an ultrasonic probe, a heating furnace, cooling water-circulating system, a cooling air compressor, vacuum system, gas supplying system and control system. An A/D converter board and an pulsar/receiver board for the measurement of wave velocity were installed in a personal computer. The apparatus was modified to install into the glovebox. Some safety functions were supplied to the control system. The shape and size of the sample was revised to minimize the amount of TRU elements for the use of the measurement. The maximum sample temperature is 1500degC. The performance of the installed apparatuses and the glovebox were confirmed through a series of tests. (author)
Gene expression programming for prediction of scour depth downstream of sills
Azamathulla, H. Md.
2012-08-01
SummaryLocal scour is crucial in the degradation of river bed and the stability of grade control structures, stilling basins, aprons, ski-jump bucket spillways, bed sills, weirs, check dams, etc. This short communication presents gene-expression programming (GEP), which is an extension to genetic programming (GP), as an alternative approach to predict scour depth downstream of sills. Published data were compiled from the literature for the scour depth downstream of sills. The proposed GEP approach gives satisfactory results (R2 = 0.967 and RMSE = 0.088) compared to the existing predictors (Chinnarasri and Kositgittiwong, 2008) with R2 = 0.87 and RMSE = 2.452 for relative scour depth.
International Nuclear Information System (INIS)
Breton, S-P; Nilsson, K; Ivanell, S; Olivares-Espinosa, H; Masson, C; Dufresne, L
2014-01-01
The effect of a downstream turbine on the production of a turbine located upstream of the latter is studied in this work. This is done through the use of two CFD simulation codes, namely OpenFOAM and EllipSys3D, which solve the Navier-Stokes equations in their incompressible form using a finite volume approach. In both EllipSys3D and OpenFoam, the LES (Large Eddy Simulation) technique is used for modelling turbulence. The wind turbine rotors are modelled as actuator disks whose loading is determined through the use of tabulated airfoil data by applying the blade-element method. A generator torque controller is used in both simulation methods to ensure that the simulated turbines adapt, in terms of rotational velocity, to the inflow conditions they are submited to. Results from both simulation codes, although they differ slightly, show that the downstream turbine affects the upstream one when the spacing between the turbines is small. This is also suggested to be the case looking at measurements performed at the Lillgrund offshore wind farm, whose turbines are located unusually close to each other. However, for distances used in today's typical wind farms, this effect is shown by our calculations not to be significant
Trace elements in sediment samples of the Aswan High Dam Lake
International Nuclear Information System (INIS)
Sherief, M.K.; Awadallah, R.M.; Grass, F.
1981-01-01
Main and trace elements in Nile sediments of the Aswan High Dam Lake were investigated by means of Instrumental Activation Analysis. It was shown that the composition of the Nile sediments changes in accordance with the large gradients in flow rate and with elution and absorption processes. Particles containing Ca, Ba, Hf, Ti, V, and Na are sedimented preferentially near the headwater of Lake Nubia, whereas some elements are rather uniformly distributed, e.g. Fe, Co, Sm, and Eu, and some, such as Al, Sc, Cs, Th, La, and Ce, show a distinct increase downstream. Some elements do not fit into any of these three groups. (author)
Physicochemical Characteristics of River Water Downstream of a Large Tropical Hydroelectric Dam
Directory of Open Access Journals (Sweden)
Teck-Yee Ling
2016-01-01
Full Text Available Water quality in the downstream river of a hydroelectric dam may be affected by the structural design and operation. To date, little is known about the water quality downstream of the largest dam in Malaysia, the Bakun hydroelectric dam. Therefore, the objective of the study was to determine the water quality downstream of the dam when the spillway was closed and when it was opened. Results of the study indicate that the dam plays a significant role in regulating the water quality downstream of it. When the spillway was closed, pH and oxygen were lower in the river where DO was below 5 mg/L. When the spillway was opened, the water quality improved in terms of oxygen content (>8.0 mg/L, total sulphide (TS, and chemical oxygen demand (COD but deteriorated in terms of five-day biochemical oxygen demand (BOD5, total ammonia nitrogen (TAN, and total phosphorus (TP. Additionally, the intensity of the impacts, particularly BOD5, COD, and TAN, shows a declining trend as distance from the dam increases. This study shows that impacts on the water quality extend to a distance of 32 km from the dam particularly turbidity and DO and opening the spillway changes the water quality significantly.
Dielectric strength test to protection elements for live lines works
Directory of Open Access Journals (Sweden)
Carlos Eduardo Pinto-Salamanca
2017-06-01
Full Text Available This paper presents the design and assembly of a system of tests of sustained voltage to elements and equipment used in live line maneuvers through tests on gloves and dielectric rods, as these are the first points of contact to ensure safe operations. It means an advance for the creation of a laboratory certified in this type of tests at Universidad Pedagógica y Tecnológica de Colombia (UPTC Faculty of Duitama, considering that currently there are not laboratories that provide this service in Boyacá and Casanare. Dielectric strength tests were performed on personal protection elements and equipment under the parameters of ASTM D120, ASTM F496, ISO 60903, ASTM-F711 and IEEE 978, developing an assembly for testing gloves and dielectric rods with voltage levels up to 15 kV. The results validate the proposed system to outlook of circuit design and implementation, where tests were performed to establish dielectric capacities, in operating under open circuit conditions, with resistive load or short circuit. The compliance with the regulations established under the test sequences of safety parameters for the system and the follow-up to the tests was verified through the use of a management system for the generation of concepts of approval or rejection of the tested elements.
Conceptual Design of the LHC Beam Dumping Protection Elements TCDS and TCDQ
Goddard, B; Sans-Merce, M; Weterings, W
2004-01-01
The Beam Dumping System for the Large Hadron Collider, presently under construction at CERN, consists, per ring, of a set of horizontally deflecting extraction kicker magnets, vertically deflecting steel septa, dilution kickers and finally, a couple of hundred metres further downstream, an absorber block. A fixed diluter (TCDS) will protect the septa in the event of a beam dump that is not synchronised with the particle free gap or a spontaneous firing of the extraction kickers which will cause the beam to sweep over the septum. Another, mobile, diluter block (TCDQ) will protect the superconducting quadrupole immediate downstream of the extraction as well as the arc at injection energy and the triplet aperture at top energy from bunches with small impact parameters. This paper describes the conceptual design of the protection elements.
Alfven waves and associated energetic ions downstream from Uranus
International Nuclear Information System (INIS)
Zhang, Ming; Belcher, J.W.; Richardson, J.D.; Smith, C.W.
1991-01-01
The authors report the observation of low-frequency waves in the solar wind downstream from Uranus. These waves are observed by the Voyager spacecraft for more than 2 weeks after the encounter with Uranus and are present during this period whenever the interplanetary magnetic field is oriented such that the field lines intersect the Uranian bow shock. The magnetic field and velocity components transverse to the background field are strongly correlated, consistent with the interpretation that these waves are Alfvenic and/or fast-mode waves. The waves have a spacecraft frame frequency of about 10 -3 Hz, and when first observed near the bow shock have an amplitude comparable to the background field. As the spacecraft moves farther from Uranus, the amplitude decays. The waves appear to propagate along the magnetic field lines outward from Uranus and are right-hand polarized. Theory suggests that these waves are generated in the upstream region by a resonant instability with a proton beam streaming along the magnetic field lines. The solar wind subsequently carries these waves downstream to the spacecraft location. These waves are associated with the presence of energetic (> 28 keV) ions observed by the low-energy charged particle instrument. These ions appear two days after the start of the wave activity and occur thereafter whenever the Alfven waves occur, increasing in intensity away from Uranus. The ions are argued to originate in the Uranian magnetosphere, but pitch-angle scattering in the upstream region is required to bring them downstream to the spacecraft location
International Nuclear Information System (INIS)
Le Pape, Pierre
2012-01-01
The aim of this work is to study the dynamics of trace elements (TE) in the water column of the Orge River. In the upstream part of the watershed, land uses consist mainly in forests and agricultural soils, whereas downstream, the population density reaches up to 8,000 inh. km"-"2, in the suburbs of Paris Mega-city. The sampling sites were chosen to describe a gradation in urbanization influence from up to downstream in this particularly contrasted catchment. Four sampling campaigns were performed at seven selected sites along the Orge River during an hydrological year (2010/2011). The spatio-temporal monitoring of the concentrations in the dissolved phase ( [fr
Re-modulated technology of WDM-PON employing different DQPSK downstream signals
Gao, Chao; Xin, Xiang-jun; Yu, Chong-xiu
2012-11-01
This paper proposes a kind of modulation architecture for wavelength-division-multiplexing passive optical network (WDMPON) employing optical differential quadrature phase shift keying (DQPSK) downstream signals and two different modulation formats of re-modulated upstream signals. At the optical line terminal (OLT), 10 Gbit/s signal is modulated with DQPSK. At the optical network unit (ONU), part of the downstream signal is re-modulated with on-off keying (OOK) or inverse-return-to-zero (IRZ). Simulation results show the impact on the system employing NRZ, RZ and carrier-suppressed return-to-zero (CSRZ). The analyses also reflect that the architecture can restrain chromatic dispersion and channel crosstalk, which makes it the best architecture of access network in the future.
Downstream management practices of transnational companies in institutionally vulnerable countries
DEFF Research Database (Denmark)
Jørgensen, Michael Søgaard; Milanez, Bruno
2017-01-01
Analyses of social and environmental management in transnational product chains focus often upstream on suppliers in socially and institutionally vulnerable countries and these suppliers' hazardous processes. Furthermore focus is on transnational companies' responsibility when they source from...... such suppliers. On the contrary, not much focus has been on transnational companies' downstream export of hazardous products to vulnerable countries and the product use in those countries. The article uses pesticides as case of hazardous products and identifies mechanisms in the downstream social...... and environmental management of a Danish pesticide company in vulnerable countries and especially in Brazil. The identified mechanisms are: the transnational company's on-going interpretation of the regulatory and ethical obligations for development and use of its hazardous products in vulnerable countries, path...
Cetuximab insufficiently inhibits glioma cell growth due to persistent EGFR downstream signaling
DEFF Research Database (Denmark)
Hasselbalch, Benedikte; Lassen, Ulrik; Poulsen, Hans S
2010-01-01
Overexpression and/or amplification of the epidermal growth factor receptor (EGFR) is present in 35-45% of primary glioblastoma multiforme tumors and has been correlated with a poor prognosis. In this study, we investigated the effect of cetuximab and intracellular signaling pathways downstream...... of EGFR, important for cell survival and proliferation. We show insufficient EGFR downregulation and competition with endogenous EGFR ligands upon cetuximab treatment. Dose-response experiments showed inhibition of EGFR phosphorylation without affecting two of the prominent downstream signaling pathways....... Our results indicate that amplification and/or overexpression of EGFR is an unsatisfactory predictor for response to cetuximab....
Flow and mass transfer downstream of an orifice under flow accelerated corrosion conditions
International Nuclear Information System (INIS)
Ahmed, Wael H.; Bello, Mufatiu M.; El Nakla, Meamer; Al Sarkhi, Abdelsalam
2012-01-01
Highlights: ► Mass transfer downstream of orifices was numerically and experimentally investigated. ► The surface wear pattern is measured and used to validate the present numerical results. ► The maximum mass transfer coefficient found to occur at approximately 2–3 pipe diameters downstream of the orifice. ► The FAC wear rates were correlated with the turbulence kinetic energy and wall mass transfer in terms of Sherwood number. ► The current study offered very useful information for FAC engineers for better preparation of nuclear plant inspection scope. - Abstract: Local flow parameters play an important role in characterizing flow accelerated corrosion (FAC) downstream of sudden area change in power plant piping systems. Accurate prediction of the highest FAC wear rate locations enables the mitigation of sudden and catastrophic failures, and the improvement of the plant capacity factor. The objective of the present study is to evaluate the effect of the local flow and mass transfer parameters on flow accelerated corrosion downstream of an orifice. In the present study, orifice to pipe diameter ratios of 0.25, 0.5 and 0.74 were investigated numerically by solving the continuity and momentum equations at Reynolds number of Re = 20,000. Laboratory experiments, using test sections made of hydrocal (CaSO 4 ·½H 2 O) were carried out in order to determine the surface wear pattern and validate the present numerical results. The numerical results were compared to the plants data as well as to the present experiments. The maximum mass transfer coefficient found to occur at approximately 2–3 pipe diameters downstream of the orifice. This location was also found to correspond to the location of elevated turbulent kinetic energy generated within the flow separation vortices downstream of the orifice. The FAC wear rates were correlated with the turbulence kinetic energy and wall mass transfer in terms of Sherwood number. The current study found to offer very
Multispacecraft observations of energetic ions upstream and downstream of the bow shock
International Nuclear Information System (INIS)
Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)
1989-01-01
We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989
40 CFR 80.220 - What are the downstream standards for GPA gasoline?
2010-07-01
... 40 Protection of Environment 16 2010-07-01 2010-07-01 false What are the downstream standards for GPA gasoline? 80.220 Section 80.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... downstream location other than at a retail outlet or wholesale purchaser-consumer facility, and during the...
Estimating Subcatchment Runoff Coefficients using Weather Radar and a Downstream Runoff Sensor
DEFF Research Database (Denmark)
Ahm, Malte; Thorndahl, Søren Liedtke; Rasmussen, Michael R.
2013-01-01
This paper presents a method for estimating runoff coefficients of urban drainage subcatchments based on a combination of high resolution weather radar data and flow measurements from a downstream runoff sensor. By utilising the spatial variability of the precipitation it is possible to estimate...... the runoff coefficients of the separate subcatchments. The method is demonstrated through a case study of an urban drainage catchment (678 ha) located in the city of Aarhus, Denmark. The study has proven that it is possible to use corresponding measurements of the relative rainfall distribution over...... the catchment and downstream runoff measurements to identify the runoff coefficients at subcatchment level....
Estimating subcatchment runoff coefficients using weather radar and a downstream runoff sensor.
Ahm, Malte; Thorndahl, Søren; Rasmussen, Michael R; Bassø, Lene
2013-01-01
This paper presents a method for estimating runoff coefficients of urban drainage subcatchments based on a combination of high resolution weather radar data and flow measurements from a downstream runoff sensor. By utilising the spatial variability of the precipitation it is possible to estimate the runoff coefficients of the separate subcatchments. The method is demonstrated through a case study of an urban drainage catchment (678 ha) located in the city of Aarhus, Denmark. The study has proven that it is possible to use corresponding measurements of the relative rainfall distribution over the catchment and downstream runoff measurements to identify the runoff coefficients at subcatchment level.
Plant GSK3 proteins regulate xylem cell differentiation downstream of TDIF-TDR signalling
Kondo, Yuki; Ito, Tasuku; Nakagami, Hirofumi; Hirakawa, Yuki; Saito, Masato; Tamaki, Takayuki; Shirasu, Ken; Fukuda, Hiroo
2014-03-01
During plant radial growth typically seen in trees, procambial and cambial cells act as meristematic cells in the vascular system to self-proliferate and differentiate into xylem cells. These two processes are regulated by a signalling pathway composed of a peptide ligand and its receptor; tracheary element differentiation inhibitory factor (TDIF) and TDIF RECEPTOR (TDR). Here we show that glycogen synthase kinase 3 proteins (GSK3s) are crucial downstream components of the TDIF signalling pathway suppressing xylem differentiation from procambial cells. TDR interacts with GSK3s at the plasma membrane and activates GSK3s in a TDIF-dependent fashion. Consistently, a specific inhibitor of plant GSK3s strongly induces xylem cell differentiation through BRI1-EMS SUPPRESSOR 1 (BES1), a well-known target transcription factor of GSK3s. Our findings provide insight into the regulation of cell fate determination in meristem maintenance.
40 CFR 80.210 - What sulfur standards apply to gasoline downstream from refineries and importers?
2010-07-01
... combined with non-S-RGAS for the sole purpose of producing midgrade gasoline. (6) Where S-RGAS is being... of the gasoline. (f) Downstream standards applicable to S-RGAS when produced or imported. (1) The downstream standard applicable to any gasoline classified as S-RGAS when produced or imported shall be...
Real Life Active Gaming Practices of 7-11-Year-Old Children.
Allsop, Susan; Rumbold, Penny Louise Sheena; Debuse, Dorothée; Dodd-Reynolds, Caroline
2013-12-01
In the laboratory, active gaming has been shown to increase physical activity levels in children compared with seated media activities. The information is sparse, however, about children's real life active gaming practices, and the laboratory protocols used thus far might not be representative. The purpose of the present study was to establish the sociodemographic characteristics, real life active gaming practices, and reasons for gameplay, to later inform intervention studies. An "Active Gaming Questionnaire" was purposely developed and distributed to 44 7-11-year-old children and their parents. Forty questionnaires were completed and returned. Analysis found 95 percent of the children had access to active gaming consoles "at home." The favorite console was the Nintendo (Kyoto, Japan) Wii™, and the favorite game was Nintendo "Wii Sports." The majority of children frequently played active games against other people. The average reported gameplay time was 81 minutes on 1-2 days per week, usually on a Saturday. More than half of the children (52.5 percent) consumed foods and/or drinks during play, which was significantly associated (P=0.000) with an extended average gameplay time (increased by 25 minutes). The majority of participants (65 percent) considered active gaming to be an alternative form of exercise, and main reasons for active videogame play included for entertainment, health benefits, and the environment. In conclusion, children 9.3±1.4 years old typically play Nintendo "Wii Sports," once or twice per week for 81 minutes. Reported active gameplay time is extended by 25 minutes when food and/or drinks are consumed.
Kacenelenbogen, Nadine; Dramaix-Wilmet, Michèle; Schetgen, M; Roland, M
2014-07-22
Analyse the parental behaviours that are recognised as influencing the health of very young children based on family structure (parents separated or not). Cross-sectional study. Free preventive medicine consultations in the French Community of Belgium. Examination of 79 701 infants aged 7-11 months as part of a free preventive medicine consultation. The data came from an assessment conducted 7-11 months after birth during which information was collected, namely about the parents' use of tobacco, the infant's type of nutrition and adherence to vaccination schedules. Parental behaviours: smoking, nutrition and compliance with vaccination schedule. The percentage of infants whose parents were separated was 6.6%. After adjusting for the cultural and socioeconomic environment as well as for other potential confounders, in the event of separation as compared with non-separated parents, the adjusted ORs (95% CI) were as follows: 1.5 (1.3 to 1.7) for the infant's exposure to tobacco; 1.3 (1.2 to 1.4) for total lack of exclusive breast feeding; 1.3 (1.1 to 1.4) and 1.2 (1.1 to 1.2) for breast feeding for a duration of less than 3 and 6 months, respectively; 1.2 (1.1 to 1.4) for non-compliance with the vaccination schedule against rotavirus. The duration of exclusive breast feeding was shorter when parents were separated (pparental separation is independently associated with certain parental at-risk behaviours regarding the children's health. This observation should be verified because this could result in major consequences for the work of family doctors, in particular in terms of parent information and targeted prevention. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Directory of Open Access Journals (Sweden)
Javier A. Dottori
2015-01-01
Full Text Available A method for modeling outflow boundary conditions in the lattice Boltzmann method (LBM based on the maximization of the local entropy is presented. The maximization procedure is constrained by macroscopic values and downstream components. The method is applied to fully developed boundary conditions of the Navier-Stokes equations in rectangular channels. Comparisons are made with other alternative methods. In addition, the new downstream-conditioned entropy is studied and it was found that there is a correlation with the velocity gradient during the flow development.
C, N, P export regimes from headwater catchments to downstream reaches
Dupas, R.; Musolff, A.; Jawitz, J. W.; Rao, P. S.; Jaeger, C. G.; Fleckenstein, J. H.; Rode, M.; Borchardt, D.
2017-12-01
Excessive amounts of nutrients and dissolved organic matter in freshwater bodies affect aquatic ecosystems. In this study, the spatial and temporal variability in nitrate (NO3), dissolved organic carbon (DOC) and soluble reactive phosphorus (SRP) was analyzed in the Selke river continuum from headwaters draining 1 - 3 km² catchments to downstream reaches representing spatially integrated signals from 184 - 456 km² catchments (part of TERENO - Terrestrial Environmental Observatories, in Germany). Three headwater catchments were selected as archetypes of the main landscape units (land use x lithology) present in the Selke catchment. Export regimes in headwater catchments were interpreted in terms of NO3, DOC and SRP land-to-stream transfer processes. Headwater signals were subtracted from downstream signals, with the differences interpreted in terms of in-stream processes and contribution of point-source emissions. The seasonal dynamics for NO3 were opposite those of DOC and SRP in all three headwater catchments, and spatial differences also showed NO3 contrasting with DOC and SRP. These dynamics were interpreted as the result of the interplay of hydrological and biogeochemical processes, for which riparian zones were hypothesized to play a determining role. In the two downstream reaches, NO3 was transported almost conservatively, whereas DOC was consumed and produced in the upper and lower river sections, respectively. The natural export regime of SRP in the three headwater catchments mimicked a point-source signal, which may lead to overestimation of domestic contributions in the downstream reaches. Monitoring the river continuum from headwaters to downstream reaches proved effective to investigate jointly land-to-stream and in-stream transport and transformation processes.
The probability that a pair of group elements is autoconjugate
Indian Academy of Sciences (India)
[1] Alghamdi A M and Russo F G, A generalization of the probability that the commutator of two group elements is equal to a given element, Bull. Iranian Math. Soc. 38 (2012). 973–986. [2] Blackburn S R, Britnell J R and Wildon M, The probability that a pair of elements of a finite group are conjugate, J. London Math. Soc.
India's Downstream Petroleum Sector
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-07-01
This study provides a holistic examination of pricing and investment dynamics in India's downstream petroleum sector. It analyses the current pricing practices, highlights the tremendous fiscal cost of current pricing and regulatory arrangements, and examines the sectoral investment dynamics. It also looks at potential paths towards market-based reform along which the Indian government may move, while at the same time protecting energy market access for India's large poor population.
Directory of Open Access Journals (Sweden)
Razvan VOICU
2015-06-01
Full Text Available Longitudinal connectivity represent the way in which organisms move the energy and material exchanges located throughout the water. Fragmentation the longitudinal connectivity of watercourses caused by dams or other hydrotechnical constructions represent a major impact on sediment transport, hydrological regime, downstream moving and biota migration. The hydromorphological elements (river continuity, as well as chemical, biological, physicochemical elements characterize the ecological status of rivers.Migratory fish species: nase (Chondrostoma nasus - protected by Bern Convention - Appendix III and barbel (Barbus barbus - rare species, protected Habitats Directive (Annex V, annex 4A of Low nr.462 and Red List of RBDD are blocked but the Hydrotechnical constructions (discharge sills, dams etc located across the watercourse Somes Mic River. One of the important think of this system is the gravitational fall of water. This solution will lead to the restoration of the longitudinal connection of the Someşul Mic River in the Manastur neighborhood. România is part of the European Union and it has the obligation to implement the provisions of the Water Framework Directive 2000/60/EC, transposed into Romanian legislation by the Water Law 107/1996 as supplemented and amended (Act 310/2004. This engineering solution for fish fauna migration upstream – downstream of the spillways supports the Water Framework Directive 2000/60/EC, transposed into Romanian legislation by the Water Law 107/1996 as supplemented and amended (Act 310/2004.
International Nuclear Information System (INIS)
Barber, R.W.; Fonty, A.
2003-01-01
This paper describes a novel vortex element method for simulating incompressible laminar flow over a two-dimensional backward-facing step. The model employs an operator-splitting technique to compute the evolution of the vorticity field downstream of abrupt changes in flow geometry. During the advective stage of the computation, a semi-Lagrangian scheme is used to update the positions of the vortex elements, whilst an analytical diffusion algorithm employing Oseen vortices is implemented during the diffusive time step. Redistributing the vorticity analytically instead of using the more traditional random-walk method enables the numerical model to simulate steady flows directly and avoids the need to filter the results to remove the oscillations created by the random-walk procedure. Model validation has been achieved by comparing the length of the recirculating eddy behind a confined backward-facing step against data from experimental and alternative numerical investigations. In addition, results from the vortex element method are compared against predictions obtained using the commercial finite-volume computational fluid dynamics code, CFD-ACE+. The results show that the vortex element scheme marginally overpredicts the length of the downstream recirculating eddy, implying that the method may be associated with an artificial reduction in the vorticity diffusion rate. Nevertheless the results demonstrate that the proposed vortex redistribution scheme provides a practical alternative to traditional random-walk discrete vortex algorithms. (author)
New element for optimizing the functioning of sediment traps
Schwindt, Sebastian; Franca, Mário; Schleiss, Anton
2017-04-01
Sediment traps protect urban areas against excessive sediment transport during hazardous floods and consist typically of a retention basin with an open sediment check dam at the downstream end. The design, as well as the morphological processes within the retention basin, were analyzed by several authors. With regard to open sediment check dams two types of triggering mechanisms for the initiation of sediment retention can be distinguished: (1) mechanical and (2) hydraulic clogging of the structure. Recent studies have shown that outlet structures combining both clogging principles may be considered to avoid undesired self-flushing. Further elements of check dams are conceivable, e.g. for retaining or conveying driftwood. This study analyses experimentally working principles and design criteria of standard elements of sediment traps. Furthermore, it introduces a new structural element to the sediment trap design with a guiding channel in the retention reservoir. Taking into account the natural shape of mountain rivers, the guiding channel has a trapezoidal cross-section shape and a rough but fixed bed. The effect of the guiding channel on sediment deposition pattern and re-mobilization are studied by means of physical model experiments with a standardized hydrograph and variable sediment supply. The results are evaluated by means of zenithal pictures and bedload transport rate, measured at the downstream end of the model. Major advantages of the combined use of both clogging principles include an improved control of the initiation of sediment deposition in order to allow for sediment transfer for small floods and a reduction of hazards related to self-flushing.
Circadian rhythms in healthy aging--effects downstream from the pacemaker
Monk, T. H.; Kupfer, D. J.
2000-01-01
Using both previously published findings and entirely new data, we present evidence in support of the argument that the circadian dysfunction of advancing age in the healthy human is primarily one of failing to transduce the circadian signal from the circadian timing system (CTS) to rhythms "downstream" from the pacemaker rather than one of failing to generate the circadian signal itself. Two downstream rhythms are considered: subjective alertness and objective performance. For subjective alertness, we show that in both normal nychthemeral (24 h routine, sleeping at night) and unmasking (36 h of constant wakeful bed rest) conditions, advancing age, especially in men, leads to flattening of subjective alertness rhythms, even when circadian temperature rhythms are relatively robust. For objective performance, an unmasking experiment involving manual dexterity, visual search, and visual vigilance tasks was used to demonstrate that the relationship between temperature and performance is strong in the young, but not in older subjects (and especially not in older men).
Heavy metals and mineral elements not included on the nutritional labels in table olives.
López-López, Antonio; López, Rafael; Madrid, Fernando; Garrido-Fernández, Antonio
2008-10-22
The average contents, in mg/kg edible portion (e.p.), of elements not considered for nutritional labeling in Spanish table olives were as follows: aluminum, 71.1; boron, 4.41; barium, 2.77; cadmium, 0.04; cobalt, 0.12; chromium, 0.19; lithium, 6.56; nickel, 0.15; lead, 0.15; sulfur, 321; tin, 18.4; strontium, 9.71; and zirconium, 0.04. Sulfur was the most abundant element in table olives, followed by aluminum and tin (related to green olives). There were significant differences between elaboration styles, except for aluminum, tin, and sulfur. Ripe olives had significantly higher concentrations (mg/kg e.p.) of boron (5.32), barium (3.91), cadmium (0.065), cobalt (0.190), chromium (0.256), lithium (10.01), nickel (0.220), and strontium (10.21), but the levels of tin (25.55) and zirconium (0.039) were higher in green olives. The content of contaminants (cadmium, nickel, and tin) was always below the maximum limits legally established. The discriminant analysis led to an overall 86% correct classification of cases (80% after cross-validation).
Takahashi, Hiroki; Hotta, Kohji; Takagi, Chiyo; Ueno, Naoto; Satoh, Nori; Shoguchi, Eiichi
2010-02-01
Brachyury, a T-box transcription factor, is expressed in ascidian embryos exclusively in primordial notochord cells and plays a pivotal role in differentiation of notochord cells. Previously, we identified approximately 450 genes downstream of Ciona intestinalis Brachyury (Ci-Bra), and characterized the expression profiles of 45 of these in differentiating notochord cells. In this study, we looked for cisregulatory sequences in minimal enhancers of 20 Ci-Bra downstream genes by electroporating region within approximately 3 kb upstream of each gene fused with lacZ. Eight of the 20 reporters were expressed in notochord cells. The minimal enchancer for each of these eight genes was narrowed to a region approximately 0.5-1.0-kb long. We also explored the genome-wide and coordinate regulation of 43 Ci-Bra-downstream genes. When we determined their chromosomal localization, it became evident that they are not clustered in a given region of the genome, but rather distributed evenly over 13 of the 14 pairs of chromosomes, suggesting that gene clustering does not contribute to coordinate control of the Ci-Bra downstream gene expression. Our results might provide Insights Into the molecular mechanisms underlying notochord formation in chordates.
Viparelli, E.; Solari, L.; Hill, K. M.
2014-12-01
Downstream fining, i.e. the tendency for a gradual decrease in grain size in the downstream direction, has been observed and studied in alluvial rivers and in laboratory flumes. Laboratory experiments and field observations show that the vertical sorting pattern over a small Gilbert delta front is characterized by an upward fining profile, with preferential deposition of coarse particles in the lowermost part of the deposit. The present work is an attempt to answer the following questions. Are there analogous sorting patterns in mixtures of sediment particles having the same grain size but differing density? To investigate this, we performed experiments at the Hydrosystems Laboratory at the University of Illinois at Urbana-Champaign. During the experiments a Gilbert delta formed and migrated downstream allowing for the study of transport and sorting processes on the surface and within the deposit. The experimental results show 1) preferential deposition of heavy particles in the upstream part of the deposit associated with a pattern of "downstream lightening"; and 2) a vertical sorting pattern over the delta front characterized by a pattern of "upward heavying" with preferential deposition of light particles in the lowermost part of the deposit. The observed downstream lightening is analogous of the downstream fining with preferential deposition of heavy (coarse) particles in the upstream part of the deposit. The observed upward heavying was unexpected because, considering the particle mass alone, the heavy (coarse) particles should have been preferentially deposited in the lowermost part of the deposit. Further, the application of classical fractional bedload transport relations suggests that in the case of mixtures of particles of uniform size and different densities equal mobility is not approached. We hypothesize that granular physics mechanisms traditionally associated with sheared granular flows may be responsible for the observed upward heavying and for the
Kröger, R; Dunne, E J; Novak, J; King, K W; McLellan, E; Smith, D R; Strock, J; Boomer, K; Tomer, M; Noe, G B
2013-01-01
This review provides a critical overview of conservation practices that are aimed at improving water quality by retaining phosphorus (P) downstream of runoff genesis. The review is structured around specific downstream practices that are prevalent in various parts of the United States. Specific practices that we discuss include the use of controlled drainage, chemical treatment of waters and soils, receiving ditch management, and wetlands. The review also focuses on the specific hydrology and biogeochemistry associated with each of those practices. The practices are structured sequentially along flowpaths as you move through the landscape, from the edge-of-field, to adjacent aquatic systems, and ultimately to downstream P retention. Often practices are region specific based on geology, cropping practices, and specific P related problems and thus require a right practice, and right place mentality to management. Each practice has fundamental P transport and retention processes by systems that can be optimized by management with the goal of reducing downstream P loading after P has left agricultural fields. The management of P requires a system-wide assessment of the stability of P in different biogeochemical forms (particulate vs. dissolved, organic vs. inorganic), in different storage pools (soil, sediment, streams etc.), and under varying biogeochemical and hydrological conditions that act to convert P from one form to another and promote its retention in or transport out of different landscape components. There is significant potential of hierarchically placing practices in the agricultural landscape and enhancing the associated P mitigation. But an understanding is needed of short- and long-term P retention mechanisms within a certain practice and incorporating maintenance schedules if necessary to improve P retention times and minimize exceeding retention capacity. Copyright © 2012 Elsevier B.V. All rights reserved.
Introduction to sump screen downstream effect analysis of AP1000 nuclear power plant
International Nuclear Information System (INIS)
Zhang Qinghua; Liu Yu; Chai Guohan
2010-01-01
The design of AP1000 takes into account the potential impact of debris clogging on sump screen. In this article, the technical background of sump screen issue and the design characteristics of AP1000 to address the sump screen blockage issue are introduced. The article focuses on the 'downstream effect' analysis method, acceptance criteria and analysis result of AP1000 sump screen. Although the design of AP1000 is different with traditional PWR, the author expects to bring some reference to advance the downstream effect analysis in China through the introduction. (authors)
A theoretical study of mixing downstream of transverse injection into a supersonic boundary layer
Baker, A. J.; Zelazny, S. W.
1972-01-01
A theoretical and analytical study was made of mixing downstream of transverse hydrogen injection, from single and multiple orifices, into a Mach 4 air boundary layer over a flat plate. Numerical solutions to the governing three-dimensional, elliptic boundary layer equations were obtained using a general purpose computer program. Founded upon a finite element solution algorithm. A prototype three-dimensional turbulent transport model was developed using mixing length theory in the wall region and the mass defect concept in the outer region. Excellent agreement between the computed flow field and experimental data for a jet/freestream dynamic pressure ratio of unity was obtained in the centerplane region of the single-jet configuration. Poorer agreement off centerplane suggests an inadequacy of the extrapolated two-dimensional turbulence model. Considerable improvement in off-centerplane computational agreement occured for a multi-jet configuration, using the same turbulent transport model.
Czech Academy of Sciences Publication Activity Database
Hatina, J.; Jansa, Petr; Forejt, Jiří
2001-01-01
Roč. 37, 12-13 (2001), s. 799-800 ISSN 0161-5890 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC I gene regulatory elements Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.973, year: 2001
Climate change issue table : petroleum downstream sector industry foundation paper
International Nuclear Information System (INIS)
Crandall, G.R.; Kelly, S.J.; Kromm, R.B.; Prime, M.G.
1999-01-01
An analysis of the impact of the Kyoto Protocol on the Canadian downstream petroleum industry is presented. The downstream sector includes petroleum refining, plus all activities regarding distribution, marketing and retailing of petroleum products. In 1990, the carbon dioxide (CO 2 ) emissions resulting from the production and consumption of petroleum products were about 207 megatons which is about 45 per cent of total Canadian CO 2 emissions. This report includes the analysis of the Base Case and the Kyoto Case. The Base Case is premised on the implementation of fuel sulphur reductions to meet cleaner fuels requirements and an enhanced program of refinery efficiency initiatives. Under the Base Case assumptions the CO 2 emissions from refinery operations in 2010 would be about 3.4 below 1990 levels. The Kyoto Case was developed on the basis of reductions in Canadian petroleum product demand that would be sufficient to achieve a 6 per cent reduction in GHG emissions from the production and consumption of petroleum products relative to 1990 levels. The model demonstrates the dramatic economic impact of the Kyoto Case reductions on the Canadian downstream petroleum sector. Investment requirements for capital improvements to further distillate production and to further desulphurization are estimated at $ 1.5 billion between 2005 and 2015. The reduced volume of gasoline sales would be expected to result in rationalization of retail outlets, resulting in the closure of some 2,000 retail outlets with a combined loss of about 12,000 jobs. It is suggested that similar impact in other countries that are signatory to the Kyoto Protocol could result in the shift of refining, refining industry jobs and related economic benefits to countries which are not participants in the Kyoto Protocol. 14 tabs., 6 figs., 5 appendices
International Retailing Operations: Downstream Entry and Expansion via Franchising
Petersen, Bent; Welch, Lawrence S.
1999-01-01
In this article, the shift into international franchising from other forms of operation, rather than the typical home market franchising base is explored. The focus is international retail franchising, based on a study of the Danish clothing and footwear industry. In this study it was found that Danish companies were moving into international franchising as an outcome of a more general shift from upstream wholesaling and subcontracting activities to downstream involvement in retailing activit...
'Patents and Downstream Innovation Suppression - Fact or Fiction?'
DEFF Research Database (Denmark)
Howells, John
Merges and Nelson have provided an empirically grounded argument that firms use pioneer patents of 'broad' scope to block downstream technological development (Merges and Nelson 1990). If this is a regular occurrence then, as they claim, they have faulted Kitch's 'prospect theory' of patents (Kitch...... 1977), a theory that is a version of the classic justification for the award of the exclusive right - that it should protect the incentive to develop property. Merges and Nelson insist that their thesis should be supported by empirical evidence and they turn to historical accounts as an important form...
Analysis of the policy effects of downstream Feed-In Tariff on China’s solar photovoltaic industry
International Nuclear Information System (INIS)
Wang, Hongwei; Zheng, Shilin; Zhang, Yanhua; Zhang, Kai
2016-01-01
The Chinese government initiated the Feed-In Tariff (“FIT”) policy for downstream power generation in August 2013. The effectiveness of the downstream FIT policy has attracted the attention of academia and government. Using the quarterly data of listed solar PV companies between 2009 and 2015, this paper provides an empirical analysis regarding the effects of the downstream FIT policy. We find that (1) the FIT policy has significantly enhanced the inventory turnover of listed PV firms and improved their profitability; (2) the FIT policy has significant effects on the inventory turnover of midstream companies and mixed industry-chain companies mainly engaged in downstream operations; (3) FIT policy is more favorable towards increasing the inventory turnover of private enterprises. Our results indicate that the FIT policy can have substantial effects on the sustainable development of China's solar photovoltaic industry. - Highlights: •The article focuses on the analysis of the effect of downstream FIT policy. •We test how FIT policy affects overcapacity and profitability of solar PV companies. •We find FIT policy significantly solved the overcapacity of China’s solar PV industry. •We find FIT policy improved profitability of listed solar PV companies. •FIT policy can’t be played alone and should be combined with taxation and R&D policy.
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or
Expression of the central growth regulator BIG BROTHER is regulated by multiple cis-elements
Directory of Open Access Journals (Sweden)
Breuninger Holger
2012-03-01
Full Text Available Abstract Background Much of the organismal variation we observe in nature is due to differences in organ size. The observation that even closely related species can show large, stably inherited differences in organ size indicates a strong genetic component to the control of organ size. Despite recent progress in identifying factors controlling organ growth in plants, our overall understanding of this process remains limited, partly because the individual factors have not yet been connected into larger regulatory pathways or networks. To begin addressing this aim, we have studied the upstream regulation of expression of BIG BROTHER (BB, a central growth-control gene in Arabidopsis thaliana that prevents overgrowth of organs. Final organ size and BB expression levels are tightly correlated, implying the need for precise control of its expression. BB expression mirrors proliferative activity, yet the gene functions to limit proliferation, suggesting that it acts in an incoherent feedforward loop downstream of growth activators to prevent over-proliferation. Results To investigate the upstream regulation of BB we combined a promoter deletion analysis with a phylogenetic footprinting approach. We were able to narrow down important, highly conserved, cis-regulatory elements within the BB promoter. Promoter sequences of other Brassicaceae species were able to partially complement the A. thaliana bb-1 mutant, suggesting that at least within the Brassicaceae family the regulatory pathways are conserved. Conclusions This work underlines the complexity involved in precise quantitative control of gene expression and lays the foundation for identifying important upstream regulators that determine BB expression levels and thus final organ size.
The jet membrane-experiment: downstream sampling
International Nuclear Information System (INIS)
Campargue, R.
1976-01-01
The invasion separation effect of the free jet structure was found in 1966 at Saclay. In the Downstream Sampling Configuration patended by Campargue (1967), the light fraction is withdrawn from the supersonic central core, by skimming the separating free jet. From experimental and theoretical results obtained for gas and isotopic mixtures, the following points linked to operation and equipment costs, are considered: system description; influence of mass ratio, expansion ratio, nature of separating gas, ratio of upflow to separating jet flow, rarefaction. Fron an uninteresting aspect of Jet Membrane (elimination of background penetration), a new principle has been discovered to produce nozzle beams which may be of great interest for other separation processes involving free jets and/or molecular beams [fr
Favorable fragmentation: river reservoirs can impede downstream expansion of riparian weeds.
Rood, Stewart B; Braatne, Jeffrey H; Goater, Lori A
2010-09-01
River valleys represent biologically rich corridors characterized by natural disturbances that create moist and barren sites suitable for colonization by native riparian plants, and also by weeds. Dams and reservoirs interrupt the longitudinal corridors and we hypothesized that this could restrict downstream weed expansion. To consider this "reservoir impediment" hypothesis we assessed the occurrences and abundances of weeds along a 315-km river valley corridor that commenced with an unimpounded reach of the Snake River and extended through Brownlee, Oxbow, and Hells Canyon reservoirs and dams, and downstream along the Snake River. Sampling along 206 belt transects with 3610 quadrats revealed 16 noxious and four invasive weed species. Ten weeds were upland plants, with Canada thistle (Cirsium arvense) restricted to the upstream reaches, where field morning glory (Convolvulus arvensis) was also more common. In contrast, St. John's wort (Hypericum perforatum) was more abundant below the dams, and medusahead wildrye (Taeniatherum caput-medusae) occurred primarily along the reservoirs. All seven riparian species were abundant in the upstream zones but sparse or absent below the dams. This pattern was observed for the facultative riparian species, poison hemlock (Conium maculatum) and perennial pepperweed (Lepidium latifolium), the obligate riparian, yellow nut sedge (Cyperus esculentus), the invasive perennial, reed canary grass (Phalaris arundinacea), and three invasive riparian trees, Russian olive (Elaeagnus angustifolia), false indigo (Amorpha fruticosa), and tamarisk (Tamarix spp.). The hydrophyte purple loosestrife (Lythrum salicaria) was also restricted to the upstream zone. These longitudinal patterns indicate that the reservoirs have impeded the downstream expansion of riparian weeds, and this may especially result from the repetitive draw-down and refilling of Brownlee Reservoir that imposes a lethal combination of drought and flood stress. The dams and
Directory of Open Access Journals (Sweden)
Sabine Schramm
2011-05-01
Full Text Available The synaptonemal complex (SC is a proteinaceous, meiosis-specific structure that is highly conserved in evolution. During meiosis, the SC mediates synapsis of homologous chromosomes. It is essential for proper recombination and segregation of homologous chromosomes, and therefore for genome haploidization. Mutations in human SC genes can cause infertility. In order to gain a better understanding of the process of SC assembly in a model system that would be relevant for humans, we are investigating meiosis in mice. Here, we report on a newly identified component of the murine SC, which we named SYCE3. SYCE3 is strongly conserved among mammals and localizes to the central element (CE of the SC. By generating a Syce3 knockout mouse, we found that SYCE3 is required for fertility in both sexes. Loss of SYCE3 blocks synapsis initiation and results in meiotic arrest. In the absence of SYCE3, initiation of meiotic recombination appears to be normal, but its progression is severely impaired resulting in complete absence of MLH1 foci, which are presumed markers of crossovers in wild-type meiocytes. In the process of SC assembly, SYCE3 is required downstream of transverse filament protein SYCP1, but upstream of the other previously described CE-specific proteins. We conclude that SYCE3 enables chromosome loading of the other CE-specific proteins, which in turn would promote synapsis between homologous chromosomes.
International Nuclear Information System (INIS)
Noshkin, V.E.; Wong, K.M.; Eagle, R.J.; Brunk, J.L.; Jokela, T.A.
1986-01-01
Information compiled in 1985 while assessing the environmental impact of radionuclides previously discharged with aqueous releases from the Rancho Seco Nuclear Power Generating Plant is presented. In October 1984, the quantities of gamma-emitting radionuclides in water discharged to Clay Creek from the plant were reduced below operationally defined detection limits for liquid effluents. However, radionuclides previously discharged persist in the downstream environment and are found in many aquatic dietary components. 134 Cs and 137 Cs are the primary gamma-emitting radionuclides detected in the edible flesh of different fish, crayfish, and frogs. Coefficients for exponential equations are generated, from a least square analysis, that relate the change in concentration of 137 Cs in fish to distance downstream and time between March and October 1985. Concentrations of 137 Cs in surface creek sediments also decreased in the downstream direction much in the same manner as concentrations decreased in fish. However, there was no significant difference in the radiocesium concentrations in surface sediements collected from comparable locations during both 1984 and 1985
Identification of hookworm DAF-16/FOXO response elements and direct gene targets.
Directory of Open Access Journals (Sweden)
Xin Gao
2010-08-01
Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.
DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis
Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio
2016-01-01
High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753
Directory of Open Access Journals (Sweden)
Chapika Sangkapitux
2009-04-01
Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy
Li, Sixin; Zhou, Lianfeng; Chang, Jianbo; Yang, Zhi; Hu, Juxiang; Hongjun, Wang
2017-11-01
Mercury concentrations in fish were investigated downstream from a newly impounded subtropical reservoir in August 2008. After 6-7 months of reservoir impoundment, mean mercury concentration in fish from downstream is significantly increased by 1.9 times. Not only carnivorous fish but also benthic fish had significantly higher total mercury concentrations than others. No significant correlation was found between total mercury concentrations and body length or weight of 13 fish species. Compared with the pre-impoundment, total mercury in fish from downstream is significantly increased by reservoir impoundment, but the increased rate is lower than those in subarctic and temperate areas. Fish samples surpassed the Chinese hygienic standard for tolerances of mercury in foods increased by 4.3%. More attention should be given to fish mercury levels from downstream sites to prevent possible adverse effects on the health of local people.
DEFF Research Database (Denmark)
Comet, Itys; Schuettengruber, Bernd; Sexton, Tom
2011-01-01
to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....
Skalak, K. J.; Pizzuto, J. E.; Jenkins, P.
2003-12-01
The potential downstream effects of dam removal were assessed on fifteen sites of varying dam size and characteristics in Pennsylvania and Maryland. The dams ranged in size from a 30 cm high fish weir to a water supply dam 57 m high. Stream order ranged from 1 to 4. The dams are located in watersheds with varying degrees of human disturbance and urbanization. The dams are also operated differently, with significant consequences for hydraulic residence time and downstream flow variability. Most streams were alluvial, but 6 of the reaches were clearly bedrock channels. We hypothesize that the channel upstream, which is unaffected by the dam, will provide an accurate model for the channel downstream of the dam long after dam removal. Therefore, reaches upstream and downstream of the dam were compared to determine the effects of the dam as well as the condition of the stream that will ultimately develop decades after dam removal. Surprisingly, the dams had no consistent influence on channel morphology. However, the percentage of sand is significantly lower downstream than upstream: the mean % sand downstream is 11.47%, while the mean % sand upstream is 21.39%. The coarser fractions of the bed, as represented by the 84th percentile grain diameter, are unaffected by the presence of the dam. These results imply that decades after dam removal, the percentage of sand on the bed will increase, but the coarse fraction of the bed will remain relatively unchanged.
Nanson, G. C.; Young, R. W.
1981-07-01
Although most streams show a downstream increase in channel size corresponding to a downstream increase in flood discharges, those flowing off the Illawarra escarpment of New South Wales show a marked reduction of channel size, accompanied by a down-stream increase in flood frequency in their lower reaches. Within the confined and steeply sloping valleys of the escarpment foothills, bed and bank sediments are relatively coarse and uncohesive, and channels increase in size, corresponding to increasing discharge downstream. However, once these streams emerge into more open rural valleys at lower slopes and are accompanied by extensive floodplains formed of fine cohesive sediment, there is a dramatic reduction in channel size. This decrease in channel size apparently results from a sudden decline in channel slope and associated stream power, the cohesive nature of downstream alluvium, its retention on the channel banks by a dense cover of pasture grasses, and the availability of an extensive floodplain to carry displaced floodwater. Under these conditions floodwaters very frequently spill out over the floodplain and the downstream channel-flow becomes a relatively unimportant component of the total peak discharge. This emphasizes the importance of these floodplains as a part of the total channel system. In situations where urban development has increased peak runoff and reduced the available area of effective floodplain, stream channels formed in this fine alluvium rapidly entrench and increase in cross-sectional area by 2-3 times. Minor man-induced channel alteration and maintenance appears to trigger this enlargement.
Pandey, Gaurav; Goel, Aditya
2017-12-01
In this paper, orthogonal frequency division multiplexing (OFDM)-passive optical network (PON) downstream transmission is demonstrated over different lengths of fiber at remote node (RN) for different m-QAM (quadrature amplitude modulation)-mapped OFDM signal (m=4, 16, 32 and 64) transmission from the central office (CO) for different data rates (10, 20 30 and 40 Gbps) using coherent detection at the user end or optical network unit (ONU). Investigation is performed with different number of subcarriers (32, 64, 128, 512 and 1,024), back-to-back optical signal-to-noise ratio (OSNR) along with transmitted and received constellation diagrams for m-QAM-mapped coherent OFDM downstream transmission at different speeds over different transmission distances. Received optical power is calculated for different bit error rates (BERs) at different speeds using m-QAM-mapped coherent detection OFDM downstream transmission. No dispersion compensation is utilized in between the fiber span. Simulation results suggest the different lengths and data rates that can be used for different m-QAM-mapped coherent detection OFDM downstream transmission, and the proposed system may be implemented in next-generation high-speed PONs (NG-PONs).
The probability that a pair of group elements is autoconjugate
Indian Academy of Sciences (India)
Let and ℎ be arbitrary elements of a given finite group . Then and ℎ are said to be autoconjugate if there exists some automorphism of such that ℎ = . In this article, we construct some sharp bounds for the probability that two random elements of are autoconjugate, denoted by P a ( G ) . It is also shown that P ...
International Nuclear Information System (INIS)
Noshkin, V.E.; Eagle, R.J.; Dawson, J.M.; Brunk, J.L.; Wong, X.M.
1984-01-01
Fish were collected for radionuclide analysis over a 5-month period in 1984 from creeks downstream of the Rancho Seco Nuclear Generating Plant, which has been discharging quantities of some fission and activation products to the waterway since 1981. Among the fish, the bluegill was selected for intensive study because it is very territorial and the radionuclide concentrations detected should be representative of the levels in the local environment at the downstream locations sampled. Among the gamma-emitting radionuclides routinely released, only 134 Cs and 137 Cs were detected in the edible flesh of fish. Concentrations in the flesh of fish decreased with distance from the plant. The relationship between concentration and distance was determined to be exponential. Exponential equations were generated to estimate concentrations in fish at downstream locations where no site-specific information was available. Mean concentrations of 137 Cs in bluegill collected during April, May, July and August from specific downstream stations were not significantly different in spite of the release of 131 mCi to the creeks between April and August. The concentrations in fish are not responding to changes in water concentrations brought about by plant discharges. Diet appears to be a more significant factor than size or weight or water concentration in regulating body burdens of 137 Cs in these fish
United Nations Educational, Scientific, and Cultural Organization, Paris (France).
This document contains materials from a Unesco European regional meeting held in Venice (November 7-11, 1977) to discuss the problem of youth unemployment. The final report of the meeting is composed of (1) a summary of the discussions on background and nature of the problem, remedies, action, education and training, creating jobs, quality of…
Kappa-Electrons Downstream of the Solar Wind Termination Shock
Fahr, H. J.
2017-12-01
A theoretical description of the solar wind electron distribution function downstream of the termination shock under the influence of the shock-induced injection of overshooting KeV-energetic electrons will be presented. A kinetic phasespace transport equation in the bulk frame of the heliosheath plasma flow is developed for the solar wind electrons, taking into account shock-induced electron injection, convective changes, magnetic cooling processes and whistler wave-induced energy diffusion. Assuming that the local electron distribution under the prevailing Non-LTE conditions can be represented by a local kappa function with a local kappa parameter that varies with the streamline coordinates, we determine the parameters of the resulting, initial kappa distribution for the downstream electrons. From this initial function spectral electron fluxes can be derived and can be compared with those measured by the VOYAGER-1 spacecraft in the range between 40 to 70 KeV. It can then be shown that with kappa values around kappa = 6 one can in fact fit these data very satisfactorily. In addition it is shown that for isentropic electron flows kappa-distributed electrons have to undergo simultaneous changes of both parameters, i.e. kappa and theta, of the electron kappa function. It is also shown then that under the influence of energy sinks and sources the electron flux becomes non-isentropic with electron entropies changing along the streamline.
Directory of Open Access Journals (Sweden)
Dominic P Golec
Full Text Available T cell development is a highly dynamic process that is driven by interactions between developing thymocytes and the thymic microenvironment. Upon entering the thymus, the earliest thymic progenitors, called CD4(-CD8(- 'double negative' (DN thymocytes, pass through a checkpoint termed "β-selection" before maturing into CD4(+CD8(+ 'double positive' (DP thymocytes. β-selection is an important developmental checkpoint during thymopoiesis where developing DN thymocytes that successfully express the pre-T cell receptor (TCR undergo extensive proliferation and differentiation towards the DP stage. Signals transduced through the pre-TCR, chemokine receptor CXCR4 and Notch are thought to drive β-selection. Additionally, it has long been known that ERK is activated during β-selection; however the pathways regulating ERK activation remain unknown. Here, we performed a detailed analysis of the β-selection events in mice lacking RasGRP1, RasGRP3 and RasGRP1 and 3. We report that RasGRP1 KO and RasGRP1/3 DKO deficient thymi show a partial developmental block at the early DN3 stage of development. Furthermore, DN3 thymocytes from RasGRP1 and RasGRP1/3 double knock-out thymi show significantly reduced proliferation, despite expression of the TCRβ chain. As a result of impaired β-selection, the pool of TCRβ(+ DN4 is significantly diminished, resulting in inefficient DN to DP development. Also, we report that RasGRP1 is required for ERK activation downstream of CXCR4 signaling, which we hypothesize represents a potential mechanism of RasGRP1 regulation of β-selection. Our results demonstrate that RasGRP1 is an important regulator of proliferation and differentiation at the β-selection checkpoint and functions downstream of CXCR4 to activate the Ras/MAPK pathway.
Downstream behavior of fission products
International Nuclear Information System (INIS)
Johnson, I.; Farahat, M.K.; Settle, J.L.; Johnson, C.E.; Ritzman, R.
1986-01-01
The downstream behavior of fission products has been investigated by injecting mixtures of CsOH, CsI, and Te into a flowing steam/hydrogen stream and determining the physical and chemical changes that took place as the gaseous mixture flowed down a reaction duct on which a temperature gradient (1000 0 to 200 0 C) had been imposed. Deposition on the wall of the duct occurred by vapor condensation in the higher temperature regions and by aerosol deposition in the remainder of the duct. Reactions in the gas stream between CsOH and CsI and between CsOH and Te had an effect on the vapor condensation. The aerosol was characterized by the use of impingement tabs placed in the gas stream
RFX2 is a candidate downstream amplifier of A-MYB regulation in mouse spermatogenesis
Directory of Open Access Journals (Sweden)
Kistler Malathi K
2009-12-01
Full Text Available Abstract Background Mammalian spermatogenesis involves formation of haploid cells from the male germline and then a complex morphological transformation to generate motile sperm. Focusing on meiotic prophase, some tissue-specific transcription factors are known (A-MYB or suspected (RFX2 to play important roles in modulating gene expression in pachytene spermatocytes. The current work was initiated to identify both downstream and upstream regulatory connections for Rfx2. Results Searches of pachytene up-regulated genes identified high affinity RFX binding sites (X boxes in promoter regions of several new genes: Adam5, Pdcl2, and Spag6. We confirmed a strong promoter-region X-box for Alf, a germ cell-specific variant of general transcription factor TFIIA. Using Alf as an example of a target gene, we showed that its promoter is stimulated by RFX2 in transfected cells and used ChIP analysis to show that the promoter is occupied by RFX2 in vivo. Turning to upstream regulation of the Rfx2 promoter, we identified a cluster of three binding sites (MBS for the MYB family of transcription factors. Because testis is one of the few sites of A-myb expression, and because spermatogenesis arrests in pachytene in A-myb knockout mice, the MBS cluster implicates Rfx2 as an A-myb target. Electrophoretic gel-shift, ChIP, and co-transfection assays all support a role for these MYB sites in Rfx2 expression. Further, Rfx2 expression was virtually eliminated in A-myb knockout testes. Immunohistology on testis sections showed that A-MYB expression is up-regulated only after pachytene spermatocytes have clearly moved away from the tubule wall, which correlates with onset of RFX2 expression, whereas B-MYB expression, by contrast, is prevalent only in earlier spermatocytes and spermatogonia. Conclusion With an expanding list of likely target genes, RFX2 is potentially an important transcriptional regulator in pachytene spermatocytes. Rfx2 itself is a good candidate to be
International Nuclear Information System (INIS)
Sallenave, R.M.; Kreutzweiser, D.P.
1994-01-01
Field studies using flow-through artificial stream channels were conducted between May and October 1992 to study the role of the feeding activity of grazing and shredding invertebrates in promoting downstream transport of 2,2',4,4',5,5'-hexachlorobiphenyl (HCBP). Plant material was labeled with [ 14 C]HCBP and fed to selected invertebrate species, and accrual of radioactivity by downstream collector species (Hydropsyche spp.) was measured. Downstream transport of HCBP was significantly increased by the presence of the grazer Elimia livescens in the upstream sections of the channels as demonstrated by significantly higher levels of radioactivity in hydropsychid larvae located downstream. Similarly, movement of HCBP downstream was significantly greater in channels containing the shredder Hydatophylax argus than in channels without shredders. These results suggest that the feeding processes of benthic invertebrates may play an important role in the downstream transport of particle-bound hydrophobic organic compounds
Comparison of pitot traverses taken at varying distances downstream of obstructions.
Guffey, S E; Booth, D W
1999-01-01
This study determined the deviations between pitot traverses taken under "ideal" conditions--at least seven duct diameter's lengths (i.e., distance = 7D) from obstructions, elbows, junction fittings, and other disturbances to flows--with those taken downstream from commonplace disturbances. Two perpendicular 10-point, log-linear velocity pressure traverses were taken at various distances downstream of tested upstream conditions. Upstream conditions included a plain duct opening, a junction fitting, a single 90 degrees elbow, and two elbows rotated 90 degrees from each other into two orthogonal planes. Airflows determined from those values were compared with the values measured more than 40D downstream of the same obstructions under ideal conditions. The ideal measurements were taken on three traverse diameters in the same plane separated by 120 degrees in honed drawn-over-mandrel tubing. In all cases the pitot tubes were held in place by devices that effectively eliminated alignment errors and insertion depth errors. Duct velocities ranged from 1500 to 4500 ft/min. Results were surprisingly good if one employed two perpendicular traverses. When the averages of two perpendicular traverses was taken, deviations from ideal value were 6% or less even for traverses taken as close as 2D distance from the upstream disturbances. At 3D distance, deviations seldom exceeded 5%. With single diameter traverses, errors seldom exceeded 5% at 6D or more downstream from the disturbance. Interestingly, percentage deviations were about the same at high and low velocities. This study demonstrated that two perpendicular pitot traverses can be taken as close as 3D from these disturbances with acceptable (< or = 5%) deviations from measurements taken under ideal conditions.
Power Plant Bromide Discharges and Downstream Drinking Water Systems in Pennsylvania.
Good, Kelly D; VanBriesen, Jeanne M
2017-10-17
Coal-fired power plants equipped with wet flue gas desulfurization (FGD) systems have been implicated in increasing bromide levels and subsequent increases in disinfection byproducts at downstream drinking water plants. Bromide was not included as a regulated constituent in the recent steam electric effluent limitations guidelines and standards (ELGs) since the U.S. EPA analysis suggested few drinking water facilities would be affected by bromide discharges from power plants. The present analysis uses a watershed approach to identify Pennsylvania drinking water intakes downstream of wet FGD discharges and to assess the potential for bromide discharge effects. Twenty-two (22) public drinking water systems serving 2.5 million people were identified as being downstream of at least one wet FGD discharge. During mean August conditions (generally low-flow, minimal dilution) in receiving rivers, the median predicted bromide concentrations contributed by wet FGD at Pennsylvania intake locations ranged from 5.2 to 62 μg/L for the Base scenario (including only natural bromide in coal) and from 16 to 190 μg/L for the Bromide Addition scenario (natural plus added bromide for mercury control); ranges depend on bromide loads and receiving stream dilution capacity.
International Nuclear Information System (INIS)
Nigro, A.A.
1991-09-01
We report on our progress from April 1990 through March 1991 on determining the status and habitat requirements of white sturgeon populations in the Columbia River downstream from McNary Dam. The study is a cooperative effort by the Oregon Department of Fish and Wildlife (ODFW), Washington Department of Fisheries (WDF), US Fish and Wildlife Service (FWS) and National Marine Fisheries Service (NMFS). Study objectives addressed by each agency are to describe the life history and population dynamics of subadults and adults between Bonneville and McNary dams and evaluate the need and identify potential methods for protecting, mitigating and enhancing populations downstream from NcNary Dam; to describe the white sturgeon recreational fishery between Bonneville and McNary dams, describe reproductive and early life history characteristics downstream from Bonneville Dam and describe life history and population dynamics of subadults and adults downstream from Bonneville Dam; to describe reproduction and early life history characteristics, define habitat requirements for spawning and rearing and quantify extent of habitat available between Bonneville and McNary dams; and to describe reproduction and early life history characteristics, define habitat requirements for spawning and rearing and quantify extent of habitat available downstream from Bonneville Dam. Our approach is to work concurrently downstream and upstream from Bonneville Dam. Upstream from Bonneville Dam we began work in the Dalles Reservoir in 1987 and expanded efforts to Bonneville Reservoir in 1988 and John Day Reservoir in 1989. Highlights of results of this work in the Dalles, Bonneville and John Day reservoirs are included in the four pages included in this report
AHP2, AHP3, and AHP5 act downstream of CKI1 in Arabidopsis female gametophyte development.
Liu, Zhenning; Yuan, Li; Song, Xiaoya; Yu, Xiaolin; Sundaresan, Venkatesan
2017-06-15
Histidine phosphotransfer proteins (HPs) are key elements of the two-component signaling system, which act as a shuttle to transfer phosphorylation signals from histidine kinases (HKs) to response regulators (RRs). CYTOKININ INDEPENDENT 1 (CKI1), a key regulator of central cell specification in the Arabidopsis female gametophyte, activates the cytokinin signaling pathway through the Arabidopsis histidine phosphotransfer proteins (AHPs). There are five HP genes in Arabidopsis, AHP1-AHP5, but it remains unknown which AHP genes act downstream of CKI1 in Arabidopsis female gametophyte development. Promoter activity analysis of AHP1-AHP5 in embryo sacs revealed AHP1, AHP2, AHP3, and AHP5 expression in the central cell. Phenotypic studies of various combinations of ahp mutants showed that triple mutations in AHP2, AHP3, and AHP5 resulted in defective embryo sac development. Using cell-specific single and double markers in the female gametophyte, the ahp2-2 ahp3 ahp5-2/+ triple mutant ovules showed loss of central cell and antipodal cell fates and gain of egg cell or synergid cell attributes, resembling the cki1 mutant phenotypes. These data suggest that AHP2, AHP3, and AHP5 are the major factors acting downstream of CKI1 in the two-component cytokinin signaling pathway to promote Arabidopsis female gametophyte development. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.
2016-01-01
Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.
Measurement of velocity deficit at the downstream of a 1:10 axial hydrokinetic turbine model
Energy Technology Data Exchange (ETDEWEB)
Gunawan, Budi [ORNL; Neary, Vincent S [ORNL; Hill, Craig [St. Anthony Falls Laboratory, 2 Third Avenue SE, Minneapolis, MN 55414; Chamorro, Leonardo [St. Anthony Falls Laboratory, 2 Third Avenue SE, Minneapolis, MN 55414
2012-01-01
Wake recovery constrains the downstream spacing and density of turbines that can be deployed in turbine farms and limits the amount of energy that can be produced at a hydrokinetic energy site. This study investigates the wake recovery at the downstream of a 1:10 axial flow turbine model using a pulse-to-pulse coherent Acoustic Doppler Profiler (ADP). In addition, turbine inflow and outflow velocities were measured for calculating the thrust on the turbine. The result shows that the depth-averaged longitudinal velocity recovers to 97% of the inflow velocity at 35 turbine diameter (D) downstream of the turbine.
Effect of boundary conditions on downstream vorticity from counter-rotating swirlers
Directory of Open Access Journals (Sweden)
Weiye Huo
2015-02-01
Full Text Available Particle image velocimetry (PIV is utilized to measure the non-reacting flow field in a reflow combustor with multiple and single swirlers. The velocity field, vortex structure and total vorticity levels are experimentally obtained using two different boundary conditions, representing a single confined swirler and multiple swirlers in an annular combustor. The influence of the boundary conditions on the flow field at several locations downstream of the swirlers is experimentally investigated, showing that the central vortex in the multi-swirler case is more concentrated than in the single-swirler case. The vorticity of the central vortex and average cross-sectional vorticity are relatively low at the swirler outlet in both cases. Both of these statistics gradually increase to the maximum values near 20 mm downstream of the swirler outlet, and subsequently decrease. It is also found that the central vortex in the multi-swirler case is consistently greater than the single-swirler case. These results demonstrate the critical influence of boundary conditions on flow characteristic of swirling flow, providing insight into the difference of the experiments on test-bed combustor and the full-scale annular combustors.
Downstream process options for the ABE fermentation.
Friedl, Anton
2016-05-01
Butanol is a very interesting substance both for the chemical industry and as a biofuel. The classical distillation process for the removal of butanol is far too energy demanding, at a factor of 220% of the energy content of butanol. Alternative separation processes studied are hybrid processes of gas-stripping, liquid-liquid extraction and pervaporation with distillation and a novel adsorption/drying/desorption hybrid process. Compared with the energy content of butanol, the resulting energy demand for butanol separation and concentration of optimized hybrid processes is 11%-22% for pervaporation/distillation and 11%-17% for liquid-liquid extraction/distillation. For a novel adsorption/drying/desorption process, the energy demand is 9.4%. But all downstream process options need further proof of industrial applicability. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Evaluation of Intracellular Signaling Downstream Chimeric Antigen Receptors.
Directory of Open Access Journals (Sweden)
Hannah Karlsson
Full Text Available CD19-targeting CAR T cells have shown potency in clinical trials targeting B cell leukemia. Although mainly second generation (2G CARs carrying CD28 or 4-1BB have been investigated in patients, preclinical studies suggest that third generation (3G CARs with both CD28 and 4-1BB have enhanced capacity. However, little is known about the intracellular signaling pathways downstream of CARs. In the present work, we have analyzed the signaling capacity post antigen stimulation in both 2G and 3G CARs. 3G CAR T cells expanded better than 2G CAR T cells upon repeated stimulation with IL-2 and autologous B cells. An antigen-driven accumulation of CAR+ cells was evident post antigen stimulation. The cytotoxicity of both 2G and 3G CAR T cells was maintained by repeated stimulation. The phosphorylation status of intracellular signaling proteins post antigen stimulation showed that 3G CAR T cells had a higher activation status than 2G. Several proteins involved in signaling downstream the TCR were activated, as were proteins involved in the cell cycle, cell adhesion and exocytosis. In conclusion, 3G CAR T cells had a higher degree of intracellular signaling activity than 2G CARs which may explain the increased proliferative capacity seen in 3G CAR T cells. The study also indicates that there may be other signaling pathways to consider when designing or evaluating new generations of CARs.
Gangopadhyay, P.; Judge, D. L.
1996-01-01
Our knowledge of the various heliospheric phenomena (location of the solar wind termination shock, heliopause configuration and very local interstellar medium parameters) is limited by uncertainties in the available heliospheric plasma models and by calibration uncertainties in the observing instruments. There is, thus, a strong motivation to develop model insensitive and calibration independent methods to reduce the uncertainties in the relevant heliospheric parameters. We have developed such a method to constrain the downstream neutral hydrogen density inside the heliospheric tail. In our approach we have taken advantage of the relative insensitivity of the downstream neutral hydrogen density profile to the specific plasma model adopted. We have also used the fact that the presence of an asymmetric neutral hydrogen cavity surrounding the sun, characteristic of all neutral densities models, results in a higher multiple scattering contribution to the observed glow in the downstream region than in the upstream region. This allows us to approximate the actual density profile with one which is spatially uniform for the purpose of calculating the downstream backscattered glow. Using different spatially constant density profiles, radiative transfer calculations are performed, and the radial dependence of the predicted glow is compared with the observed I/R dependence of Pioneer 10 UV data. Such a comparison bounds the large distance heliospheric neutral hydrogen density in the downstream direction to a value between 0.05 and 0.1/cc.
International Nuclear Information System (INIS)
Lakam Mejus; Wan Zakaria Wan Mohd Tahir; Md Shahid Ayub; Jeremy Andy; Johari Latif
2006-01-01
This paper discusses method and monitoring result of the source of seepage water emerging (mud flow) at downstream toe of the failure slope at Kampung Bharu Bukit Tinggi, Bentong Pahang. In this investigation, a saline-tracer experiment was conducted by injecting its solution into a drain at an upstream section (old road to Janda Baik town) where a pipeline was found leaking in the vicinity of the roadside and flowing towards hill slopes. Some parts of flowing water was left undetected and seeped through the soil on its way to downstream area. Seepage water downstream was monitored by using a conductivity sensor hooked up to a CR10X data logger and optical back scattering conductivity probes. From the result, it is believed that the source of seepage water is related to the water from the leaking pipeline upstream. The travelling time for the leaking water to reach downstream slope failure was within 16-17 hours. Based on this preliminary investigation, one can conclude that seepage water is one of the main contributing factors that cause slope failure in the vicinity of the investigated hill slopes. Further investigation to understand the failure mechanism at this place by conducting multi-experimental approaches in different seasons, particularly during continuous rain storms. (Author)
Impact of upstream and downstream constraints on a signaling module’s ultrasensitivity
International Nuclear Information System (INIS)
Altszyler, Edgar; Chernomoretz, Ariel; Ventura, Alejandra; Colman-Lerner, Alejandro
2014-01-01
Much work has been done on the study of the biochemical mechanisms that result in ultrasensitive behavior of simple biochemical modules. However, in a living cell, such modules are embedded in a bigger network that constrains the range of inputs that the module will receive as well as the range of the module’s outputs that network will be able to detect. Here, we studied how the effective ultrasensitivity of a modular system is affected by these restrictions. We use a simple setup to explore to what extent the dynamic range spanned by upstream and downstream components of an ultrasensitive module impact on the effective sensitivity of the system. Interestingly, we found for some ultrasensitive motifs that dynamic range limitations imposed by downstream components can produce effective sensitivities much larger than that of the original module when considered in isolation. (paper)
Sleeving-back of horizontal wells to control downstream oil saturation and improve oil recovery
Energy Technology Data Exchange (ETDEWEB)
Greaves, M.; Saghr, A. M. [Bath Univ (United Kingdom)
1998-12-31
Air injection has become popular as an enhanced recovery technology, applicable over a wide variety of reservoir conditions including heavy, medium and light oils. One problem observed in light oil reservoirs is the tendency to desaturate the oil layer downstream of the moving front. This is particularly common in the case of thermal recovery processes. In this experiment designed to study ways to restrict the de-saturation of the oil layer, a modified horizontal producer well, incorporating a `sleeve-back` principal was used. The objective was to replicate the `toe-to-heel` displacement process occurring during heavy oil recovery, wherein downstream oil is essentially immobile due to its high viscosity. The `sleeve-back` of the well was achieved using a co-aligned, two-well assembly, so that the upstream section of the horizontal producer well was active, and continuously adjusted during propagation of the combustion front. The use of this continuous `sleeve-back` operation to control the level of de-saturation in the downstream section of a sand pack was successful as confirmed by the very high oil recovery achieved, equivalent to 93.5 per cent of oil in place. The level of CO{sub 2} production was also very high. The `sleeve-back` of the horizontal producer well made the light oil in-situ combustion more efficient compared to what would be expected in a fully-open well. The `sleeve-back` of the well also produced thermal contours in the sand pack that closely resembled those observed with heavy, highly viscous oil. By sealing-off the otherwise open well in the downstream part of the reservoir, the de-saturation of the oil layer was prevented. 9 refs., 4 tabs., 9 figs.
Directory of Open Access Journals (Sweden)
Cécilia Brun
Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte
International Nuclear Information System (INIS)
Hong, S.D.; Sugii, Y.; Okamoto, K.; Madarame, H.
2002-01-01
An experimental study was conducted on the chemically reacting liquid round free jet, Laser Induced Fluorescence (LIF) technique was adopted to evaluate the diffusion width of the jet into liquid streams. In the fluid engineering, it is very important to evaluate the characteristics of reacting jet for the safety of the nuclear reactor. In this study, the jet profile of downstream region far away from the transition point was evaluated, providing comparisons between reacting and non-reacting jet case. The concentration of the jet solution was varied from 0.01 mol/L to 0.5 mol/L in reacting cases. In the downstream far away from the transition point, the jet profiles between reacting cases and non-reacting cases were visualized quite different. It was concluded that the chemical reaction affects the momentum diffusion of the jet in the downstream region. (author)
DEFF Research Database (Denmark)
Schroeder, Ralf; Merten, Nicole; Mathiesen, Jesper Mosolff
2009-01-01
Prostaglandin D(2) activation of the seven transmembrane receptor CRTH2 regulates numerous cell functions that are important in inflammatory diseases such as asthma. Despite its disease implication, no studies to date aimed at identifying receptor domains governing signaling and surface expression......2 at the plasma membrane, presence of this domain confers a signaling-compromised conformation onto the receptor. Indeed, a mutant receptor lacking the major portion of its C-terminal tail displays paradoxically enhanced Galphai and ERK1/2 activation in spite of enhanced constitutive and agonist......-mediated internalization. Enhanced activation of Galphai proteins and downstream signaling cascades is likely due to the inability of the tail-truncated receptor to recruit beta-arrestin2 and undergo homologous desensitization. Unexpectedly, CRTH2 is not phosphorylated upon agonist-stimulation, a primary mechanism...
Element fluxes from Copahue Volcano, Argentina
Varekamp, J. C.
2003-12-01
Copahue volcano in Argentina has an active volcano-magmatic hydrothermal system that emits fluids with pH=0.3 that feed a river system. River flux measurements and analytical data provide element flux data from 1997 to 2003, which includes the eruptive period of July to December 2000. The fluids have up to 6.5 percent sulfate, 1 percent Cl and ppm levels of B, As, Cu, Zn and Pb. The hydrothermal system acts as a perfect scrubber for magmatic gases during the periods of passive degassing, although the dissolved magmatic gases are modified through water rock interaction and mineral precipitation. The magmatic SO2 disproportionates into sulfate and liquid elemental sulfur at about 300 C; the sulfate is discharged with the fluids, whereas the liquid sulfur is temporarily retained in the reservoir but ejected during phreatic and hydrothermal eruptions. The intrusion and chemical attack of new magma in the hydrothermal reservoir in early 2000 was indicated by strongly increased Mg concentrations and Mg fluxes, and higher Mg/Cl and Mg/K values. The hydrothermal discharge has acidified a large glacial lake (0.5 km3) to pH=2 and the lake effluents acidify the exiting river. Even more than 100 km downstream, the effects of acid pulses from the lake are evident from red coated boulders and fish die-offs. The river-bound sulfate fluxes from the system range from 70 to 200 kilotonnes/year. The equivalent SO2 output of the whole volcanic system ranges from 150 to 500 tonnes/day, which includes the fraction of native sulfur that formed inside the mountain but does not include the release of SO2 into the atmosphere during the eruptions. Trace element fluxes of the river will be scaled up and compared with global element fluxes from meteoric river waters (subterranean volcanic weathering versus watershed weathering).
OGJ group weathered tough times upstream and downstream in 1991
International Nuclear Information System (INIS)
Biggs, J.B.; Price, R.B.
1992-01-01
With an upstream sector hit by low oil and gas prices and downstream operations squeezed by weak petroleum demand, 1991, was a tough year for the group of 22 major integrated U.S. companies Oil and Gas Journal tracks. This paper reports that the brief respite caused by the oil price spike in second half 1990 ended abruptly early in first half 1991, and it turned into a year of buckling down for most companies. They shed non-core assets, implemented strategic restructuring moves, and reduced staff. Although low prices slowed overall drilling activity for the group, oil and gas production increased slightly, and most companies reported reserves gains. Recession in the U.S. and Europe depressed demand for the group's fined products enough to pinch downstream earnings even as buoyant Asia-Pacific demand helped jack up world product sales
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
2015-12-29
In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C
Tidal Influence on Water Quality of Kapuas Kecil River Downstream
Purnaini, Rizki; Sudarmadji; Purwono, Suryo
2018-02-01
The Kapuas Kecil River is strongly influenced by tidal, in the dry season the intrusion of surface water is often a problem for the WTP because it causes the change of raw water quality to be processed. The purpose of this study was to examine the effect of sea tides on water quality of the Kapuas Kecil River. The study was conducted in Kapuas River downstream along ± 30 km from the upper boundary to the estuary. Water sampling is carried out during the dry and rainy season, when the tidal conditions at 7 (seven) locations of the monitoring station. Descriptive analysis methods and regression-correlation statistics are used to determine the effect of tides on water quality in Kapuas River downstream. In general, the water quality of the Kapuas Kecil River has exceeded the criteria of first class water quality, ie water that can be used for drinking water. The status of water quality of the Kapuas Kecil River based on the pollution index calculation shows the condition of the river is "mild to medium pollutants". The result of multiple linear regression analysis got the value of coefficient of determination (adjusted R square) = 0,760, which in whole show that independent variable (tidal and distance) influence to dependent variable (value of TDS) equal to 76%.
Ferencz, S. B.; Cardenas, M. B.; Neilson, B. T.; Watson, J.
2017-12-01
large natural storm events. To our knowledge, this study is the first to use multiple downstream field sites to characterize how dam-induced SW-GW interactions and in-stream temperature and solute transport behave under hydropeaking conditions.
International Nuclear Information System (INIS)
Chen Long-Quan; Qiao Yao-Jun; Ji Yue-Feng
2013-01-01
In this paper, we propose a new structure of a centralized-light-source wavelength division multiplexed passive optical network (WDM-PON) utilizing inverse-duobinary-return-to-zero (inverse-duobinary-RZ) downstream and DPSK upstream. It reuses downstream light for the upstream modulation, which retrenches lasers assembled at each optical network unit (ONU), and ultimately cuts down the cost of ONUs a great deal. Meanwhile, a 50-km-reach WDM-PON experiment with 10-Gb/s inverse-duobinary-RZ downstream and 6-Gb/s DPSK upstream is demonstrated here. It is revealed to be a novel cost-effective alternative for the next generation access network. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)
Downstream processing of Isochrysis galbana: a step towards microalgal biorefinery
Gilbert-López, B.; Mendiola, J.A.; Fontecha, J.; Broek, van den L.A.M.; Sijtsma, L.; Cifuentes, A.; Herrero, M.; Ibáñez, E.
2015-01-01
An algae-based biorefinery relies on the efficient use of algae biomass through its fractionation of several valuable/bioactive compounds that can be used in industry. If this biorefinery includes green platforms as downstream processing technologies able to fulfill the requirements of green
CypA, a gene downstream of HIF-1α, promotes the development of PDAC.
Directory of Open Access Journals (Sweden)
Huan Zhang
Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.
Linking Three Gorges Dam and downstream hydrological regimes along the Yangtze River, China
Mei, X.; Dai, Z.; Van Gelder, P.H.A.J.M.; Gao, J.
2015-01-01
The magnitude of anthropogenic influence, especially dam regulation, on hydrological system is of scientific and practical value for large river management. As the largest dam in the world by far, Three Gorges Dam (TGD) is expected to be a strong evidence on dam impacts on downstream hydrological
Fortner, Sarah K.; Lyons, W. Berry
2018-04-01
Here we present a synthesis of the trace element chemistry in melt on the surface Canada Glacier, Taylor Valley, McMurdo Dry Valleys (MDV), Antarctica ( 78°S). The MDV is largely ice-free. Low accumulation rates, strong winds, and proximity to the valley floor make these glaciers dusty in comparison to their inland counterparts. This study examines both supraglacial melt streams and cryoconite holes. Supraglacial streams on the lower Canada Glacier have median dissolved (<0.4 µm) concentrations of Fe, Mn, As, Cu, and V of 71.5, 75.5, 3.7, 4.6, and 4.3 nM. All dissolved Cd concentrations and the vast majority of Pb values are below our analytical detection (i.e. 0.4 and 0.06 nM). Chemical behavior did not follow similar trends for eastern and western draining waters. Heterogeneity likely reflects distinctions eolian deposition, rock:water ratios, and hydrologic connectivity. Future increases in wind-delivered sediment will likely drive dynamic responses in melt chemistry. For elements above detection limits, dissolved concentrations in glacier surface melt are within an order of magnitude of concentrations observed in proglacial streams (i.e. flowing on the valley floor). This suggests that glacier surfaces are an important source of downstream chemistry. The Fe enrichment of cryoconite water relative to N, P, or Si exceeds enrichment observed in marine phytoplankton. This suggests that the glacier surface is an important source of Fe to downstream ecosystems.
International Nuclear Information System (INIS)
Ferenbaugh, R.W.; Gladney, E.S.
1997-06-01
In 1979, stream sediments, streambank soils, and streambank vegetation were sampled at 100 m intervals downstream of the outfall of the TA-50 radioactive liquid waste treatment facility in Mortandad Canyon. Sampling was discontinued at a distance of 3260 m at the location of the sediment traps in the canyon. The purpose of the sampling was to investigate the effect of the residual contaminants in the waste treatment facility effluent on elemental concentrations in various environmental media
Gorrepati, Lakshmi; Eisenmann, David M
2015-01-01
In metazoans, stem cells in developing and adult tissues can divide asymmetrically to give rise to a daughter that differentiates and a daughter that retains the progenitor fate. Although the short-lived nematode C. elegans does not possess adult somatic stem cells, the lateral hypodermal seam cells behave in a similar manner: they divide once per larval stage to generate an anterior daughter that adopts a non-dividing differentiated fate and a posterior daughter that retains the seam fate and the ability to divide further. Wnt signaling pathway is known to regulate the asymmetry of these divisions and maintain the progenitor cell fate in one daughter, but how activation of the Wnt pathway accomplished this was unknown. We describe here our recent work that identified the GATA transcription factor EGL-18 as a downstream target of Wnt signaling necessary for maintenance of a progenitor population of larval seam cells. EGL-18 was previously shown to act in the initial specification of the seam cells in the embryo. Thus the acquisition of a Wnt-responsive cis-regulatory module allows an embryonic fate specification factor to be reutilized later in life downstream of a different regulator (Wnt signaling) to maintain a progenitor cell population. These results support the use of seam cell development in C. elegans as a simple model system for studying stem and progenitor cell biology.
DEFF Research Database (Denmark)
Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja
2009-01-01
Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5......). A linkage analysis performed in a mutation-negative family identified a novel locus for BDA2 on chromosome 20p12.3 that incorporates the gene for Bone morphogenetic protein 2 (BMP2). No point mutation was identified in BMP2, so a high-density array CGH analysis covering the critical interval...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb....
Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase
Directory of Open Access Journals (Sweden)
Luis V. Rodríguez-Durán
2011-01-01
Full Text Available Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.
Novel strategies for upstream and downstream processing of tannin acyl hydrolase.
Rodríguez-Durán, Luis V; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N
2011-01-01
Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.
Ralph, Timothy; Wethered, Adam; Smith, Hugh; Heijnis, Henk
2014-05-01
Land clearance, soil tillage and grazing in agricultural catchments have liberated sediment and altered hydrological connectivity between hillslopes and channels, leading to increased sediment availability, mobilisation and delivery to rivers. The type and amount of sediment supplied to rivers is critical for fluvial geomorphology and aquatic ecosystem health. Contemporary sediment dynamics are routinely investigated using environmental radionuclides such as caesium-137 (Cs-137) and excess lead-210 (Pb-210ex), which can provide information regarding sediment source types and fluvial processes if sediment sources can be distinguished from one another and mixing models applied to representative samples. However, downstream transport, mixing and dilution of radionuclide-labelled sediment (especially from sources with low initial concentrations) can obliterate the tracer signal; sometimes before anything of geomorphological importance happens in the catchment. Can these findings be used as evidence of sediment source variations and fluvial processes when the limits of detection (of Cs-137 in particular) are being exceeded so rapidly downstream? Sediment sources and downstream sediment dynamics were investigated in Coolbaggie Creek, a major supplier of sediment to the Macquarie River in an agricultural catchment with temperate to semi-arid climate in Australia. Radionuclides were used to discriminate between the banks and gullies (Cs-137 1.45 +/- 0.47 Bq/kg; Pb-210ex 4.67 +/- 1.93 Bq/kg). Within the trunk stream, suspended sediment, organic matter and Cs-137 and Pb-210ex concentrations declined downstream. Results from a mixing model suggest that agricultural topsoils account for 95% of fine sediment entering the channel in the upper reach (200 m2) downstream, with channel expansion and gullies contributing fine sediment to the system. A lack of topsoil being supplied to the channel suggests minimal lateral connectivity between the catchment and the trunk stream in all
Blattmann, Peter; Heusel, Moritz; Aebersold, Ruedi
2016-01-01
SWATH-MS is an acquisition and analysis technique of targeted proteomics that enables measuring several thousand proteins with high reproducibility and accuracy across many samples. OpenSWATH is popular open-source software for peptide identification and quantification from SWATH-MS data. For downstream statistical and quantitative analysis there exist different tools such as MSstats, mapDIA and aLFQ. However, the transfer of data from OpenSWATH to the downstream statistical tools is currently technically challenging. Here we introduce the R/Bioconductor package SWATH2stats, which allows convenient processing of the data into a format directly readable by the downstream analysis tools. In addition, SWATH2stats allows annotation, analyzing the variation and the reproducibility of the measurements, FDR estimation, and advanced filtering before submitting the processed data to downstream tools. These functionalities are important to quickly analyze the quality of the SWATH-MS data. Hence, SWATH2stats is a new open-source tool that summarizes several practical functionalities for analyzing, processing, and converting SWATH-MS data and thus facilitates the efficient analysis of large-scale SWATH/DIA datasets.
Simon, Katharina; Hennen, Stephanie; Merten, Nicole; Blättermann, Stefanie; Gillard, Michel; Kostenis, Evi; Gomeza, Jesus
2016-01-08
Recent studies have recognized G protein-coupled receptors as important regulators of oligodendrocyte development. GPR17, in particular, is an orphan G protein-coupled receptor that has been identified as oligodendroglial maturation inhibitor because its stimulation arrests primary mouse oligodendrocytes at a less differentiated stage. However, the intracellular signaling effectors transducing its activation remain poorly understood. Here, we use Oli-neu cells, an immortalized cell line derived from primary murine oligodendrocytes, and primary rat oligodendrocyte cultures as model systems to identify molecular targets that link cell surface GPR17 to oligodendrocyte maturation blockade. We demonstrate that stimulation of GPR17 by the small molecule agonist MDL29,951 (2-carboxy-4,6-dichloro-1H-indole-3-propionic acid) decreases myelin basic protein expression levels mainly by triggering the Gαi/o signaling pathway, which in turn leads to reduced activity of the downstream cascade adenylyl cyclase-cAMP-PKA-cAMP response element-binding protein (CREB). In addition, we show that GPR17 activation also diminishes myelin basic protein abundance by lessening stimulation of the exchange protein directly activated by cAMP (EPAC), thus uncovering a previously unrecognized role for EPAC to regulate oligodendrocyte differentiation. Together, our data establish PKA and EPAC as key downstream effectors of GPR17 that inhibit oligodendrocyte maturation. We envisage that treatments augmenting PKA and/or EPAC activity represent a beneficial approach for therapeutic enhancement of remyelination in those demyelinating diseases where GPR17 is highly expressed, such as multiple sclerosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Has dyke development in the Vietnamese Mekong Delta shifted flood hazard downstream?
Van Khanh Triet, Nguyen; Viet Dung, Nguyen; Fujii, Hideto; Kummu, Matti; Merz, Bruno; Apel, Heiko
2017-08-01
In the Vietnamese part of the Mekong Delta (VMD) the areas with three rice crops per year have been expanded rapidly during the last 15 years. Paddy-rice cultivation during the flood season has been made possible by implementing high-dyke flood defenses and flood control structures. However, there are widespread claims that the high-dyke system has increased water levels in downstream areas. Our study aims at resolving this issue by attributing observed changes in flood characteristics to high-dyke construction and other possible causes. Maximum water levels and duration above the flood alarm level are analysed for gradual trends and step changes at different discharge gauges. Strong and robust increasing trends of peak water levels and duration downstream of the high-dyke areas are found with a step change in 2000/2001, i.e. immediately after the disastrous flood which initiated the high-dyke development. These changes are in contrast to the negative trends detected at stations upstream of the high-dyke areas. This spatially different behaviour of changes in flood characteristics seems to support the public claims. To separate the impact of the high-dyke development from the impact of the other drivers - i.e. changes in the flood hydrograph entering the Mekong Delta, and changes in the tidal dynamics - hydraulic model simulations of the two recent large flood events in 2000 and 2011 are performed. The hydraulic model is run for a set of scenarios whereas the different drivers are interchanged. The simulations reveal that for the central VMD an increase of 9-13 cm in flood peak and 15 days in duration can be attributed to high-dyke development. However, for this area the tidal dynamics have an even larger effect in the range of 19-32 cm. However, the relative contributions of the three drivers of change vary in space across the delta. In summary, our study confirms the claims that the high-dyke development has raised the flood hazard downstream. However, it is not
Human polyomavirus JCV late leader peptide region contains important regulatory elements
International Nuclear Information System (INIS)
Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh; Khalili, Kamel; Safak, Mahmut
2006-01-01
Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader
The Chromium is an essential element in the human
International Nuclear Information System (INIS)
Alvarado Gamez, A.; Blanco Saenz, R.; Mora Morales, E.
2002-01-01
The Chromium is an essential element for human and animals, because it a preponderant function in the insulin metabolism as a glucose tolerance factor (GTF). The deficiency of chromium engenders a deterioration in the glucose metabolism due to bad efficiency of insulin. Because the importance of this element an exhaustive reference review was made and this presents some studies realized in laboratory animals and in human beings where it is prove with resuits the effect of chromium over the improvement of patients with non-insulin dependant diabetes. Three substances are presented as chromium active biological forms: a material rich in chromium known as glucose tolerance factor, chromium picolinate and a substance of low molecular weight LMWCr in its forms of apo and holo that contains chromium and it links the insulin receptor and improves its activity. Also this paper presents information about the condition of diabetes in Costa Rica. (Author) [es
A novel cell autolysis system for cost-competitive downstream processing.
Hajnal, Ivan; Chen, Xiangbin; Chen, Guo-Qiang
2016-11-01
The industrial production of low value-added biological products poses significant challenges due to cost pressures. In recent years, it has been argued that synthetic biology approaches will lead to breakthroughs that eliminate price bottlenecks for the production of a wide range of biological products including bioplastics and biofuels. One significant bottleneck lies in the necessity to break the tough cell walls of microbes in order to release intracellular products. We here report the implementation of the first synthetic biology standard part based on the lambda phage SRRz genes and a synthetic ribosome binding site (RBS) that works in Escherichia coli and Halomonas campaniensis, which enables the producer strains to induce lysis after the addition of small amounts (1-5 %) of solvents or to spontaneously lyse during the stresses of downstream processing, and thus has the potential to eliminate the mechanical cell disruption step as both an efficiency bottleneck and a significant capex barrier when implementing downstream bioprocesses.
Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie
2016-04-15
Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Kim, Jong Hyun; Wang, Aibing; Conti, Mary Anne; Adelstein, Robert S.
2012-01-01
Ligand-induced internalization of the epidermal growth factor receptor (EGFR) is an important process for regulating signal transduction, cellular dynamics, and cell-cell communication. Here, we demonstrate that nonmuscle myosin II (NM II) is required for the internalization of the EGFR and to trigger the EGFR-dependent activation of ERK and AKT. The EGFR was identified as a protein that interacts with NM II by co-immunoprecipitation and mass spectrometry analysis. This interaction requires both the regulatory light chain 20 (RLC20) of NM II and the kinase domain of the EGFR. Two paralogs of NM II, NM II-A, and NM II-B can act to internalize the EGFR, depending on the cell type and paralog content of the cell line. Loss (siRNA) or inhibition (25 μm blebbistatin) of NM II attenuates the internalization of the EGFR and impairs EGFR-dependent activation of ERK and AKT. Both internalization of the EGFR and downstream signaling to ERK and AKT can be partially restored in siRNA-treated cells by introduction of wild type (WT) GFP-NM II, but cannot be restored by motor mutant NM II. Taken together, these results suggest that NM II plays a role in the internalization of the EGFR and EGFR-mediated signaling pathways. PMID:22718763
Directory of Open Access Journals (Sweden)
Teck-Yee Ling
2017-01-01
Full Text Available This study examined the water quality of the large young tropical Bakun hydroelectric reservoir in Sarawak, Malaysia, and the influence of the outflow on the downstream river during wet and dry seasons. Water quality was determined at five stations in the reservoir at three different depths and one downstream station. The results show that seasons impacted the water quality of the Bakun Reservoir, particularly in the deeper water column. Significantly lower turbidity, SRP, and TP were found during the wet season. At 3–6 m, the oxygen content fell below 5 mg/L and hypoxia was also recorded. Low NO2--N, NO3--N, and SRP and high BOD5, OKN, and TP were observed in the reservoir indicating organic pollution. Active logging activities and the dam construction upstream resulted in water quality deterioration. The outflow decreased the temperature, DO, and pH and increased the turbidity and TSS downstream. Elevated organic matter and nutrients downstream are attributable to domestic discharge along the river. This study shows that the downstream river was affected by the discharge through the turbines, the spillway operations, and domestic waste. Therefore, all these factors should be taken into consideration in the downstream river management for the health of the aquatic organisms.
Stites, Mallory C.; Federmeier, Kara D.
2015-01-01
We used eye-tracking to investigate the downstream processing consequences of encountering noun/verb (NV) homographs (i.e., park) in semantically neutral but syntactically constraining contexts. Target words were followed by a prepositional phrase containing a noun that was plausible for only one meaning of the homograph. Replicating previous work, we found increased first fixation durations on NV homographs compared to unambiguous words, which persisted into the next sentence region. At the downstream noun, we found plausibility effects following ambiguous words that were correlated with the size of a reader's first fixation effect, suggesting that this effect reflects the recruitment of processing resources necessary to suppress the homograph's context-inappropriate meaning. Using these same stimuli, Lee and Federmeier (2012) found a sustained frontal negativity to the NV homographs, and, on the downstream noun, found a plausibility effect that was also positively correlated with the size of a reader's ambiguity effect. Together, these findings suggest that when only syntactic constraints are available, meaning selection recruits inhibitory mechanisms that can be measured in both first fixation slowdown and ERP ambiguity effects. PMID:25961358
Downstream Fining of Polydispersed Gravity Currents Along a V-Shaped Valley.
Besson, C. K.; Meriaux, C. A. M. D.
2014-12-01
Turbidity currents belong to the class of currents transporting sediments, whose deposits exhibit downstream grain size fining. In this study, the objective was to better understand the relationship between downstream fining and grain sizes at the source. To this end, we performed four lock-exchange experiments of polydispersed and turbulent gravity currents flowing along a 5-m long V-shaped valley. The particle volumetric concentrations were typically 3%. The four currents were made of 1) Silicon Carbide (SiC), 2) Glass Beads (GBs), 3) a combined poorly sorted SiC/GBs, and 4) a moderately sorted combined SiC/GBs. We used the Morphologi G3 tool developed by Malvern Instruments Corporate (Malvern Instruments Ltd, UK) for the grain size analyses. We first established a criterion for identifying the appropriate number of grain size classes nbclassfor characterizing the grain size distributions. We considered the four statistical indicators that are the arithmetic mean size dmean, the standard deviation σd, the skewness Skd, and the kurtosis Kd, and show that the four indicators for the initial grain size distributions reach plateaux when nb_class≥ 20. Hence we chose nbclass=20 as being our appropriate bin width. These four indicators were then calculated for samples taken along the deposits to establish the grain size distributions along the deposits. The subsequent profiles of dmean, σd, Skd, and Kd with distance from the lock show highly variable behaviours between the different initial distributions. In particular, the distance over which the loss of the largest grains of the initial distribution occurs [dmean> dmean(initial)], can cover up to half the runout length. Curiously, the different rates of fining estimated from the curves (dmean/ dmean(initial)) as a function of downstream distance (x/x_runout) do not appear to be well correlated with the sedimentation velocities based on dmean(initial). This is currently being investigated.
Scoppettone, G. Gary; Rissler, Peter H.; Salgado, J. Antonio; Harry, Beverly
2013-01-01
We compared cui-ui (Chasmistes cujus) recruitment from two reaches of the Truckee River with histories of severe erosional downcutting caused by a decline in Pyramid Lake surface elevation. In 1975, Marble Bluff Dam (MBD) was constructed 5 kilometers upstream of the extant mouth of the Truckee River to stabilize the upstream reach of the river; the downstream reach of the river remained unstable and consequently unsuitable for cui-ui recruitment. By the early 2000s, there was a decrease in the Truckee River’s slope from MBD to Pyramid Lake after a series of wet years in the 1990s. This was followed by changes in river morphology and erosion abatement. These changes led to the question as to cui-ui recruitment potential in the Truckee River downstream of MBD. In 2012, more than 7,000 cui-ui spawners were passed upstream of MBD, although an indeterminate number of cui-ui spawned downstream of MBD. In this study, we compared cui-ui recruitment upstream and downstream of MBD during a Truckee River low-flow year (2012). Cui-ui larvae emigration to Pyramid Lake began earlier and ended later downstream of MBD. A greater number of cui-ui larvae was produced downstream of MBD than upstream. This also was true for native Tahoe sucker (Catostomus tahoensis) and Lahontan redside (Richardsonius egregius). The improved Truckee River stability downstream of MBD and concomitant cui-ui recruitment success is attributed to a rise in Pyramid Lake's surface elevation. A decline in lake elevation may lead to a shift in stream morphology and substrate composition to the detriment of cui-ui reproductive success as well as the reproductive success of other native fishes.
The effect of CD4 receptor downregulation and its downstream signaling molecules on HIV-1 latency
International Nuclear Information System (INIS)
Kim, Kyung-Chang; Kim, Hyeon Guk; Roh, Tae-Young; Park, Jihwan; Jung, Kyung-Min; Lee, Joo-Shil; Choi, Sang-Yun; Kim, Sung Soon; Choi, Byeong-Sun
2011-01-01
Research highlights: → CD4 receptors were downregulated on the surface of HIV-1 latently infected cells. → CD4 downstream signaling molecules were suppressed in HIV-1 latently infected cells. → HIV-1 progeny can be reactivated by induction of T-cell activation signal molecules. → H3K4me3 and H3K9ac were highly enriched in CD4 downstream signaling molecules. → HIV-1 latency can be maintained by the reduction of downstream signaling molecules. -- Abstract: HIV-1 can establish a latent infection in memory CD4 + T cells to evade the host immune response. CD4 molecules can act not only as the HIV-1 receptor for entry but also as the trigger in an intracellular signaling cascade for T-cell activation and proliferation via protein tyrosine kinases. Novel chronic HIV-1-infected A3.01-derived (NCHA) cells were used to examine the involvement of CD4 downstream signaling in HIV-1 latency. CD4 receptors in NCHA cells were dramatically downregulated on its surface but were slightly decreased in whole-cell lysates. The expression levels of CD4 downstream signaling molecules, including P56 Lck , ZAP-70, LAT, and c-Jun, were sharply decreased in NCHA cells. The lowered histone modifications of H3K4me3 and H3K9ac correlated with the downregulation of P56 Lck , ZAP-70, and LAT in NCHA cells. AP-1 binding activity was also reduced in NCHA cells. LAT and c-Jun suppressed in NCHA cells were highly induced after PMA treatment. In epigenetic analysis, other signal transduction molecules which are associated with active and/or latent HIV-1 infection showed normal states in HIV-1 latently infected cells compared to A3.01 cells. In conclusion, we demonstrated that the HIV-1 latent state is sustained by the reduction of downstream signaling molecules via the downregulation of CD4 and the attenuated activity of transcription factor as AP-1. The HIV-1 latency model via T-cell deactivation may provide some clues for the development of the new antireservoir therapy.
The effect of CD4 receptor downregulation and its downstream signaling molecules on HIV-1 latency
Energy Technology Data Exchange (ETDEWEB)
Kim, Kyung-Chang [National Institute of Health, Chungbuk (Korea, Republic of); School of Life Science and Biotechnology, Korea University, Seoul (Korea, Republic of); Kim, Hyeon Guk [National Institute of Health, Chungbuk (Korea, Republic of); Roh, Tae-Young [Division of Molecular and Life Science, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Park, Jihwan [Division of Molecular and Life Science, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Jung, Kyung-Min; Lee, Joo-Shil [National Institute of Health, Chungbuk (Korea, Republic of); Choi, Sang-Yun [School of Life Science and Biotechnology, Korea University, Seoul (Korea, Republic of); Kim, Sung Soon [National Institute of Health, Chungbuk (Korea, Republic of); Choi, Byeong-Sun, E-mail: byeongsun@korea.kr [National Institute of Health, Chungbuk (Korea, Republic of)
2011-01-14
Research highlights: {yields} CD4 receptors were downregulated on the surface of HIV-1 latently infected cells. {yields} CD4 downstream signaling molecules were suppressed in HIV-1 latently infected cells. {yields} HIV-1 progeny can be reactivated by induction of T-cell activation signal molecules. {yields} H3K4me3 and H3K9ac were highly enriched in CD4 downstream signaling molecules. {yields} HIV-1 latency can be maintained by the reduction of downstream signaling molecules. -- Abstract: HIV-1 can establish a latent infection in memory CD4 + T cells to evade the host immune response. CD4 molecules can act not only as the HIV-1 receptor for entry but also as the trigger in an intracellular signaling cascade for T-cell activation and proliferation via protein tyrosine kinases. Novel chronic HIV-1-infected A3.01-derived (NCHA) cells were used to examine the involvement of CD4 downstream signaling in HIV-1 latency. CD4 receptors in NCHA cells were dramatically downregulated on its surface but were slightly decreased in whole-cell lysates. The expression levels of CD4 downstream signaling molecules, including P56{sup Lck}, ZAP-70, LAT, and c-Jun, were sharply decreased in NCHA cells. The lowered histone modifications of H3K4me3 and H3K9ac correlated with the downregulation of P56{sup Lck}, ZAP-70, and LAT in NCHA cells. AP-1 binding activity was also reduced in NCHA cells. LAT and c-Jun suppressed in NCHA cells were highly induced after PMA treatment. In epigenetic analysis, other signal transduction molecules which are associated with active and/or latent HIV-1 infection showed normal states in HIV-1 latently infected cells compared to A3.01 cells. In conclusion, we demonstrated that the HIV-1 latent state is sustained by the reduction of downstream signaling molecules via the downregulation of CD4 and the attenuated activity of transcription factor as AP-1. The HIV-1 latency model via T-cell deactivation may provide some clues for the development of the new
Human muscle fibre type-specific regulation of AMPK and downstream targets by exercise
DEFF Research Database (Denmark)
Kristensen, Dorte Enggaard; Albers, Peter Hjorth; Prats, Clara
2015-01-01
are expressed in a fibre type-dependent manner and that fibre type-specific activation of AMPK and downstream targets is dependent on exercise intensity. Pools of type I and II fibres were prepared from biopsies of m. vastus lateralis from healthy men before and after two exercise trials; A) continuous cycling......AMP-activated protein kinase (AMPK) is a regulator of energy homeostasis during exercise. Studies suggest muscle fibre type-specific AMPK expression. However, fibre type-specific regulation of AMPK and downstream targets during exercise has not been proven. We hypothesized that AMPK subunits...... (CON) 30 min at 69 ± 1% VO2peak or B) interval cycling (INT) 30 min with 6 × 1.5 min high-intense bouts peaking at 95 ± 2% VO2peak . In type I vs. II fibres a higher β1 AMPK (+215%) and lower γ3 AMPK expression (-71%) was found. α1 , α2 , β2 and γ1 AMPK expression was similar between fibre types...
Energy Technology Data Exchange (ETDEWEB)
Nigro, Anthony A. (Oregon Department of Fish and Wildlife, Portland, OR)
1990-09-01
We report on our progress from April 1989 through March 1990 on determining the status and habitat requirements of white sturgeon populations in the Columbia River downstream from McNary Dam. The study is a cooperative effort by the Oregon Department of Fish and Wildlife (ODFW), Washington Department of Fisheries (WDF), US Fish and Wildlife Service (FWS) and National Marine Fisheries Service (NMFS). Study objectives addressed by each agency are to describe the life history and population dynamics of subadults and adults between Bonneville and McNary dams and evaluate the need and identify potential methods for protecting, mitigating and enhancing populations downstream from McNary Dam, to describe the white sturgeon recreational fishery between Bonneville and McNary dams, describe reproductive and early life history characteristics downstream from Bonneville Dam and describe life history and population dynamics of subadults and adults downstream from Bonneville Dam, to describe reproduction and early life history characteristics, define habitat requirements for spawning and rearing and quantify extent of habitat available between Bonneville and McNary dams, and to describe reproduction and early life history characteristics, define habitat requirements for spawning and rearing and quantify extent of habitat available downstream from Bonneville Dam. Our approach is to work concurrently downstream and upstream from Bonneville Dam. Upstream from Bonneville Dam we began work in the Dalles Reservoir in 1987 and expanded efforts to Bonneville Reservoir in 1988 and John Day Reservoir in 1989. Highlights from this work is also included. 47 refs., 33 figs., 66 tabs.
Recent hydrocarbon developments in Latin America: Key issues in the downstream oil sector
International Nuclear Information System (INIS)
Wu, K.; Pezeshki, S.
1995-01-01
This report discusses the following: (1) An overview of major issues in the downstream oil sector, including oil demand and product export availability, the changing product consumption pattern, and refineries being due for major investment; (2) Recent upstream developments in the oil and gas sector in Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Mexico, Peru, Trinidad and Tobago, and Venezuela; (3) Recent downstream developments in the oil and gas sector in Argentina, Chile, Colombia, Ecuador, Mexico, Peru, Cuba, and Venezuela; (4) Pipelines in Argentina, Bolivia, Brazil, Chile, and Mexico; and (5) Regional energy balance. 4 figs., 5 tabs
Recent hydrocarbon developments in Latin America: Key issues in the downstream oil sector
Energy Technology Data Exchange (ETDEWEB)
Wu, K.; Pezeshki, S.
1995-03-01
This report discusses the following: (1) An overview of major issues in the downstream oil sector, including oil demand and product export availability, the changing product consumption pattern, and refineries being due for major investment; (2) Recent upstream developments in the oil and gas sector in Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Mexico, Peru, Trinidad and Tobago, and Venezuela; (3) Recent downstream developments in the oil and gas sector in Argentina, Chile, Colombia, Ecuador, Mexico, Peru, Cuba, and Venezuela; (4) Pipelines in Argentina, Bolivia, Brazil, Chile, and Mexico; and (5) Regional energy balance. 4 figs., 5 tabs.
Ezoddini Ardakani, Fatemeh; Bahrololoumi, Zahra; Zangouie Booshehri, Maryam; Navab Azam, Alireza; Ayatollahi, Fatemeh
2010-01-01
Inferior alveolar nerve block injection is one of the common intra oral anesthetic techniques, with a failure rate of 15-20%. The aim of this study was to evaluate the position of the lingula as an index for this injection. Thirty eight panoramic radiographs of 7-11 year old patients were analyzed and the distance between the lingula index and occlusal plane was measured. Then, lower alveolar nerve block injection was performed on 88 children. Finally, a visual analogue scale was used to measure the rate of pain in the patients. This distance increased with age and in children younger than nine years is -0.45 mm on the right side and -0.95 mm on the left side. This distance in children older than 9 years is -0.23 mm on the right side and 0.47 mm on the left side. The success rates of inferior alveolar nerve block injection based on lingual index were 49% on the right side and 53.8% on the left side. As the lingual index has various positions and its distance from the occlusal plane increases with age, it is not an appropriate landmark for inferior alveolar nerve block injection.
Downstream passage of fish larvae and eggs through a small-sized reservoir, Mucuri river, Brazil
Directory of Open Access Journals (Sweden)
Paulo S. Pompeu
2011-12-01
Full Text Available In South America, one important symptom of the failure of fish passages to sustain fish migratory recruitment is the inability of eggs and larvae to reach the nurseries. This is especially so when the breeding areas are located upstream of a reservoir, and the floodplain is downstream of the dam. Therefore, the transport of fish larvae and eggs across reservoir barriers is a key factor in the development of effective conservation strategies. In this paper, we evaluate the potential for migratory fish larvae and egg transportation across a small size reservoir in eastern Brazil. We sampled fish daily between 15th October 2002 and 15th February 2003 (spawning period in the Mucuri River, immediately upstream of the reservoir and downstream of the Santa Clara Power Plant dam. Our study was the first to indicate the possibility of successful larval passage through the reservoir of a hydroelectric reservoir and dam in South America, and showed that the passage of migratory fish larvae was associated significantly with residence time of water in the reservoir. The relatively short water residence time and elevated turbidity of the Santa Clara's reservoir waters during the rainy season certainly contributed to the successful passage, and can be considered as key factors for a priori evaluations of the feasibility of a downstream larval passage.
da Silva, Yuri Jacques Agra Bezerra; Cantalice, José Ramon Barros; Singh, Vijay P; do Nascimento, Clístenes Williams Araújo; Piscoya, Victor Casimiro; Guerra, Sérgio M S
2015-10-01
Data regarding trace element concentrations and fluxes in suspended sediments and bedload are scarce. To fill this gap and meet the international need to include polluted rivers in future world estimation of trace element fluxes, this study aimed to determine the trace element fluxes in suspended sediment and bedload of an environmentally impacted river in Brazil. Water, suspended sediment, and bedload from both the upstream and the downstream cross sections were collected. To collect both the suspended sediment and water samples, we used the US DH-48. Bedload measurements were carried out using the US BLH 84 sampler. Concentrations of Cd, Cr, Cu, Fe, Mn, Ni, Pb, and Zn were determined by inductively coupled plasma (ICP-OES). As and Hg were determined by an atomic absorption spectrophotometer (AA-FIAS). The suspended sediments contributed more than 99 % of the trace element flux. By far Pb and to a less extent Zn at the downstream site represents major concerns. The yields of Pb and Zn in suspended sediments were 4.20 and 2.93 kg km(2) year(-1), respectively. These yields were higher than the values reported for Pb and Zn for Tuul River (highly impacted by mining activities), 1.60 and 1.30 kg km(2) year(-1), respectively, as well as the Pb yield (suspended + dissolved) to the sea of some Mediterranean rivers equal to 3.4 kg km(2) year(-1). Therefore, the highest flux and yield of Pb and Zn in Ipojuca River highlighted the importance to include medium and small rivers-often overlooked in global and regional studies-in the future estimation of world trace element fluxes in order to protect estuaries and coastal zones.
MicroRNA-145 suppresses hepatocellular carcinoma by targeting IRS1 and its downstream Akt signaling
Energy Technology Data Exchange (ETDEWEB)
Wang, Yelin [Department of Anesthesiology, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Hu, Chen; Cheng, Jun [Department of Surgery, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Chen, Binquan [Department of Anesthesiology, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Ke, Qinghong; Lv, Zhen; Wu, Jian [Department of Surgery, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Zhou, Yanfeng, E-mail: zyfhdj@yahoo.com [Department of Anesthesiology, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou (China)
2014-04-18
Highlights: • MiR-145 expression is down-regulated in HCC tissues and inversely related with IRS1 levels. • MiR-145 directly targets IRS1 in HCC cells. • Restored expression of miR-145 suppressed HCC cell proliferation and growth. • MiR-145 induced IRS1 under-expression potentially reduced downstream AKT signaling. - Abstract: Accumulating evidences have proved that dysregulation of microRNAs (miRNAs) is involved in cancer initiation and progression. In this study, we showed that miRNA-145 level was significantly decreased in hepatocellular cancer (HCC) tissues and cell lines, and its low expression was inversely associated with the abundance of insulin receptor substrate 1 (IRS1), a key mediator in oncogenic insulin-like growth factor (IGF) signaling. We verified IRS1 as a direct target of miR-145 using Western blotting and luciferase reporter assay. Further, the restoration of miR-145 in HCC cell lines suppressed cancer cell growth, owing to down-regulated IRS1 expression and its downstream Akt/FOXO1 signaling. Our results demonstrated that miR-145 could inhibit HCC through targeting IRS1 and its downstream signaling, implicating the loss of miR-145 regulation may be a potential molecular mechanism causing aberrant oncogenic signaling in HCC.
Monitoring Thermal Pollution in Rivers Downstream of Dams with Landsat ETM+ Thermal Infrared Images
Directory of Open Access Journals (Sweden)
Feng Ling
2017-11-01
Full Text Available Dams play a significant role in altering the spatial pattern of temperature in rivers and contribute to thermal pollution, which greatly affects the river aquatic ecosystems. Understanding the temporal and spatial variation of thermal pollution caused by dams is important to prevent or mitigate its harmful effect. Assessments based on in-situ measurements are often limited in practice because of the inaccessibility of water temperature records and the scarcity of gauges along rivers. By contrast, thermal infrared remote sensing provides an alternative approach to monitor thermal pollution downstream of dams in large rivers, because it can cover a large area and observe the same zone repeatedly. In this study, Landsat Enhanced Thematic Mapper Plus (ETM+ thermal infrared imagery were applied to assess the thermal pollution caused by two dams, the Geheyan Dam and the Gaobazhou Dam, located on the Qingjiang River, a tributary of the Yangtze River downstream of the Three Gorges Reservoir in Central China. The spatial and temporal characteristics of thermal pollution were analyzed with water temperatures estimated from 54 cloud-free Landsat ETM+ scenes acquired in the period from 2000 to 2014. The results show that water temperatures downstream of both dams are much cooler than those upstream of both dams in summer, and the water temperature remains stable along the river in winter, showing evident characteristic of the thermal pollution caused by dams. The area affected by the Geheyan Dam reaches beyond 20 km along the downstream river, and that affected by the Gaobazhou Dam extends beyond the point where the Qingjiang River enters the Yangtze River. Considering the long time series and global coverage of Landsat ETM+ imagery, the proposed technique in the current study provides a promising method for globally monitoring the thermal pollution caused by dams in large rivers.
A SINE in the genome of the cephalochordate amphioxus is an Alu element
Holland, Linda Z.
2006-01-01
Transposable elements of about 300 bp, termed “short interspersed nucleotide elements or SINEs are common in eukaryotes. However, Alu elements, SINEs containing restriction sites for the AluI enzyme, have been known only from primates. Here I report the first SINE found in the genome of the cephalochordate, amphioxus. It is an Alu element of 375 bp that does not share substantial identity with any genomic sequences in vertebrates. It was identified because it was located in the FoxD regulatory region in a cosmid derived from one individual, but absent from the two FoxD alleles of BACs from a second individual. However, searches of sequences of BACs and genomic traces from this second individual gave an estimate of 50-100 copies in the amphioxus genome. The finding of an Alu element in amphioxus raises the question of whether Alu elements in amphioxus and primates arose by convergent evolution or by inheritance from a common ancestor. Genome-wide analyses of transposable elements in amphioxus and other chordates such as tunicates, agnathans and cartilaginous fishes could well provide the answer. PMID:16733535
Franca, M. J.; Battisacco, E.; Schleiss, A. J.
2014-12-01
The transport of sediments by water throughout the river basins, from the steep slopes of the upstream regions to the sea level, is recognizable important to keep the natural conditions of rivers with a role on their ecology processes. Over the last decades, a reduction on the supply of sand and gravel has been observed downstream dams existing in several alpine rivers. Many studies highlight that the presence of a dam strongly modifies the river behavior in the downstream reach, in terms of morphology and hydrodynamics, with consequences on local ecology. Sediment deficit, bed armoring, river incision and bank instability are the main effects which affect negatively the aquatic habitats and the water quality. One of the proposed techniques to solve the problem of sediment deficit downstream dams, already adopted in few Japanese and German rivers although on an unsatisfactory fashion, is the artificial replenishment of these. Generally, it was verified that the erosion of the replenishments was not satisfactory and the transport rate was not enough to move the sediments to sufficient downstream distances. In order to improve and to provide an engineering answer to make this technique more applicable, a series of laboratory tests are ran as preparatory study to understand the hydrodynamics of the river flow when the replenishment technique is applied. Erodible volumes, with different lengths and submergence conditions, reproducing sediment replenishments volumes, are positioned along a channel bank. Different geometrical combinations of erodible sediment volumes are tested as well on the experimental flume. The first results of the experimental research, concerning erosion time evolution, the influence of discharge and the distance travelled by the eroded sediments, will be presented and discussed.
International Nuclear Information System (INIS)
Thompson, Sunnie R.; Sarnow, Peter
2003-01-01
Human enterovirus 71 (EV71) is a member of the Enterovirus genus of the Picornaviridae family. Other members of this family utilize an unusual mechanism of translation initiation whereby ribosomes are recruited internally to the viral RNA by an internal ribosome site (IRES) located in their 5' noncoding regions (5' NCR). Using dicistronic reporter constructs, we demonstrate that the 5' NCRs of the 7423/MS/87 and BrCr strains of EV71 function as an IRES both in extracts and in cultured cells. Preincubation of translation extracts with purified coxsackievirus 2A protease cleaved elF4G, a component of the cap binding complex, resulting in a significant decrease in translation of capped mRNAs. In contrast, the translational efficiency of the EV71 IRES was enhanced under this condition, demonstrating that the EV71 IRES functions similar to other enterovirus IRES elements when components of the cap binding protein complex are cleaved. Finally, insertion of an upstream, out-of-frame start codon in the 5' NCR of the EV71 genome inhibited IRES activity, suggesting that EV71 can be classified as a type I IRES, in which ribosomes first bind upstream of the initiation codon and then scan the mRNA until an appropriate downstream AUG start codon is encountered and protein synthesis commences
International Nuclear Information System (INIS)
Klessa, D.A.
2000-01-01
The compositions of waters in Magela Creek upstream and downstream of Ranger uranium mine were reviewed. The water quality parameters examined were pH, electrical conductivity (EC) and turbidity, and dissolved calcium, magnesium, sodium, potassium, chloride, sulphate, ammonium, nitrate, copper, lead, manganese, zinc, uranium and radium-226. The frequency distributions of each of these parameters in waters upstream of the mine were characterised and statistically described to provide a baseline which allows a change in water chemistry downstream of the mine to be assessed. With the exception of pH, EC, turbidity, magnesium, calcium, sodium and manganese, data that comprise the baseline are not normally distributed. The frequency distributions of copper, lead, zinc, uranium and radium-226 forming the baseline are characterised by a large proportion of values at or near analytical detection limits and contamination in a relatively large proportion of the remainder. A comparison of upstream and downstream data shows that there is good conformity in pH, EC, turbidity, sodium, potassium and chloride. For calcium, nitrate, ammonium, lead, uranium, radium and zinc less than 40% of the downstream data fall outside the 20th and 80th baseline percentiles but in the ease of U, data are biased towards relatively high values. More than 40% of downstream magnesium and sulphate data are outside these percentile boundaries and are skewed towards relatively high concentrations. Copper, lead and zinc in mine waters (characterised by the composition of waters contained in the former RP4) do not appear to pose a risk as contaminants based upon the results of toxicity testing and water quality guideline trigger levels with risk minimised for greater than 1 in 20 dilution
Featured collection introduction: Connectivity of streams and wetlands to downstream waters
Alexander, Laurie C.; Fritz, Ken M.; Schofield, Kate; Autrey, Bradley; DeMeester, Julie; Golden, Heather E.; Goodrich, David C.; Kepner, William G.; Kiperwas, Hadas R.; Lane, Charles R.; LeDuc, Stephen D.; Leibowitz, Scott; McManus, Michael G.; Pollard, Amina I.; Ridley, Caroline E.; Vanderhoof, Melanie; Wigington, Parker J.
2018-01-01
Connectivity is a fundamental but highly dynamic property of watersheds. Variability in the types and degrees of aquatic ecosystem connectivity presents challenges for researchers and managers seeking to accurately quantify its effects on critical hydrologic, biogeochemical, and biological processes. However, protecting natural gradients of connectivity is key to protecting the range of ecosystem services that aquatic ecosystems provide. In this featured collection, we review the available evidence on connections and functions by which streams and wetlands affect the integrity of downstream waters such as large rivers, lakes, reservoirs, and estuaries. The reviews in this collection focus on the types of waters whose protections under the U.S. Clean Water Act have been called into question by U.S. Supreme Court cases. We synthesize 40+ years of research on longitudinal, lateral, and vertical fluxes of energy, material, and biota between aquatic ecosystems included within the Act's frame of reference. Many questions about the roles of streams and wetlands in sustaining downstream water integrity can be answered from currently available literature, and emerging research is rapidly closing data gaps with exciting new insights into aquatic connectivity and function at local, watershed, and regional scales. Synthesis of foundational and emerging research is needed to support science‐based efforts to provide safe, reliable sources of fresh water for present and future generations.
Weigel, T.; Toussaiant, F.; Stockhause, M.; Höck, H.; Kindermann, S.; Lautenschlager, M.; Ludwig, T.
2012-12-01
We propose a wide adoption of structural elements (typed links, collections, trees) in the Handle System to improve identification and access of scientific data, metadata and software as well as traceability of data provenance. Typed links target the issue of data provenance as a means to assess the quality of scientific data. Data provenance is seen here as a directed acyclic graph with nodes representing data and vertices representing derivative operations (Moreau 2010). Landing pages can allow a human user to explore the provenance graph back to the primary unprocessed data, thereby also giving credit to the original data producer. As in Earth System Modeling no single infrastructure with complete data lifecycle coverage exists, we propose to split the problem domain in two parts. Project-specific infrastructures such as the German project C3-Grid or the Earth System Grid Federation (ESGF) for CMIP5 data are aware of data and data operations (Toussaint et al. 2012) and can thus detect and accumulate single nodes and vertices in the provenance graph, assigning Handles to data, metadata and software. With a common schema for typed links, the provenance graph is established as downstream infrastructures refer incoming Handles. Data in this context is for example hierarchically structured Earth System model output data, which receives DataCite DOIs only for the most coarse-granular elements. Using Handle tree structures, the lower levels of the hierarchy can also receive Handles, allowing authors to more precisely identify the data they used (Lawrence et al. 2011). We can e.g. define a DOI for just the 2m-temperature variable of CMIP5 data across many CMIP5 experiments or a DOI for model and observational data coming from different sources. The structural elements should be implemented through Handle values at the Handle infrastructure level for two reasons. Handle values are more durable than downstream websites or databases, and thus the provenance chain does not
Castro, D M P; Hughes, R M; Callisto, M
2013-11-01
Successive daily peak flows from hydropower plants can disrupt aquatic ecosystems and alter the composition and structure of macroinvertebrates downstream. We evaluated the influence of peak flow changes on macroinvertebrate drift downstream of a hydroelectric plant as a basis for determining ecological flows that might reduce the disturbance of aquatic biota. The aim of this study was to assess the influence of flow fluctuations on the seasonal and daily drift patterns of macroinvertebrates. We collected macroinvertebrates during fixed flow rates (323 m3.s-1 in the wet season and 111 m3.s-1 in the dry season) and when peak flows fluctuated (378 to 481 m3.s-1 in the wet season, and 109 to 173 m3.s-1 in the dry season) in 2010. We collected 31,924 organisms belonging to 46 taxa in the four sampling periods. Taxonomic composition and densities of drifting invertebrates differed between fixed and fluctuating flows, in both wet and dry seasons, but family richness varied insignificantly. We conclude that macroinvertebrate assemblages downstream of dams are influenced by daily peak flow fluctuations. When making environmental flow decisions for dams, it would be wise to consider drifting macroinvertebrates because they reflect ecological changes in downstream biological assemblages.
Has dyke development in the Vietnamese Mekong Delta shifted flood hazard downstream?
Directory of Open Access Journals (Sweden)
N. V. K. Triet
2017-08-01
Full Text Available In the Vietnamese part of the Mekong Delta (VMD the areas with three rice crops per year have been expanded rapidly during the last 15 years. Paddy-rice cultivation during the flood season has been made possible by implementing high-dyke flood defenses and flood control structures. However, there are widespread claims that the high-dyke system has increased water levels in downstream areas. Our study aims at resolving this issue by attributing observed changes in flood characteristics to high-dyke construction and other possible causes. Maximum water levels and duration above the flood alarm level are analysed for gradual trends and step changes at different discharge gauges. Strong and robust increasing trends of peak water levels and duration downstream of the high-dyke areas are found with a step change in 2000/2001, i.e. immediately after the disastrous flood which initiated the high-dyke development. These changes are in contrast to the negative trends detected at stations upstream of the high-dyke areas. This spatially different behaviour of changes in flood characteristics seems to support the public claims. To separate the impact of the high-dyke development from the impact of the other drivers – i.e. changes in the flood hydrograph entering the Mekong Delta, and changes in the tidal dynamics – hydraulic model simulations of the two recent large flood events in 2000 and 2011 are performed. The hydraulic model is run for a set of scenarios whereas the different drivers are interchanged. The simulations reveal that for the central VMD an increase of 9–13 cm in flood peak and 15 days in duration can be attributed to high-dyke development. However, for this area the tidal dynamics have an even larger effect in the range of 19–32 cm. However, the relative contributions of the three drivers of change vary in space across the delta. In summary, our study confirms the claims that the high-dyke development has raised the flood
International Nuclear Information System (INIS)
Beaugelin-Seiller, K.; Brottet, D.
1994-01-01
The detection of radionuclides in water, downstream of nuclear installations located on river banks, is often very difficult notably because of their low concentrations. Thus the use of biological indicators is an interesting process to detect radioactive contamination of an aquatic ecosystem. From 1986 to 1990, artificial radionuclides were measured in freshwater mosses sampled downstream of the nuclear power station of Bugey. These field data on the whole, have shown a comparatively good qualitative and quantitative relationship between radioactive composition of liquid waste and radionuclides detected in mosses. In other respects, the results showed up a relatively clear hierarchical structure in the affinity of the different radionuclides for the mosses. To specify these relations, mesh bags containing allochtonous mosses were immersed at four stations downstream of the power plant and regularly sampled during a 10-h waste discharge period. (author)
Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis
National Research Council Canada - National Science Library
Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W
2005-01-01
A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Directory of Open Access Journals (Sweden)
Gustavo A Gomez
Full Text Available The transcription factor Etsrp is required for vasculogenesis and primitive myelopoiesis in zebrafish. When ectopically expressed, etsrp is sufficient to induce the expression of many vascular and myeloid genes in zebrafish. The mammalian homolog of etsrp, ER71/Etv2, is also essential for vascular and hematopoietic development. To identify genes downstream of etsrp, gain-of-function experiments were performed for etsrp in zebrafish embryos followed by transcription profile analysis by microarray. Subsequent in vivo expression studies resulted in the identification of fourteen genes with blood and/or vascular expression, six of these being completely novel. Regulation of these genes by etsrp was confirmed by ectopic induction in etsrp overexpressing embryos and decreased expression in etsrp deficient embryos. Additional functional analysis of two newly discovered genes, hapln1b and sh3gl3, demonstrates their importance in embryonic vascular development. The results described here identify a group of genes downstream of etsrp likely to be critical for vascular and/or myeloid development.
Mei, Xuefei; Dai, Zhijun; Darby, Stephen E.; Gao, Shu; Wang, Jie; Jiang, Weiguo
2018-04-01
River flooding—the world's most significant natural hazard—is likely to increase under anthropogenic climate change. Most large rivers have been regulated by damming, but the extent to which these impoundments can mitigate extreme flooding remains uncertain. Here the catastrophic 2016 flood on the Changjiang River is first analyzed to assess the effects of both the Changjiang's reservoir cascade and the Three Gorges Dam (TGD), the world's largest hydraulic engineering project on downstream flood discharge and water levels. We show that the Changjiang's reservoir cascade impounded over 30.0 × 103 m3/s of flow at the peak of the flood on 25 July 2016, preventing the occurrence of what would otherwise have been the second largest flood ever recorded in the reach downstream of the TGD. Half of this flood water storage was retained by the TGD alone, meaning that impoundment by the TGD reduced peak water levels at the Datong hydrometric station (on 25 July) by 1.47 m, compared to pre-TGD conditions. However, downstream morphological changes, in particular, extensive erosion of the natural floodplain, offset this reduction in water level by 0.22 m, so that the full beneficial impact of floodwater retention by the TGD was not fully realized. Our results highlight how morphological adjustments downstream of large dams may inhibit their full potential to mitigate extreme flood risk.
Recent Molecular Advances on Downstream Plant Responses to Abiotic Stress
Directory of Open Access Journals (Sweden)
Cláudia Regina Batista de Souza
2012-07-01
Full Text Available Abiotic stresses such as extremes of temperature and pH, high salinity and drought, comprise some of the major factors causing extensive losses to crop production worldwide. Understanding how plants respond and adapt at cellular and molecular levels to continuous environmental changes is a pre-requisite for the generation of resistant or tolerant plants to abiotic stresses. In this review we aimed to present the recent advances on mechanisms of downstream plant responses to abiotic stresses and the use of stress-related genes in the development of genetically engineered crops.
Downstream flow top width prediction in a river system | Choudhury ...
African Journals Online (AJOL)
ANFIS, ARIMA and Hybrid Multiple Inflows Muskingum models (HMIM) were applied to simulate and forecast downstream discharge and flow top widths in a river system. The ANFIS model works on a set of linguistic rules while the ARIMA model uses a set of past values to predict the next value in a time series. The HMIM ...
Turbulence downstream of subcoronary stentless and stented aortic valves.
Funder, Jonas Amstrup; Frost, Markus Winther; Wierup, Per; Klaaborg, Kaj-Erik; Hjortdal, Vibeke; Nygaard, Hans; Hasenkam, J Michael
2011-08-11
Regions of turbulence downstream of bioprosthetic heart valves may cause damage to blood components, vessel wall as well as to aortic valve leaflets. Stentless aortic heart valves are known to posses several hemodynamic benefits such as larger effective orifice areas, lower aortic transvalvular pressure difference and faster left ventricular mass regression compared with their stented counterpart. Whether this is reflected by diminished turbulence formation, remains to be shown. We implanted either stented pericardial valve prostheses (Mitroflow), stentless valve prostheses (Solo or Toronto SPV) in pigs or they preserved their native valves. Following surgery, blood velocity was measured in the cross sectional area downstream of the valves using 10MHz ultrasonic probes connected to a dedicated pulsed Doppler equipment. As a measure of turbulence, Reynolds normal stress (RNS) was calculated at two different blood pressures (baseline and 50% increase). We found no difference in maximum RNS measurements between any of the investigated valve groups. The native valve had significantly lower mean RNS values than the Mitroflow (p=0.004), Toronto SPV (p=0.008) and Solo valve (p=0.02). There were no statistically significant differences between the artificial valve groups (p=0.3). The mean RNS was significantly larger when increasing blood pressure (p=0.0006). We, thus, found no advantages for the stentless aortic valves compared with stented prosthesis in terms of lower maximum or mean RNS values. Native valves have a significantly lower mean RNS value than all investigated bioprostheses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Flow diagnostics downstream of a tribladed rotor model
DEFF Research Database (Denmark)
Naumov, I. V.; Rahmanov, V. V.; Okulov, Valery
2012-01-01
This paper presents results of a study of vortex wake structures and measurements of instantaneous 3D velocity fields downstream of a triblade turbine model. Two operation modes of flow around the rotor with different tip speed ratios were tested. Initially the wake structures were visualized...... and subsequently quantitative data were recorded through velocity field restoration from particle tracks using a stereo PIV system.The study supplied flow diagnostics and recovered the instantaneous 3D velocity fields in the longitudinal cross section behind a tribladed rotor at different values of tip speed ratio...
Buccola, Norman L.; Rounds, Stewart A.; Sullivan, Annett B.; Risley, John C.
2012-01-01
Detroit Dam was constructed in 1953 on the North Santiam River in western Oregon and resulted in the formation of Detroit Lake. With a full-pool storage volume of 455,100 acre-feet and a dam height of 463 feet, Detroit Lake is one of the largest and most important reservoirs in the Willamette River basin in terms of power generation, recreation, and water storage and releases. The U.S. Army Corps of Engineers operates Detroit Dam as part of a system of 13 reservoirs in the Willamette Project to meet multiple goals, which include flood-damage protection, power generation, downstream navigation, recreation, and irrigation. A distinct cycle in water temperature occurs in Detroit Lake as spring and summer heating through solar radiation creates a warm layer of water near the surface and isolates cold water below. Controlling the temperature of releases from Detroit Dam, therefore, is highly dependent on the location, characteristics, and usage of the dam's outlet structures. Prior to operational changes in 2007, Detroit Dam had a well-documented effect on downstream water temperature that was problematic for endangered salmonid fish species, releasing water that was too cold in midsummer and too warm in autumn. This unnatural seasonal temperature pattern caused problems in the timing of fish migration, spawning, and emergence. In this study, an existing calibrated 2-dimensional hydrodynamic water-quality model [CE-QUAL-W2] of Detroit Lake was used to determine how changes in dam operation or changes to the structural release points of Detroit Dam might affect downstream water temperatures under a range of historical hydrologic and meteorological conditions. The results from a subset of the Detroit Lake model scenarios then were used as forcing conditions for downstream CE-QUAL-W2 models of Big Cliff Reservoir (the small reregulating reservoir just downstream of Detroit Dam) and the North Santiam and Santiam Rivers. Many combinations of environmental, operational, and
Using forest carbon credits to offset emissions in the downstream business
Hein, Lars
2017-01-01
A forthcoming report by Concawe, entitled Using Forest Carbon Credits to Offset Emissions in the Downstream Business, investigated whether, and how, forest carbon credits can be used to offset emissions from the European refining and road transport sectors. Forest carbon plays a major role in the
40 CFR 80.219 - Designation and downstream requirements for GPA gasoline.
2010-07-01
... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Designation and downstream requirements for GPA gasoline. 80.219 Section 80.219 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... sold or dispensed for use in motor vehicles at a retail outlet or wholesale purchaser-consumer facility...
A downstream voyage with mercury
Heinz, Gary
2016-01-01
Retrospective essay for the Bulletin of Environmental Contamination and Toxicology.As I look back on my paper, “Effects of Low Dietary Levels of Methyl Mercury on Mallard Reproduction,” published in 1974 in the Bulletin of Environmental Contamination and Toxicology, a thought sticks in my mind. I realize just how much my mercury research was not unlike a leaf in a stream, carried this way and that, sometimes stalled in an eddy, restarted, and carried downstream at a pace and path that was not completely under my control. I was hired in 1969 by the Patuxent Wildlife Research Center to study the effects of environmental pollutants on the behavior of wildlife. A colleague was conducting a study on the reproductive effects of methylmercury on mallards (Anas platyrhynchos), and he offered to give me some of the ducklings. I conducted a pilot study, testing how readily ducklings approached a tape-recorded maternal call. Sample sizes were small, but the results suggested that ducklings from mercury-treated parents behaved differently than controls. That’s how I got into mercury research—pretty much by chance.
DEFF Research Database (Denmark)
Damkjær Bartels, Mette; Hansen, Lars H.; Boye, Kit
2011-01-01
In methicillin resistant Staphylococcus aureus (MRSA), the arginine catabolic mobile element (ACME) was initially described in USA300 (t008-ST8) where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec). A common health-care associated MRSA in Copenhagen, Denmark (t024......-ST8) is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing...... of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1) and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME...
Evaluating Lignocellulosic Biomass, Its Derivatives, and Downstream Products with Raman Spectroscopy
Lupoi, Jason S.; Gjersing, Erica; Davis, Mark F.
2015-01-01
The creation of fuels, chemicals, and materials from plants can aid in replacing products fabricated from non-renewable energy sources. Before using biomass in downstream applications, it must be characterized to assess chemical traits, such as cellulose, lignin, or lignin monomer content, or the sugars released following an acid or enzymatic hydrolysis. The measurement of these traits allows researchers to gage the recalcitrance of the plants and develop efficient deconstruction strategies to maximize yields. Standard methods for assessing biomass phenotypes often have experimental protocols that limit their use for screening sizeable numbers of plant species. Raman spectroscopy, a non-destructive, non-invasive vibrational spectroscopy technique, is capable of providing qualitative, structural information and quantitative measurements. Applications of Raman spectroscopy have aided in alleviating the constraints of standard methods by coupling spectral data with multivariate analysis to construct models capable of predicting analytes. Hydrolysis and fermentation products, such as glucose and ethanol, can be quantified off-, at-, or on-line. Raman imaging has enabled researchers to develop a visual understanding of reactions, such as different pretreatment strategies, in real-time, while also providing integral chemical information. This review provides an overview of what Raman spectroscopy is, and how it has been applied to the analysis of whole lignocellulosic biomass, its derivatives, and downstream process monitoring. PMID:25941674
Umar, M.; Rhoads, Bruce L.; Greenberg, Jonathan A.
2018-01-01
Although past work has noted that contrasts in turbidity often are detectable on remotely sensed images of rivers downstream from confluences, no systematic methodology has been developed for assessing mixing over distance of confluent flows with differing surficial suspended sediment concentrations (SSSC). In contrast to field measurements of mixing below confluences, satellite remote-sensing can provide detailed information on spatial distributions of SSSC over long distances. This paper presents a methodology that uses remote-sensing data to estimate spatial patterns of SSSC downstream of confluences along large rivers and to determine changes in the amount of mixing over distance from confluences. The method develops a calibrated Random Forest (RF) model by relating training SSSC data from river gaging stations to derived spectral indices for the pixels corresponding to gaging-station locations. The calibrated model is then used to predict SSSC values for every river pixel in a remotely sensed image, which provides the basis for mapping of spatial variability in SSSCs along the river. The pixel data are used to estimate average surficial values of SSSC at cross sections spaced uniformly along the river. Based on the cross-section data, a mixing metric is computed for each cross section. The spatial pattern of change in this metric over distance can be used to define rates and length scales of surficial mixing of suspended sediment downstream of a confluence. This type of information is useful for exploring the potential influence of various controlling factors on mixing downstream of confluences, for evaluating how mixing in a river system varies over time and space, and for determining how these variations influence water quality and ecological conditions along the river.
Goldstine, Jimena V; Nahas, Shareef; Gamo, Kristin; Gartler, Stanley M; Hansen, R Scott; Roelfsema, Jeroen H; Gatti, Richard A; Marahrens, York
2006-04-08
Double strand DNA breaks in the genome lead to the activation of the ataxia-telangiectasia mutated (ATM) kinase in a process that requires ATM autophosphorylation at serine-1981. ATM autophosphorylation only occurs if ATM is previously acetylated by Tip60. The activated ATM kinase phosphorylates proteins involved in arresting the cell cycle, including p53, and in repairing the DNA breaks. Chloroquine treatment and other manipulations that produce chromatin defects in the absence of detectable double strand breaks also trigger ATM phosphorylation and the phosphorylation of p53 in primary human fibroblasts, while other downstream substrates of ATM that are involved in the repair of DNA double strand breaks remain unphosphorylated. This raises the issue of whether ATM is constitutively activated in patients with genetic diseases that display chromatin defects. We examined lymphoblastoid cell lines (LCLs) generated from patients with different types of chromatin disorders: Immunodeficiency, Centromeric instability, Facial anomalies (ICF) syndrome, Coffin Lowry syndrome, Rubinstein Taybi syndrome and Fascioscapulohumeral Muscular Dystrophy. We show that ATM is phosphorylated on serine-1981 in LCLs derived from ICF patients but not from the other syndromes. The phosphorylated ATM in ICF cells did not phosphorylate the downstream targets NBS1, SMC1 and H2AX, all of which require the presence of double strand breaks. We demonstrate that ICF cells respond normally to ionizing radiation, ruling out the possibility that genetic deficiency in ICF cells renders activated ATM incapable of phosphorylating its downstream substrates. Surprisingly, p53 was also not phosphorylated in ICF cells or in chloroquine-treated wild type LCLs. In this regard the response to chromatin-altering agents differs between primary fibroblasts and LCLs. Our findings indicate that although phosphorylation at serine-1981 is essential in the activation of the ATM kinase, serine-1981 phosphorylation is
Downstream ecological effects of dams: A geomorphic perspective
International Nuclear Information System (INIS)
Ligon, F.K.; Dietrich, W.E.; Trush, W.J.
1995-01-01
The damming of a river changes the flow of water, sediment, nutrients, energy, and biota, interrupting and altering most of a river's ecological processes. This article discusses the importance of geomorphological analysis in river conservation and management. To illustrate how subtle geomorphological adjustments may profoundly influence the ecological relationships downstream from dames, three case studies are presented. Then a geomorphically based approach for assessing and possibly mitigating some of the environmental effects of dams by tailoring dam designed and operation is outlined. The cases are as follows: channel simplification and salmon decline on the McKenzie River in Oregon; Channel incision and reduced floodplain inundation on the Oconee river in Georgia; Increased stability of a braided river in New Zealand's south island. 41 refs., 10 figs., 1 tab
Downstream wind flow path diversion and its effects on the performance of vertical axis wind turbine
International Nuclear Information System (INIS)
Maganhar, A.L.
2015-01-01
In the present experimental study efforts have been made to analysis path diversion effect of downstream wind flow on performance of vertical axis wind turbine (VAWT). For the blockage of downstream wind flow path at various linear displaced positions, a normal erected flat wall, semi-circular and cylindrical shapes were tested for path diverting geometries. Performance of VAWT in terms of improved rotor speed up to 45% was achieved. (author)
Weber, M; Rinke, K; Hipsey, M R; Boehrer, B
2017-07-15
Sustainable management of drinking water reservoirs requires balancing the demands of water supply whilst minimizing environmental impact. This study numerically simulates the effect of an improved withdrawal scheme designed to alleviate the temperature pollution downstream of a reservoir. The aim was to identify an optimal withdrawal strategy such that water of a desirable discharge temperature can be supplied downstream without leading to unacceptably low oxygen concentrations within the reservoir. First, we calibrated a one-dimensional numerical model for hydrodynamics and oxygen dynamics (GLM-AED2), verifying that the model reproduced water temperatures and hypolimnetic dissolved oxygen concentrations accurately over a 5 year period. Second, the model was extended to include an adaptive withdrawal functionality, allowing for a prescribed withdrawal temperature to be found, with the potential constraint of hypolimnetic oxygen concentration. Scenario simulations on epi-/metalimnetic withdrawal demonstrate that the model is able to autonomously determine the best withdrawal height depending on the thermal structure and the hypolimnetic oxygen concentration thereby optimizing the ability to supply a desirable discharge temperature to the downstream river during summer. This new withdrawal strategy also increased the hypolimnetic raw water volume to be used for drinking water supply, but reduced the dissolved oxygen concentrations in the deep and cold water layers (hypolimnion). Implications of the results for reservoir management are discussed and the numerical model is provided for operators as a simple and efficient tool for optimizing the withdrawal strategy within different reservoir contexts. Copyright © 2017 Elsevier Ltd. All rights reserved.
Muhammad, A.; Evenson, G. R.; Boluwade, A.; Jha, S. K.; Rasmussen, P. F.
2016-12-01
Hydrological processes are highly complex and strongly nonlinear and cannot be represented through simple means. Models are built to replicate these processes. However, models due to various sources of uncertainty including their structural capability often lead to inaccurate results. The aim of this study is to setup the soil water assessment tool (SWAT) for a watershed that is dominated by potholes in the Prairie region of Canada. The potholes not connected to the stream, also known as geographically isolated wetlands (GIWs), are dynamic in nature leading to a fill and spill situation due to varying surface runoff conditions. Significant land use changes have resulted in almost 70% of wetlands being lost and have posed threat of flooding to downstream areas. While some studies were devoted to identify the presence of potholes only few have explored the impacts of wetlands on the downstream hydrology. In this study, we follow Evenson et al., (2016) approach of modifying SWAT model. The modification enhances structural capability of SWAT while depicting the dynamics of wetlands at HRUs level. Redefining the formation of HRUs in such way effectively captures the spatial presence of potholes. We then routed the potholes' fill and spill hydrology to direct the flow to the potholes immediately downstream. The model was calibrated for 2005-2008 and verified over 2009-2011 at a daily time step. We tested our model with three land use change scenarios by varying the presence of potholes and evaluated its impact on the downstream hydrograph. We foresee a significant improvement in replicating stream flow using this novel approach. We believe that it will effectively improve the predictive power of SWAT for this highly complex sub basin (Upper Assiniboine catchment at Kamsack) located in Canadian Prairie.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Temesgen, Habtamu; Wu, Wei; Legesse, Abiyot; Yirsaw, Eshetu; Bekele, Belew
2018-02-23
Characterized by high population density on a rugged topography, the Gedeo-Abaya landscape dominantly contains a multi-strata traditional agroforests showing the insight of Gedeo farmers on natural resource management practices. Currently, this area has been losing its resilience and is becoming unable to sustain its inhabitants. Based on both RS-derived and GIS-computed land-use/cover changes (LUCC) as well as socioeconomic validations, this article explored the LUCC and agroecological-based driver patterns in Gedeo-Abaya landscape from 1986 to 2015. A combination of geo-spatial technology and cross-sectional survey design were employed to detect the drivers behind these changes. The article discussed that LUCC and the prevalence of drivers are highly diverse and vary throughout agroecological zones. Except for the population, most downstream top drivers are perceived as insignificant in the upstream region and vice versa. In the downstream, land-use/cover (LUC) classes are more dynamic, diverse, and challenged by nearly all anticipated drivers than are upstream ones. Agroforestry LUC has been increasing (by 25% of its initial cover) and is becoming the predominant cover type, although socioeconomic analysis and related findings show its rapid LUC modification. A rapid reduction of woodland/shrubland (63%) occurred in the downstream, while wetland/marshy land increased threefold (158%), from 1986 to 2015 with annual change rates of - 3.7 and + 6%, respectively. Land degradation induced by changes in land use is a serious problem in Africa, especially in the densely populated sub-Saharan regions such as Ethiopia (FAO 2015). Throughout the landscape, LUCC is prominently affecting land-use system of the study landscape due to population pressure in the upstream region and drought/rainfall variability, agribusiness investment, and charcoaling in the downstream that necessitate urgent action.
SGLT2 Inhibitors: Glucotoxicity and Tumorigenesis Downstream the Renal Proximal Tubule?
Bertinat, Romina; Nualart, Francisco; Yáñez, Alejandro J
2016-08-01
At present, diabetes mellitus is the main cause of end-stage renal disease. Effective glycaemic management is the most powerful tool to delay the establishment of diabetic complications, such as diabetic kidney disease. Together with reducing blood glucose levels, new anti-diabetic agents are expected not only to control the progression but also to restore known defects of the diabetic kidney. Sodium-glucose co-transporter 2 (SGLT2) inhibitors are promising anti-diabetic agents that reduce hyperglycaemia by impairing glucose reabsorption in proximal tubule of the kidney and increasing glucosuria. SGLT2 inhibitors have shown to reduce glucotoxicity in isolated proximal tubule cells and also to attenuate expression of markers of overall kidney damage in experimental animal models of diabetes, but the actual renoprotective effect for downstream nephron segments is still unknown and deserves further attention. Here, we briefly discuss possible undesired effects of enhanced glucosuria and albuminuria in nephron segments beyond the proximal tubule after SGLT2 inhibitor treatment, offering new lines of research to further understand the renoprotective action of these anti-diabetic agents. Strategies blocking glucose reabsorption by renal proximal tubule epithelial cells (RPTEC) may be protective for RPTEC, but downstream nephron segments will still be exposed to high glucose and albumin levels through the luminal face. The actual effect of constant enhanced glucosuria over distal nephron segments remains to be established. J. Cell. Physiol. 231: 1635-1637, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Fazioli, R.; Quaglino, S.; Di Domenico, M.
2000-01-01
The opening of the italian gas market , due to the privatisation and liberalisation process, has been implemented by the important normative evolution of this sector both at european and national level. The debate following this process in the gas market has focussed, basically, on the up-stream sector leaving aside the important down-stream sector also concerning gas local distribution and sales. In this article it is paid more attention to the down-stream sector considering the firms' evolution from a basic mono utility to multi utility and multi services organisational structure. This potential firms' evolution in the italian gas market will be considered also referring to specific international experience in this market [it
Hayes, Maria; Tiwari, Brijesh K
2015-09-17
Bioactive peptides and carbohydrates are sourced from a myriad of plant, animal and insects and have huge potential for use as food ingredients and pharmaceuticals. However, downstream processing bottlenecks hinder the potential use of these natural bioactive compounds and add cost to production processes. This review discusses the health benefits and bioactivities associated with peptides and carbohydrates of natural origin and downstream processing methodologies and novel processes which may be used to overcome these.
Coarse and fine sediment transportation patterns and causes downstream of the Three Gorges Dam
Li, Songzhe; Yang, Yunping; Zhang, Mingjin; Sun, Zhaohua; Zhu, Lingling; You, Xingying; Li, Kanyu
2017-11-01
Reservoir construction within a basin affects the process of water and sediment transport downstream of the dam. The Three Gorges Reservoir (TGR) affects the sediment transport downstream of the dam. The impoundment of the TGR reduced total downstream sediment. The sediment group d≤0.125 mm (fine particle) increased along the path, but the average was still below what existed before the reservoir impoundment. The sediments group d>0.125 mm (coarse particle) was recharged in the Yichang to Jianli reach, but showed a deposition trend downstream of Jianli. The coarse sediment in the Yichang to Jianli section in 2003 to 2007 was above the value before the TGR impoundment. However, the increase of both coarse and fine sediments in 2008 to 2014 was less than that in 2003 to 2007. The sediment retained in the dam is the major reason for the sediment reduction downstream. However, the retention in different river reaches is affected by riverbed coarsening, discharge, flow process, and conditions of lake functioning and recharging from the tributaries. The main conclusions derived from our study are as follows: 1) The riverbed in the Yichang to Shashi section was relatively coarse, thereby limiting the supply of fine and coarse sediments. The fine sediment supply was mainly controlled by TGR discharge, whereas the coarse sediment supply was controlled by the duration of high flow and its magnitude. 2) The supply of both coarse and fine sediments in the Shashi to Jianli section was controlled by the amount of total discharge. The sediment supply from the riverbed was higher in flood years than that in the dry years. The coarse sediment tended to deposit, and the deposition in the dry years was larger than that in the flood years. 3) The feeding of the fine sediment in the Luoshan to Hankou section was mainly from the riverbed. The supply in 2008 to 2014 was more than that in 2003 to 2007. Around 2010, the coarse sediments transited from depositing to scouring that was
Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon
2013-06-01
Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.
Husson, Steven J.; Costa, Wagner Steuer; Wabnig, Sebastian; Stirman, Jeffrey N.; Watson, Joseph D.; Spencer, W. Clay; Akerboom, Jasper; Looger, Loren L.; Treinin, Millet; Miller, David M.; Lu, Hang; Gottschalk, Alexander
2012-01-01
Summary Background Nociception generally evokes rapid withdrawal behavior in order to protect the tissue from harmful insults. Most nociceptive neurons responding to mechanical insults display highly branched dendrites, an anatomy shared by Caenorhabditis elegans FLP and PVD neurons, which mediate harsh touch responses. Although several primary molecular nociceptive sensors have been characterized, less is known about modulation and amplification of noxious signals within nociceptor neurons. First, we analyzed the FLP/PVD network by optogenetics and studied integration of signals from these cells in downstream interneurons. Second, we investigated which genes modulate PVD function, based on prior single neuron mRNA profiling of PVD. Results Selectively photoactivating PVD, FLP and downstream interneurons using Channelrhodopsin-2 (ChR2) enabled functionally dissecting this nociceptive network, without interfering signals by other mechanoreceptors. Forward or reverse escape behaviors were determined by PVD and FLP, via integration by command interneurons. To identify mediators of PVD function, acting downstream of primary nocisensor molecules, we knocked down PVD-specific transcripts by RNAi and quantified light-evoked PVD-dependent behavior. Cell-specific disruption of synaptobrevin or voltage-gated Ca2+-channels (VGCCs) showed that PVD signals chemically to command interneurons. Knocking down the DEG/ENaC channel ASIC-1 and the TRPM channel GTL-1 indicated that ASIC-1 may extend PVD’s dynamic range and that GTL-1 may amplify its signals. These channels act cell-autonomously in PVD, downstream of primary mechanosensory molecules. Conclusions Our work implicates TRPM channels in modifying excitability of, and DEG/ENaCs in potentiating signal output from a mechano-nociceptor neuron. ASIC-1 and GTL-1 homologues, if functionally conserved, may denote valid targets for novel analgesics. PMID:22483941
Ji, Xiaoyu; Liu, Guifeng; Liu, Yujia; Zheng, Lei; Nie, Xianguang; Wang, Yucheng
2013-10-04
Tamarix spp. are woody halophyte, which are very tolerant to abiotic stresses such as salinity and drought, but little is known about their specific stress response systems. Basic leucine zipper proteins (bZIPs) play important roles in the ability of plants to withstand adverse environmental conditions. However, their exact roles in abiotic stress tolerance are still not fully known. In the current study, we functionally characterized a bZIP gene (ThbZIP1) from Tamarix hispida in response to abiotic stresses. We addressed the regulatory network of ThbZIP1 in three levels, i.e. its upstream regulators, the cis-acting elements recognized by ThbZIP1, and its downstream target genes. Two MYCs were found to bind to E-box, in the promoter of ThbZIP1 to activate its expression. Expression of ThbZIP1 is induced by ABA, salt, drought, methyl viologen and cold. ThbZIP1 can specifically bind to ACGT elements, with the highest binding affinity to the C-box, followed by the G-box and lastly the A-box. Compared with wild-type (Col-0) Arabidopsis, transgenic plants expressing ThbZIP1 had an increased tolerance to drought and salt, but had an increased sensitivity to ABA during seed germination and root growth; meanwhile, ROS level, cell death and water loss rate in transgenic plants were significantly reduced. Microarray analyses showed that many ROS scavenging genes were up-regulated by ThbZIP1 under salt stress conditions. Based on these data, we suggest that ThbZIP1 confers abiotic stress tolerance through activating stress tolerance genes to modulate ROS scavenging ability and other physiological changes involved in stress tolerance, and plays an important role in the ABA-mediated stress response of T. hispida.
The transcriptional repressor DREAM is involved in thyroid gene expression
International Nuclear Information System (INIS)
D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella
2005-01-01
Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca 2+ interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function
Directory of Open Access Journals (Sweden)
Stephan eMeinke
2013-01-01
Full Text Available 2B4 (CD244 and NK-T-B-antigen (NTB-A, CD352 are activating receptors on human NK cells and belong to the family of SLAM-related receptors. Engagement of these receptors leads to phosphorylation of their cytoplasmic tails and recruitment of the adapter proteins SAP and EAT-2. X-linked lymphoproliferative syndrome (XLP is a severe immunodeficiency that results from mutations in the SAP gene. 2B4 and NTB-A-mediated cytotoxicity are abrogated in XLP NK cells. To elucidate the molecular basis for this defect we analyzed early signaling events in SAP knockdown cells. Similar to XLP NK cells, knockdown of SAP in primary human NK cells leads to a reduction of 2B4 and NTB-A-mediated cytotoxicity. We found that early signaling events such as raft recruitment and receptor phosphorylation are not affected by the absence of SAP, indicating the defect in the absence of SAP is downstream of these events. In addition, knockdown of EAT-2 does not impair 2B4 or NTB-A-mediated cytotoxicity. Surprisingly, EAT-2 recruitment to both receptors is abrogated in the absence of SAP, revealing a novel cooperativity between these adapters.
Adams, L. E.; Lund, J. R.; Moyle, P. B.; Quiñones, R. M.; Herman, J. D.; O'Rear, T. A.
2017-09-01
Building reservoir release schedules to manage engineered river systems can involve costly trade-offs between storing and releasing water. As a result, the design of release schedules requires metrics that quantify the benefit and damages created by releases to the downstream ecosystem. Such metrics should support making operational decisions under uncertain hydrologic conditions, including drought and flood seasons. This study addresses this need and develops a reservoir operation rule structure and method to maximize downstream environmental benefit while meeting human water demands. The result is a general approach for hedging downstream environmental objectives. A multistage stochastic mixed-integer nonlinear program with Markov Chains, identifies optimal "environmental hedging," releases to maximize environmental benefits subject to probabilistic seasonal hydrologic conditions, current, past, and future environmental demand, human water supply needs, infrastructure limitations, population dynamics, drought storage protection, and the river's carrying capacity. Environmental hedging "hedges bets" for drought by reducing releases for fish, sometimes intentionally killing some fish early to reduce the likelihood of large fish kills and storage crises later. This approach is applied to Folsom reservoir in California to support survival of fall-run Chinook salmon in the lower American River for a range of carryover and initial storage cases. Benefit is measured in terms of fish survival; maintaining self-sustaining native fish populations is a significant indicator of ecosystem function. Environmental hedging meets human demand and outperforms other operating rules, including the current Folsom operating strategy, based on metrics of fish extirpation and water supply reliability.
Shi, Huaiping; Zhang, Tianying; Yi, Yongqing; Ma, Yue
2016-06-01
Although previous studies have shown that Ras-ERK signaling in mitosis is closed due to the inhibition of signal transduction, the events involved in the molecular mechanisms are still unclear. In the present study, we investigated the Ras-ERK signaling pathway in mitotic COS7 cells. The results demonstrated that treatment with epidermal growth factor (EGF) failed to increase the endocytosis of EGF-EGFR (EGF receptor) complexes in mitotic COS7 cells, although a large amount of endosomes were found in asynchronous COS7 cells. Clathrin expression levels in mitotic COS7 cells were inhibited whereas caveolin expression levels in mitotic COS7 cells were almost unaffected. Y1068 and Y1086 residues of EGFR in the mitotic COS7 cells were activated. However, Grb2 and Shc in the mitotic COS7 cells did not bind to activated EGFR. Ras activity was inhibited in the mitotic COS7 cells whereas its downstream protein, Raf, was obviously phosphorylated by EGF in mitosis. Treatment with phorbol 12-myristate 13-acetate (PMA) also increased the phosphorylation levels of Raf in the mitotic COS7 cells. Nevertheless, Raf phosphorylation in mitosis was significantly inhibited by AG1478. Lastly, activation of EGF-mediated MEK and ERK in the mitotic COS7 cells was obviously inhibited. In summary, our results suggest that the Ras-ERK pathway is inhibited in mitotic COS7 cells which may be the dual result of the difficulty in the transduction of EGF signaling by EGFR or Raf to downstream proteins.
Qu, Aifang; Xiang, Wei
2018-05-01
In this paper, we study the stability of the three-dimensional jet created by a supersonic flow past a concave cornered wedge with the lower pressure at the downstream. The gas beyond the jet boundary is assumed to be static. It can be formulated as a nonlinear hyperbolic free boundary problem in a cornered domain with two characteristic free boundaries of different types: one is the rarefaction wave, while the other one is the contact discontinuity, which can be either a vortex sheet or an entropy wave. A more delicate argument is developed to establish the existence and stability of the square jet structure under the perturbation of the supersonic incoming flow and the pressure at the downstream. The methods and techniques developed here are also helpful for other problems involving similar difficulties.
Mingoia, Marina; Morici, Eleonora; Marini, Emanuela; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E
2016-03-01
The objective of this study was to investigate macrolide-resistant Streptococcus agalactiae isolates harbouring erm(TR), an erm(A) gene subclass, with emphasis on their erm(TR)-carrying genetic elements. Four erm(TR)-carrying elements have been described to date: three closely related (ICE10750-RD.2, Tn1806 and ICESp1108) in Streptococcus pyogenes, Streptococcus pneumoniae and S. pyogenes, respectively; and one completely different (IMESp2907, embedded in ICESp2906 to form ICESp2905) in S. pyogenes. Seventeen macrolide-resistant erm(TR)-positive S. agalactiae isolates were phenotypically and genotypically characterized. Their erm(TR)-carrying elements were explored by analysing the distinctive recombination genes of known erm(TR)-carrying integrative and conjugative elements (ICEs) and by PCR mapping. The new genetic context and organization of IMESp2907 in S. agalactiae were explored using several experimental procedures and in silico analyses. Five isolates harboured ICE10750-RD.2/Tn1806, five isolates harboured ICESp1108 and five isolates bore unknown erm(TR)-carrying elements. The remaining two isolates, exhibiting identical serotypes and pulsotypes, harboured IMESp2907 in a new genetic environment, which was further investigated in one of the two isolates, SagTR7. IMESp2907 was circularizable in S. agalactiae, as described in S. pyogenes. The new IMESp2907 junctions were identified based on its site-specific integration; the att sites were almost identical to those in S. pyogenes. In strain SagTR7, erm(TR)-carrying IMESp2907 was embedded in an erm(TR)-less internal element related to ICE10750-RD.2/Tn1806, which, in turn, was embedded in an ICESde3396-like element. The resulting whole ICE, ICESagTR7 (∼129 kb), was integrated into the chromosome downstream of the rplL gene, and was excisable in circular form and transferable by conjugation. This is the first study exploring erm(TR)-carrying genetic elements in S. agalactiae. © The Author 2015. Published by
Operating multireservoir hydropower systems for downstream water quality
International Nuclear Information System (INIS)
Hayes, D.F.
1990-01-01
Hydropower reservoir operations often impact tailwater quality and water quality in the stream or river below the impoundment for many miles. Determining optimal operating strategies for a system of hydropower reservoirs involves solving a highly dimensional nonlinear, nonconvex optimization problem. This research adds the additional complexities of downstream water quality considerations within the optimization formulation to determine operating strategies for a system of hydropower reservoirs operating in series (tandem) or parallel. The formulation was used to determine operating strategies for six reservoirs of the upper Cumberland river basin in Tennessee and Kentucky. Significant dissolved oxygen (DO) violations occur just upstream of Nashville, Tennessee below Old Hickory dam during the months of August and September. Daily reservoir releases were determined for the period of June through September which would produce the maximum hydropower revenue while meeting downstream water quality objectives. Optimal releases for three operational strategies were compared to historical operations for the years 1985, 1986, and 1988. These strategies included: spilling as necessary to meet water quality criteria, near normal operation (minimal spills), and drawdown of reservoirs as necessary to meet criteria without spills. Optimization results showed an 8% to 15% hydropower loss may be necessary to meet water quality criteria through spills and a 2% to 9% improvement in DO below Old Hickory may be possible without significant spills. Results also showed that substantial increases in initial headwater elevations would be necessary to meet daily DO criteria and avoid spills. The optimal control theory algorithm used to solve the problem proved to be an efficient and robust solver of this large optimization problem
Downstream cumulative effects of land use on freshwater communities
Kuglerová, L.; Kielstra, B. W.; Moore, D.; Richardson, J. S.
2015-12-01
Many streams and rivers are subject to disturbance from intense land use such as urbanization and agriculture, and this is especially obvious for small headwaters. Streams are spatially organized into networks where headwaters represent the tributaries and provide water, nutrients, and organic material to the main stems. Therefore perturbations within the headwaters might be cumulatively carried on downstream. Although we know that the disturbance of headwaters in urban and agricultural landscapes poses threats to downstream river reaches, the magnitude and severity of these changes for ecological communities is less known. We studied stream networks along a gradient of disturbance connected to land use intensity, from urbanized watersheds to watersheds placed in agricultural settings in the Greater Toronto Area. Further, we compared the patterns and processes found in the modified watershed to a control watershed, situated in a forested, less impacted landscape. Preliminary results suggest that hydrological modifications (flash floods), habitat loss (drainage and sewer systems), and water quality issues of small streams in urbanized and agricultural watersheds represent major disturbances and threats for aquatic and riparian biota on local as well as larger spatial scales. For example, communities of riparian plants are dominated by species typical of the land use on adjacent uplands as well as the dominant land use on the upstream contributing area, instead of riparian obligates commonly found in forested watersheds. Further, riparian communities in disturbed environments are dominated by invasive species. The changes in riparian communities are vital for various functions of riparian vegetation. Bank erosion control is suppressed, leading to severe channel transformations and sediment loadings in urbanized watersheds. Food sources for instream biota and thermal regimes are also changed, which further triggers alterations of in-stream biological communities
Influence of Copper Ore Comminution in HPGR on Downstream Minerallurgical Processes
Directory of Open Access Journals (Sweden)
Saramak D.
2017-09-01
Full Text Available Crushing processes taking place in high-pressure grinding rolls devices (HPGR are currently one of the most efficient methods of hard ore size reduction in terms of the energy consumption. The HPGR products are characterized by a fine particle size and the micro-cracks formation in individual particles, which appears in downstream grinding processes, decreasing their energy consumption. The purpose of the paper was to analyze the effectiveness of a ball mill grinding process and flotation operations depending on the changeable conditions of run of the HPGR crushing process. The research programme carried out included crushing tests in the laboratory scale HPGR device at various settings of the operating pressure volume and selected qualitative properties of the feed material (i.e. particle size distribution. On the basis of obtained results the models, defining the grinding process effectiveness as a function of changeable conditions of HPGR process run, were determined. Based on these models the optimal grinding time in a ball mill was specified which is, in turn, the basis for optimization of operation the technological comminution circuits for a given material type. The obtained results proved that the application of HPGR devices in given copper ore comminution circuit may improve the effectiveness of downstream grinding process what leads to improvement of the entire circuit work efficiency through decreasing the process energy consumption and enhancing the product size reduction.
Downstream process development in biotechnological itaconic acid manufacturing.
Magalhães, Antonio Irineudo; de Carvalho, Júlio Cesar; Medina, Jesus David Coral; Soccol, Carlos Ricardo
2017-01-01
Itaconic acid is a promising chemical that has a wide range of applications and can be obtained in large scale using fermentation processes. One of the most important uses of this biomonomer is the environmentally sustainable production of biopolymers. Separation of itaconic acid from the fermented broth has a considerable impact in the total production cost. Therefore, optimization and high efficiency downstream processes are technological challenges to make biorefineries sustainable and economically viable. This review describes the current state of the art in recovery and purification for itaconic acid production via bioprocesses. Previous studies on the separation of itaconic acid relying on operations such as crystallization, precipitation, extraction, electrodialysis, diafiltration, pertraction, and adsorption. Although crystallization is a typical method of itaconic acid separation from fermented broth, other methods such as membrane separation and reactive extraction are promising as a recovery steps coupled to the fermentation, potentially enhancing the overall process yield. Another approach is adsorption in fixed bed columns, which efficiently separates itaconic acid. Despite recent advances in separation and recovery methods, there is still space for improvement in IA recovery and purification.
Major and trace elements in sediments of the upper course of Lerma river
International Nuclear Information System (INIS)
Tejeda, S.; Zarazua-Ortega, G.; Avila-Perez, P.; Garcia-Mejia, A.; Carapia-Morales, L.; Diaz-Delgado
2006-01-01
The Lerma is one of the most important rivers of Mexico, where it drains highly populated and industrialized regions. The concentration of six major and trace elements: titanium, manganese, iron, zinc, copper and lead in the surface sediments of the upper course of Lerma river was investigated, in order to identify its distribution along the river and to recognize the principal sites of pollution. The surface sediment samples were collected at 8 sites distributed following the stream flow direction of the river. Major and trace elements concentrations were determined by energy dispersive X-ray spectrometry. The results show that the metal concentrations in the sediments decrease in the sequence: Fe > Ti > Mn > Zn > Cu > Pb. Concentration of Fe, Mn and Ti were significantly higher than the other metals in site 8,200 meters downstream the Alzate Dam. The high concentrations and spatial variations of Zn, Cu and Pb in the middle sites of the upper course of the Lerma River indicate that the river pollution is probably associated with urban and industrial discharges. (author)
International Nuclear Information System (INIS)
Zhang, Zheng; Jin, Bo; Jin, Yaqiong; Huang, Shengquan; Niu, Xiaohua; Mao, Zebin; Xin, Dianqi
2017-01-01
Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that the PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.
Kedia, Kushal S.; Ghoniem, Ahmed F.
2012-01-01
The objective of this work is to investigate the flame stabilization mechanism and the conditions leading to the blowoff of a laminar premixed flame anchored downstream of a heat-conducting perforated-plate/multi-hole burner, with overall nearly
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
International Nuclear Information System (INIS)
Mori, Shoji; Tominaga, Akira; Fukano, Tohru
2007-01-01
If a flow obstacle, such as a spacer is placed in a boiling two-phase flow within a channel, the temperature on the surface of the heating tube is severely affected by the existence of the spacer. Under certain conditions, a spacer has a cooling effect, and under other conditions, the spacer causes dryout of the cooling water film on the heating surface. The burnout mechanism, which always occurs upstream of a spacer, however, remains unclear. In a previous paper [Fukano, T., Mori, S., Akamatsu, S., Baba, A., 2002. Relation between temperature fluctuation of a heating surface and generation of drypatch caused by a cylindrical spacer in a vertical boiling two-phase upward flow in a narrow annular channel. Nucl. Eng. Des. 217, 81-90], we reported that the disturbance wave has a significant effect on dryout and burnout occurrence and that a spacer greatly affects the behavior of the liquid film downstream of the spacer. In the present study, we examined in detail the influences of a spacer on the heat transfer and film thickness characteristics downstream of the spacer by considering the result in steam-water and air-water systems. The main results are summarized as follows: (1)The spacer averages the liquid film in the disturbance wave flow. As a result, dryout tends not to occur downstream of the spacer. This means that large temperature increases do not occur there. However, traces of disturbance waves remain, even if the disturbance waves are averaged by the spacer. (2)There is a high probability that the location at which burnout occurs is upstream of the downstream spacer, irrespective of the spacer spacing. (3)The newly proposed burnout occurrence model can explain the phenomena that burnout does occur upstream of the downstream spacer, even if the liquid film thickness t Fm is approximately the same before and behind the spacer
Energy Technology Data Exchange (ETDEWEB)
Mori, Shoji [Yokohama National University, Yokohama 240-8501 (Japan)], E-mail: morisho@ynu.ac.jp; Tominaga, Akira [Ube National College of Technology, Ube 755-8555 (Japan)], E-mail: tominaga@ube-k.ac.jp; Fukano, Tohru [Kurume Institute of University, Fukuoka 830-0052 (Japan)], E-mail: fukanot@cc.kurume-it.ac.jp
2007-12-15
If a flow obstacle, such as a spacer is placed in a boiling two-phase flow within a channel, the temperature on the surface of the heating tube is severely affected by the existence of the spacer. Under certain conditions, a spacer has a cooling effect, and under other conditions, the spacer causes dryout of the cooling water film on the heating surface. The burnout mechanism, which always occurs upstream of a spacer, however, remains unclear. In a previous paper [Fukano, T., Mori, S., Akamatsu, S., Baba, A., 2002. Relation between temperature fluctuation of a heating surface and generation of drypatch caused by a cylindrical spacer in a vertical boiling two-phase upward flow in a narrow annular channel. Nucl. Eng. Des. 217, 81-90], we reported that the disturbance wave has a significant effect on dryout and burnout occurrence and that a spacer greatly affects the behavior of the liquid film downstream of the spacer. In the present study, we examined in detail the influences of a spacer on the heat transfer and film thickness characteristics downstream of the spacer by considering the result in steam-water and air-water systems. The main results are summarized as follows: (1)The spacer averages the liquid film in the disturbance wave flow. As a result, dryout tends not to occur downstream of the spacer. This means that large temperature increases do not occur there. However, traces of disturbance waves remain, even if the disturbance waves are averaged by the spacer. (2)There is a high probability that the location at which burnout occurs is upstream of the downstream spacer, irrespective of the spacer spacing. (3)The newly proposed burnout occurrence model can explain the phenomena that burnout does occur upstream of the downstream spacer, even if the liquid film thickness t{sub Fm} is approximately the same before and behind the spacer.
Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E
2006-10-01
Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.
The brassinosteroid receptor BRI1 can generate cGMP enabling cGMP-dependent downstream signaling
Wheeler, Janet I.
2017-05-08
The brassinosteroid receptor BRASSINOSTEROID INSENSITIVE 1 (BRI1) is a member of the leucine rich repeat receptor like kinase family. The intracellular kinase domain of BRI1 is an active kinase and also encapsulates a guanylate cyclase catalytic centre. Using liquid chromatography tandem mass spectrometry, we confirmed that the recombinant cytoplasmic domain of BRI1 generates pmol amounts of cGMP per μg protein with a preference for magnesium over manganese as a co-factor. Importantly, a functional BRI1 kinase is essential for optimal cGMP generation. Therefore, the guanylate cyclase activity of BRI1 is modulated by the kinase while cGMP, the product of the guanylate cyclase, in turn inhibits BRI1 kinase activity. Furthermore, we show using Arabidopsis root cell cultures that cGMP rapidly potentiates phosphorylation of the downstream substrate BRASSINOSTEROID SIGNALING KINASE 1 (BSK1). Taken together, our results suggest that cGMP acts as a modulator that enhances downstream signaling while dampening signal generation from the receptor. This article is protected by copyright. All rights reserved.
International Nuclear Information System (INIS)
Chen Jiansheng; Fan Zhechao; Gu Weizu; Zhao Xia; Wang Jiyang
2003-01-01
In the paper, the sources of spring water and well water of Qilian Mountain's north side, Longshou Mountain, Badain Jaran Desert, Gurinai, Guaizi Lake, and Ejina Basin are studied by the methods of environmental isotopes and water chemistry. The groundwater of downstream areas (such as Badain Jaran Desert) is found that it is recharged by the precipitation of Qilian Mountain, and the average recharge elevation is 3300 m. Lots of naked limestones layers exist at the mountaintop of Qilian Mountain. The snow water of Qilian Mountain melts and directly infiltrates into deep layer passing through karst stratum or Big Fault in Front of the Mountain, and directly recharges into Badain Jaran Desert and its downstream areas passing through Longshou Mountain. The calcareous cementation and travertine, found in the lakes of the desert, approve that the groundwater passed the limestone layer. Confined water recharges shallow aquifer by means of leakage. The groundwater recharge volume is six hundreds millions cubic meters per year by calculating the evaporation amount, and the age of confined groundwater is 20-30 years. (authors)
The brassinosteroid receptor BRI1 can generate cGMP enabling cGMP-dependent downstream signaling
Wheeler, Janet I.; Wong, Aloysius Tze; Marondedze, Claudius; Groen, Arnoud J.; Kwezi, Lusisizwe; Freihat, Lubna; Vyas, Jignesh; Raji, Misjudeen; Irving, Helen R.; Gehring, Christoph A
2017-01-01
The brassinosteroid receptor BRASSINOSTEROID INSENSITIVE 1 (BRI1) is a member of the leucine rich repeat receptor like kinase family. The intracellular kinase domain of BRI1 is an active kinase and also encapsulates a guanylate cyclase catalytic centre. Using liquid chromatography tandem mass spectrometry, we confirmed that the recombinant cytoplasmic domain of BRI1 generates pmol amounts of cGMP per μg protein with a preference for magnesium over manganese as a co-factor. Importantly, a functional BRI1 kinase is essential for optimal cGMP generation. Therefore, the guanylate cyclase activity of BRI1 is modulated by the kinase while cGMP, the product of the guanylate cyclase, in turn inhibits BRI1 kinase activity. Furthermore, we show using Arabidopsis root cell cultures that cGMP rapidly potentiates phosphorylation of the downstream substrate BRASSINOSTEROID SIGNALING KINASE 1 (BSK1). Taken together, our results suggest that cGMP acts as a modulator that enhances downstream signaling while dampening signal generation from the receptor. This article is protected by copyright. All rights reserved.
Pietrowski, D; Graw, J
1997-10-01
In a previous report we demonstrated the in vitro interaction of alpha-crystallin with an element downstream of the transcriptional initiation site (DOTIS) of the murine gamma E-crystallin promoter (Pietrowski et al., 1994, Gene 144, 171-178). The aim of the present study was to investigate the influence of phosphorylation on this particular interaction. We could demonstrate that the autophosphorylation of alpha-crystallin leads to a complete loss of interaction with the DOTIS element, however, PKA-dependent phosphorylation of alpha-crystallin is without effect on the interaction. It is hypothesized that the autophosphorylation of alpha-crystallin might be involved in regulatory mechanisms of the murine gamma D/E/F-crystallin gene expression.
Directory of Open Access Journals (Sweden)
C. F. Castro-Bolinaga
2015-03-01
Full Text Available This paper presents the preliminary results of a coupled modelling effort to study the fate of tailings (radioactive waste-by product downstream of the Coles Hill uranium deposit located in Virginia, USA. The implementation of the overall modelling process includes a one-dimensional hydraulic model to qualitatively characterize the sediment transport process under severe flooding conditions downstream of the potential mining site, a two-dimensional ANSYS Fluent model to simulate the release of tailings from a containment cell located partially above the local ground surface into the nearby streams, and a one-dimensional finite-volume sediment transport model to examine the propagation of a tailings sediment pulse in the river network located downstream. The findings of this investigation aim to assist in estimating the potential impacts that tailings would have if they were transported into rivers and reservoirs located downstream of the Coles Hill deposit that serve as municipal drinking water supplies.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Kern, Jordan D; Patino-Echeverri, Dalia; Characklis, Gregory W
2014-08-19
Due to their operational flexibility, hydroelectric dams are ideal candidates to compensate for the intermittency and unpredictability of wind energy production. However, more coordinated use of wind and hydropower resources may exacerbate the impacts dams have on downstream environmental flows, that is, the timing and magnitude of water flows needed to sustain river ecosystems. In this paper, we examine the effects of increased (i.e., 5%, 15%, and 25%) wind market penetration on prices for electricity and reserves, and assess the potential for altered price dynamics to disrupt reservoir release schedules at a hydroelectric dam and cause more variable and unpredictable hourly flow patterns (measured in terms of the Richards-Baker Flashiness (RBF) index). Results show that the greatest potential for wind energy to impact downstream flows occurs at high (∼25%) wind market penetration, when the dam sells more reserves in order to exploit spikes in real-time electricity prices caused by negative wind forecast errors. Nonetheless, compared to the initial impacts of dam construction (and the dam's subsequent operation as a peaking resource under baseline conditions) the marginal effects of any increased wind market penetration on downstream flows are found to be relatively minor.
Prototyping phase of the high heat flux scraper element of Wendelstein 7-X
Energy Technology Data Exchange (ETDEWEB)
Boscary, J., E-mail: jean.boscary@ipp.mpg.de [Max Planck Institute for Plasma Physics, Garching (Germany); Greuner, H. [Max Planck Institute for Plasma Physics, Garching (Germany); Ehrke, G. [Max Planck Institute for Plasma Physics, Greifswald (Germany); Böswirth, B.; Wang, Z. [Max Planck Institute for Plasma Physics, Garching (Germany); Clark, E. [University of Tennessee, Knoxville (United States); Lumsdaine, A. [Oak Ridge National Laboratory, USA National Laboratory, Oak Ridge, Tennessee (United States); Tretter, J. [Max Planck Institute for Plasma Physics, Garching (Germany); McGinnis, D.; Lore, J. [Oak Ridge National Laboratory, USA National Laboratory, Oak Ridge, Tennessee (United States); Ekici, K. [University of Tennessee, Knoxville (United States)
2016-11-01
Highlights: • Aim of scraper element: reduction of heat loads on high heat flux divertor ends. • Design: actively water-cooled for 20 MW/m{sup 2} local heat loads. • Technology: CFC NB31 monoblocks bonded by HIP to CuCrZr cooling tube. • Successful high heat flux testing up to 20 MW/m{sup 2}. - Abstract: The water-cooled high heat flux scraper element aims to reduce excessive heat loads on the target element ends of the actively cooled divertor of Wendelstein 7-X. Its purpose is to intercept some of the plasma fluxes both upstream and downstream before they reach the divertor surface. The scraper element has 24 identical plasma facing components (PFCs) divided into 6 modules. One module has 4 PFCs hydraulically connected in series by 2 water boxes. A PFC, 247 mm long and 28 mm wide, has 13 monoblocks made of CFC NB31 bonded by hot isostatic pressing onto a CuCrZr cooling tube equipped with a copper twisted tape. 4 full-scale prototypes of PFCs have been successfully tested in the GLADIS facility up to 20 MW/m{sup 2}. The difference observed between measured and calculated surface temperatures is probably due to the inhomogeneity of CFC properties. The design of the water box prototypes has been detailed to allow the junction between the cooling pipe of the PFCs and the water boxes by internal orbital welding. The prototypes are presently under fabrication.
Palstra, A.P.; Guerrero, M.A.; Klein Breteler, J.G.P.; Thillart, G.E.E.J.M.
2011-01-01
The onset of downstream migration of European eels is accompanied by a cessation of feeding and the start of sexual maturation which stresses the link between metabolism and sexual maturation, also suggesting an important role for exercise. Exercise has been tested with eels in swim tunnels and was
Headwater Stream Management Dichotomies: Local Amphibian Habitat vs. Downstream Fish Habitat
Jackson, C. R.
2002-12-01
Small headwater streams in mountainous areas of the Pacific Northwest often do not harbor fish populations because of low water depth and high gradients. Rather, these streams provide habitat for dense assemblages of stream-dwelling amphibians. A variety of management goals have been suggested for such streams such as encouraging large woody debris recruitment to assist in sediment trapping and valley floor formation, encouraging large woody debris recruitment to provide downstream wood when debris flows occur, providing continuous linear stream buffers within forest harvest areas to provide shade and bank stability, etc. A basic problem with analying the geomorphic or biotic benefits of any of these strategies is the lack of explicit management goals for such streams. Should managers strive to optimize downstream fish habitat, local amphibian habitat, or both? Through observational data and theoretical considerations, it will be shown that these biotic goals will lead to very different geomorphic management recommendations. For instance, woody debris greater than 60 cm diameter may assist in valley floor development, but it is likely to create subsurface channel flow of unknown value to amphibians. Trapping and retention of fine sediments within headwater streams may improve downstream spawning gravels, but degrades stream-dwelling amphibian habitat. In response to the need for descriptive information on habitat and channel morphology specific to small, non-fish-bearing streams in the Pacific Northwest, morphologies and wood frequencies in forty-two first- and second-order forested streams less than four meters wide were surveyed. Frequencies and size distributions of woody debris were compared between small streams and larger fish-bearing streams as well as between second-growth and virgin timber streams. Statistical models were developed to explore dominant factors affecting channel morphology and habitat. Findings suggest geomorphological relationships
Energy Technology Data Exchange (ETDEWEB)
Fazioli, R. [Ferrara Univ., Ferrara (Italy); Quaglino, S. [Cap Gemini Ernst and Young, Energy Division, Milan (Italy); Di Domenico, M. [Milan Bocconi Univ., Milan (Italy). Istituto di Economia delle Fonti di Energia
2000-07-01
The opening of the italian gas market , due to the privatisation and liberalisation process, has been implemented by the important normative evolution of this sector both at european and national level. The debate following this process in the gas market has focussed, basically, on the up-stream sector leaving aside the important down-stream sector also concerning gas local distribution and sales. In this article it is paid more attention to the down-stream sector considering the firms' evolution from a basic mono utility to multi utility and multi services organisational structure. This potential firms' evolution in the italian gas market will be considered also referring to specific international experience in this market. [Italian] L'apertura del mercato italiano del gas naturale e' la conseguenza, principalmente, dei processi di privatizzazione e liberalizzazione che sono seguiti alla normativa europea e nazionale che disciplinano tale mercato. Il dibattito seguito a questo processo si e' essenzialmente focalizzato sul settore up-stream e poca attenzione e' stata invece rivolta all'importante settore down-stream, ossia la distribuzione locale e la vendita. Su tale settore si focalizza l'attenzione di questo articolo nell'intento di delineare i possibili scenari di sviluppo delle imprese operanti che, da una semplice strutura mono-utility, si evolvano verso una struttura multi-utility e multi-service.
Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny
2015-08-01
Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene
Barroso, Eva; Benito-Sanz, Sara; Belinchón, Alberta; Yuste-Checa, Patricia; Gracia, Ricardo; Aragones, Angel; Campos-Barros, Angel; Heath, Karen E
2010-01-01
Léri-Weill dyschondrosteosis (LWD, MIM 127300), is a dominantly inherited skeletal dysplasia with disproportionate short stature, mesomelic limb shortening, and the characteristic Madelung deformity. Two regions of the pseudoautosomal region 1 (PAR1) have been shown to be involved in LWD, SHOX (short-stature homeobox-containing gene) and the downstream enhancer region. We report our genetic findings of a young girl clinically diagnosed with LWD. We analyzed the proband and her family using MLPA and microsatellite analysis. We identified a deletion, 726-866 kb in size, of the downstream SHOX enhancer region in the proband. Neither parent carried the deletion. Microsatellite analysis showed that the deleted allele was of paternal origin. The mutation is more likely to have arisen from a de novo event but paternal gonadal mosaicism cannot be excluded. In conclusion, we report the clinical and molecular details of the first case of a de novo deletion of the downstream PAR1 region in an LWD individual. De novo deletions of SHOX and the downstream enhancer region must be therefore considered in cases of isolated LWD. Copyright 2010 Elsevier Masson SAS. All rights reserved.
Kwok, Karen Y; Yamazaki, Eriko; Yamashita, Nobuyoshi; Taniyasu, Sachi; Murphy, Margaret B; Horii, Yuichi; Petrick, Gert; Kallerborn, Roland; Kannan, Kurunthachalam; Murano, Kentaro; Lam, Paul K S
2013-03-01
Perfluoroalkyl substances (PFAS) have been globally detected in various environmental matrices, yet their fate and transport to the Arctic is still unclear, especially for the European Arctic. In this study, concentrations of 17 PFAS were quantified in two ice cores (n=26), surface snow (n=9) and surface water samples (n=14) collected along a spatial gradient in Svalbard, Norway. Concentrations of selected ions (Na(+), SO4(2-), etc.) were also determined for tracing the origins and sources of PFAS. Perfluorobutanoate (PFBA), perfluorooctanoate (PFOA) and perfluorononanoate (PFNA) were the dominant compounds found in ice core samples. Taking PFOA, PFNA and perfluorooctane-sulfonate (PFOS) as examples, higher concentrations were detected in the middle layers of the ice cores representing the period of 1997-2000. Lower concentrations of C8-C12 perfluorocarboxylates (PFCAs) were detected in comparison with concentrations measured previously in an ice core from the Canadian Arctic, indicating that contamination levels in the European Arctic are lower. Average PFAS concentrations were found to be lower in surface snow and melted glacier water samples, while increased concentrations were observed in river water downstream near the coastal area. Perfluorohexanesulfonate (PFHxS) was detected in the downstream locations, but not in the glacier, suggesting existence of local sources of this compound. Long-range atmospheric transport of PFAS was the major deposition pathway for the glaciers, while local sources (e.g., skiing activities) were identified in the downstream locations. Copyright © 2012 Elsevier B.V. All rights reserved.
Yeh, Chien-Hung; Wei, Liang-Yu; Chow, Chi-Wai
2017-11-20
In this work, we propose and demonstrate for the first time up to our knowledge, using a 682 nm visible vertical-cavity surface-emitting laser (VCSEL) applied in a bi-directional wavelength remodulated VLC system with a free space transmission distance of 3 m. To achieve a high VLC downstream traffic, spectral efficient orthogonal-frequency-division-multiplexing quadrature-amplitude-modulation (OFDM-QAM) with bit and power loading algorithms are applied on the VCSEL in the central office (CO). The OFDM downstream wavelength is remodulated by an acousto-optic modulator (AOM) with OOK modulation to produce the upstream traffic in the client side. Hence, only a single VCSEL laser is needed for the proposed bi-directional VLC system, achieving 10.6 Gbit/s OFDM downstream and 2 Mbit/s remodulated OOK upstream simultaneously. For the proposed system, as a single laser source with wavelength remodulation is used, the laser wavelength and temperature managements at the client side are not needed; and the whole system could be cost effective and energy efficient.
Numerical Simulations of Marine Hydrokinetic (MHK) Turbines Using the Blade Element Momentum Theory
Javaherchi, Teymour; Thulin, Oskar; Aliseda, Alberto
2011-11-01
Energy extraction from the available kinetic energy in tidal currents via Marine Hydrokinetic (MHK) turbines has recently attracted scientists' attention as a highly predictable source of renewable energy. The strongest tidal resources have a concentrated nature that require close turbine spacing in a farm of MHK turbines. This tight spacing, however, will lead to interaction of the downstream turbines with the turbulent wake generated by upstream turbines. This interaction can significantly reduce the power generated and possibly result in structural failure before the expected service life is completed. Development of a numerical methodology to study the turbine-wake interaction can provide a tool for optimization of turbine spacing to maximize the power generated in turbine arrays. In this work, we will present numerical simulations of the flow field in a farm of horizontal axis MHK turbines using the Blade Element Momentum Theory (BEMT). We compare the value of integral variables (i.e. efficiency, power, torque and etc.) calculated for each turbine in the farm for different arrangements with varying streamwise and lateral offsets between turbines. We find that BEMT provides accurate estimates of turbine efficiency under uniform flow conditions, but overpredicts the efficiency of downstream turbines when they are strongly affected by the wakes. Supported by DOE through the National Northwest Marine Renewable Energy Center.
DEFF Research Database (Denmark)
Harboe, Morten; Garred, Peter; Karlstrøm, Ellen
2009-01-01
Complement activation plays an important role in human pathophysiology. The effect of classical pathway activation is largely dependent on alternative pathway (AP) amplification, whereas the role of AP for the down-stream effect of mannan-induced lectin pathway (LP) activation is poorly understood...... that AP amplification is quantitatively responsible for the final effect of initial specific LP activation. TCC generation on the solid phase was distinctly but less inhibited by anti-fD. C2 bypass of the LP pathway could be demonstrated, and AP amplification was also essential during C2 bypass in LP...... as shown by complete inhibition of TCC generation in C2-deficient serum by anti-fD and anti-properdin antibodies. In conclusion, the down-stream effect of LP activation depends strongly on AP amplification in normal human serum and in the C2 bypass pathway....
Msx genes are important apoptosis effectors downstream of the Shh/Gli3 pathway in the limb.
Lallemand, Yvan; Bensoussan, Vardina; Cloment, Cécile Saint; Robert, Benoît
2009-07-15
In tetrapods, the anteroposterior (AP) patterning of the limb is under the control of the antagonistic activities of the secreted factor Sonic hedgehog (Shh) and Gli3R, the truncated repressor form of the transcription factor Gli3. In this report, we show that Msx1 and Msx2 are targets and downstream effectors of Gli3R. Consequently, in Shh null mutants, Msx genes are overexpressed and, furthermore, partially responsible for the limb phenotype. This is exemplified by the fact that reducing Msx activity in Shh mutants partially restores a normal limb development. Finally, we show that the main action of the Msx genes, in both normal and Shh(-/-) limb development, is to control cell death in the mesenchyme. We propose that, in the limb, Msx genes act downstream of the Shh/Gli3 pathway by transducing BMP signaling and that, in the absence of Shh signaling, their deregulation contributes to the extensive apoptosis that impairs limb development.
Sources for increased DOC-concentrations in the groundwater downstream of the landfill Hohne (DEA)
International Nuclear Information System (INIS)
Bahlmann, E.; Seifert, R.; Eschenbach, A.; Kleinschmidt, V.
2017-08-01
Construction waste together with drilling mud and oil-contaminated soil had been deposited in the landfill Hohne from 1971. Four groundwater monitoring sites had been installed: one monitoring site upstream and three sites downstream of the landfill in three different directions. Downstream of the landfill increased concentrations of chloride, sulphate, sodium and DOC (dissolved organic carbon) had been measured over a period of years. Particularly the source of the DOC has remained unclear. Assumptions were (i) leaking of contaminants from the landfill and degradation under the landfill by microbes or plants or (ii) leaching of DOC from the soil under the landfill caused by a change in the redox potential. The determination of the DOC source was the major subject of this study.
Energy Technology Data Exchange (ETDEWEB)
Tuovinen, Tiina S.; Roivainen, Paeivi, E-mail: paivi.roivainen@uef.fi; Makkonen, Sari; Kolehmainen, Mikko; Holopainen, Toini; Juutilainen, Jukka
2011-12-01
Element-specific concentration ratios (CRs) assuming that plant uptake of elements is linear are commonly used in radioecological modelling to describe the soil-to-plant transfer of elements. The goal of this study was to investigate the validity of the linearity assumption in boreal forest plants, for which only limited relevant data are available. The soil-to-plant transfer of three essential (Mo, Ni, Zn) and two non-essential (Pb, U) elements relevant to the safety of radioactive waste disposal was studied. Three understory species (blueberry, narrow buckler fern and May lily) and two tree species (Norway spruce and rowan) were included. Examining CRs as a function of soil concentration showed that CR was not constant but decreased with increasing soil concentrations for all elements and plant species. A non-linear equation fitted fairly well with the empirical data; the R{sup 2}-values for this equation were constantly higher than those for the linear fit. The difference between the two fits was most evident at low soil concentrations where the use of constant CRs underestimated transfer from soil to plants. Site-specific factors affected the transfer of Mo and Ni. The results suggested that systematic variation with soil concentrations explains a part of the large variation of empirically determined CRs, and the accuracy of modelling the soil-to-plant transfer might be improved by using non-linear methods. Non-linearity of soil-to-plant transfer has been previously reported for a few different species, elements and environments. The present study systematically tested the linearity assumption for five elements (both essential and non-essential) and in five boreal forest species representing different growth traits and phylogenies. The data supported non-linearity in all cases.
International Nuclear Information System (INIS)
Tuovinen, Tiina S.; Roivainen, Päivi; Makkonen, Sari; Kolehmainen, Mikko; Holopainen, Toini; Juutilainen, Jukka
2011-01-01
Element-specific concentration ratios (CRs) assuming that plant uptake of elements is linear are commonly used in radioecological modelling to describe the soil-to-plant transfer of elements. The goal of this study was to investigate the validity of the linearity assumption in boreal forest plants, for which only limited relevant data are available. The soil-to-plant transfer of three essential (Mo, Ni, Zn) and two non-essential (Pb, U) elements relevant to the safety of radioactive waste disposal was studied. Three understory species (blueberry, narrow buckler fern and May lily) and two tree species (Norway spruce and rowan) were included. Examining CRs as a function of soil concentration showed that CR was not constant but decreased with increasing soil concentrations for all elements and plant species. A non-linear equation fitted fairly well with the empirical data; the R 2 -values for this equation were constantly higher than those for the linear fit. The difference between the two fits was most evident at low soil concentrations where the use of constant CRs underestimated transfer from soil to plants. Site-specific factors affected the transfer of Mo and Ni. The results suggested that systematic variation with soil concentrations explains a part of the large variation of empirically determined CRs, and the accuracy of modelling the soil-to-plant transfer might be improved by using non-linear methods. Non-linearity of soil-to-plant transfer has been previously reported for a few different species, elements and environments. The present study systematically tested the linearity assumption for five elements (both essential and non-essential) and in five boreal forest species representing different growth traits and phylogenies. The data supported non-linearity in all cases.
Energy taxes and subsidies downstream: transparency and dissemination
International Nuclear Information System (INIS)
Aissaour, A.
2001-01-01
The reasons why governments levy taxes are discussed with special reference to the energy sector. The article focuses on the quantitative aspect of policies and gives a guide to the relevant statistical sources. It summarises the basis of taxes and subsidies and discusses the incidence of energy taxation together with the structure of taxes and subsidies in energy downstream. It reviews the main sources of data and issues highlighted by published statistics and the impact of taxes levied on the consumption of energy products and other taxes (e.g. VAT) which directly affect end-user prices. Production-based levies such as royalties, petroleum revenue taxes, windfall taxes and import and export taxes on fuels are not discussed. The paper is presented under the sub-headings of (i) theoretical foundations in a nutshell; (ii) the incidence of taxation; (iii) the structure and main features of energy taxation (iv) base rate and level of taxation (v) sources of data and methods and (vi) observability and comparability
Directory of Open Access Journals (Sweden)
Y. D. Chashechkin
2006-01-01
Full Text Available The flow of continuously stratified fluids past obstacles was studied analytically, numerically, and experimentally. The obstacles discussed here include a flat strip, aligned with the flow, inclined or transverse to the flow and a horizontal cylinder. In the flow pattern, transient and attached (lee internal waves, downstream wakes with submerged interfaces and vortices, soaring singular interfaces, soaring vortices and vortex systems are distinguished. New components of laminar flow past a horizontally towed strip are presented. Fine transverse streaky structures on the strip in the downstream wake were visualized. Soaring isolated interfaces, which are internal boundary layers forming inside the downstream attached wave field past bluff bodies were observed. With increasing of the body velocity a vortex pair was formed directly at the leading edge of this interface.
International Nuclear Information System (INIS)
Zheng Changyu; O'Connell, Brian C.; Baum, Bruce J.
2003-01-01
Classically, the 5' and 3' long terminal repeats (LTRs) are considered necessary but not sufficient for retroviral integration. Recently, we reported that inclusion of these and additional elements from Moloney murine leukemia virus (MoMLV) facilitated transgene integration, without retroviral integrase, when placed in an adenoviral context (AdLTR-luc vector) (Nat. Biotech. 18 (2000), 176; Biochem. Biophys. Res. Commun. 300 (2003), 115). To help understand this nonhomologous DNA recombination event, we constructed another vector, AdELP-luc, with 2.7 kb of MoMLV elements identically placed into an E1-deleted adenovirus type 5 backbone upstream of a luciferase cDNA reporter gene. Unlike AdLTR-luc, no MoMLV elements were placed downstream of the expression cassette. AdELP-luc readily infected epithelial cells in vitro. Southern hybridizations with DNA from cloned cells showed that disruption of the MoMLV sequences occurred. One cell clone, grown in vitro without any special selection medium for 9 months, exhibited stable vector integration and luciferase activity. Importantly, both Southern hybridization and FISH analyses showed that in addition to the MoMLV elements and expression cassette, substantial adenoviral sequence downstream of the luciferase cDNA was genomically integrated. These results suggest that the 2.7 kb of MoMLV sequence included in AdELP-luc have cis-acting functions and mediates an unusual integration event
Comparison of Flow Structures in the Downstream Region of a Cylinder with Flexible Strip
Directory of Open Access Journals (Sweden)
Tekşin Süleyman
2015-01-01
Full Text Available The present study investigates the details of flow structure to downstream of a circular cylinder mounted on a flat surface, in successive plan-view plane both in the boundary layer and up level region. The behavior of the flow in the wake of the bare cylinder and attached a flexible strip which has a 1400 N/mm2 modulus of elasticity vinyl PVC transperent film. The length of strip 240 mm (L/D=4 is investigated using Particle Image Velocimetry (PIV technique for Reynolds numbers based on the cylinder diameter of 2500. The flow data downstream of the cylinder are presented using time-averaged velocity vector map, Vavg, streamline patterns, ψavg, vorticity contours, ωavg, and Reynolds stress correlations, u’u’ avg, v’v’ avg, u’v’ avg and rms velocity values. The locations of the peak values of Reynolds stress correlations and other data are also presented in both bare cylinder and attached body in order to determine the regions under high fluctuations. Another L/D ratios will be investigated in other experiments.
Zou, Lin; Feng, Yan; Li, Yan; Zhang, Ming; Chen, Chan; Cai, Jiayan; Gong, Yu; Wang, Larry; Thurman, Joshua M.; Wu, Xiaobo; Atkinson, John P.; Chao, Wei
2013-01-01
Severe sepsis involves massive activation of the innate immune system and leads to high mortality. Previous studies have demonstrated that various types of Toll-like receptors (TLRs) mediate a systemic inflammatory response and contribute to organ injury and mortality in animal models of severe sepsis. However, the downstream mechanisms responsible for TLR-mediated septic injury are poorly understood. Here, we show that activation of TLR2, TLR3 and TLR4 markedly enhanced complement factor B (cfB) synthesis and release by macrophages and cardiac cells. Polymicrobial sepsis, created by cecal ligation and puncture (CLP) in a mouse model, augmented cfB levels in the serum, peritoneal cavity and major organs including the kidney and heart. CLP also led to the alternative pathway (AP) activation, C3 fragment deposition in the kidney and heart, and cfB-dependent C3dg elevation. Bacteria isolated from septic mice activated the serum AP via a factor D-dependent manner. MyD88 deletion attenuated cfB/C3 up-regulation as well as cleavage induced by polymicrobial infection. Importantly, during sepsis, absence of cfB conferred a protective effect with improved survival and cardiac function, and markedly attenuated acute kidney injury. cfB deletion also led to increased neutrophil migratory function during the early phase of sepsis, decreased local and systemic bacterial load, attenuated cytokine production and reduced neutrophil reactive oxygen species production. Together, our data indicate that cfB acts as a downstream effector of TLR signaling and plays a critical role in the pathogenesis of severe bacterial sepsis. PMID:24154627
Brucella microti sp. nov., isolated from the common vole Microtus arvalis.
Scholz, Holger C; Hubalek, Zdenek; Sedlácek, Ivo; Vergnaud, Gilles; Tomaso, Herbert; Al Dahouk, Sascha; Melzer, Falk; Kämpfer, Peter; Neubauer, Heinrich; Cloeckaert, Axel; Maquart, Marianne; Zygmunt, Michel S; Whatmore, Adrian M; Falsen, Enevold; Bahn, Peter; Göllner, Cornelia; Pfeffer, Martin; Huber, Birgit; Busse, Hans-Jürgen; Nöckler, Karsten
2008-02-01
Two Gram-negative, non-motile, non-spore-forming, coccoid bacteria (strains CCM 4915(T) and CCM 4916), isolated from clinical specimens of the common vole Microtus arvalis during an epizootic in the Czech Republic in 2001, were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA (rrs) and recA gene sequence similarities, both isolates were allocated to the genus Brucella. Affiliation to Brucella was confirmed by DNA-DNA hybridization studies. Both strains reacted equally with Brucella M-monospecific antiserum and were lysed by the bacteriophages Tb, Wb, F1 and F25. Biochemical profiling revealed a high degree of enzyme activity and metabolic capabilities not observed in other Brucella species. The omp2a and omp2b genes of isolates CCM 4915(T) and CCM 4916 were indistinguishable. Whereas omp2a was identical to omp2a of brucellae from certain pinniped marine mammals, omp2b clustered with omp2b of terrestrial brucellae. Analysis of the bp26 gene downstream region identified strains CCM 4915(T) and CCM 4916 as Brucella of terrestrial origin. Both strains harboured five to six copies of the insertion element IS711, displaying a unique banding pattern as determined by Southern blotting. In comparative multilocus VNTR (variable-number tandem-repeat) analysis (MLVA) with 296 different genotypes, the two isolates grouped together, but formed a separate cluster within the genus Brucella. Multilocus sequence typing (MLST) analysis using nine different loci also placed the two isolates separately from other brucellae. In the IS711-based AMOS PCR, a 1900 bp fragment was generated with the Brucella ovis-specific primers, revealing that the insertion element had integrated between a putative membrane protein and cboL, encoding a methyltransferase, an integration site not observed in other brucellae. Isolates CCM 4915(T) and CCM 4916 could be clearly distinguished from all known Brucella species and their biovars by means of both their phenotypic and molecular
Environmental considerations in energy planning for the Amazon region: Downstream effects of dams
International Nuclear Information System (INIS)
Manyari, Waleska Valenca; de Carvalho, Osmar Abilio
2007-01-01
The most salient current feature of the electric energy sector in Brazil is the pressing need for expansion. In this context, the hydroelectric resources of the Amazon region are considered a competitive alternative despite the structural problems they entail. These include reliance of new investments and environmental restrictions. Concerning the latter, plans to build large-scale dams in the region have drawn criticism mainly on account of the loss of forest cover in areas flooded by dam reservoirs and the conflicts concerning the relocation of indigenous and riverside communities in the region. This article seeks to contribute to better understanding of the environmental issue in the Amazon by focusing attention on the downstream effects of dams, which have large-scale, hitherto neglected ecological repercussions. The impact of dams extends well beyond the area surrounding the artificial lakes they create, harming rich Amazon wetland ecosystems. The morphology of dammed rivers changes in response to new inputs of energy and matter, which may in turn destroy certain biotopes. This is a remote-sensing-based case study of the Tucurui hydroelectric scheme in the Amazon state of Para. Attention is drawn to the need to take into account effects on alluvial rivers downstream from hydroelectric power plants when it comes to making planning decisions, as part of a sustainable energy policy
Shin, Yong; Lim, Swee Yin; Lee, Tae Yoon; Park, Mi Kyoung
2015-09-15
Sample processing, especially that involving nucleic acid extraction, is a prerequisite step for the isolation of high quantities of relatively pure DNA for downstream analyses in many life science and biomedical engineering studies. However, existing methods still have major problems, including labor-intensive time-consuming methods and high costs, as well as requirements for a centrifuge and the complex fabrication of filters and membranes. Here, we first report a versatile Dimethyl adipimidate/Thin film based Sample processing (DTS) procedure without the limitations of existing methods. This procedure is useful for the extraction of DNA from a variety of sources, including 6 eukaryotic cells, 6 bacteria cells, and 2 body fluids in a single step. Specifically, the DTS procedure does not require a centrifuge and has improved time efficiency (30 min), affordability, and sensitivity in downstream analysis. We validated the DTS procedure for the extraction of DNA from human body fluids, as well as confirmed that the quality and quantity of the extracted DNA were sufficient to allow robust detection of genetic and epigenetic biomarkers in downstream analysis.
Resolution of thermal striping issue downstream of a horizontal pipe elbow in stratified pipe flow
International Nuclear Information System (INIS)
Kuzay, T.M.; Kasza, K.E.
1985-01-01
A thermally stratified pipe flow produced by a thermal transient when passing through a horizontal elbow as a result of secondary flow gives rise to large thermal fluctuations on the inner curvature wall of the downstream piping. These fluctuations were measured in a specially instrumented horizontal pipe and elbow system on a test set-up using water in the Mixing Components Technology Facility (MCTF) at Argonne National Laboratory (ANL). This study is part of a larger program which is studying the influence of thermal buoyancy on general reactor component performance. This paper discusses the influence of pipe flow generated thermal oscillations on the thermal stresses induced in the pipe walls. The instrumentation was concentrated around the exit plane of the 90 0 sweep elbow, since prior tests had indicated that the largest thermal fluctuations would occur within about one hydraulic diameter downstream of the elbow exit. The thermocouples were located along the inner curvature of the piping and measured the near surface fluid temperature. The test matrix involved thermal downramps under turbulent flow conditions
Gellan Gum: Fermentative Production, Downstream Processing and Applications
Directory of Open Access Journals (Sweden)
Ishwar B. Bajaj
2007-01-01
Full Text Available The microbial exopolysaccharides are water-soluble polymers secreted by microorganisms during fermentation. The biopolymer gellan gum is a relatively recent addition to the family of microbial polysaccharides that is gaining much importance in food, pharmaceutical and chemical industries due to its novel properties. It is commercially produced by C. P. Kelco in Japan and the USA. Further research and development in biopolymer technology is expected to expand its use. This article presents a critical review of the available information on the gellan gum synthesized by Sphingomonas paucimobilis with special emphasis on its fermentative production and downstream processing. Rheological behaviour of fermentation broth during fermentative production of gellan gum and problems associated with mass transfer have been addressed. Information on the biosynthetic pathway of gellan gum, enzymes and precursors involved in gellan gum production and application of metabolic engineering for enhancement of yield of gellan gum has been specified. Characteristics of gellan gum with respect to its structure, physicochemical properties, rheology of its solutions and gel formation behaviour are discussed. An attempt has also been made to review the current and potential applications of gellan gum in food, pharmaceutical and other industries.
Downstream Processing of Synechocystis for Biofuel Production
Sheng, Jie
Lipids and free fatty acids (FFA) from cyanobacterium Synechocystis can be used for biofuel (e.g. biodiesel or renewable diesel) production. In order to utilize and scale up this technique, downstream processes including culturing and harvest, cell disruption, and extraction were studied. Several solvents/solvent systems were screened for lipid extraction from Synechocystis. Chloroform + methanol-based Folch and Bligh & Dyer methods were proved to be "gold standard" for small-scale analysis due to their highest lipid recoveries that were confirmed by their penetration of the cell membranes, higher polarity, and stronger interaction with hydrogen bonds. Less toxic solvents, such as methanol and MTBE, or direct transesterification of biomass (without preextraction step) gave only slightly lower lipid-extraction yields and can be considered for large-scale application. Sustained exposure to high and low temperature extremes severely lowered the biomass and lipid productivity. Temperature stress also triggered changes of lipid quality such as the degree of unsaturation; thus, it affected the productivities and quality of Synechocystis-derived biofuel. Pulsed electric field (PEF) was evaluated for cell disruption prior to lipid extraction. A treatment intensity > 35 kWh/m3 caused significant damage to the plasma membrane, cell wall, and thylakoid membrane, and it even led to complete disruption of some cells into fragments. Treatment by PEF enhanced the potential for the low-toxicity solvent isopropanol to access lipid molecules during subsequent solvent extraction, leading to lower usage of isopropanol for the same extraction efficiency. Other cell-disruption methods also were tested. Distinct disruption effects to the cell envelope, plasma membrane, and thylakoid membranes were observed that were related to extraction efficiency. Microwave and ultrasound had significant enhancement of lipid extraction. Autoclaving, ultrasound, and French press caused significant
Corrosion impact of reductant on DWPF and downstream facilities
Energy Technology Data Exchange (ETDEWEB)
Mickalonis, J. I. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Imrich, K. J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jantzen, C. M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Murphy, T. H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Wilderman, J. E. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2014-12-01
Glycolic acid is being evaluated as an alternate reductant in the preparation of high level waste for the Defense Waste Processing Facility (DWPF) at the Savannah River Site (SRS). During processing, the glycolic acid is not completely consumed and small quantities of the glycolate anion are carried forward to other high level waste (HLW) facilities. The impact of the glycolate anion on the corrosion of the materials of construction throughout the waste processing system has not been previously evaluated. A literature review had revealed that corrosion data in glycolate-bearing solution applicable to SRS systems were not available. Therefore, testing was recommended to evaluate the materials of construction of vessels, piping and components within DWPF and downstream facilities. The testing, conducted in non-radioactive simulants, consisted of both accelerated tests (electrochemical and hot-wall) with coupons in laboratory vessels and prototypical tests with coupons immersed in scale-up and mock-up test systems. Eight waste or process streams were identified in which the glycolate anion might impact the performance of the materials of construction. These streams were 70% glycolic acid (DWPF feed vessels and piping), SRAT/SME supernate (Chemical Processing Cell (CPC) vessels and piping), DWPF acidic recycle (DWPF condenser and recycle tanks and piping), basic concentrated recycle (HLW tanks, evaporators, and transfer lines), salt processing (ARP, MCU, and Saltstone tanks and piping), boric acid (MCU separators), and dilute waste (HLW evaporator condensate tanks and transfer line and ETF components). For each stream, high temperature limits and worst-case glycolate concentrations were identified for performing the recommended tests. Test solution chemistries were generally based on analytical results of actual waste samples taken from the various process facilities or of prototypical simulants produced in the laboratory. The materials of construction for most vessels
Contrasting morphodynamics in alluvial fans and fan deltas: effect of the downstream boundary
Dijk, M. van; Kleinhans, M.G.; Postma, G.; Kraal, E.
2012-01-01
Alluvial fans and fan deltas can, in principle, have exactly the same upstream conditions, but fan deltas by definition have ponding water at their downstream boundary. This ponding creates effects on the autogenic behaviour of fan deltas, such as backwater adaptation, mouth bars and backward
Van Leeuwen, C H A; Dokk, T; Haugen, T O; Kiffney, P M; Museth, J
2017-06-01
Behaviour of early life stages of the salmonid European grayling Thymallus thymallus was investigated by assessing the timing of larval downstream movement from spawning areas, the depth at which larvae moved and the distribution of juvenile fish during summer in two large connected river systems in Norway. Trapping of larvae moving downstream and electrofishing surveys revealed that T. thymallus larvae emerging from the spawning gravel moved downstream predominantly during the night, despite light levels sufficient for orientation in the high-latitude study area. Larvae moved in the water mostly at the bottom layer close to the substratum, while drifting debris was caught in all layers of the water column. Few young-of-the-year still resided close to the spawning areas in autumn, suggesting large-scale movement (several km). Together, these observations show that there may be a deliberate, active component to downstream movement of T. thymallus during early life stages. This research signifies the importance of longitudinal connectivity for T. thymallus in Nordic large river systems. Human alterations of flow regimes and the construction of reservoirs for hydropower may not only affect the movement of adult fish, but may already interfere with active movement behaviour of fish during early life stages. © 2017 The Fisheries Society of the British Isles.
Spatial patterns of some trace elements in four Swedish stream networks
Directory of Open Access Journals (Sweden)
J. Temnerud
2013-03-01
Full Text Available Four river basins in southern Sweden, with catchment sizes from 0.3 to 127 km2 (median 1.9, were sampled in October~2007. The 243 samples were analysed for 26 trace elements (Ag, As, Au, Ba, Be, Bi, Cd, Co, Cr, Cu, Ga, Ge, In, La, Li, Mo, Ni, Pb, Sb, Se, Sn, Tl, Ti, U, V and Zn to identify spatial patterns within drainage networks. The range and median of each element were defined for different stream orders, and relationships to catchment characteristics, including deposition history, were explored. The sampling design made it possible to compare the differences along 40 stream reaches, above and below 53 stream junctions with 107 tributaries and between the 77 inlets and outlets of 36 lakes. The largest concentration differences (at reaches, junctions and lakes were observed for lakes, with outlets usually having lower concentration compared to the inlets for As, Ba, Be, Bi, Cd, Co, Cr, Ga, Ge, Ni, Pb, Sn, Ti, Tl, U, V and Zn. Significantly lower concentrations were observed for Cd and Co when comparing headwaters with downstream sites in each catchment. Common factor analysis (FA revealed that As, Bi, Cr, Ga, Ge, Tl and V co-vary positively with Al, Fe and total organic carbon (TOC and negatively with La, Li and pH. The strong removal of a large number of trace elements when passing through lakes is evident though in the FA, where lake surface coverage plots opposite to many of those elements. Forest volume does not respond in a similar systematic fashion and, surprisingly, the amount of wetland does not relate strongly to either Fe or TOC at any of the rivers. A better understanding of the quantitative removal of organic carbon and iron will aid in understanding trace element fluxes from landscapes rich in organic matter and iron.
Directory of Open Access Journals (Sweden)
Tamás Juhász
Full Text Available Pituitary adenylate cyclase activating polypeptide (PACAP is an important neurotrophic factor influencing differentiation of neuronal elements and exerting protecting role during traumatic injuries or inflammatory processes of the central nervous system. Although increasing evidence is available on its presence and protecting function in various peripheral tissues, little is known about the role of PACAP in formation of skeletal components. To this end, we aimed to map elements of PACAP signalling in developing cartilage under physiological conditions and during oxidative stress. mRNAs of PACAP and its receptors (PAC1,VPAC1, VPAC2 were detectable during differentiation of chicken limb bud-derived chondrogenic cells in micromass cell cultures. Expression of PAC1 protein showed a peak on days of final commitment of chondrogenic cells. Administration of either the PAC1 receptor agonist PACAP 1-38, or PACAP 6-38 that is generally used as a PAC1 antagonist, augmented cartilage formation, stimulated cell proliferation and enhanced PAC1 and Sox9 protein expression. Both variants of PACAP elevated the protein expression and activity of the Ca-calmodulin dependent Ser/Thr protein phosphatase calcineurin. Application of PACAPs failed to rescue cartilage formation when the activity of calcineurin was pharmacologically inhibited with cyclosporine A. Moreover, exogenous PACAPs prevented diminishing of cartilage formation and decrease of calcineurin activity during oxidative stress. As an unexpected phenomenon, PACAP 6-38 elicited similar effects to those of PACAP 1-38, although to a different extent. On the basis of the above results, we propose calcineurin as a downstream target of PACAP signalling in differentiating chondrocytes either in normal or pathophysiological conditions. Our observations imply the therapeutical perspective that PACAP can be applied as a natural agent that may have protecting effect during joint inflammation and/or may promote
Downstream and upstream extension of the House of Quality
DEFF Research Database (Denmark)
Holmen, Elsebeth; Kristensen, Preben Sander
. The transformation processes and characteristics constituting this fan were based on the knowledge possessed by the company before entering into development interaction with suppliers. If it is these characteristics which are used to express the demands of the company in the subsequent interaction process, much......Executive summary 1. During 1993-94 the authors followed a product development process in a Danish butter cookie company. The process was structured according to the Quality Function Deployment technique House of Quality. Originally, the intention was to study the prototyping process that we...... a discussion in a diabetics end-user focus group. During a series of meetings, the production manager and the sales manager transformed attributes int characteristics and constructed Houses of Quality for a sugar-free cookie. 2. Downstream on its way to the end-user, the product passes through a chain of users...
International Nuclear Information System (INIS)
Matveyeva, I.; Burkitbayev, M.; Jacimovic, R.; Planinsek, P.; Smodis, B.; Stegnar, P.
2014-01-01
New data on the concentrations of the main gamma-emitting radionuclides, minor and trace elements, and isotopes of uranium (with Ra-226 as a daughter product of U-238) and thorium in soils and sediments of the Shu valley (from the river Chon-Kemin to the river Kuragatty downstream the river Shu) are presented, determined by high-resolution gamma-spectrometry, k 0 -instrumental neutron activation analysis and alpha-spectrometry with appropriate radiochemical separations of the samples, respectively. The results obtained showed an aquatic migration pathway of most of the trace elements and radionuclides and predicted water pollution downstream the river Shu. The scandium method showed pollution by As, Br, Ca, Cr, Zr of the Tasotkel dam impoundment and by Ca and Cr of the river Shu below its confluence with the river Kuragatty. According to the disequilibrium isotopic method for uranium (using the isotopic ratio U-234/U-238), areas with accumulation and leaching processes were estimated for soils and sediments of the river Shu and its main inflows. (author)
Dong, Zhiwen; Kang, Shichang; Qin, Dahe; Qin, Xiang; Yan, Fangping; Du, Wentao; Wei, Ting
2017-03-01
An evaluation of glacial meltwater chemistry is needed under recent dramatic glacier melting when water resources might be significantly impacted. This study investigated trace elements variation in the meltwater stream, and its related aquatic environmental information, at the Laohugou (LHG) glacier basin (4260 m a.s.l.) at a remote location in northeast Tibetan Plateau. We focused on the spatial, temporal and diurnal change of trace elements during the glacier ablation period. Results showed evident elements spatial difference on the glacier surface meltwater, as most of the elements showed increased concentration at the terminus compared to higher elevations sites. Dominant elements in the meltwater were Ba, Sr and Cr, whereas elements with high enrichment factors (EFs) were Sb, Ni, Mo and Zn. Temporal change of some trace elements concentration (e.g. Sc, Cu, and Rb) indicated increasing trend with accelerated snow-ice melting, whereas others (e.g. Ni, Zn, and Pb) showed decreasing trend. We find that, trace elements showed evident diurnal change and a peak value of concentration was observed each day at about 15:00-17:00, and the diurnal change was influenced by runoff level and pH. Moreover, EFs calculations revealed that heavy metals were partially originated from regional anthropogenic sources. Overall, the accelerated diurnal and temporal snow-ice melting (with high runoff level) were correlated to increased elemental concentration, pH, EC and elemental change mode, and thus this work is of great importance for evaluating the impacts of accelerated glacier melting to meltwater chemistry and downstream ecosystem in the northeast Tibetan Plateau. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Cuvier, Alicia
2015-01-01
Uranium mining and uranium ore processing increase the environmental activity of U and Th decay products and trace elements, in particular in case of releases to the adjacent rivers. Contaminants accumulate then preferentially in sedimentation areas (such as ponds or lakes) or in wetlands (peat lands, marshes or riverbanks) located downstream to the mine. Wetlands - generally located at the head of watershed - are particularly sensitive to environmental changes and anthropogenic pressure. This poses a risk of release of contaminants from these accumulation areas. The objective of the present study is to propose an easily reproducible methodology - in particular for the orphan mining sites - to identify and characterize accumulation areas. This study also aims to improve our understanding of the mechanisms of accumulation and release, in these areas. This study was performed around the former mining site of Bertholene (France). Standing and mobile in situ gamma spectrometry is used to accurately locate the accumulation areas. Soils, sediments, vegetation, water and peat are also sampled upstream and downstream of the mine, in order to (a) characterize the activities and the disequilibria of the U-Th decay chains and the associated trace elements according to the scale of observation, (b) understand the mechanisms of accumulation and release and (c) identify the potential sources using geochemical proxies and isotopic analyses. The results obtained show that radionuclides are mainly accumulated in a flooding area located downstream the mine. Strong U-238 activities (≥ 20000 Bq.kg"-"1) and strong Ra-226/U-238 and Th-230/Ra-226 activity ratios are recorded, involving preferential inputs of U-238 and Th-230 during flooding events. Trace element contamination is low, except for Mn, Ba and S. Such contaminations are potentially explained by the geochemical composition of the uranium ore and by the past and current processes of ore and water mine. Sequential extractions
Water Scarcity Hotspots Travel Downstream Due to Human Interventions in the 20th and 21st Century
Veldkamp, T. I. E.; Wada, Y.; Aerts, J. C. J. H.; Doell, P.; Gosling, S. N.; Liu, J.; Masaki, Y.; Oki, T.; Ostberg, S.; Pokhrel, Y.;
2017-01-01
Water scarcity is rapidly increasing in many regions. In a novel, multi-model assessment, we examine how human interventions (HI: land use and land cover change, man-made reservoirs and human water use) affected monthly river water availability and water scarcity over the period 1971 - 2010. Here we show that HI drastically change the critical dimensions of water scarcity, aggravating water scarcity for 8.8%(7.4 - 16.5 %) ) of the global population but alleviating it for another 8.3 % (6.4 -15.8 %). Positive impacts of HI mostly occur upstream, whereas HI aggravate water scarcity downstream; HI cause water scarcity to travel downstream. Attribution of water scarcity changes to HI components is complex and varies among the hydrological models. Seasonal variation in impacts and dominant HI components is also substantial. A thorough consideration of the spatially and temporally varying interactions among HI components and of uncertainties is therefore crucial for the success of water scarcity adaptation by HI.
Water scarcity hotspots travel downstream due to human interventions in the 20th and 21st century
Veldkamp, T. I. E.; Wada, Y.; Aerts, J. C. J. H.; Döll, P.; Gosling, S. N.; Liu, J.; Masaki, Y.; Oki, T.; Ostberg, S.; Pokhrel, Y.; Satoh, Y.; Kim, H.; Ward, P. J.
2017-06-01
Water scarcity is rapidly increasing in many regions. In a novel, multi-model assessment, we examine how human interventions (HI: land use and land cover change, man-made reservoirs and human water use) affected monthly river water availability and water scarcity over the period 1971-2010. Here we show that HI drastically change the critical dimensions of water scarcity, aggravating water scarcity for 8.8% (7.4-16.5%) of the global population but alleviating it for another 8.3% (6.4-15.8%). Positive impacts of HI mostly occur upstream, whereas HI aggravate water scarcity downstream; HI cause water scarcity to travel downstream. Attribution of water scarcity changes to HI components is complex and varies among the hydrological models. Seasonal variation in impacts and dominant HI components is also substantial. A thorough consideration of the spatially and temporally varying interactions among HI components and of uncertainties is therefore crucial for the success of water scarcity adaptation by HI.
International Nuclear Information System (INIS)
Kurkjian, Robert; Dunlap, Charles; Flegal, A. Russell
2004-01-01
Lead concentrations and isotopic compositions measured along 80 km of the Debed River in the Republic of Armenia provide new insights into the geochemical and physical controls on riparian Pb transport by allowing comparison of the long-range, downstream impacts of acid mine drainage with runoff from an industrialized city. The modern background Pb concentration in Armenian surface waters is estimated to be ∼0.01 μg/L, based on analyses of remote alpine rivers in Armenia. The lead concentration in the Debed River is 8 μg/L (800 times background) after passing through Vanadzor, the second largest industrial city in Armenia; it then decreases to 1 μg/L before the Debed River flows into the Alaverdi mining district. There, the Debed River receives waters from two mining drainage streams with Pb concentrations >3000 μg/L, but those concentrations decrease 3 orders of magnitude to ∼3 μg/L by the time the river exits Armenia and flows into the Republic of Georgia. Isotope mixing plots show shifts in Pb isotope composition as the river flows out of Vanadzor, evidencing the mixture of an average terrestrial Pb composition ( 206 Pb/ 207 Pb ∼ 1.17; 208 Pb/ 207 Pb ∼ 2.45) with past leaded gasoline and other industrial Pb emissions retained in the river's sediments within that region ( 208 Pb/ 207 Pb ≤ 2.45). The isotopic composition again shifts (e.g., 208 Pb/ 207 Pb ≥ 2.46) as the river passes through the Alaverdi mining district, where isotopic ratios in the water are characteristic of Pb in the area's massive sulfide deposits. Modeling both downstream elemental concentrations and Pb isotopic compositions further resolves the physical and chemical behavior of the contaminants in the river system. A multi-element model of concentration gradients in the acid mine drainage streams indicates Pb is attenuated by Al(OH) 3 precipitation (54% of the loss) and by adsorption onto other particles settling out of the water column (46% of the loss). Modeling of Pb
Longitudinal distribution of Chironomidae (Diptera) downstream from a dam in a neotropical river.
Pinha, G D; Aviz, D; Lopes Filho, D R; Petsch, D K; Marchese, M R; Takeda, A M
2013-08-01
The damming of a river causes dangerous consequences on structure of the environment downstream of the dam, modifying the sediment composition, which impose major adjustments in longitudinal distribution of benthic community. The construction of Engenheiro Sérgio Motta Dam in the Upper Paraná River has caused impacts on the aquatic communities, which are not yet fully known. This work aimed to provide more information about the effects of this impoundment on the structure of Chironomidae larvae assemblage. The analysis of data of physical and chemical variables in relation to biological data of 8 longitudinal sections in the Upper Paraná River showed that composition of Chironomidae larvae of stations near Engenheiro Sérgio Motta Dam differed of the other stations (farther of the Dam). The predominance of coarse sediments at stations upstream and finer sediments further downstream affected the choice of habitat by different morphotypes of Chironomidae and it caused a change in the structure of this assemblage in the longitudinal stretch.
Streams, riparian areas, floodplains, alluvial aquifers, and downstream waters (e.g., large rivers, lakes, and oceans) are interconnected by longitudinal, lateral, and vertical fluxes of water, other materials, and energy. Collectively, these interconnected waters are called fluv...
Directory of Open Access Journals (Sweden)
Z. A. Kurbanova
2013-01-01
Full Text Available When you select a specific consumption of the dam, the corresponding minimum Noah value crest front of the dam, it is necessary to take into account possible changes of the water level regime due to a General erosion of the river channel for attaching in the downstream. Considering this circumstance, has developed a methodology and computer program for calculation of total washout of the bottom of the riverbed downstream waterworks depending on the specific consumption of the dam. In the course of the research were graphic and analytical depending on the impact of specific economical expenditure on the depth of the total washout for fastening downstream of the spillway dam.
Yang, Yang; Zhou, Zhengchao; Bai, Yanying; Jiao, Wentao; Chen, Weiping
2016-07-01
The distribution of trace elements (TEs) in water, sediment, riparian soil and dominant plants was investigated in the Fenghe River, Northwestern China. The Fenghe River ecosystem was polluted with Cd, Cr, Hg and Pb. There was a high pollution risk in the midstream and downstream regions and the risk level for Cd was much higher than that of the other elements. The average values of bioconcentration coefficient for Cd and Zn were 2.21 and 1.75, respectively, indicating a large accumulation of Cd and Zn in the studied species. With broad ecological amplitudes, L. Levl. et Vant. Trin., and L. had the greatest TE concentrations in aboveground and belowground biomass of the studied species and were potential biomonitors or phytoremediators for the study area. Multivariate techniques including cluster analysis, correlation analysis, principal component analysis, and canonical correspondence analysis were used to analyze the relations between TE concentrations in plants and various environmental factors. The soil element concentration is the main factor determining the accumulation of TEs in plants. The co-release behavior of common pollutants and TEs drove the accumulation of Hg, Cd, and As in the studied plants. Significant enrichment of some elements in the Fenghe River has led to a decline in the biodiversity of plants. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Energy Technology Data Exchange (ETDEWEB)
Kwiatkowski, R.; Czaus, K.; Skladnik-Sadowska, E.; Malinowski, K.; Zebrowski, J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Sadowski, M.J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Karpinski, L.; Paduch, M.; Scholz, M. [Institute of Plasma Physics and Laser Microfusion (IPPLM), 01-497 Warsaw (Poland); Kubes, P. [Czech Technical University (CVUT), 166-27 Prague, (Czech Republic)
2011-07-01
The paper describes measurements of energy spectra of electrons emitted in the upstream direction along the symmetry-axis of the PF-1000 facility, operated with the deuterium filling at 21 kV, 290 kJ. The measurements were performed with a magnetic analyzer. The same analyzer was used to measure also electron beams emitted in along the symmetry-axis in the downstream direction. The recorded spectra showed that the electron-beams emitted in the upstream direction have energies in the range from about 40 keV to about 800 keV, while those in the downstream direction have energies in the range from about 60 keV to about 200 keV. These spectra confirm that in the PF (Plasma Focus) plasma column there appear strong local fields accelerating charged particles in different directions. This document is composed of a paper and a poster. (authors)
Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia
Palomero, Teresa; Odom, Duncan T.; O'Neil, Jennifer; Ferrando, Adolfo A.; Margolin, Adam; Neuberg, Donna S.; Winter, Stuart S.; Larson, Richard S.; Li, Wei; Liu, X. Shirley; Young, Richard A.; Look, A. Thomas
2006-01-01
Aberrant expression of 1 or more transcription factor oncogenes is a critical component of the molecular pathogenesis of human T-cell acute lymphoblastic leukemia (T-ALL); however, oncogenic transcriptional programs downstream of T-ALL oncogenes are mostly unknown. TAL1/SCL is a basic helix-loop-helix (bHLH) transcription factor oncogene aberrantly expressed in 60% of human T-ALLs. We used chromatin immunoprecipitation (ChIP) on chip to identify 71 direct transcriptional targets of TAL1/SCL. ...
Directory of Open Access Journals (Sweden)
Jussara de Azambuja Loch
2007-06-01
Full Text Available OBJETIVO: Conhecer as opiniões e comportamentos de um grupo de universitários sobre o grau de privacidade que consideram adequado em várias situações clínicas e em quais destas situações admitem a quebra de confidencialidade. MÉTODOS: Trata-se de um estudo transversal, descritivo, quali-quantitativo, no qual 711 universitários responderam a um questionário anônimo sobre a confidencialidade na assistência à saúde. O fator em estudo foi o reconhecimento dos limites éticos à confidencialidade e o desfecho avaliado foi a admissão da quebra de confidencialidade em situações clínicas freqüentes na morbidade dos adolescentes. A análise estatística utilizou o EpiInfo 6.04 e Microsoft Excel, 1997. A pesquisa foi aprovada pelo CEP/PUCRS. RESULTADOS: 82% dos adolescentes identificam a situação ideal de revelação mediante autorização do paciente, diferenciando-a das demais formas de quebra de confidencialidade. Em relação a revelações não autorizadas, a maioria admite a quebra do sigilo nas situações de idéias suicidas (85%, violência (84,2%, abuso sexual (81,7%, anorexia nervosa (81,3% e risco à vida de terceiros (72,3%; cerca da metade em HIV/Aids (57,9%, drogadição (51,7% e DST (44,7%; e menos de um terço a aceitam em casos de gravidez (33,6%, homossexualidade (20,7% e atividade sexual (15,6%. CONCLUSÃO: Os participantes estabelecem graus diferentes sobre o valor da confidencialidade no contexto assistencial. Aceitam que as informações sejam comunicadas a terceiros quando houver autorização do paciente. Quanto maiores os riscos à integridade física, mais facilmente admitem a quebra não autorizada do sigilo, porém dificilmente a aceitam nos aspectos referentes a sua sexualidade.OBJECTIVE:To understand the opinion and behavior of a group of college students about the degree of privacy considered appropriate in several clinical settings and in which situations breach of confidentiality is admitted. METHODS
Wave propagation downstream of a high power helicon in a dipolelike magnetic field
International Nuclear Information System (INIS)
Prager, James; Winglee, Robert; Roberson, B. Race; Ziemba, Timothy
2010-01-01
The wave propagating downstream of a high power helicon source in a diverging magnetic field was investigated experimentally. The magnetic field of the wave has been measured both axially and radially. The three-dimensional structure of the propagating wave is observed and its wavelength and phase velocity are determined. The measurements are compared to predictions from helicon theory and that of a freely propagating whistler wave. The implications of this work on the helicon as a thruster are also discussed.
Aylward, Bruce Allan
1998-12-01
Land use change that accompanies economic development and population growth is intended to raise the economic productivity of land. An inevitable by product of this process is the alteration of natural vegetation and downstream hydrological function. This dissertation explores hydrological externalities of land use change in detail, particularly with regard to their economic impact on large hydroelectric reservoirs (LHRs). A review of the linkages between land use, hydrological function and downstream economic activity suggests that on theoretical grounds the net welfare effect of land use change on hydrological function will be indeterminate. Review of the literature suggests that, though the effects of downstream sedimentation will typically be negative, they may often be of little practical significance. The literature on water quantity impacts is sparse at best. This is most surprising in the case of the literature on LHRs where the potentially important and positive effects of increased water yield are typically ignored in favor of simplistic efforts to document the negative effects of reservoir sedimentation. In order to improve the methodological basis for the economic valuation of hydrological externalities, the dissertation considers existing techniques for the evaluation of non-marketed goods and services, clarifying the manner in which they have been and, in the future, may be applied to the topic at hand. A deterministic simulation model is then constructed for the case of LHRs. The model incorporates the effect of changes in water yield, the seasonal pattern of water yield and sedimentation of live and dead storage volumes as they affect reservoir operation and the production of hydroelectricity. The welfare effects of changes in the productivity of the LHR in the short run and changes to the power system expansion plan in the long run are evaluated using the marginal opportunity costs of alternative power sources and power plants, respectively. A case
Tang, Zhanqi; Jiang, Nan
2018-05-01
This study reports the modifications of scale interaction and arrangement in a turbulent boundary layer perturbed by a wall-mounted circular cylinder. Hot-wire measurements were executed at multiple streamwise and wall-normal wise locations downstream of the cylindrical element. The streamwise fluctuating signals were decomposed into large-, small-, and dissipative-scale signatures by corresponding cutoff filters. The scale interaction under the cylindrical perturbation was elaborated by comparing the small- and dissipative-scale amplitude/frequency modulation effects downstream of the cylinder element with the results observed in the unperturbed case. It was obtained that the large-scale fluctuations perform a stronger amplitude modulation on both the small and dissipative scales in the near-wall region. At the wall-normal positions of the cylinder height, the small-scale amplitude modulation coefficients are redistributed by the cylinder wake. The similar observation was noted in small-scale frequency modulation; however, the dissipative-scale frequency modulation seems to be independent of the cylindrical perturbation. The phase-relationship observation indicated that the cylindrical perturbation shortens the time shifts between both the small- and dissipative-scale variations (amplitude and frequency) and large-scale fluctuations. Then, the integral time scale dependence of the phase-relationship between the small/dissipative scales and large scales was also discussed. Furthermore, the discrepancy of small- and dissipative-scale time shifts relative to the large-scale motions was examined, which indicates that the small-scale amplitude/frequency leads the dissipative scales.
The dynamics of entrepreneurship in ICT: case of mobile phones downstream services in Kenya
R.N. Kanothi (Raphael)
2009-01-01
textabstractThe research paper explores the extent to which mobile phones downstream services, defined here as those provided using the existing connectivity, are generating opportunities for entrepreneurship development in Kenya. After identifying the services of mobile payphones, money transfer
A mathematical model for erosion-corrosion downstream of an orifice
International Nuclear Information System (INIS)
Thomas, R.M.
1989-08-01
In certain types of nuclear plant, the internal surfaces of the steel high-pressure boiler tubes become covered with magnetite. This normal growth of protective magnetite may, in unfavourable circumstances, be replaced by rapid attack on the tube wall. Particularly at risk are the regions downstream of the orifice plates commonly fitted near the boiler inlet. An attempt is made to construct a mathematical model for this erosion-corrosion which is considerably more complete than those available hitherto. A systematic synthesis is developed of the various aspects of the phenomenon, namely the mechanism of the topotactic oxidation at the interface between magnetite and metal, the kinetics of the electrode reactions at the magnetite/solution interface, the thermodynamics of magnetite solubility and the calculation of mass transfer in solution. With one choice of parameters and some simplification, the treatment reduces to the original theory of Bignold. (author)
Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])
A distant cis acting intronic element induces site-selective RNA editing
DEFF Research Database (Denmark)
Daniel, Chammiran; Venø, Morten Trillingsgaard; Ekdahl, Ylva
2012-01-01
Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated...... shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce...... the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been...
Zhang, Wangshou; Swaney, Dennis; Hong, Bongghi; Howarth, Robert
2017-04-01
Phosphorus (P) originating from anthropogenic sources as a pollutant of surface waters has been an environmental issue for decades because of the well-known role of P in eutrophication. Human activities, such as food production and rapid urbanization, have been linked to increased P inputs which are often accompanied by corresponding increases in riverine P export. However, uneven distributions of anthropogenic P inputs along watersheds from the headwaters to downstream reaches can result in significantly different contributions to the riverine P fluxes of a receiving water body. So far, there is still very little scientific understanding of anthropogenic P inputs and their impacts on riverine flux in river reaches along the upstream to downstream continuum. Here, we investigated P budgets in a series of nested watersheds draining into Hongze Lake of China, and developed a simple empirical function to describe the relationship between anthropogenic inputs and riverine TP fluxes. The results indicated that an average of 1.1% of anthropogenic P inputs are exported into rivers, with most of the remainder retained in the watershed landscape over the period studied. Fertilizer application was the main contributor of P loading to the lake (55% of total loads), followed by legacy P stock (30%), food and feed P inputs (12%) and non-food P inputs (4%). From 60% to 89% of the riverine TP loads generated from various locations within this basin were ultimately transported into the receiving lake of the downstream, with an average rate of 1.86 tons P km-1 retaining in the main stem of the inflowing river annually. Our results highlight that in-stream processes can significantly buffer the riverine P loading to the downstream receiving lake. An integrated P management strategy considering the influence of anthropogenic inputs and hydrological interactions is required to assess and optimize P management for protecting fresh waters.
Kedia, Kushal S.
2012-03-01
The objective of this work is to investigate the flame stabilization mechanism and the conditions leading to the blowoff of a laminar premixed flame anchored downstream of a heat-conducting perforated-plate/multi-hole burner, with overall nearly adiabatic conditions. We use unsteady, fully resolved, two-dimensional simulations with detailed chemical kinetics and species transport for methane-air combustion. Results show a bell-shaped flame stabilizing above the burner plate hole, with a U-shaped section anchored between neighboring holes. The base of the positively curved U-shaped section of the flame is positioned near the stagnation point, at a location where the flame displacement speed is equal to the flow speed. This location is determined by the combined effect of heat loss and flame stretch on the flame displacement speed. As the mass flow rate of the reactants is increased, the flame displacement speed at this location varies non-monotonically. As the inlet velocity is increased, the recirculation zone grows slowly, the flame moves downstream, and the heat loss to the burner decreases, strengthening the flame and increasing its displacement speed. As the inlet velocity is raised, the stagnation point moves downstream, and the flame length grows to accommodate the reactants mass flow. Concomitantly, the radius of curvature of the flame base decreases until it reaches an almost constant value, comparable to the flame thickness. While the heat loss decreases, the higher flame curvature dominates thereby reducing the displacement speed of the flame base. For a stable flame, the gradient of the flame base displacement speed normal to the flame is higher than the gradient of the flow speed along the same direction, leading to dynamic stability. As inlet velocity is raised further, the former decreases while the latter increases until the stability condition is violated, leading to blowoff. The flame speed during blow off is determined by the feedback between the
Horowitz, A.J.; Elrick, K.A.; Smith, J.J.
2001-01-01
Suspended sediment, sediment-associated, total trace element, phosphorus (P), and total organic carbon (TOC) fluxes were determined for the Mississippi, Columbia, Rio Grande, and Colorado Basins for the study period (the 1996, 1997, and 1998 water years) as part of the US Geological Survey's redesigned National Stream Quality Accounting Network (NASQAN) programme. The majority (??? 70%) of Cu, Zn, Cr, Ni, Ba, P, As, Fe, Mn, and Al are transported in association with suspended sediment; Sr transport seems dominated by the dissolved phase, whereas the transport of Li and TOC seems to be divided equally between both phases. Average dissolved trace element levels are markedly lower than reported during the original NASQAN programme; this seems due to the use of 'clean' sampling, processing, and analytical techniques rather than to improvements in water quality. Partitioning between sediment and water for Ag, Pb, Cd, Cr, Co, V, Be, As, Sb, Hg, and Ti could not be estimated due to a lack of detectable dissolved concentrations in most samples. Elevated suspended sediment-associated Zn levels were detected in the Ohio River Basin and elevated Hg levels were detected in the Tennessee River, the former may affect the mainstem Mississippi River, whereas the latter probably do not. Sediment-associated concentrations of Ag, Cu, Pb, Zn, Cd, Cr, Co, Ba, Mo, Sb, Hg, and Fe are markedly elevated in the upper Columbia Basin, and appear to be detectable (Zn, Cd) as far downstream as the middle of the basin. These elevated concentrations seem to result from mining and/or mining-related activities. Consistently detectable concentrations of dissolved Se were found only in the Colorado River Basin. Calculated average annual suspended sediment fluxes at the mouths of the Mississippi and Rio Grande Basins were below, whereas those for the Columbia and Colorado Basins were above previously published annual values. Downstream suspended sediment-associated and total trace element fluxes
Emiroglu, M. Emin
2010-01-01
This paper presents the results of a laboratory study on the flow characteristics of sharp-crested weirs, broad-crested weirs, and labyrinth weirs. The variation of the maximum bubble penetration depth for different weir types is investigated depending on overfall jet expansion, discharge, and drop height. Moreover, most efficient depth, length and width of the downstream receiving pool in an open channel system are studied by considering the penetration depth, overfall jet expansion, jet tra...
Energy Technology Data Exchange (ETDEWEB)
Kuzay, T.M.; Kasza, K.E.
1985-01-01
A thermally stratified pipe flow produced by a thermal transient when passing through a horizontal elbow as a result of secondary flow gives rise to large thermal fluctuations on the inner curvature wall of the downstream piping. These fluctuations were measured in a specially instrumented horizontal pipe and elbow system on a test set-up using water in the Mixing Components Technology Facility (MCTF) at Argonne National Laboratory (ANL). This study is part of a larger program which is studying the influence of thermal buoyancy on general reactor component performance. This paper discusses the influence of pipe flow generated thermal oscillations on the thermal stresses induced in the pipe walls. The instrumentation was concentrated around the exit plane of the 90/sup 0/ sweep elbow, since prior tests had indicated that the largest thermal fluctuations would occur within about one hydraulic diameter downstream of the elbow exit. The thermocouples were located along the inner curvature of the piping and measured the near surface fluid temperature. The test matrix involved thermal downramps under turbulent flow conditions.
Magirl, Christopher S.; Keith, Mackenzie K.; Anderson, Scott W.; O'Connor, Jim; Robert Aldrich,; Mastin, Mark C.
2015-12-28
On March 22, 2014, the State Route 530 Landslide near Oso, Washington, traveled almost 2 kilometers (km), destroyed more than 40 structures, and impounded the North Fork Stillaguamish River to a depth of 8 meters (m) and volume of 3.3×106 cubic meters (m3). The landslide killed 43 people. After overtopping and establishing a new channel through the landslide, the river incised into the landslide deposit over the course of 10 weeks draining the impoundment lake and mobilizing an estimated 280,000±56,000 m3 of predominantly sand-sized and finer sediment. During the first 4 weeks after the landslide, this eroded sediment caused downstream riverbed aggradation of 1–2 m within 1 km of the landslide and 0.4 m aggradation at Whitman Road Bridge, 3.5 km downstream. Winter high flows in 2014–15 were anticipated to mobilize an additional 220,000±44,000 m3 of sediment, potentially causing additional aggradation and exacerbating flood risk downstream of the landslide. Analysis of unit stream power and bed-material transport capacity along 35 km of the river corridor indicated that most fine-grained sediment will transport out of the North Fork Stillaguamish River, although some localized additional aggradation was possible. This new aggradation was not likely to exceed 0.1 m except in reaches within a few kilometers downstream of the landslide, where additional aggradation of up to 0.5 m is possible. Alternative river response scenarios, including continued mass wasting from the landslide scarp, major channel migration or avulsion, or the formation of large downstream wood jams, although unlikely, could result in reaches of significant local aggradation or channel change.
Wilcox, Andrew C.; O'Connor, James E.; Major, Jon J.
2014-01-01
Condit Dam on the White Salmon River, Washington, a 38 m high dam impounding a large volume (1.8 million m3) of fine-grained sediment (60% sand, 35% silt and clay, and 5% gravel), was rapidly breached in October 2011. This unique dam decommissioning produced dramatic upstream and downstream geomorphic responses in the hours and weeks following breaching. Blasting a 5 m wide hole into the base of the dam resulted in rapid reservoir drawdown, abruptly releasing ~1.6 million m3 of reservoir water, exposing reservoir sediment to erosion, and triggering mass failures of the thickly accumulated reservoir sediment. Within 90 min of breaching, the reservoir's water and ~10% of its sediment had evacuated. At a gauging station 2.3 km downstream, flow increased briefly by 400 m3 s−1during passage of the initial pulse of released reservoir water, followed by a highly concentrated flow phase—up to 32% sediment by volume—as landslide-generated slurries from the reservoir moved downstream. This hyperconcentrated flow, analogous to those following volcanic eruptions or large landslides, draped the downstream river with predominantly fine sand. During the ensuing weeks, suspended-sediment concentration declined and sand and gravel bed load derived from continued reservoir erosion aggraded the channel by >1 m at the gauging station, after which the river incised back to near its initial elevation at this site. Within 15 weeks after breaching, over 1 million m3 of suspended load is estimated to have passed the gauging station, consistent with estimates that >60% of the reservoir's sediment had eroded. This dam removal highlights the influence of interactions among reservoir erosion processes, sediment composition, and style of decommissioning on rate of reservoir erosion and consequent downstream behavior of released sediment.
Hagedorn, K. B.; Cartwright, I.
2008-12-01
The distribution of rare earth elements (REE) and trace elements was measured by ICP-MS on fresh, slightly weathered and weathered granite and surface water samples from a network of 11 pristine rivers draining the Australian Victorian Alps during (i) high and (ii) low discharge conditions. River water REE concentrations are largely derived from atmospheric precipitation (rain, snow), as indicated by similar Chondrite normalized REE patterns (higher LREE over HREE; negative Ce anomalies, positive Eu anomalies) and similar total REE concentrations during both dry and wet seasons. Calculations based on the covariance between REE and Cl concentrations and oxygen and hydrogen isotopes indicate precipitation input coupled with subsequent evaporation may account for 30% o 100% of dissolved REE in stream waters. The dissolved contribution to the granitic substratum to stream water comes mainly from the transformation of plagioclase to smectite, kaolinite and gibbsite and minor apatite dissolution. However, since most REE of the regional granite are present in accessory minerals (titanite, zircon, etc.) they do not significantly contribute to the river REE pool. REE concentrations drop sharply downstream as a result of dilution and chemical attenuation. A trend of downstream enrichment of the heavier REE is due to selective partitioning of the lighter REE (as both free REE or REECO3 complexes) to hydrous oxides of suspended Al which, in turn, is controlled by a downstream increase of pH to values > 6.1 (for free REE) and > 7.3 (for REECO3 complexes). Although most circumneutral waters were supersaturated with REE phosphate compounds, precipitation of LnPO4 is not believed to have been a dominant process because the predicted phosphate fractionation pattern is inconsistent with the observed trends. Negative saturation indices of hydrous ferric oxides also militate against surface complexation onto goethite. Instead, REE attenuation most likely resulted from adsorption onto
Zhang, Chao; Wang, Bing; Li, Lei; Li, Yawei; Li, Pengzhi; Lv, Guohua
2017-09-01
Surgery followed by radiotherapy is the standard treatment for chordomas, which are a rare but low-grade type of bone cancer arising from remnants of the embryonic notochord. However, disease recurrence following radiotherapy is common, most likely due to endogenous DNA repair mechanisms that promote cell survival upon radiation strikes. The ataxia telangiectasia mutated/ataxia telangiectasia mutated and Rad3 related (ATM/ATR)-mediated pathway has a critical role in DNA repair mechanisms; however, it has rarely been investigated in chordomas. In the present study, the expression of signal molecules related to the ATM/ATR pathway in chordoma tissues and adjacent normal tissues were initially examined using immunohistochemistry and western blot analysis. Chordoma U-CH1 and U-CH2 cells were subsequently used to investigate cell responses to ionizing radiation and the potential protective actions mediated by the ATM/ATR pathway. Phosphorylated (p)-ATM, p-ATR, γ-H2A histone family, member X (H2AX) and RAD51 were significantly upregulated in chordoma tissues relative to adjacent normal tissues (PATM, γ-H2AX and RAD51 expression in U-CH1 cells (PATM, p-ATR and RAD51 levels in U-CH2 cells (PATM/ATR pathway, in which RAD51 serves as an important downstream effector. Thus, RAD51 presents a promising therapeutic target for improving the outcome of radiotherapy treatment in chordomas.
International Nuclear Information System (INIS)
Nagaya, Yukinori; Utanohara, Yoichi; Nakamura, Akira; Murase, Michio
2008-01-01
In this study, in order to evaluate the effects of flow field on corrosion rate due to flow accelerated corrosion (FAC), a corrosion rate downstream of an orifice was measured using the electric resistance method. The diameter of the pipe is 50 mm and that of the orifice is 24.3 mm, and flow velocity of the experimental loop was set at 5m/s, and the temperature of water was controlled within ±1 at 150deg-C. There were no significant circumferential difference in measured corrosion rate, and the maximum corrosion rate was observed at 1D or 2D downstream from the orifice. The ratios of the measured corrosion rate and the calculated wall shear stress at the 1D downstream from the orifice to the value at upstream under well developed flow agreed well. (author)
Gao, Chenhao; Li, Dong; Jin, Changyu; Duan, Shaowei; Qi, Shuanghui; Liu, Kaige; Wang, Hanchen; Ma, Haoli; Hai, Jiangbo; Chen, Mingxun
2017-04-01
GLABRA3 (GL3), a bHLH transcription factor, has previously proved to be involved in anthocyanin biosynthesis and trichome formation in Arabidopsis, however, its downstream targeted genes are still largely unknown. Here, we found that GL3 was widely present in Arabidopsis vegetative and reproductive organs. New downstream targeted genes of GL3 for anthocyanin biosynthesis and trichome formation were identified in young shoots and expanding true leaves by RNA sequencing. GL3-mediated gene expression was tissue specific in the two biological processes. This study provides new clues to further understand the GL3-mediated regulatory network of anthocyanin biosynthesis and trichome formation in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Kun Li
2015-01-01
Full Text Available This paper investigates a special single machine scheduling problem derived from practical industries, namely, the selective single machine scheduling with sequence dependent setup costs and downstream demands. Different from traditional single machine scheduling, this problem further takes into account the selection of jobs and the demands of downstream lines. This problem is formulated as a mixed integer linear programming model and an improved particle swarm optimization (PSO is proposed to solve it. To enhance the exploitation ability of the PSO, an adaptive neighborhood search with different search depth is developed based on the decision characteristics of the problem. To improve the search diversity and make the proposed PSO algorithm capable of getting out of local optimum, an elite solution pool is introduced into the PSO. Computational results based on extensive test instances show that the proposed PSO can obtain optimal solutions for small size problems and outperform the CPLEX and some other powerful algorithms for large size problems.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Trehalose-6-phosphate synthesis controls yeast gluconeogenesis downstream and independent of SNF1.
Deroover, Sofie; Ghillebert, Ruben; Broeckx, Tom; Winderickx, Joris; Rolland, Filip
2016-06-01
Trehalose-6-P (T6P), an intermediate of trehalose biosynthesis, was identified as an important regulator of yeast sugar metabolism and signaling. tps1Δ mutants, deficient in T6P synthesis (TPS), are unable to grow on rapidly fermentable medium with uncontrolled influx in glycolysis, depletion of ATP and accumulation of sugar phosphates. However, the exact molecular mechanisms involved are not fully understood. We show that SNF1 deletion restores the tps1Δ growth defect on glucose, suggesting that lack of TPS hampers inactivation of SNF1 or SNF1-regulated processes. In addition to alternative, non-fermentable carbon metabolism, SNF1 controls two major processes: respiration and gluconeogenesis. The tps1Δ defect appears to be specifically associated with deficient inhibition of gluconeogenesis, indicating more downstream effects. Consistently, Snf1 dephosphorylation and inactivation on glucose medium are not affected, as confirmed with an in vivo Snf1 activity reporter. Detailed analysis shows that gluconeogenic Pck1 and Fbp1 expression, protein levels and activity are not repressed upon glucose addition to tps1Δ cells, suggesting a link between the metabolic defect and persistent gluconeogenesis. While SNF1 is essential for induction of gluconeogenesis, T6P/TPS is required for inactivation of gluconeogenesis in the presence of glucose, downstream and independent of SNF1 activity and the Cat8 and Sip4 transcription factors. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Custer, Christine M.; Yang, C.; Crock, J.G.; Shearn-Bochsler, V.; Smith, K.S.; Hageman, P.L.
2009-01-01
Concentrations of 31 metals, metalloids, and other elements were measured in insects and insectivorous bird tissues from three drainages with different geochemistry and mining histories in Summit Co., Colorado, in 2003, 2004, and 2005. In insect samples, all 25 elements that were analyzed in all years increased in both Snake and Deer Creeks in the mining impacted areas compared to areas above and below the mining impacted areas. This distribution of elements was predicted from known or expected sediment contamination resulting from abandoned mine tailings in those drainages. Element concentrations in avian liver tissues were in concordance with levels in insects, that is with concentrations higher in mid-drainage areas where mine tailings were present compared to both upstream and downstream locations; these differences were not always statistically different, however. The lack of statistically significant differences in liver tissues, except for a few elements, was due to relatively small sample sizes and because many of these elements are essential and therefore well regulated by the bird's homeostatic processes. Most elements were at background concentrations in avian liver tissue except for Pb which was elevated at mid-drainage sites to levels where ??-aminolevulinic acid dehydratase activity was inhibited at other mining sites in Colorado. Lead exposure, however, was not at toxic levels. Fecal samples were not a good indication of what elements birds ingested and were potentially exposed to. ?? Springer Science+Business Media B.V. 2008.
Velocity and shear stress distribution downstream of mechanical heart valves in pulsatile flow.
Giersiepen, M; Krause, U; Knott, E; Reul, H; Rau, G
1989-04-01
Ten mechanical valves (TAD 27 mm): Starr-Edwards Silastic Ball, Björk-Shiley Standard, Björk-Shiley Concave-Convex, Björk-Shiley Monostrut, Hall-Kaster (Medtronic-Hall), OmniCarbon, Bicer Val, Sorin, Saint-Jude Medical and Hemex (Duromedics) are investigated in a comparative in vitro study. The velocity and turbulent shear stress profiles of the valves were determined by Laser Doppler anemometry in two different downstream axes within a model aortic root. Depending on the individual valve design, velocity peaks up to 1.5 m/s and turbulent shear stress peaks up to 150 N/m2 were measured during the systolic phase. These shear stress peaks mainly occurred in areas of flow separation and intense momentum exchange. Directly downstream of the valves (measuring axis 0.55.dAorta) turbulent shear stress peaks occurred at peak systole and during the deceleration phase, while in the second measuring axis (1.5.dAorta) turbulence levels were lower. Shear stress levels were high at the borders of the fluid jets. The results are discussed from a fluid-dynamic point of view.
Berger, Tim; Kreibich, Maximilian; Morlock, Julia; Kondov, Stoyan; Scheumann, Johannes; Kari, Fabian A; Rylski, Bartosz; Siepe, Matthias; Beyersdorf, Friedhelm; Czerny, Martin
2018-02-19
To evaluate early and mid-term clinical outcomes and to assess the potential of the frozen elephant trunk technique to induce remodelling of downstream aortic segments in acute and chronic thoracic aortic dissections. Over a 4-year period, 65 patients (48 men, aged 61 ± 12 years) underwent total aortic arch replacement using the frozen elephant trunk technique for acute (n = 31) and chronic (n = 34) thoracic aortic dissections at our institution. We assessed diameter changes at 3 levels: the L1 segment at the stent graft level; the L2 segment at the thoraco-abdominal transition level and the L3 segment at the coeliac trunk level. True-lumen (TL) and false-lumen (FL) diameter changes were assessed at each level. Fifty-six percent of patients had already undergone previous aortic or cardiac surgery. In-hospital mortality was 6%. Symptomatic spinal cord injury was not observed in this series. During a mean follow-up of 12 ± 12 months, late death was observed in 6% of patients. Aortic reinterventions in downstream aortic segments were performed in 28% at a mean of 394 ± 385 days. TL expansion and FL shrinkage were measured in all segments and were observed at each level. This effect was the most pronounced at the level of the stent graft in patients with chronic aortic dissection, TL diameter increased from 15 ± 17 mm before surgery to 28 ± 2 mm (P = 0.001) after 2 years, and the FL diameter decreased from 40 ± 11 mm before surgery to 32 ± 17 mm (P = 0.026). The frozen elephant trunk technique is associated with an excellent clinical outcome in a complex cohort of patients, and also effectively induces remodelling in downstream aortic segments in acute and chronic thoracic aortic dissections. The need for secondary interventions in downstream segments, which mainly depends on the extent of the underlying disease process, remains substantial. Further studies are required to assess the long-term outcome of
Rowell, Candace; Kuiper, Nora; Preud'Homme, Hugues
2016-07-01
The knowledge-base of bottled water leachate is highly contradictory due to varying methodologies and limited multi-elemental and/or molecular analyses; understanding the range of contaminants and their pathways is required. This study determined the leaching potential and leaching kinetics of trace elements, using consistent comprehensive quantitative and semi-quantitative (79 elements total) analyses, and BPA, using isotopic dilution and MEPS pre-concentration with UHPLC-ESI-QTOF. Statistical methods were used to determine confounders and predictors of leaching and human health risk throughout 12days of UV exposure and after exposure to elevated temperature. Various types of water were used to assess the impact of water quality. Results suggest Sb leaching is primarily dependent upon water quality, not container type. Bottle type is a predictor of elemental leaching for Pb, Ba, Cr, Cu, Mn and Sr; BPA was detected in samples from polycarbonate containers. Health risks from the consumption of bottled water increase after UV exposure. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Margret H Bülow
2010-12-01
Full Text Available Forkhead transcription factors of the FoxO subfamily regulate gene expression programs downstream of the insulin signaling network. It is less clear which proteins mediate transcriptional control exerted by Target of rapamycin (TOR signaling, but recent studies in nematodes suggest a role for FoxA transcription factors downstream of TOR. In this study we present evidence that outlines a similar connection in Drosophila, in which the FoxA protein Fork head (FKH regulates cellular and organismal size downstream of TOR. We find that ectopic expression and targeted knockdown of FKH in larval tissues elicits different size phenotypes depending on nutrient state and TOR signaling levels. FKH overexpression has a negative effect on growth under fed conditions, and this phenotype is not further exacerbated by inhibition of TOR via rapamycin feeding. Under conditions of starvation or low TOR signaling levels, knockdown of FKH attenuates the size reduction associated with these conditions. Subcellular localization of endogenous FKH protein is shifted from predominantly cytoplasmic on a high-protein diet to a pronounced nuclear accumulation in animals with reduced levels of TOR or fed with rapamycin. Two putative FKH target genes, CG6770 and cabut, are transcriptionally induced by rapamycin or FKH expression, and silenced by FKH knockdown. Induction of both target genes in heterozygous TOR mutant animals is suppressed by mutations in fkh. Furthermore, TOR signaling levels and FKH impact on transcription of the dFOXO target gene d4E-BP, implying a point of crosstalk with the insulin pathway. In summary, our observations show that an alteration of FKH levels has an effect on cellular and organismal size, and that FKH function is required for the growth inhibition and target gene induction caused by low TOR signaling levels.
New functionalities in abundant element oxides: ubiquitous element strategy
International Nuclear Information System (INIS)
Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi
2011-01-01
While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements. (topical review)
Reineke, Lucas C; Merrick, William C
2009-12-01
Cap-independent initiation of translation is thought to promote protein synthesis on some mRNAs during times when cap-dependent initiation is down-regulated. However, the mechanism of cap-independent initiation is poorly understood. We have previously reported the secondary structure within the yeast minimal URE2 IRES element. In this study, we sought to investigate the mechanism of internal initiation in yeast by assessing the functional role of nucleotides within the minimal URE2 IRES element, and delineating the cis-sequences that modulate levels of internal initiation using a monocistronic reporter vector. Furthermore, we compared the eIF2A sensitivity of the URE2 IRES element with some of the invasive growth IRES elements using DeltaeIF2A yeast. We found that the stability of the stem-loop structure within the minimal URE2 IRES element is not a critical determinant of optimal IRES activity, and the downstream sequences that modulate URE2 IRES-mediated translation can be defined to discrete regions within the URE2 coding region. Repression of internal initiation on the URE2 minimal IRES element by eIF2A is not dependent on the stability of the secondary structure within the URE2 IRES element. Our data also indicate that eIF2A-mediated repression is not specific to the URE2 IRES element, as both the GIC1 and PAB1 IRES elements are repressed by eIF2A. These data provide valuable insights into the mRNA requirements for internal initiation in yeast, and insights into the mechanism of eIF2A-mediated suppression.
DEFF Research Database (Denmark)
Jensen, Jesper Bevensee; Gibbon, Timothy Braidwood; Yu, Xianbin
2010-01-01
We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors.......We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors....
Shin, K.; Kojima, H.; Matsumoto, H.; Mukai, T.
2007-02-01
Geotail plasma wave observations show the existence of intense electrostatic quasi-monochromatic (EQM) waves in the downstream region of the Earth's bow shock. They oscillate parallel to the ambient magnetic field and appear at frequencies between the electron plasma and ion plasma frequencies. Although these waves have been believed to be Doppler-shifted ion acoustic waves, the typical plasma parameters observed in the downstream region do not support the generation conditions for ion acoustic waves. In this paper, the existence of cold electron beam-like components accompanying EQM waves is considered based on waveform and statistical analyses. Linear dispersion analyses using realistic plasma parameters revealed that the cold electron beams cause destabilization of electron acoustic waves at frequencies consistent with those of observed EQM waves. The results of observations and linear analyses suggest that EQM waves are generated by the destabilization of the electron acoustic mode.
Isotopic study of the effect of Tarbela reservoir on the groundwater system in the downstream areas
International Nuclear Information System (INIS)
Sajjad, M.I.; Tasneem, M.A.; Hussain, S.D.; Khan, I.H.; Ali, M.; Latif, Z.
1994-04-01
Isotopic studies were carried out on the right side of river Indus, downstream of Tarbela dam to study the effect of Tarbela Reservoir on the groundwater system. The main objectives of the study were to determine the hydraulic connection, if any, between the Tarbela Lake and the groundwater appearing in the ponds near Gadon Amazai, see the effect of Tarbela dam on the groundwater system in the downstream areas, compute the relative contribution of different recharge sources towards groundwater system and to estimate residence time of groundwater in the area. Isotopic data reveals that the ponds near Gadoon Amazai area are being recharged by local rains and there is no contribution of Tarbela lake. The area around Gadoon Amazai, Topi and Kalabat is solely recharged by local rains while the area around Swabi, Zaida and Lahor has mixed recharge with major contribution from local canal system. Tritium data suggests that the residence time of groundwater in the study area varies from a few years to 30 years. Te groundwater in the area has low dissolved salt contents and is, generally, of good quality. (author) 19 figs
Zhang, Wangshou; Swaney, Dennis P.; Hong, Bongghi; Howarth, Robert W.
2017-12-01
The increasing trend in riverine phosphorus (P) loads resulting from anthropogenic inputs has gained wide attention because of the well-known role of P in eutrophication. So far, however, there is still limited scientific understanding of anthropogenic P inputs and their impacts on riverine flux in river reaches along the upstream-to-downstream continuum. Here we investigated P budgets in a series of nested watersheds draining into Hongze Lake of China and developed an empirical function to describe the relationship between anthropogenic inputs and riverine P fluxes. Our results indicated that there are obvious gradients regarding P budgets in response to changes in human activities. Fertilizer application and food and feed P import was always the dominant source of P inputs in all sections, followed by nonfood P. Further interpretation using the model revealed the processes of P loading to the lake. About 2%-9% of anthropogenic P inputs are transported from the various sections into the corresponding tributaries of the river systems, depending upon local precipitation rates. Of this amount, around 41%-95% is delivered to the main stem of the Huai River after in-stream attenuation in its tributaries. Ultimately, 55%-86% of the P loads delivered to different locations of the main stem are transported into the receiving lake of the downstream, due to additional losses in the main stem. An integrated P management strategy that considers the gradients of P loss along the upstream-to-downstream continuum is required to assess and optimize P management to protect the region's freshwater resource.
Doig, Lorne E; Carr, Meghan K; Meissner, Anna G N; Jardine, Tim D; Jones, Paul D; Bharadwaj, Lalita; Lindenschmidt, Karl-Erich
2017-11-01
Across the circumpolar world, intensive anthropogenic activities in the southern reaches of many large, northward-flowing rivers can cause sediment contamination in the downstream depositional environment. The influence of ice cover on concentrations of inorganic contaminants in bed sediment (i.e., sediment quality) is unknown in these rivers, where winter is the dominant season. A geomorphic response unit approach was used to select hydraulically diverse sampling sites across a northern test-case system, the Slave River and delta (Northwest Territories, Canada). Surface sediment samples (top 1 cm) were collected from 6 predefined geomorphic response units (12 sites) to assess the relationships between bed sediment physicochemistry (particle size distribution and total organic carbon content) and trace element content (mercury and 18 other trace elements) during open-water conditions. A subset of sites was resampled under-ice to assess the influence of season on these relationships and on total trace element content. Concentrations of the majority of trace elements were strongly correlated with percent fines and proxies for grain size (aluminum and iron), with similar trace element grain size/grain size proxy relationships between seasons. However, finer materials were deposited under ice with associated increases in sediment total organic carbon content and the concentrations of most trace elements investigated. The geomorphic response unit approach was effective at identifying diverse hydrological environments for sampling prior to field operations. Our data demonstrate the need for under-ice sampling to confirm year-round consistency in trace element-geochemical relationships in fluvial systems and to define the upper extremes of these relationships. Whether contaminated or not, under-ice bed sediment can represent a "worst-case" scenario in terms of trace element concentrations and exposure for sediment-associated organisms in northern fluvial systems
Directory of Open Access Journals (Sweden)
Jabulani Ray Gumbo
2016-06-01
Full Text Available The deterioration of water quality in our freshwater sources is on the increase worldwide and, in South Africa, mostly due to the discharge of municipal sewage effluent. Here we report on the use of principal component analysis, coupled with factor and cluster analysis, to study the similarities and differences between upstream and downstream sampling sites that are downstream of municipal sewage plants. The contribution of climatic variables, air temperature, humidity, and rainfall were also evaluated with respect to variations in water quality at the sampling sites. The physicochemical and microbial values were higher than the Department of Water Affairs and Forestry (DWAF and World Health Organization (WHO guidelines. The cluster analysis showed the presence of two clusters for each of the Mvudi, Dzindi, and Luvuvhu Rivers and Nandoni reservoir sampling sites. The principal component analysis (PCA accounted for 40% of the water quality variation and was associated strongly with pH, electrical conductivity, calcium, magnesium, chloride, bromide, nitrate, and total coliform, and negatively with rainfall, which represented Mvudi downstream and was attributed to the Thohoyandou sewage plant. The PCA accounted for 54% of the variation and was associated strongly with electrical conductivity, sulfate; total dissolved solids, fluoride, turbidity, nitrate, manganese, alkalinity, magnesium, and total coliform represented Dzindi downstream, with inflows from the Vuwani sewage plant and agriculture. The PCA accounted for 30% of the variation and was associated strongly with total dissolved solids, electrical conductivity, magnesium, fluoride, nitrate, sulfate, total coliform average air temperature, and total rainfall, and negatively associated with manganese and bromide represented Luvuvhu upstream and was associated with commercial agriculture. The PCA accounted for 21% of the variation and was associated strongly with turbidity, alkalinity, magnesium
Wang, Dongfang; Qin, Jingkai; Jia, Jirong; Yan, Peipei; Li, Wensheng
2017-01-29
This study aims to determine the post-transcriptional regulation mechanism of the transcription factor pou1f1 (pou class 1 homeobox 1), which is the key gene for pituitary development, somatic growth in vertebrates, and transcription of several hormone genes in teleost fish. MicroRNA miR-223-3p was identified as a bona fide target of pou1f; overexpression of miR-223-3p in primary pituitary cells led to the down-regulation of pou1f1 and downstream genes, and inhibition of miR-223-3p led to the up-regulation of pou1f1 in Nile tilapia dispersed primary pituitary cells. An adenylate-uridylate-rich element (AU-Rich element) was found in the 3'UTR of pou1f1 mRNA, and deletion of the AU-Rich element led to slower mRNA decay and therefore more protein output. A potential mutual relationship between miR-223-3p and the AU-rich element was also investigated, and the results demonstrated that with or without the AU-Rich element, miR-223-3p induced the up-regulation of a reporter system under serum starvation conditions, indicating that miR-223-3p and the AU-Rich element function independent of each other. This study is the first to investigate the post-transcriptional mechanism of pou1f1, which revealed that miR-223-3p down-regulated pou1f1 and downstream gene expressions, and the AU-Rich element led to rapid decay of pou1f1 mRNA. MicroRNA miR-223-3p and the AU-Rich element co-regulated the post-transcriptional expression of pou1f1 independently in Nile tilapia, demonstrating that pou1f1 is under the control of a dual post-transcription regulation mechanism. Copyright © 2016 Elsevier Inc. All rights reserved.
A computational fluid dynamics modeling study of guide walls for downstream fish passage
Mulligan, Kevin; Towler, Brett; Haro, Alexander J.; Ahlfeld, David P.
2017-01-01
A partial-depth, impermeable guidance structure (or guide wall) for downstream fish passage is typically constructed as a series of panels attached to a floating boom and anchored across a water body (e.g. river channel, reservoir, or power canal). The downstream terminus of the wall is generally located nearby to a fish bypass structure. If guidance is successful, the fish will avoid entrainment in a dangerous intake structure (i.e. turbine intakes) while passing from the headpond to the tailwater of a hydroelectric facility through a safer passage route (i.e. the bypass). The goal of this study is to determine the combination of guide wall design parameters that will most likely increase the chance of surface-oriented fish being successfully guided to the bypass. To evaluate the flow field immediately upstream of a guide wall, a parameterized computational fluid dynamics model of an idealized power canal was constructed in © ANSYS Fluent v 14.5 (ANSYS Inc., 2012). The design parameters investigated were the angle and depth of the guide wall and the average approach velocity in the power canal. Results call attention to the importance of the downward to sweeping flow ratio and demonstrate how a change in guide wall depth and angle can affect this important hydraulic cue to out-migrating fish. The key findings indicate that a guide wall set at a small angle (15° is the minimum in this study) and deep enough such that sweeping flow dominant conditions prevail within the expected vertical distribution of fish approaching the structure will produce hydraulic conditions that are more likely to result in effective passage.
International Nuclear Information System (INIS)
Barros de Oliveira, Sonia Maria; Cardoso da Silva, Paulo Sergio; Paci Mazzilli, Barbara; Teixeira Favaro, Deborah Ines; Saueia, Catia Heloisa
2007-01-01
In the Cubatao region, southern Brazil, sediments are transported by several rivers from the Serra do Mar Ridge into the Santos estuary. Fertilizer plants have been operating along the margins of one of these rivers (Mogi River) producing a large volume of phosphogypsum, which is stockpiled in nearby areas. Surface sediments of the Mogi River were sampled upstream and downstream in relation to the point where the effluents of the phosphogypsum piles flow into the drainage system. In the vicinity of this point one sediment core was collected. Results show that REE, Ba, Zr and Th concentrations in the non-contaminated sediments are of the same order as those present in the upper continental crust. The contaminated samples present a composition affected by that of the phosphogypsum, marked by a higher concentration of these elements and a stronger degree of REE fractionation. These phosphogypsum characteristics are inherited from the Catalao igneous phosphate ore and were moderately modified by the industrial process of phosphoric acid production. The phosphogypsum signal decreases rapidly downstream, pointing to a limited area of influence of the stacks. The deepest sediments of the core are also free of contamination, representing a time interval prior to the deposition of phosphogypsum wastes on the banks of the estuary
The mobilization of hazardous elements after a tropical storm event in a polluted estuary
Energy Technology Data Exchange (ETDEWEB)
Rodriguez-Iruretagoiena, Azibar, E-mail: azibar.rodriguez@ehu.es [Department of Analytical Chemistry, University of the Basque Country, P.O. Box 664, 48080 Bilbao, Basque Country (Spain); Fdez Ortiz de Vallejuelo, Silvia; Diego, Alberto de [Department of Analytical Chemistry, University of the Basque Country, P.O. Box 664, 48080 Bilbao, Basque Country (Spain); Leão, Felipe B. de; Medeiros, Diego de; Oliveira, Marcos L.S.; Tafarel, Silvio R. [Environmental Science and Nanotechnology Department, Institute of Environmental Research and Human Development — IPADH, Capivari de Baixo, Santa Catarina (Brazil); Arana, Gorka; Madariaga, Juan Manuel [Department of Analytical Chemistry, University of the Basque Country, P.O. Box 664, 48080 Bilbao, Basque Country (Spain); Silva, Luis F.O., E-mail: felipeqma@hotmail.com [Environmental Science and Nanotechnology Department, Institute of Environmental Research and Human Development — IPADH, Capivari de Baixo, Santa Catarina (Brazil)
2016-09-15
The Tubarão River (Santa Catarina, Brazil) is affected by hazardous elements (HEs) pollution from abandoned coal mines, agricultural activities, urban discharges, industrial and leisure zones, etc. In order to study the distribution and sources of HEs contamination in a polluted estuary after a tropical storm, waters and surface sediments were collected from 15 sampling sites along the Tubarão River. The concentration of 24 elements (Ag, Al, As, Ba, Cd, Co, Cr, Cu, Fe, Hg, Mg, Mn, Mo, Ni, Pb, Sb, Se, Sn, Sr, Ti, Tl, V, W, and Zn) were measured by Inductively Coupled Plasma Mass Spectrometry (ICP-MS) and the mineralogical composition of the sediments by Raman spectroscopy and X-ray diffraction (XRD). The metal concentrations in water and sediment showed wide spatial variation due to the variability in water discharges and anthropogenic inputs after a storm. In general, higher metal concentration in water and lower in sediments were found upstream (closer to coal mining). Downstream sampling sites and the Oratorio River sampling site (one of the eight tributaries of the estuary) showed the highest values in sediment samples. Normalized and Weighed Average Concentrations (NWAC) were calculated, which allow us to identify, in a very simple way, the sampling sites of higher concern (hotspots of contamination) in the studied area. NWAC suggested that the strong rainfall events could affect to the metal distribution in sediments. The results of this study were compared with a previous study in the same area during dry season by Principal Component Analysis (PCA), showing changes in environmental pollution of the sediment after a strong storm event. - Highlights: • The highest water HEs concentrations were identified in the sampling sites closest to the coal mines. • The presence of gypsum downstream is due to the remobilisation of upstream sediments by storm flow. • The HEs composition of the Tubarao River sediments changes due to strong rainfall events.
Beam Halo on the LHC TCDQ Diluter System and Thermal Load on the Downstream Superconducting Magnets
Goddard, B; Presland, A; Redaelli, S; Robert-Démolaize, G; Sarchiapone, L; Weiler, T; Weterings, W
2006-01-01
The moveable single-jawed graphite TCDQ diluter must be positioned very close to the circulating LHC beam in order to prevent damage to downstream components in the event of an unsynchronised beam abort. A two-jawed graphite TCS.IR6 collimator forms part of the TCDQ system. The requirement to place the jaws close to the beam means that the system can intercept a substantial beam halo load. Initial investigations indicated a worryingly high heat load on the Q4 coils. This paper presents the updated load cases, shielding and simulation geometry, and the results of simulations of the energy deposition in the TCDQ system and in the downstream superconducting Q4 magnet. The implications for the operation of the LHC are discussed.
Energy Technology Data Exchange (ETDEWEB)
Legros, E.
2002-06-01
Invited by the 'para-petroleum industry club' of the French group of para-petroleum and para-gas companies (GEP) on April 2, 2002, J.P. Vettier, general director of the refining-marketing activity of TotalFinaElf company, described the new configuration of the downstream strategy of the French group, now the fourth biggest oil company in the world. This downstream activity seems to have profited from the different fusions that have led to the present day structure. (J.S.)
Vadnais, Marie-Ève; Assani, Ali A.; Landry, Raphaëlle; Leroux, Denis; Gratton, Denis
2012-11-01
During the first half of the twentieth century, many hydroelectric facilities were built in the Saint-Maurice River watershed, followed by other human activities in the second half of the century (pleasure boating, boom dismantling, urbanization, etc.). The goal of the study is to constrain the effects of these various types of human activities, particularly those of the many dams in the watershed, on the hydromorphological evolution of the Saint-Maurice River downstream from the La Gabelle (dam) power plant (43,000 km2). Comparison of specific discharge in this river with streamflow measured in a natural river setting reveals a significant decrease in seasonal maximum flows, aside from winter, when daily maximum flows increased significantly. Also, unlike natural rivers, the long-term trend in spring flows is not characterized by a significant change in mean downstream from the La Gabelle plant. These hydrological changes are linked to the inversion-type management mode of the reservoirs built downstream from the plant. As for the morphological evolution, the longitudinal variability of bankfull width downstream from the plant shows two significant shifts in mean: the first, which was quasi-abrupt, took place downstream of the des Forges rapid; and the second, which was gradual, occurred upstream from the confluence of the Saint-Maurice River with the St. Lawrence River, above the point where the Saint-Maurice splits into two branches. Comparison of aerial photographs taken at various times (1948, 1964, 1975, 1996, and 2008) reveals no significant change in the mean of bankfull width over time. However, a significant increase in the surface area of islets located at the confluence was observed, which is caused by sediment accumulation. These sediments were likely derived from local bank erosion resulting from anthropogenic changes.
International Nuclear Information System (INIS)
Cull, R.F.; East, T.J.; Marten, R.; Murray, A.S.; Duggan, K.
1986-01-01
Milling of uraniferous and other metalliferous ores at the Northern Hercules (Moline) Mine near Pine Creek produced some 246,000 tonnes of tailings between 1959 and the closure of the mill in 1972. During this period tailings were contained by several bunds which later failed resulting in the erosion and transport of tailings by tributaries of the Mary River. Suspended sediment concentrations as high as 94 g/L were recorded in Tailings Creek immediately downstream of the eroding tailings pile during the 1984/85 wet season and the total yield was equivalent to a mean erosion rate for the tailings area of 4 mm/yr. This erosion rate is about two orders of magnitude higher than natural rates in the Pine Creek area. Erosion rates of the tailings pile have, however, decreased perhaps by as much as a factor of eight since the last bund was breached. Radioactive dose rates recorded along a series of transects across floodplains downstream of the mill are consistently related to the sedimentary environment. The main channel is associated with low dose rates, and the relatively low energy environments of backswamps and flood bypass channels are characterised by higher dose rates. Longitudinally, dose rates on the floodplain generally decrease with distance downstream although the rate of decrease is not constant, and appears to be dependent upon the hydrological and geomorphic character of the catchment
Taniguchi, Kristine; Biggs, Trent; Langendoen, Eddy; Castillo, Carlos; Gudiño, Napoleon; Yuan, Yongping; Liden, Douglas
2016-04-01
Urban-induced erosion in Tijuana, Mexico, has led to excessive sediment deposition in the Tijuana Estuary in the United States. Urban areas in developing countries, in contrast to developed countries, are characterized by much lower proportions of vegetation and impervious surfaces due to limited access to urban services such as road paving and landscaping, and larger proportions of exposed soils. In developing countries, traditional watershed scale variables such as impervious surfaces may not be good predictors of channel enlargement. In this research, we surveyed the stream channel network of an erodible tributary of the Tijuana River Watershed, Los Laureles Canyon, at 125 locations, including repeat surveys from 2008. Structure from Motion (SfM) and 3D photo-reconstruction techniques were used to create digital terrain models of stream reaches upstream and downstream of channel hardpoints. Channels are unstable downstream of hardpoints, with incision up to 2 meters and widening up to 12 meters. Coordinated channelization is essential to avoid piece-meal approaches that lead to channel degradation. Watershed impervious area is not a good predictor of channel erosion due to the overriding importance of hardpoints and likely to the high sediment supply from the unpaved roads which prevents channel erosion throughout the stream network.
The industrial melanism mutation in British peppered moths is a transposable element.
Van't Hof, Arjen E; Campagne, Pascal; Rigden, Daniel J; Yung, Carl J; Lingley, Jessica; Quail, Michael A; Hall, Neil; Darby, Alistair C; Saccheri, Ilik J
2016-06-02
Discovering the mutational events that fuel adaptation to environmental change remains an important challenge for evolutionary biology. The classroom example of a visible evolutionary response is industrial melanism in the peppered moth (Biston betularia): the replacement, during the Industrial Revolution, of the common pale typica form by a previously unknown black (carbonaria) form, driven by the interaction between bird predation and coal pollution. The carbonaria locus has been coarsely localized to a 200-kilobase region, but the specific identity and nature of the sequence difference controlling the carbonaria-typica polymorphism, and the gene it influences, are unknown. Here we show that the mutation event giving rise to industrial melanism in Britain was the insertion of a large, tandemly repeated, transposable element into the first intron of the gene cortex. Statistical inference based on the distribution of recombined carbonaria haplotypes indicates that this transposition event occurred around 1819, consistent with the historical record. We have begun to dissect the mode of action of the carbonaria transposable element by showing that it increases the abundance of a cortex transcript, the protein product of which plays an important role in cell-cycle regulation, during early wing disc development. Our findings fill a substantial knowledge gap in the iconic example of microevolutionary change, adding a further layer of insight into the mechanism of adaptation in response to natural selection. The discovery that the mutation itself is a transposable element will stimulate further debate about the importance of 'jumping genes' as a source of major phenotypic novelty.
Czech Academy of Sciences Publication Activity Database
Ruivenkamp, C. A. L.; van Wezel, T.; Zanon, C.; Stassen, A. P. M.; Vlček, Čestmír; Csikós, T.; Klous, A. M.; Tripodis, N.; Perrakis, A.; Boerrigter, L.; Groot, P. C.; Lindeman, J.; Mooi, W. J.; Meijjer, G. A.; Scholten, G.; Dauwerse, H.; Pačes, Václav; van Zandwijk, N.; van Ommen, G. J. B.; Demant, P.
2002-01-01
Roč. 31, č. 3 (2002), s. 295-300 ISSN 1061-4036 R&D Projects: GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : cancer * cloning * phosphatase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 26.711, year: 2002
Environmental radiological studies downstream from Rancho Seco Nuclear Power Generating Station
International Nuclear Information System (INIS)
Noshkin, V.E.; Wong, K.M.; Eagle, R.J.; Dawson, J.W.; Brunk, J.L.; Jokela, T.A.
1985-01-01
This report summarizes the information compiled in 1984 while assessing the environmental impact of radionuclides in aquatic releases from the Rancho Seco Nuclear Power Generating Station. Gamma-emitting radionuclides discharged since 1981 are found in many of the dietary components derived from the creeks receiving the effluent wastewater. Some soils and crops are found to contain radionuclides that originate from the contaminated water that was transferred to land during the irrigation season. 134 Cs and 137 Cs are the primary gamma-emitting radionuclides detected in the edible flesh of fish from the creeks. Concentrations in the flesh of fish decreased exponentially with distance from the plant. No significant differences in the 137 Cs activity were found between male and female fish of equal size, but concentrations may vary in fish of different size, with the season and diet. 21% of the total 137 Cs and 134 Cs discharged between 1981 and 1984 is associated with the creek sediments to a distance of 27 km from the plant. Fractions of the missing inventory have been transferred to land during the irrigation season or to downstream regions more distant than 27 km from the plant. The radiocesium content of the sediments in 1984 decreased significantly in a downstream direction, much in the same manner as concentrations decreased in fish. Radioactivity originating from the plant was not above detection limits in any terrestrial food item sampled beyond 6.5 km from the plant. Based on the usage factors provided by individuals interviewed in a 1984 survey, the fish and aquatic-organism ingestion pathway contributed the largest radiological dose to humans utilizing products contaminated with the radionuclides in the liquid wastes discharged from the Rancho Seco Nuclear Power Generating Station in 1984
International Nuclear Information System (INIS)
DeCola, E.G.; Robertson, T.L.; Robertson, R.; Banta, J.
2004-01-01
This study assessed the need for an oil spill response plan for downstream coastal communities that could be affected by oil spilled from tankers travelling in Prince William Sound, Alaska. For the purpose of oil spill contingency planning, the State of Alaska has been divided into the Kodiak and Cook Inlet sub-areas that are at risk for downstream impacts from a Prince William Sound oil spill. The 1989 Exxon Valdez oil spill provided an example of a worst-case scenario oil spill from a tanker in Prince William Sound, but the oil spill planning system that has evolved in Alaska does not adequately plan for on oil spill that originates in one sub-area of the state, but impacts other sub-areas in the downstream spill path. This study analyzed the gaps that exist in the current response planning system in the Prince William Sound, Cook Inlet and Kodiak sub-areas. A method was proposed to improve the existing response plans so that emergency response teams are better prepared to manage cross-boundary oil spills originating in Prince William Sound. The proposed method focuses on nearshore response and sensitive areas protection for coastlines and communities that are at risk for oil spills from a tanker travelling the Trans-Alaska Pipeline System (TAPS). 11 refs., 3 figs
Systems-wide analysis of BCR signalosomes and downstream phosphorylation and ubiquitylation
DEFF Research Database (Denmark)
Satpathy, Shankha; Wagner, Sebastian A; Beli, Petra
2015-01-01
B-cell receptor (BCR) signaling is essential for the development and function of B cells; however, the spectrum of proteins involved in BCR signaling is not fully known. Here we used quantitative mass spectrometry-based proteomics to monitor the dynamics of BCR signaling complexes (signalosomes......) and to investigate the dynamics of downstream phosphorylation and ubiquitylation signaling. We identify most of the previously known components of BCR signaling, as well as many proteins that have not yet been implicated in this system. BCR activation leads to rapid tyrosine phosphorylation and ubiquitylation...... of the receptor-proximal signaling components, many of which are co-regulated by both the modifications. We illustrate the power of multilayered proteomic analyses for discovering novel BCR signaling components by demonstrating that BCR-induced phosphorylation of RAB7A at S72 prevents its association...
International Nuclear Information System (INIS)
Loeffler Peltier, Gretchen; Meyer, Judith L.; Jagoe, Charles H.; Hopkins, William A.
2008-01-01
We used the biomonitor, Corbicula fluminea, to investigate the contributions of trace elements associated with different point sources and land uses in a large river. Trace elements were analyzed in tissues of clams collected from 15 tributary streams draining five land use or point source types: agriculture, forest, urban, coal-fired power plant (CFPP), and wastewater (WWTP). Clams from forested catchments had elevated Hg concentrations, and concentrations of arsenic and selenium were highest (5.0 ± 0.2 and 13.6 ± 0.9 μg g -1 dry mass (DM), respectively) in clams from CFPP sites. Cadmium concentrations were significantly higher in clams from urban and CFPP sites (4.1 ± 0.2 and 3.6 ± 0.9 μg g -1 DM, respectively). Non-metric multidimensional scaling (NMS) of tissue concentrations in clams clustered at CFPP and forest/agriculture sites at opposite ends of the ordination space, and the distribution of sites was driven by Cu, Zn, Cd, and Hg. - C. fluminea collected downstream of CFPPs had elevated tissue concentrations of trace elements
Design methodology for integrated downstream separation systems in an ethanol biorefinery
Mohammadzadeh Rohani, Navid
Energy security and environmental concerns have been the main drivers for a historic shift to biofuel production in transportation fuel industry. Biofuels should not only offer environmental advantages over the petroleum fuels they replace but also should be economically sustainable and viable. The so-called second generation biofuels such as ethanol which is the most produced biofuel are mostly derived from lignocellulosic biomasses. These biofuels are more difficult to produce than the first generation ones mainly due to recalcitrance of the feedstocks in extracting their sugar contents. Costly pre-treatment and fractionation stages are required to break down lignocellulosic feedstocks into their constituent elements. On the other hand the mixture produced in fermentation step in a biorefinery contains very low amount of product which makes the subsequent separation step more difficult and more energy consuming. In an ethanol biorefinery, the dilute fermentation broth requires huge operating cost in downstream separation for recovery of the product in a conventional distillation technique. Moreover, the non-ideal nature of ethanol-water mixture which forms an iseotrope at almost 95 wt%, hinders the attainment of the fuel grade ethanol (99.5 wt%). Therefore, an additional dehydration stage is necessary to purify the ethanol from its azeotropic composition to fuel-grade purity. In order to overcome the constraint pertaining to vapor-liquid equilibrium of ethanol-water separation, several techniques have been investigated and proposed in the industry. These techniques such as membrane-based technologies, extraction and etc. have not only sought to produce a pure fuel-grade ethanol but have also aimed at decreasing the energy consumption of this energy-intensive separation. Decreasing the energy consumption of an ethanol biorefinery is of paramount importance in improving its overall economics and in facilitating the way to displacing petroleum transportation fuel
Modelling of the impact of biofouling on hydrodynamics downstream of a tidal turbine
Bennis, A. C.; Rivier, A.; Dauvin, J. C.
2016-02-01
Biological organisms, like barnacles, mussels or bryozoans, colonize rapidly an immersed surface and could form a thickness until several centimeters on it. This biofouling could modify hydrodynamics around tidal turbine by increasing drag and hence resistance and could be detrimental to the performance of turbine (e.g. Orme et al., 2001; Khor and Xiao, 2011). Our work focuses on modifications of vortices downstream of a tidal turbine due to biofouling using CFD. Fixed biological organisms are solved explicitly by the model and are considered by modifying the blade profile. Firstly an airfoil colonized by barnacles is modelled for various fouling height and spacing and results are compared to experimental and simulated data (Orme et al., 2001; Khor and Xiao, 2011) in order to assess the capacity of the model to reproduce the flow around a blade with biofouling. Then a Darrieus vertical axis tidal turbine is modelled using a dynamic mesh. Configuration with smooth clean blades is assessed by comparison with experiments and simulations made by Roa (2011) and Bossard (2012). Biological organisms with various heights, spacing and shapes are fixed on blades and wakes downstream of clean and colonized tidal turbine are compared. Vorticity fields around the tidal turbine are clearly modified when blades are colonized. Samples will be taken from location where farms are planned to be built (Alderney Race/Raz Blanchard) to characterize more precisely the characteristics of species which are liable to fix on tidal turbine.Reference:Bossard (2012). Doctoral dissertation, Université de Grenoble.Khor & Xiao. (2011). Ocean Eng, 38(10), 1065-1079. Orme et al. (2001). Marine Renewable Energy Conference, Newcastle.Roa (2011).Doctoral dissertation, Université de Grenoble.
Odigie, Kingsley; Cohen, A.D.; Swarzenski, Peter W.; Flegal, R
2014-01-01
Lead isotopic and trace element records of two contrasting sediment cores were examined to reconstruct historic, industrial contaminant inputs to Lake Tanganyika, Africa. Observed fluxes of Co, Cu, Mn, Ni, Pb, and Zn in age-dated sediments collected from the lake varied both spatially and temporally over the past two to four centuries. The fluxes of trace elements were lower (up to 10-fold) at a mid-lake site (MC1) than at a nearshore site (LT-98-58), which is directly downstream from the Kahama and Nyasanga River watersheds and adjacent to the relatively pristine Gombe Stream National Park. Trace element fluxes at that nearshore site did not measurably change over the last two centuries (1815–1998), while the distal, mid-lake site exhibited substantial changes in the fluxes of trace elements – likely caused by changes in land use – over that period. For example, the flux of Pb increased by ∼300% from 1871 to 1991. That apparent accelerated weathering and detrital mobilization of lithogenic trace elements was further evidenced by (i) positive correlations (r = 0.77–0.99, p factors (EF operations within the lake’s watershed over the past century. The data also indicate that the mid-lake site is a much more sensitive and useful recorder of environmental changes than the nearshore site. Furthermore, the lead isotopic compositions of sediment at the sites differed spatially, indicating that the Pb (and other trace elements by association) originated from different natural sources at the two locations.
Munia, H.; Guillaume, J. H A; Mirumachi, N.; Porkka, M.; Wada, Y.|info:eu-repo/dai/nl/341387819; Kummu, M.
2016-01-01
Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analysed in many of these international river basins, this has
Modelling optimization involving different types of elements in finite element analysis
International Nuclear Information System (INIS)
Wai, C M; Rivai, Ahmad; Bapokutty, Omar
2013-01-01
Finite elements are used to express the mechanical behaviour of a structure in finite element analysis. Therefore, the selection of the elements determines the quality of the analysis. The aim of this paper is to compare and contrast 1D element, 2D element, and 3D element used in finite element analysis. A simple case study was carried out on a standard W460x74 I-beam. The I-beam was modelled and analyzed statically with 1D elements, 2D elements and 3D elements. The results for the three separate finite element models were compared in terms of stresses, deformation and displacement of the I-beam. All three finite element models yield satisfactory results with acceptable errors. The advantages and limitations of these elements are discussed. 1D elements offer simplicity although lacking in their ability to model complicated geometry. 2D elements and 3D elements provide more detail yet sophisticated results which require more time and computer memory in the modelling process. It is also found that the choice of element in finite element analysis is influence by a few factors such as the geometry of the structure, desired analysis results, and the capability of the computer
Mergers and acquisitions of downstream facilities by producing countries
Energy Technology Data Exchange (ETDEWEB)
Ligon, D.R.
1988-01-01
The author discusses a phenomenon that he calls the ''re-integration'' or ''re-coupling'' of the worldwide oil industry, as foreign, particularly OPEC, producers are becoming directly involved with downstream operations in their most important markets. This phenomenon already has produced some far-reaching consequences that will become even more important and pervasive in the near future. First, he describes the factors and logic that led to these arrangements. Next, he outlines some of their practical considerations and implications. While some of the market factors described are applicable to any non-integrated producer, he spends most of his time discussing OPEC and ''neo-OPEC'' producers such as Mexico. These are the people doing the deals and are therefore probably of greatest interest.
Santana, Mateus F; Silva, José C F; Batista, Aline D; Ribeiro, Lílian E; da Silva, Gilvan F; de Araújo, Elza F; de Queiroz, Marisa V
2012-12-22
Mycosphaerella fijiensis is a ascomycete that causes Black Sigatoka in bananas. Recently, the M. fijiensis genome was sequenced. Repetitive sequences are ubiquitous components of fungal genomes. In most genomic analyses, repetitive sequences are associated with transposable elements (TEs). TEs are dispersed repetitive DNA sequences found in a host genome. These elements have the ability to move from one location to another within the genome, and their insertion can cause a wide spectrum of mutations in their hosts. Some of the deleterious effects of TEs may be due to ectopic recombination among TEs of the same family. In addition, some transposons are physically linked to genes and can control their expression. To prevent possible damage caused by the presence of TEs in the genome, some fungi possess TE-silencing mechanisms, such as RIP (Repeat Induced Point mutation). In this study, the abundance, distribution and potential impact of TEs in the genome of M. fijiensis were investigated. A total of 613 LTR-Gypsy and 27 LTR-Copia complete elements of the class I were detected. Among the class II elements, a total of 28 Mariner, five Mutator and one Harbinger complete elements were identified. The results of this study indicate that transposons were and are important ectopic recombination sites. A distribution analysis of a transposable element from each class of the M. fijiensis isolates revealed variable hybridization profiles, indicating the activity of these elements. Several genes encoding proteins involved in important metabolic pathways and with potential correlation to pathogenicity systems were identified upstream and downstream of transposable elements. A comparison of the sequences from different transposon groups suggested the action of the RIP silencing mechanism in the genome of this microorganism. The analysis of TEs in M. fijiensis suggests that TEs play an important role in the evolution of this organism because the activity of these elements, as well
Directory of Open Access Journals (Sweden)
Santana Mateus F
2012-12-01
Full Text Available Abstract Background Mycosphaerella fijiensis is a ascomycete that causes Black Sigatoka in bananas. Recently, the M. fijiensis genome was sequenced. Repetitive sequences are ubiquitous components of fungal genomes. In most genomic analyses, repetitive sequences are associated with transposable elements (TEs. TEs are dispersed repetitive DNA sequences found in a host genome. These elements have the ability to move from one location to another within the genome, and their insertion can cause a wide spectrum of mutations in their hosts. Some of the deleterious effects of TEs may be due to ectopic recombination among TEs of the same family. In addition, some transposons are physically linked to genes and can control their expression. To prevent possible damage caused by the presence of TEs in the genome, some fungi possess TE-silencing mechanisms, such as RIP (Repeat Induced Point mutation. In this study, the abundance, distribution and potential impact of TEs in the genome of M. fijiensis were investigated. Results A total of 613 LTR-Gypsy and 27 LTR-Copia complete elements of the class I were detected. Among the class II elements, a total of 28 Mariner, five Mutator and one Harbinger complete elements were identified. The results of this study indicate that transposons were and are important ectopic recombination sites. A distribution analysis of a transposable element from each class of the M. fijiensis isolates revealed variable hybridization profiles, indicating the activity of these elements. Several genes encoding proteins involved in important metabolic pathways and with potential correlation to pathogenicity systems were identified upstream and downstream of transposable elements. A comparison of the sequences from different transposon groups suggested the action of the RIP silencing mechanism in the genome of this microorganism. Conclusions The analysis of TEs in M. fijiensis suggests that TEs play an important role in the evolution of
Multiyear Downstream Response to Dam Removal on the White Salmon River, WA
Wilcox, A. C.; O'Connor, J. E.; Major, J. J.
2017-12-01
The 2011 removal of the 38 m tall Condit Dam on the White Salmon River, Washington was one of the largest dam removals to date, in terms of both dam height and sediment release. We examined the multiyear geomorphic response to this event, through 2015, including in a bedrock-confined canyon and in a less-confined, backwater-influenced pool reach near the river's mouth, to the large, rapid influx of fine reservoir sediment produced by the breach and to subsequent sediment transfer in the free-flowing White Salmon River. In the canyon reach, aggraded sediments were rapidly eroded from riffles, returning them toward pre-breach bed elevations within weeks, but pool aggradation persisted for longer. The downstream, less-confined reach transformed from a deep pool to a narrower pool-riffle channel with alternate bars; multiyear observations showed persistence of bars and of this new and distinct morphology. This downstream reach marks a rare case in post-dam removal channel response; in most dam removals, channels have rapidly reverted toward pre-removal morphology, as in the canyon reach here. Comparison of the multiyear geomorphic evolution of the White Salmon River to other recent large dam removals in the U.S. allows evaluation of the relative influences of antecedent channel morphology, post-breach hydrology, and dam removal style, as well as providing a basis for predicting responses to future dam removals.
Energy Technology Data Exchange (ETDEWEB)
Morris, J; Johnson, S
2007-12-03
The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.
DEFF Research Database (Denmark)
Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask
2012-01-01
Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...
DEFF Research Database (Denmark)
Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask
Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...
Flow structure in the downstream of a square cylinder with different angles of incidence
Directory of Open Access Journals (Sweden)
N Jamshidi
2016-09-01
Full Text Available This paper presents comparisons between flow fields for turbulent flow over square cylinder with two different angles of incidence in free stream at Reynolds number of Re = 3400. The present numerical results were obtained using a two-dimensional finite-volume code which solves governing equations. The pressure field was obtained with well known SIMPLE algorithm. The central difference scheme was employed for the discretization of convection and diffusion terms. The ν2 f and standard k - ε model were used for simulation of turbulent flow. Time averaged velocity, root mean square velocities and streamlines in the downstream of square cylinders are presented. A number of quantities such as Strouhal number, drag coefficient and the length of the wake are calculated for the case of angle of incidence α = 0°, 45° with two turbulent models. Strouhal number and the length of the wake are larger for the case of α = 45° because of the sharp corners in it which results in more diffusion of turbulence in the downstream of the cylinder. On the other hand, with comparison of results obtained by ν2 f and standard k - ε models with experiment, it is obvious that ν2 f leads to much more accurate results.
Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko
2015-04-21
Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.
Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.
2017-09-06
Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the
Atypical RNA Elements Modulate Translational Readthrough in Tobacco Necrosis Virus D.
Newburn, Laura R; White, K Andrew
2017-04-15
Tobacco necrosis virus, strain D (TNV-D), is a positive-strand RNA virus in the genus Betanecrovirus and family Tombusviridae The production of its RNA-dependent RNA polymerase, p82, is achieved by translational readthrough. This process is stimulated by an RNA structure that is positioned immediately downstream of the recoding site, termed the readthrough stem-loop (RTSL), and a sequence in the 3' untranslated region of the TNV-D genome, called the distal readthrough element (DRTE). Notably, a base pairing interaction between the RTSL and the DRTE, spanning ∼3,000 nucleotides, is required for enhancement of readthrough. Here, some of the structural features of the RTSL, as well as RNA sequences and structures that flank either the RTSL or DRTE, were investigated for their involvement in translational readthrough and virus infectivity. The results revealed that (i) the RTSL-DRTE interaction cannot be functionally replaced by stabilizing the RTSL structure, (ii) a novel tertiary RNA structure positioned just 3' to the RTSL is required for optimal translational readthrough and virus infectivity, and (iii) these same activities also rely on an RNA stem-loop located immediately upstream of the DRTE. Functional counterparts for the RTSL-proximal structure may also be present in other tombusvirids. The identification of additional distinct RNA structures that modulate readthrough suggests that regulation of this process by genomic features may be more complex than previously appreciated. Possible roles for these novel RNA elements are discussed. IMPORTANCE The analysis of factors that affect recoding events in viruses is leading to an ever more complex picture of this important process. In this study, two new atypical RNA elements were shown to contribute to efficient translational readthrough of the TNV-D polymerase and to mediate robust viral genome accumulation in infections. One of the structures, located close to the recoding site, could have functional
Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko
2015-01-01
The limb skeletal elements that have unique morphology and distinct locations are developed from limb progenitors, derived from the lateral plate mesoderm. These skeletal elements arise during limb development. In this study, we show genetic evidence that function of Sall4 is essential prior to limb outgrowth for development of the anterior-proximal skeletal elements. Furthermore, genetic interaction between Sall4 and Gli3 is upstream of establishing Shh (Sonic hedgehog) expression, and there...
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Directory of Open Access Journals (Sweden)
Russell G. DEATH
2011-09-01
Full Text Available Reduced thermal amplitude has been highlighted as a limiting factor for aquatic invertebrate diversity in springs. Moving downstream water temperature range increases and invertebrate richness is expected to change accordingly. In the present study temperature patterns were investigated in seven spring-fed streams, between April 2001 and November 2002, and compared to five run-off-fed streams to assess the degree of crenic temperature constancy. Temperature and physico-chemical characteristics of the water, and food resource levels were measured, and the invertebrate fauna collected at 4 distances (0, 100, 500 m and 1 km from seven springs in the North and South Islands of New Zealand. Temperature variability was greater for run-off-fed streams than for springs, and increased in the spring-fed streams with distance from the source. Periphyton and physico-chemical characteristics of the water did not change markedly over the 1 km studied, with the exception of water velocity and organic matter biomass, which increased and decreased, respectively. The rate of increase in temperature amplitude differed greatly for the studied springs, probably being affected by flow, altitude, and the number and type of tributaries (i.e., spring- or run-off-fed joining the spring-fed stream channel. Longitudinal changes in the number and evenness of invertebrate taxa were positively correlated to thermal amplitude (rs = 0.8. Moving downstream, invertebrate communities progressively incorporated taxa with higher mobility and taxa more common in nearby run-off-fed streams. Chironomids and non-insect taxa were denser at the sources. Chironomid larvae also numerically dominated communities 100 and 500 m downstream from the sources, together with Pycnocentria spp. and Zelolessica spp., while taxa such as Hydora sp. and Hydraenidae beetles, the mayflies Deleatidium spp. and Coloburiscus humeralis, and the Trichoptera Pycnocentrodes spp., all had greater abundances 1 km
Corrosion mechanisms downstream the nuclear cycle: from processing-recycling to transmutation
International Nuclear Information System (INIS)
Balbaud-Celerier, F.
2010-01-01
The author gives a detailed overview of his scientific and research activities in the field of material behaviour in environments met during the downstream part of the nuclear cycle. In the first part, he presents his works on material corrosion in concentrated and high temperature nitric acid, and more particularly on the phenomenon which governs this corrosion: the nitric acid reduction mechanism. In the second part, he reports researches performed within the frame of hybrid reactor development for the processing of future fuels. In both parts, he also discusses the perspectives for new researches and developments
Directory of Open Access Journals (Sweden)
Fang Gao
2017-04-01
Full Text Available Summary: Notch signaling is critically involved in neural development, but the downstream effectors remain incompletely understood. In this study, we cultured neurospheres from Nestin-Cre-mediated conditional Rbp-j knockout (Rbp-j cKO and control embryos and compared their miRNA expression profiles using microarray. Among differentially expressed miRNAs, miR-342-5p showed upregulated expression as Notch signaling was genetically or pharmaceutically interrupted. Consistently, the promoter of the miR-342-5p host gene, the Ena-vasodilator stimulated phosphoprotein-like (Evl, was negatively regulated by Notch signaling, probably through HES5. Transfection of miR-342-5p promoted the differentiation of neural stem cells (NSCs into intermediate neural progenitors (INPs in vitro and reduced the stemness of NSCs in vivo. Furthermore, miR-342-5p inhibited the differentiation of neural stem/intermediate progenitor cells into astrocytes, likely mediated by targeting GFAP directly. Our results indicated that miR-342-5p could function as a downstream effector of Notch signaling to regulate the differentiation of NSCs into INPs and astrocytes commitment. : In this article, Han and colleagues show that miR-342-5p acts as a downstream effector of Notch signaling in the mouse CNS. Notch signal inhibits miR-342-5p expression by regulating its host gene Evl. And with attenuated Notch signal in NSCs, miR-342-5p is upregulated to promote NSCs transition into INPs, and to inhibit astrocyte commitment by targeting GFAP. Keywords: neural stem cells, intermediate neural progenitors, Notch, RBP-J, neuron, glia, miR-342-5p
Mixed Element Formulation for the Finite Element-Boundary Integral Method
National Research Council Canada - National Science Library
Meese, J; Kempel, L. C; Schneider, S. W
2006-01-01
A mixed element approach using right hexahedral elements and right prism elements for the finite element-boundary integral method is presented and discussed for the study of planar cavity-backed antennas...
Vicente, Tiago; Mota, José P B; Peixoto, Cristina; Alves, Paula M; Carrondo, Manuel J T
2011-01-01
The advent of advanced therapies in the pharmaceutical industry has moved the spotlight into virus-like particles and viral vectors produced in cell culture holding great promise in a myriad of clinical targets, including cancer prophylaxis and treatment. Even though a couple of cases have reached the clinic, these products have yet to overcome a number of biological and technological challenges before broad utilization. Concerning the manufacturing processes, there is significant research focusing on the optimization of current cell culture systems and, more recently, on developing scalable downstream processes to generate material for pre-clinical and clinical trials. We review the current options for downstream processing of these complex biopharmaceuticals and underline current advances on knowledge-based toolboxes proposed for rational optimization of their processing. Rational tools developed to increase the yet scarce knowledge on the purification processes of complex biologicals are discussed as alternative to empirical, "black-boxed" based strategies classically used for process development. Innovative methodologies based on surface plasmon resonance, dynamic light scattering, scale-down high-throughput screening and mathematical modeling for supporting ion-exchange chromatography show great potential for a more efficient and cost-effective process design, optimization and equipment prototyping. Copyright © 2011 Elsevier Inc. All rights reserved.
Continuous downstream processing for high value biological products: A Review.
Zydney, Andrew L
2016-03-01
There is growing interest in the possibility of developing truly continuous processes for the large-scale production of high value biological products. Continuous processing has the potential to provide significant reductions in cost and facility size while improving product quality and facilitating the design of flexible multi-product manufacturing facilities. This paper reviews the current state-of-the-art in separations technology suitable for continuous downstream bioprocessing, focusing on unit operations that would be most appropriate for the production of secreted proteins like monoclonal antibodies. This includes cell separation/recycle from the perfusion bioreactor, initial product recovery (capture), product purification (polishing), and formulation. Of particular importance are the available options, and alternatives, for continuous chromatographic separations. Although there are still significant challenges in developing integrated continuous bioprocesses, recent technological advances have provided process developers with a number of attractive options for development of truly continuous bioprocessing operations. © 2015 Wiley Periodicals, Inc.
Sandoval, Imelda T; Delacruz, Richard Glenn C; Miller, Braden N; Hill, Shauna; Olson, Kristofor A; Gabriel, Ana E; Boyd, Kevin; Satterfield, Christeena; Remmen, Holly Van; Rutter, Jared; Jones, David A
2017-04-11
Elucidating signaling pathways that regulate cellular metabolism is essential for a better understanding of normal development and tumorigenesis. Recent studies have shown that mitochondrial pyruvate carrier 1 (MPC1) , a crucial player in pyruvate metabolism, is downregulated in colon adenocarcinomas. Utilizing zebrafish to examine the genetic relationship between MPC1 and Adenomatous polyposis coli (APC), a key tumor suppressor in colorectal cancer, we found that apc controls the levels of mpc1 and that knock down of mpc1 recapitulates phenotypes of impaired apc function including failed intestinal differentiation. Exogenous human MPC1 RNA rescued failed intestinal differentiation in zebrafish models of apc deficiency. Our data demonstrate a novel role for apc in pyruvate metabolism and that pyruvate metabolism dictates intestinal cell fate and differentiation decisions downstream of apc .
On the interaction of a fan stator and acoustic treatments using the transfer element method
Energy Technology Data Exchange (ETDEWEB)
Wang Xiaoyu; Sun Xiaofeng [Fluid and Acoustic Engineering Laboratory, Beijing University of Aeroacoustics and Astronautics, Beijing 100083 (China)], E-mail: Sunxf@buaa.edu.cn
2010-02-15
In the present investigation, a theoretical model is suggested to study the interaction of a fan stator and acoustic treatments using the transfer element method. Firstly, the solution of an acoustic field caused by a fan stator in an infinite duct is extended to that in a finite domain with all knowns and unknowns on the interface plane. Secondly, the related numerical results for an annular cascade are compared with the data obtained by directly solving an integral equation based on the blade boundary condition, which have good agreement with each other. Finally, more emphasis is placed on studying how a fan stator interacts with both upstream and downstream acoustic treatments. It is found that the interaction has an important influence on sound attenuation. In addition, optimal sound attenuation will depend on the combined design of both acoustic treatment and the fan stator. (invited paper)
On the interaction of a fan stator and acoustic treatments using the transfer element method
International Nuclear Information System (INIS)
Wang Xiaoyu; Sun Xiaofeng
2010-01-01
In the present investigation, a theoretical model is suggested to study the interaction of a fan stator and acoustic treatments using the transfer element method. Firstly, the solution of an acoustic field caused by a fan stator in an infinite duct is extended to that in a finite domain with all knowns and unknowns on the interface plane. Secondly, the related numerical results for an annular cascade are compared with the data obtained by directly solving an integral equation based on the blade boundary condition, which have good agreement with each other. Finally, more emphasis is placed on studying how a fan stator interacts with both upstream and downstream acoustic treatments. It is found that the interaction has an important influence on sound attenuation. In addition, optimal sound attenuation will depend on the combined design of both acoustic treatment and the fan stator. (invited paper)
DEFF Research Database (Denmark)
Pinto, Rita; Hansen, Lars; Hintze, John
2017-01-01
to be a limitation. Here, we report that the combined use of genome editing tools and last generation Tet-On systems can resolve these issues. Our principle is based on precise integration of inducible transcriptional elements (coined PrIITE) targeted to: (i) exons of an endogenous gene of interest (GOI) and (ii......Tetracycline-based inducible systems provide powerful methods for functional studies where gene expression can be controlled. However, the lack of tight control of the inducible system, leading to leakiness and adverse effects caused by undesirable tetracycline dosage requirements, has proven......) a safe harbor locus. Using PrIITE cells harboring a GFP reporter or CDX2 transcription factor, we demonstrate discrete inducibility of gene expression with complete abrogation of leakiness. CDX2 PrIITE cells generated by this approach uncovered novel CDX2 downstream effector genes. Our results provide...
International Nuclear Information System (INIS)
Luck, J.M.; Othman, D.B.
1997-01-01
Major, trace elements and Sr-Pb isotope data on the dissolved and particulate phases are reported for water samples taken regularly over the September flood of a Mediterranean river (S France). This river drains runoff from a small, carbonate, karstified watershed with Miocene and Jurassic lithologies, and characterized by agricultural, urban and road network activities. The objective is to combine all the data into a dynamic model for constraining the origin(s) and movements of waters and of their loads. Furthermore, for metals, it becomes then feasible to know their fate and bioavailability downstream
Directory of Open Access Journals (Sweden)
L. Vollmer
2016-09-01
Full Text Available An intentional yaw misalignment of wind turbines is currently discussed as one possibility to increase the overall energy yield of wind farms. The idea behind this control is to decrease wake losses of downstream turbines by altering the wake trajectory of the controlled upwind turbines. For an application of such an operational control, precise knowledge about the inflow wind conditions, the magnitude of wake deflection by a yawed turbine and the propagation of the wake is crucial. The dependency of the wake deflection on the ambient wind conditions as well as the uncertainty of its trajectory are not sufficiently covered in current wind farm control models. In this study we analyze multiple sources that contribute to the uncertainty of the estimation of the wake deflection downstream of yawed wind turbines in different ambient wind conditions. We find that the wake shapes and the magnitude of deflection differ in the three evaluated atmospheric boundary layers of neutral, stable and unstable thermal stability. Uncertainty in the wake deflection estimation increases for smaller temporal averaging intervals. We also consider the choice of the method to define the wake center as a source of uncertainty as it modifies the result. The variance of the wake deflection estimation increases with decreasing atmospheric stability. Control of the wake position in a highly convective environment is therefore not recommended.
The insulin receptor substrate (IRS)-1 pleckstrin homology domain functions in downstream signaling.
Vainshtein, I; Kovacina, K S; Roth, R A
2001-03-16
The pleckstrin homology (PH) domain of the insulin receptor substrate-1 (IRS-1) plays a role in directing this molecule to the insulin receptor, thereby regulating its tyrosine phosphorylation. In this work, the role of the PH domain in subsequent signaling was studied by constructing constitutively active forms of IRS-1 in which the inter-SH2 domain of the p85 subunit of phosphatidylinositol 3-kinase was fused to portions of the IRS-1 molecule. Chimeric molecules containing the PH domain were found to activate the downstream response of stimulating the Ser/Thr kinase Akt. A chimera containing point mutations in the PH domain that abolished the ability of this domain to bind phosphatidylinositol 4,5-bisphosphate prevented these molecules from activating Akt. These mutations also decreased by about 70% the amount of the constructs present in a particulate fraction of the cells. These results indicate that the PH domain of IRS-1, in addition to directing this protein to the receptor for tyrosine phosphorylation, functions in the ability of this molecule to stimulate subsequent responses. Thus, compromising the function of the PH domain, e.g. in insulin-resistant states, could decrease both the ability of IRS-1 to be tyrosine phosphorylated by the insulin receptor and to link to subsequent downstream targets.
Spinazzola, Janelle M.; Kunkel, Louis M.
2016-01-01
Introduction Since the identification of the dystrophin gene in 1986, a cure for Duchenne muscular dystrophy (DMD) has yet to be discovered. Presently, there are a number of genetic-based therapies in development aimed at restoration and/or repair of the primary defect. However, growing understanding of the pathophysiological consequences of dystrophin absence has revealed several promising downstream targets for the development of therapeutics. Areas covered In this review, we discuss various strategies for DMD therapy targeting downstream consequences of dystrophin absence including loss of muscle mass, inflammation, fibrosis, calcium overload, oxidative stress, and ischemia. The rationale of each approach and the efficacy of drugs in preclinical and clinical studies are discussed. Expert opinion For the last 30 years, effective DMD drug therapy has been limited to corticosteroids, which are associated with a number of negative side effects. Our knowledge of the consequences of dystrophin absence that contribute to DMD pathology has revealed several potential therapeutic targets. Some of these approaches may have potential to improve or slow disease progression independently or in combination with genetic-based approaches. The applicability of these pharmacological therapies to DMD patients irrespective of their genetic mutation, as well as the potential benefits even for advanced stage patients warrants their continued investigation. PMID:28670506
Element-topology-independent preconditioners for parallel finite element computations
Park, K. C.; Alexander, Scott
1992-01-01
A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.
Downstream reporter gene imaging for signal transduction pathway of dopamine type 2 receptor
International Nuclear Information System (INIS)
Le, Uyenchi N.; Min, Jung Joon; Moon, Sung Min; Bom, Hee Seung
2004-01-01
The Dopamine 2 receptor (D2R) signal pathway regulates gene expression by phosphorylation of proteins including cAMP reponse element-binding protein (CREB), a transcription factor. In this study, we developed a reporter strategy using the GAL4 fusion CREB to assess the phosphorylation of CREB, one of the targets of the D2R signal transduction pathway. We used three plasmids: GAL4 fusion transactivator (pCMV-CREB), firefly luciferase reporter with GAL4 binding sites (pG5-FLUC), and D2R plasmid (pCMV-D2R). Group 1 293T cells were transiently transfected with pCMV-CREB and pG5-FLUC, and group 2 cells were transfected with all three plasmids. Transfected cells were stimulated with different concentrations of dopamine (0-200 M). For animal studies, group 1 and 2 cells (1x10 6 ) were subcutaneously injected on the left and right thigh of six nude mice, respectively. Dopamine stimiulation was performed with intraperitoneal injection of L-DOPA incombination with carbidopa, a peripheral DOPA decarboxylase inhibitor. Bioluminescence optical imaging studies were performed before and after L-DOPA injection. In cell culture studies, group 1 cells showed strong luciferase activity which implies direct activation of the signaling pathway due to growth factors contained in culture medium. Group 2 cells showed strong luciferase activity and a further increase after administration of dopamine. In animal studies, group 1 and 2 cells showed bioluminescence signal before L-DOPA injection, but signal from group 2 cells significantly increased 12 h after L-DOPA injection. The signal from group 1 cells disappeared thereafter, but group 2 cells continued to show signal until 36 h of L-DOPA injection. This study demonstrates imaging of the D2R signal transduction pathway and should be useful for noninvasive imaging of downstream effects of G-coupled protein pathways
European downstream oil industry safety performance. Statistical summary of reported incidents 2009
International Nuclear Information System (INIS)
Burton, A.; Den Haan, K.H.
2010-10-01
The sixteenth such report by CONCAWE, this issue includes statistics on workrelated personal injuries for the European downstream oil industry's own employees as well as contractors for the year 2009. Data were received from 33 companies representing more than 97% of the European refining capacity. Trends over the last sixteen years are highlighted and the data are also compared to similar statistics from related industries. In addition, this report presents the results of the first Process Safety Performance Indicator data gathering exercise amongst the CONCAWE membership.
Aberrations and Emittance Growth in the DARHT 2nd Axis Downstream Transport
Energy Technology Data Exchange (ETDEWEB)
Schulze, Martin E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-10-24
The emittance of the DARHT 2nd Axis has been inferred from solenoid scans performed in the downstream transport (DST) region using a short kicked pulse. The beam spot size is measured by viewing optical transition radiation (OTR) in the near field as a function of the field (current) of a solenoid magnet (S4). The imaging station containing the OTR target is located about 100 cm downstream of the solenoid magnet. The emittance is then inferred using a beam optics code such as LAMDA or XTR by fitting the data to initial conditions upstream of the S4 solenoid magnet. The initial conditions are the beam size, beam convergence and emittance. The beam energy and current are measured. In preparation for a solenoid scan, the magnets upstream of the solenoid are adjusted to produce a round beam with no beam losses due to scraping in the beam tube. This is different from the standard tune in which the beam tune is adjusted to suppress the effects of ions and rf in the septum dump. In this standard tune, approximately 10% of the beam is lost due to scraping as the beam enters the small 3.75” ID beam tube after the septum. The normalized emittance inferred from recent solenoid scans typically ranges from 600 to 800 π(mm-mrad). This larger beam size increases the sensitivity to any non-linear fields in the Collins quadrupoles that are mounted along the small diameter beam tube. The primary magnet used to adjust the beam size in this region is the S3 solenoid magnet. Measurements made of the beam shape as the beam size was decreased showed significant structure consistent with non-linear fields. Using the measured magnetic fields in the Collins quadrupoles including higher order multipoles, the beam transport through the Collins quadrupoles is simulated and compared to the observed OTR images. The simulations are performed using the beam optics codes TRANSPORT [1] and TURTLE [2]. Estimates of the emittance growth and beam losses are made as a function of the S3
Olsthoorn, T.
2010-12-01
Groundwater from the Amsterdam Water Supply Dunes (GE: 52.35°N 4.55°E) has been used for the drinking water supply of Amsterdam since 1853. During the first half of the 20th century, severe intrusion and upconing occurred, with many of the wells turning brackish or saline. Already in 1903, the hydrologist/director of the Amsterdam Water Supply, Pennink, predicted this, based on his unique sand-box modeling, which he published in 1915 in the form of a large-size hard-bound book in four languages showing detailed black and white photographs of his tests. This book is now on the web: http://www.citg.tudelft.nl/live/pagina.jsp?id=68e12562-a4d2-489a-b82e-deca5dd32c42&lang=en Pennink devoted much of his work on saltwater upconing below wells, which he so feared. He simulated simultaneous flow of fresh and salt water, using milk to represent the saltwater having about the same density. With our current modeling tools, we can simulate his experiments, allowing to better understand his setup and even to verify our code. Pennink took interest in the way these cones form and in the point at which the salt water enters the screen. Surprizing, at least to many, is that this entry point is not necessarily the screen bottom. Measurements of the salinity distribution in salinized wells in the Amsterdam Water Supply Dune area confirmed this thirty years later when salinzation was severely occurring. The curved cone shape under ambient flow conditions provides part of the explanation why a short-term shut down of a well almost immediately diminishes salt concentrations, but salinization downstream of the wells in case with substantial lateral groundwater flow is not affected. Downstream salinization due to extraction was clearly shown in Pennink's experiments. However, the phenomenon seems still largely unknown or ignored. Downstream salinization also affects downstream heads for years after extraction has stopped. The presentation demonstrates and explains these local and more
A Practical Approach to Governance and Optimization of Structured Data Elements.
Collins, Sarah A; Gesner, Emily; Morgan, Steven; Mar, Perry; Maviglia, Saverio; Colburn, Doreen; Tierney, Diana; Rocha, Roberto
2015-01-01
Definition and configuration of clinical content in an enterprise-wide electronic health record (EHR) implementation is highly complex. Sharing of data definitions across applications within an EHR implementation project may be constrained by practical limitations, including time, tools, and expertise. However, maintaining rigor in an approach to data governance is important for sustainability and consistency. With this understanding, we have defined a practical approach for governance of structured data elements to optimize data definitions given limited resources. This approach includes a 10 step process: 1) identification of clinical topics, 2) creation of draft reference models for clinical topics, 3) scoring of downstream data needs for clinical topics, 4) prioritization of clinical topics, 5) validation of reference models for clinical topics, and 6) calculation of gap analyses of EHR compared against reference model, 7) communication of validated reference models across project members, 8) requested revisions to EHR based on gap analysis, 9) evaluation of usage of reference models across project, and 10) Monitoring for new evidence requiring revisions to reference model.
The transuranium elements: From neptunium and plutonium to element 112
International Nuclear Information System (INIS)
Hoffman, D.C.
1996-01-01
Beginning in the 1930's, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs
Olson, S. L.; Lee, J. R.; Fujita, O.; Kikuchi, M.; Kashiwagi, T.
2013-01-01
The effect of low velocity forced flow on microgravity flame spread is examined using quantitative analysis of infrared video imaging. The objective of the quantitative analysis is to provide insight into the mechanisms of flame spread in microgravity where the flame is able to spread from a central location on the fuel surface, rather than from an edge. Surface view calibrated infrared images of ignition and flame spread over a thin cellulose fuel were obtained along with a color video of the surface view and color images of the edge view using 35 mm color film at 2 Hz. The cellulose fuel samples were mounted in the center of a 12 cm wide by 16 cm tall flow duct and were ignited in microgravity using a straight hot wire across the center of the 7.5 cm wide by 14 cm long samples. Four cases, at 1 atm. 35%O2 in N2, at forced flows from 2 cm/s to 20 cm/s are presented here. This flow range captures flame spread from strictly upstream spread at low flows, to predominantly downstream spread at high flow. Surface temperature profiles are evaluated as a function of time, and temperature gradients for upstream and downstream flame spread are measured. Flame spread rates from IR image data are compared to visible image spread rate data. IR blackbody temperatures are compared to surface thermocouple readings to evaluate the effective emissivity of the pyrolyzing surface. Preheat lengths and pyrolysis lengths are evaluated both upstream and downstream of the central ignition point. A surface energy balance estimates the net heat flux from the flame to the fuel surface along the length of the fuel. Surface radiative loss and gas-phase radiation from soot are measured relative to the net heat feedback from the flame. At high surface heat loss relative to heat feedback, the downstream flame spread does not occur.
Price rigidity in the downstream petroleum industry in New Zealand: where does it happen?
International Nuclear Information System (INIS)
Delpachitra, S.B.
2002-01-01
This paper examines the pricing behaviour of the downstream petroleum product market in New Zealand using multivariate error correction models. The unique feature of these models is the use of actual weekly wholesale and retail prices of diesel and unleaded petrol to measure the relative rigidity of domestic prices. The results suggest that price adjustments in domestic markets in response to price changes in world crude oil markets and refined product markets are very weak. Domestic wholesale prices appear to be the key variable in determining retail prices. Lack of competition in the wholesale sector is found to be the main reason for weak price adjustments. (author)
Price rigidity in the downstream petroleum industry in New Zealand. Where does it happen?
International Nuclear Information System (INIS)
Delpachitra, Sarath B.
2002-01-01
This paper examines the pricing behaviour of the downstream petroleum product market in New Zealand using multivariate error correction models. The unique feature of these models is the use of actual weekly wholesale and retail prices of diesel and unleaded petrol to measure the relative rigidity of domestic prices. The results suggest that price adjustments in domestic markets in response to price changes in world crude oil markets and refined product markets are very weak. Domestic wholesale prices appear to be the key variable in determining retail prices. Lack of competition in the wholesale sector is found to be the main reason for weak price adjustments
Strack, O. D. L.
2018-02-01
We present equations for new limitless analytic line elements. These elements possess a virtually unlimited number of degrees of freedom. We apply these new limitless analytic elements to head-specified boundaries and to problems with inhomogeneities in hydraulic conductivity. Applications of these new analytic elements to practical problems involving head-specified boundaries require the solution of a very large number of equations. To make the new elements useful in practice, an efficient iterative scheme is required. We present an improved version of the scheme presented by Bandilla et al. (2007), based on the application of Cauchy integrals. The limitless analytic elements are useful when modeling strings of elements, rivers for example, where local conditions are difficult to model, e.g., when a well is close to a river. The solution of such problems is facilitated by increasing the order of the elements to obtain a good solution. This makes it unnecessary to resort to dividing the element in question into many smaller elements to obtain a satisfactory solution.
International Nuclear Information System (INIS)
Ilbaeck, Nils-Gunnar; Glynn, Anders W.; Wikberg, Lotta; Netzel, Elvy; Lindh, Ulf
2004-01-01
In experimental studies on the common human coxsackievirus B type 3 (CB3) infection, administered cadmium (Cd) is known to accumulate in the liver and kidneys. CB3 adapted to Balb/c mice was used to study whether infection affects the Cd-binding protein, metallothionein (MT) and if this alters the normal physiological trace element balance in the liver, kidney, spleen and brain. On day 3 of infection, degradation of liver proteins (44%, P<0.01) occurred, whereas in the spleen, protein increased (63%, P<0.05). The infection increased MT five-fold (P<0.01) in liver and kidneys, and in spleen by 34% (P<0.05). A redistribution of Cd and copper (Cu) from the liver to the kidney was associated with this increase in MT, resulting in an increased (P<0.01) kidney/liver ratio for both elements. The infection increased the zinc (Zn) concentration more in the kidney than in the liver, but the kidney/liver ratio was not significantly affected. Results show that MT is increased in several organs during the early phase of infection and is associated with redistribution of both essential and non-essential trace elements. This may be a normal response in common infections that could adversely influence the pathogenesis when the host is concomitantly exposed to potentially toxic trace elements, even at levels in the physiological range
The Arabidopsis PLAT domain protein1 is critically involved in abiotic stress tolerance
DEFF Research Database (Denmark)
Hyun, Tae Kyung; van der Graaff, Eric; Albacete, Alfonso
2014-01-01
. Abiotic stress treatments induced PLAT1 expression and caused expansion of its expression domain. The ABF/ABRE transcription factors, which are positive mediators of abscisic acid signalling, activate PLAT1 promoter activity in transactivation assays and directly bind to the ABRE elements located...... in this promoter in electrophoretic mobility shift assays. This suggests that PLAT1 represents a novel downstream target of the abscisic acid signalling pathway. Thus, we showed that PLAT1 critically functions as positive regulator of abiotic stress tolerance, but also is involved in regulating plant growth...
Development of polygon elements based on the scaled boundary finite element method
International Nuclear Information System (INIS)
Chiong, Irene; Song Chongmin
2010-01-01
We aim to extend the scaled boundary finite element method to construct conforming polygon elements. The development of the polygonal finite element is highly anticipated in computational mechanics as greater flexibility and accuracy can be achieved using these elements. The scaled boundary polygonal finite element will enable new developments in mesh generation, better accuracy from a higher order approximation and better transition elements in finite element meshes. Polygon elements of arbitrary number of edges and order have been developed successfully. The edges of an element are discretised with line elements. The displacement solution of the scaled boundary finite element method is used in the development of shape functions. They are shown to be smooth and continuous within the element, and satisfy compatibility and completeness requirements. Furthermore, eigenvalue decomposition has been used to depict element modes and outcomes indicate the ability of the scaled boundary polygonal element to express rigid body and constant strain modes. Numerical tests are presented; the patch test is passed and constant strain modes verified. Accuracy and convergence of the method are also presented and the performance of the scaled boundary polygonal finite element is verified on Cook's swept panel problem. Results show that the scaled boundary polygonal finite element method outperforms a traditional mesh and accuracy and convergence are achieved from fewer nodes. The proposed method is also shown to be truly flexible, and applies to arbitrary n-gons formed of irregular and non-convex polygons.
Prospects seen in problems of C.I.S. downstream sector
International Nuclear Information System (INIS)
Phillips, S.; Morgan, T.
1992-01-01
For good reasons the attention of Russian authorities and western investors has until now focused on problems of the upstream oil sector in the Commonwealth of Independent States and the Sharp fall in output since the late 1980s. This article attempts to give a more balanced view of the industry by drawing attention to the problems and opportunities in the refining and distribution sector, where western companies are now beginning to invest, and comparing the investment opportunities with those in the upstream. It concludes that given recent experience of the high cost and practical difficulties of increasing crude output, it would make more commercial and economic sense to direct a higher proportion of the industry's investment into improving the effectiveness of the downstream sector
Energy deposition in a thin copper target downstream and off-axis of a proton-radiography target
International Nuclear Information System (INIS)
Greene, G.A.; Finfrock, C.C.; Snead, C.L.; Hanson, A.L.; Murray, M.M.
2002-01-01
A series of proton energy-deposition experiments was conducted to measure the energy deposited in a copper target located downstream and off-axis of a high-energy proton-radiography target. The proton/target interactions involved low-intensity bunches of protons at 24 GeV/c onto a spherical target consisting of concentric shells of tungsten and copper. The energy-deposition target was placed at five locations downstream of the proton-radiography target, off-axis of the primary beam transport, and was either unshielded or shielded by 5 or 10 cm of lead. Maximum temperature rises measured in the energy-deposition target due to single bunches of 5x10 10 protons on the proton-radiography target were approximately 20 mK per bunch. The data indicated that the scattered radiation was concentrated close to the primary transport axis of the beam line. The energy deposited in the energy-deposition target was reduced by moving the target radially away from the primary transport axis. Placing lead shielding in front of the target further reduced the energy deposition. The measured temperature rises of the energy-deposition target were empirically correlated with the distance from the source, the number of protons incident on the proton-radiography target, the thickness of the lead shielding, and the angle of the energy-deposition target off-axis of the beam line from the proton-radiography target. The correlation of the experimental data that was developed provides a starting point for the evaluation of the shielding requirements for devices downstream of proton-radiography targets such as superconducting magnets
A reverse signaling pathway downstream of Sema4A controls cell migration via Scrib.
Sun, Tianliang; Yang, Lida; Kaur, Harmandeep; Pestel, Jenny; Looso, Mario; Nolte, Hendrik; Krasel, Cornelius; Heil, Daniel; Krishnan, Ramesh K; Santoni, Marie-Josée; Borg, Jean-Paul; Bünemann, Moritz; Offermanns, Stefan; Swiercz, Jakub M; Worzfeld, Thomas
2017-01-02
Semaphorins comprise a large family of ligands that regulate key cellular functions through their receptors, plexins. In this study, we show that the transmembrane semaphorin 4A (Sema4A) can also function as a receptor, rather than a ligand, and transduce signals triggered by the binding of Plexin-B1 through reverse signaling. Functionally, reverse Sema4A signaling regulates the migration of various cancer cells as well as dendritic cells. By combining mass spectrometry analysis with small interfering RNA screening, we identify the polarity protein Scrib as a downstream effector of Sema4A. We further show that binding of Plexin-B1 to Sema4A promotes the interaction of Sema4A with Scrib, thereby removing Scrib from its complex with the Rac/Cdc42 exchange factor βPIX and decreasing the activity of the small guanosine triphosphatase Rac1 and Cdc42. Our data unravel a role for Plexin-B1 as a ligand and Sema4A as a receptor and characterize a reverse signaling pathway downstream of Sema4A, which controls cell migration. © 2017 Sun et al.
DEFF Research Database (Denmark)
Xu, Xuebing
1997-01-01
Production of structured lipids by lipase-catalyzed interesterification attracts great interests recently. Structured lipids are defined, in this article, as triacylglycerols which contain both medium or short chain fatty acids and long chain fatty acids, each groups locating specifically in the sn......-2 position or sn-1,3 positions of glycerol backbone. These kinds of lipids are reported to be promising for both enteral and parenteral nutrition. However, acyl migration occurs in the reaction stage and downstream purification process. This side-reaction causes by-products which are harmful...
Is blade element momentum theory (BEM) enough for smart rotor design
Yu, W.; Simao Ferreira, C.J.; van Kuik, G.A.M.
2014-01-01
Smart rotor emerges as an innovation technique to reduce the impact of dynamic loading on wind turbines. Local movements of distributed aerodynamic devices will enhance the non-uniformity and dynamic effects of loading, which will challenge the applicability of the blade element momentum theory
International Nuclear Information System (INIS)
Seaborg, G.T.; Loveland, W.D.
1990-01-01
This book is the 12th volume in a series on transuranium elements. Varied techniques for production of these elements, the methods used in the identification, and the exquisitely refined microchemical techniques required to deal wth samples sometimes involving only a few atoms are described in detail. The chapter on synthesis of the new elements is liberally laced with reminiscences of the proud progenitors as well as the criteria for the discovery of a new chemical element. The authors lament that the superheavy elements (elements in the region of atomic number 114) still elude detection even though their creation should be possible, and some, at least, should survive long enough to be detected. One chapter in the book is devoted to practical applictions of uranium, and the transuranic elements
Experimental Study of Elements Promoting Mixing in Fuel Elements
International Nuclear Information System (INIS)
Silin, Nicolas; Juanico, Luis; Delmastro, Dario
2003-01-01
In the present work a thermal tracing technique is used to measure the increase of the mixing between subchannels in the presence of different mixing elements.As representative elements a spacer, a spacer with mixing vanes and turbulence promoter buttons were considered.The performance of these elements was evaluated by studying the behavior of a thermal trace in each case.Also the pressure drop for each case is presented.The results present a qualitative and quantitative guide for the application of each one of these appendages in future nuclear elements
Mothes, Patricia A; Vallance, James W.
2015-01-01
Lahars are volcanic debris flows that are dubbed primary when triggered by eruptive activity or secondary when triggered by other factors such as heavy rainfall after eruptive activity has waned. Variation in time and space of the proportion of sediment to water within a lahar dictates lahar flow phase and the resultant sedimentary character of deposits. Characteristics of source material and of debris eroded and incorporated during flow downstream may strongly affect the grain-size composition of flowing lahars and their deposits. Lahars borne on the flanks of two steep-sided stratocones in Ecuador exemplify two important lahar types. Glacier-clad Cotopaxi volcano has been a producer of primary lahars that flow great distances downstream. Such primary lahars include those of both clast-rich and matrix-rich composition—some of which have flowed as far as 325 km to the Pacific Ocean. Cotopaxi's last important eruption in 1877 generated formidable syneruptive lahars comparable in size to those that buried Armero, Colombia, following the 1985 eruption of Nevado del Ruiz volcano. In contrast, ash-producing eruptive activity during the past 15 years at Tungurahua volcano has generated a continual supply of fresh volcaniclastic debris that is regularly remobilized by precipitation. Between 2000 and 2011, 886 rain-generated lahars were registered at Tungurahua. These two volcanoes pose dramatically different hazards to nearby populations. At Tungurahua, the frequency and small sizes of lahars have resulted in effective mitigation measures. At Cotopaxi 137 years have passed since the last important lahar-producing eruption, and there is now a high-risk situation for more than 100,000 people living in downstream valleys.
Downstream plasma transport and metal ionization in a high-powered pulsed-plasma magnetron
International Nuclear Information System (INIS)
Meng, Liang; Szott, Matthew M.; McLain, Jake T.; Ruzic, David N.; Yu, He
2014-01-01
Downstream plasma transport and ionization processes in a high-powered pulsed-plasma magnetron were studied. The temporal evolution and spatial distribution of electron density (n e ) and temperature (T e ) were characterized with a 3D scanning triple Langmuir probe. Plasma expanded from the racetrack region into the downstream region, where a high n e peak was formed some time into the pulse-off period. The expansion speed and directionality towards the substrate increased with a stronger magnetic field (B), largely as a consequence of a larger potential drop in the bulk plasma region during a relatively slower sheath formation. The fraction of Cu ions in the deposition flux was measured on the substrate using a gridded energy analyzer. It increased with higher pulse voltage. With increased B field from 200 to 800 Gauss above racetrack, n e increased but the Cu ion fraction decreased from 42% to 16%. A comprehensive model was built, including the diffusion of as-sputtered Cu flux, the Cu ionization in the entire plasma region using the mapped n e and T e data, and ion extraction efficiency based on the measured plasma potential (V p ) distribution. The calculations matched the measurements and indicated the main causes of lower Cu ion fractions in stronger B fields to be the lower T e and inefficient ion extraction in a larger pre-sheath potential.
Corporate Governance and Human Resource Management in Nigeria’s Downstream Petroleum Sector
Directory of Open Access Journals (Sweden)
Oyewunmi Olabode A.
2017-06-01
Full Text Available The emergence of a ‘new world economy’ makes it imperative for corporate entities to adjust their corporate values, practices and internal processes. This paper explored the interrelatedness of selected corporate governance practices and human resource management outcomes. The paper relied on established corporate management theories as a platform for empirical consideration of selected issues relative to four established players in Nigeria’s downstream petroleum sector. A descriptive method was adopted and data was collected via a survey of 112 respondents. Contextual arguments were captured to achieve a robust appreciation of issues affecting individual participation and operations of corporate entities. The study found that there is a significant relationship between corporate governance practices and human resource management outcomes. Requisite conclusions and recommendations were provided in the light of empirical and theoretical findings.
Li, Miaoxin; Li, Jiang; Li, Mulin Jun; Pan, Zhicheng; Hsu, Jacob Shujui; Liu, Dajiang J; Zhan, Xiaowei; Wang, Junwen; Song, Youqiang; Sham, Pak Chung
2017-05-19
Whole genome sequencing (WGS) is a promising strategy to unravel variants or genes responsible for human diseases and traits. However, there is a lack of robust platforms for a comprehensive downstream analysis. In the present study, we first proposed three novel algorithms, sequence gap-filled gene feature annotation, bit-block encoded genotypes and sectional fast access to text lines to address three fundamental problems. The three algorithms then formed the infrastructure of a robust parallel computing framework, KGGSeq, for integrating downstream analysis functions for whole genome sequencing data. KGGSeq has been equipped with a comprehensive set of analysis functions for quality control, filtration, annotation, pathogenic prediction and statistical tests. In the tests with whole genome sequencing data from 1000 Genomes Project, KGGSeq annotated several thousand more reliable non-synonymous variants than other widely used tools (e.g. ANNOVAR and SNPEff). It took only around half an hour on a small server with 10 CPUs to access genotypes of ∼60 million variants of 2504 subjects, while a popular alternative tool required around one day. KGGSeq's bit-block genotype format used 1.5% or less space to flexibly represent phased or unphased genotypes with multiple alleles and achieved a speed of over 1000 times faster to calculate genotypic correlation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Estes, Lyndon; Chen, Peng; Debats, Stephanie; Evans, Tom; Ferreira, Stefanus; Kuemmerle, Tobias; Ragazzo, Gabrielle; Sheffield, Justin; Wolf, Adam; Wood, Eric; Caylor, Kelly
2018-01-01
Land cover maps increasingly underlie research into socioeconomic and environmental patterns and processes, including global change. It is known that map errors impact our understanding of these phenomena, but quantifying these impacts is difficult because many areas lack adequate reference data. We used a highly accurate, high-resolution map of South African cropland to assess (1) the magnitude of error in several current generation land cover maps, and (2) how these errors propagate in downstream studies. We first quantified pixel-wise errors in the cropland classes of four widely used land cover maps at resolutions ranging from 1 to 100 km, and then calculated errors in several representative "downstream" (map-based) analyses, including assessments of vegetative carbon stocks, evapotranspiration, crop production, and household food security. We also evaluated maps' spatial accuracy based on how precisely they could be used to locate specific landscape features. We found that cropland maps can have substantial biases and poor accuracy at all resolutions (e.g., at 1 km resolution, up to ∼45% underestimates of cropland (bias) and nearly 50% mean absolute error (MAE, describing accuracy); at 100 km, up to 15% underestimates and nearly 20% MAE). National-scale maps derived from higher-resolution imagery were most accurate, followed by multi-map fusion products. Constraining mapped values to match survey statistics may be effective at minimizing bias (provided the statistics are accurate). Errors in downstream analyses could be substantially amplified or muted, depending on the values ascribed to cropland-adjacent covers (e.g., with forest as adjacent cover, carbon map error was 200%-500% greater than in input cropland maps, but ∼40% less for sparse cover types). The average locational error was 6 km (600%). These findings provide deeper insight into the causes and potential consequences of land cover map error, and suggest several recommendations for land
Hutchins, M.; McGrane, S. J.; Miller, J. D.; Hitt, O.; Bowes, M.
2016-12-01
Continuous monitoring of water flows and quality is invaluable in improving understanding of the influence of urban areas on river health. When used to inform predictive modelling, insights can be gained as to how urban growth may affect the chemical and biological quality of rivers as they flow downstream into larger waterbodies. Water flow and quality monitoring in two urbanising sub-catchments (long term flow records are available, but particular focus is given to monitoring of an extended set of sites during prolonged winter rainfall. In the Ray sub-catchment streams were monitored in which urban cover varied across a range of 7-78%. A rural-urban gradient in DO was apparent in the low flow period prior to the storms. Transient low DO (works (STW). In this respect temperature- and respiration-driven DO sags in summer were at least if not more severe than those driven by the winter storms. Likewise, although winter storm NH4 concentrations violated EU legislation downstream of the STW, they were lower than summer concentrations in pollutant flushes following dry spells. In contrast the predominant phenomenon affecting water quality in the Cut during the storms was dilution. Here, a river water quality model was calibrated and applied over the course of a year to capture the importance of periphyton photosynthesis and respiration cycles in determining water quality and to predict the influence of hypothetical urban growth on downstream river health. The periods monitored intensively, dry spells followed by prolonged rainfall, represent: (i) marked changes in conditions likely to become more prevalent in future, (ii) situations under which water quality in urban areas is likely to be particularly vulnerable, being influenced for example by first flush effects followed by capacity exceedance at STW. Despite this, whilst being somewhat long lasting in places, impacts on DO were not severe.
Regmi, D.; Kargel, J. S.; Leonard, G. J.; Haritashya, U. K.; Karki, A.; Poudyal, S.
2017-12-01
With long-term temperature increases due to climate change, glacier lakes in several parts of the world are a fast-developing threat to infrastructure and downstream communities. There are more than 2000 glacier lakes in Nepal; while most pose no significant hazard to people, a comparative few are very dangerous, such as Tso Rolpa, Imja, Barun and Thulagi glacier lakes. The objectives of this study are to present 1) a review of prior glacier lake studies that have been carried out in the Nepal Himalaya; 2) recent research results, including bathymetric studies of the lakes; 3) a summary of possible infrastructure damages, especially multi-million-dollar hydropower projects, that are under threat of glacier lake outburst floods (GLOFs); 4) to present the outcome of the recently completed Imja lake lowering project, which is the highest altitude lake ever controlled by lowering the water level. This project is being undertaken as a response to a scientific ground-based bathymetric and geophysical survey funded by the United Nations Development Program and a satellite-based study of the long-term development of the lake (funded by NASA's SERVIR program, J. Kargel, PI). The objective of the Imja Lake GLOF mitigation project is to lower the water level by three meters to reduce the lake volume, increase the freeboard, and improve the safety of tourism, downstream communities, and the infrastructure of Nepal's Everest region. This GLOF mitigation step taken by Nepal's government to reduce the risk of an outburst flood is a good step to reduce the chances of a GLOF, and to reduce the magnitude of a disaster if a GLOF nonetheless occurs despite our best efforts. We will also present the prospects for the future of Imja Lake, including an outline of possible steps that could further reduce the hazards faced by downstream communities and infrastructure. Key words: Glacier Lakes; GLOF; Hydropower; Imja lake; lake lowering
Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA.
Chwalenia, Katarzyna; Qin, Fujun; Singh, Sandeep; Tangtrongstittikul, Panjapon; Li, Hui
2017-11-22
cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.
Critical interactionism: an upstream-downstream approach to health care reform.
Martins, Diane Cocozza; Burbank, Patricia M
2011-01-01
Currently, per capita health care expenditures in the United States are more than 20% higher than any other country in the world and more than twice the average expenditure for European countries, yet the United States ranks 37th in life expectancy. Clearly, the health care system is not succeeding in improving the health of the US population with its focus on illness care for individuals. A new theoretical approach, critical interactionism, combines symbolic interactionism and critical social theory to provide a guide for addressing health care problems from both an upstream and downstream approach. Concepts of meaning from symbolic interactionism and emancipation from critical perspective move across system levels to inform and reform health care for individuals, organizations, and societies. This provides a powerful approach for health care reform, moving back and forth between the micro and macro levels. Areas of application to nursing practice with several examples (patients with obesity; patients who are lesbian, gay, bisexual, and transgender; workplace bullying and errors), nursing education, and research are also discussed.
Energy Technology Data Exchange (ETDEWEB)
Ortiz, Rosario, E-mail: r_oh@ciencias.unam.mx [Laboratorio de Microscopía Electrónica, Facultad de Ciencias, Universidad Nacional Autónoma de México, México DF 04510, México (Mexico); Kouznetsova, Anna, E-mail: Anna.Kouznetsova@ki.se [Department of Cell and Molecular Biology, Karolinska Institutet, Berzelius väg 35, 171 77 Stockholm (Sweden); Echeverría-Martínez, Olga M., E-mail: omem@ciencias.unam.mx [Laboratorio de Microscopía Electrónica, Facultad de Ciencias, Universidad Nacional Autónoma de México, México DF 04510, México (Mexico); Vázquez-Nin, Gerardo H., E-mail: vazqueznin@ciencias.unam.mx [Laboratorio de Microscopía Electrónica, Facultad de Ciencias, Universidad Nacional Autónoma de México, México DF 04510, México (Mexico); Hernández-Hernández, Abrahan, E-mail: abrahan.hernandez@ki.se [Department of Cell and Molecular Biology, Karolinska Institutet, Berzelius väg 35, 171 77 Stockholm (Sweden)
2016-05-15
The synaptonemal complex (SC) is a proteinaceous structure that holds the homologous chromosomes in close proximity while they exchange genetic material in a process known as meiotic recombination. This meiotic recombination leads to genetic variability in sexually reproducing organisms. The ultrastructure of the SC is studied by electron microscopy and it is observed as a tripartite structure. Two lateral elements (LE) separated by a central region (CR) confer its classical tripartite organization. The LEs are the anchoring platform for the replicated homologous chromosomes to properly exchange genetic material with one another. An accurate assembly of the LE is indispensable for the proper completion of meiosis. Ultrastructural studies suggested that the LE is organized as a multilayered unit. However, no validation of this model has been previously provided. In this ultrastructural study, by using mice with different genetic backgrounds that affect the LE width, we provide further evidence that support a multilayered organization of the LE. Additionally, we provide data suggesting additional roles of the different cohesin complex components in the structure of the LEs of the SC. - Highlights: • The lateral element of the synaptonemal complex is a multilayered structure. • The width of the lateral element in synaptonemal complex-null mice is different. • Two cohesin complex cores plus one axial element form a wild-type lateral element. • The layers of the lateral element can be analyzed in different null mice models.
Kleinhans, M.G.; Wilbers, A.W.E.; Brinke, W.B.M. ten
2007-01-01
At river bifurcations water and sediment is divided among the downstream branches. Prediction of the sediment transport rate and divisionthereof at bifurcations is of utmost importance for understanding the evolution of the bifurcates for short-term management purposes and forlong-term fluvial plain
Directory of Open Access Journals (Sweden)
Susely F.S. Tada
2006-01-01
Full Text Available The potato (Solanum tuberosum L. mitochondrial cox3/sdh4/pseudo-cox2 gene cluster has previously been identified by heterologous hybridization using a Marchantia polymorpha sdh4 probe. In our present study we used Southern blotting using sdh4 and cox2 probes to show that the sdh4 and cox2 genes are clustered in the mitochondria of potato, soybean and pea. Northern blotting revealed cotranscription of sdh4 and cox2 in potato but not in cauliflower, indicating that these genes are not clustered in cauliflower. A putative recombination point was detected downstream of the cox2 pseudogene (pseudo-cox2 in potato mitochondrial DNA (mtDNA. This sequence corresponds to a 32 bp sequence which appears to be well-conserved and is adjacent to the terminals of some mitochondrial genes in Citrullus lanatus, Beta vulgaris and Arabidopsis thaliana and is probably involved in the genic rearrangements. It is possible the potato mtDNA pseudo-cox2 gene was generated by recombination during evolution in the same way as that of several other mitochondrial genes and remains as an inactive partial copy of the functional cox2 which was also detected in potato mtDNA.
Žic, E.; Arbanas, Ž.; Bićanić, N.; Ožanić, N.
2015-02-01
Mudflows regularly generate significant human and property losses. Analyzing mudflows is important to assess the risks and to delimit vulnerable areas where mitigation measures are required. The smoothed-particle hydrodynamics (SPH) model adopted here considers, in two phases, a granular skeleton with voids filled with either water or mud. The SPH depth-integrated numerical model (Pastor et al., 2009a) used for the present simulations is a 2-D model capable of predicting the runout distance, flow velocity, deposition pattern and the final volume of mudflows. It is based on mathematical and rheological models. In this study, the main characteristics of mudflow processes that have emerged in the past (1908) in the area downstream of the Grohovo landslide are examined, and the more relevant parameters and attributes describing the mudflow are presented. Principal equations that form the basis of the SPH depth-integrated model are reviewed and applied to analyze the Grohovo landslide and the propagation of the mudflow wave downstream of the landslide. Based on the SPH method, the runout distance, quantities of the deposited materials and the velocity of mudflow progression which occurred in the past at the observed area are analyzed and qualitatively compared to the recorded consequences of the actual event. Within the SPH simulation, the Newtonian rheological model in the turbulent flow regime and the Bingham rheological model were adopted and a comparison was made of the application of the Egashira and Hungr erosion law.
Microreactor and method for preparing a radiolabeled complex or a biomolecule conjugate
Energy Technology Data Exchange (ETDEWEB)
Reichert, David E; Kenis, Paul J. A.; Wheeler, Tobias D; Desai, Amit V; Zeng, Dexing; Onal, Birce C
2015-03-17
A microreactor for preparing a radiolabeled complex or a biomolecule conjugate comprises a microchannel for fluid flow, where the microchannel comprises a mixing portion comprising one or more passive mixing elements, and a reservoir for incubating a mixed fluid. The reservoir is in fluid communication with the microchannel and is disposed downstream of the mixing portion. A method of preparing a radiolabeled complex includes flowing a radiometal solution comprising a metallic radionuclide through a downstream mixing portion of a microchannel, where the downstream mixing portion includes one or more passive mixing elements, and flowing a ligand solution comprising a bifunctional chelator through the downstream mixing portion. The ligand solution and the radiometal solution are passively mixed while in the downstream mixing portion to initiate a chelation reaction between the metallic radionuclide and the bifunctional chelator. The chelation reaction is completed to form a radiolabeled complex.
Eyler, Sheila; Welsh, Stuart A.; Smith, David R.; Rockey, Mary
2016-01-01
Hydroelectric dams impact the downstream migrations of silver American Eels Anguilla rostrata via migratory delays and turbine mortality. A radiotelemetry study of American Eels was conducted to determine the impacts of five run-of-the-river hydroelectric dams located over a 195-km stretch of the Shenandoah River, Virginia–West Virginia, during fall 2007–summer 2010. Overall, 96 radio-tagged individuals (mean TL = 85.4 cm) migrated downstream past at least one dam during the study. Most American Eels passed dams relatively quickly; over half (57.9%) of the dam passage events occurred within 1 h of reaching a dam, and most (81.3%) occurred within 24 h of reaching the dam. Two-thirds of the dam passage events occurred via spill, and the remaining passage events were through turbines. Migratory delays at dams were shorter and American Eels were more likely to pass via spill over the dam during periods of high river discharge than during low river discharge. The extent of delay in migration did not differ between the passage routes (spill versus turbine). Twenty-eight American Eels suffered turbine-related mortality, which occurred at all five dams. Mortality rates for eels passing through turbines ranged from 15.8% to 40.7% at individual dams. Overall project-specific mortality rates (with all passage routes combined) ranged from 3.0% to 14.3%. To protect downstream-migrating American Eels, nighttime turbine shutdowns (1800–0600 hours) were implemented during September 15–December 15. Fifty percent of all downstream passage events in the study occurred during the turbine shutdown period. Implementation of the seasonal turbine shutdown period reduced cumulative mortality from 63.3% to 37.3% for American Eels passing all five dams. Modifying the turbine shutdown period to encompass more dates in the spring and linking the shutdowns to environmental conditions could provide greater protection to downstream-migrating American Eels.
Brown, R. D.; Jakubowski, A. K.
1974-01-01
Heat-transfer and pressure distributions were measured for laminar separated flows downstream of rearward-facing steps with and without mass suction. The flow conditions were such that the boundary-layer thickness was comparable to or larger than the step height. For both suction and no-suction cases, an increase in the step height resulted in a sharp decrease in the initial heat-transfer rates behind the step. Downstream, however, the heat transfer gradually recovered back to less than or near attached-flow values. Mass suction from the step base area increased the local heat-transfer rates; however, this effect was relatively weak for the laminar flows considered. Even removal of the entire approaching boundary layer raised the post-step heat-transfer rates only about 10 percent above the flatplate values. Post-step pressure distributions were found to depend on the entrainment conditions at separation. In the case of the solid-faced step, a sharp pressure drop behind the step was followed by a very short plateau and relatively fast recompression. For the slotted-step connected to a large plenum but without suction, the pressure drop at the base was much smaller and the downstream recompression more gradual than that for solid-faced step.
Bravo, Andrea G; Loizeau, Jean-Luc; Dranguet, Perrine; Makri, Stamatina; Björn, Erik; Ungureanu, Viorel Gh; Slaveykova, Vera I; Cosio, Claudia
2016-06-01
Chlor-alkali plants using mercury (Hg) cell technology are acute point sources of Hg pollution in the aquatic environment. While there have been recent efforts to reduce the use of Hg cells, some of the emitted Hg can be transformed to neurotoxic methylmercury (MeHg). Here, we aimed (i) to study the dispersion of Hg in four reservoirs located downstream of a chlor-alkali plant along the Olt River (Romania) and (ii) to track the activity of bacterial functional genes involved in Hg methylation. Total Hg (THg) concentrations in water and sediments decreased successively from the initial reservoir to downstream reservoirs. Suspended fine size particles and seston appeared to be responsible for the transport of THg into downstream reservoirs, while macrophytes reflected the local bioavailability of Hg. The concentration and proportion of MeHg were correlated with THg, but were not correlated with bacterial activity in sediments, while the abundance of hgcA transcript correlated with organic matter and Cl(-) concentration, indicating the importance of Hg bioavailability in sediments for Hg methylation. Our data clearly highlights the importance of considering Hg contamination as a legacy pollutant since there is a high risk of continued Hg accumulation in food webs long after Hg-cell phase out.
Kuijper, Arno; Groep, P. van der; Wall, E. van der; Diest, P.J. van
2005-01-01
INTRODUCTION Hypoxia-inducible factor 1 (HIF-1) alpha and its downstream targets carbonic anhydrase IX (CAIX) and vascular endothelial growth factor (VEGF) are key factors in the survival of proliferating tumor cells in a hypoxic microenvironment. We studied the expression and prognostic relevance
International Nuclear Information System (INIS)
Borrell, Asunción; Tornero, Victoria; Bhattacharjee, Dola; Aguilar, Alex
2016-01-01
The Sundarbans forest is the largest and one of the most diverse and productive mangrove ecosystems in the world. Located at the northern shoreline of the Bay of Bengal in the Indian Ocean and straddling India and Bangladesh, the mangrove forest is the result of three primary river systems that originate further north and northwest. During recent decades, the Sundarbans have been subject to increasing pollution by trace elements caused by the progressive industrialization and urbanization of the basins of these three rivers. As a consequence, animals and plants dwelling downstream in the mangroves are exposed to these pollutants in varying degrees, and may potentially affect human health when consumed. The aim of the present study was to analyse the concentrations of seven trace elements (Zn, Cu, Cr, Hg, Pb, Cd and As) in 14 different animal and plant species collected in the Sundarbans in Bangladesh to study their transfer through the food web and to determine whether their levels in edible species are acceptable for human consumption. δ"1"5N values were used as a proxy of the trophic level. A decrease in Zn, Cu, Pb and Cd levels was observed with increasing trophic position. Trace element concentrations measured in all organisms were, in general, lower than the concentrations obtained in other field studies conducted in the same region. When examined with respect to accepted international standards, the concentrations observed in fish and crustaceans were generally found to be safe for human consumption. However, the levels of Zn in Scylla serrata and Cr and Cd in Harpadon nehereus exceeded the proposed health advisory levels and may be of concern for human health. - Highlights: • Trace elements were determined in organisms from the Sundarbans mangrove. • The levels found were similar to those determined in wildlife from other mangroves. • Levels in three edible species were close to threshold limits for human consumption. • Except for Cr, As and Hg
Energy Technology Data Exchange (ETDEWEB)
Borrell, Asunción, E-mail: xonborrell@ub.edu [Department of Animal Biology, Institute of Biodiversity (IRBIO), University of Barcelona, Av. Diagonal, 643, Barcelona (Spain); Tornero, Victoria [Department of Animal Biology, Institute of Biodiversity (IRBIO), University of Barcelona, Av. Diagonal, 643, Barcelona (Spain); Bhattacharjee, Dola [Indian Institute of Science Education & Research — Kolkata, Department of Biological Sciences, Mohanpur Campus, Nadia, West Bengal (India); Aguilar, Alex [Department of Animal Biology, Institute of Biodiversity (IRBIO), University of Barcelona, Av. Diagonal, 643, Barcelona (Spain)
2016-03-01
The Sundarbans forest is the largest and one of the most diverse and productive mangrove ecosystems in the world. Located at the northern shoreline of the Bay of Bengal in the Indian Ocean and straddling India and Bangladesh, the mangrove forest is the result of three primary river systems that originate further north and northwest. During recent decades, the Sundarbans have been subject to increasing pollution by trace elements caused by the progressive industrialization and urbanization of the basins of these three rivers. As a consequence, animals and plants dwelling downstream in the mangroves are exposed to these pollutants in varying degrees, and may potentially affect human health when consumed. The aim of the present study was to analyse the concentrations of seven trace elements (Zn, Cu, Cr, Hg, Pb, Cd and As) in 14 different animal and plant species collected in the Sundarbans in Bangladesh to study their transfer through the food web and to determine whether their levels in edible species are acceptable for human consumption. δ{sup 15}N values were used as a proxy of the trophic level. A decrease in Zn, Cu, Pb and Cd levels was observed with increasing trophic position. Trace element concentrations measured in all organisms were, in general, lower than the concentrations obtained in other field studies conducted in the same region. When examined with respect to accepted international standards, the concentrations observed in fish and crustaceans were generally found to be safe for human consumption. However, the levels of Zn in Scylla serrata and Cr and Cd in Harpadon nehereus exceeded the proposed health advisory levels and may be of concern for human health. - Highlights: • Trace elements were determined in organisms from the Sundarbans mangrove. • The levels found were similar to those determined in wildlife from other mangroves. • Levels in three edible species were close to threshold limits for human consumption. • Except for Cr, As and Hg
Directory of Open Access Journals (Sweden)
Ashour Mohamed A.
2015-03-01
Full Text Available Using energy dissipaters on the soled aprons downstream of head structures is the main technique for accelerating hydraulic jump formation and dissipating a great amount of the residual harmful kinetic energy occurring downstream of head structures. In this paper, an experimental study was conducted to investigate some untested shapes of curved dissipaters with different angles of curvature and arrangements from two points of view. The first is to examine its efficiency in dissipating the kinetic water energy. The second is to examine the most effective shape and arrangement obtained from the aforementioned step in enriching the flow with dissolved oxygen for enhancement of the irrigation water quality. The study was held in the irrigation and hydraulic laboratory of the Civil Department, Faculty of Engineering, Assiut University, using a movable bed tilting channel 20 m long, 30 cm wide, and 50 cm high, using 21 types of curved dissipaters with different arrangements. A total of 660 runs were carried out. Results were analysed, tabulated and graphically presented, and new formulas were introduced to estimate the energy dissipation ratio, as well as the DO concentrations. Results in general showed that the dissipater performance is more tangible in dissipating the residual energy when the curvature is in the opposite direction to that of the flow. Also, the energy loss ratio increases with an increase in curvature angle (θ, until it reaches (θ = 120°, then it decreases again. The study also showed that using three rows of dissipaters give nearly the same effect as using four rows, concerning both the relative energy dissipation and dissolved oxygen content. So, it is recommended to use three rows of the curved dissipater with the angle of curvature (θ = 120° in the opposite direction to that of the flow to obtain the maximum percentage of water energy dissipation downstream of head structures, and maximum dissolved oxygen content too
Microbial production of scleroglucan and downstream processing
Directory of Open Access Journals (Sweden)
Natalia Alejandra Castillo
2015-10-01
Full Text Available Synthetic petroleum-based polymers and natural plant polymers have the disadvantage of restricted sources, in addition to the non-biodegradability of the former ones. In contrast, eco-sustainable microbial polysaccharides, of low-cost and standardized production, represent an alternative to address this situation. With a strong global market, they attracted worldwide attention because of their novel and unique physico-chemical properties as well as varied industrial applications, and many of them are promptly becoming economically competitive. Scleroglucan, a beta-1,3-beta-1,6-glucan secreted by Sclerotium fungi, exhibits high potential for commercialization and may show different branching frequency, side-chain length and/or molecular weight depending on the producing strain or culture conditions. Water-solubility, viscosifying ability and wide stability over temperature, pH and salinity make scleroglucan useful for different biotechnological (enhanced oil recovery, food additives, drug delivery, cosmetic and pharmaceutical products, biocompatible materials, etc., and biomedical (immunoceutical, antitumor, etc. applications. It can be copiously produced at bioreactor scale under standardized conditions, where a high EPS concentration normally governs the process optimization. Operative and nutritional conditions, as well as the incidence of scleroglucan downstream processing will be discussed in this chapter. The relevance of using standardized inocula from selected strains and experiences concerning the intricate scleroglucan scaling-up will be also herein outlined.
Directory of Open Access Journals (Sweden)
Matthew H. Wong
2016-07-01
Full Text Available BACKGROUND: Extensive cross talk exists between PI3K/Akt/mTOR and mitogen-activated protein kinase (MAPK pathways, and both are upregulated in pancreatic ductal adenocarcinoma (PDAC. Our previous study suggested that epidermal growth factor receptor inhibitor erlotinib which acts upstream of these pathways acts synergistically with PI3K inhibitors in PDAC. Horizontal combined blockade upstream and downstream of these two pathways is therefore explored. METHODS: Erlotinib paired with PI3K inhibitor (BYL719 was tested against erlotinib plus dual PI3K/mTOR inhibitor BEZ-235, and MEK inhibitor (PD98059 plus BEZ235, on five primary PDAC cell lines and on two pairs of parent and erlotinib-resistant (ER cell lines. A range of in vitro assays including cell proliferation, Western blotting, migration, clonogenic, cell cycle, and apopotic assays was used to test for the efficacy of combined blockade. RESULTS: Dual downstream blockade of the MAPK and PAM pathways was more effective in attenuating downstream molecular signals. Synergy was demonstrated for erlotinib and BEZ235 and for PD-98059 and BEZ-235. This resulted in a trend of increased growth cell cycle arrest, apoptosis, cell proliferation, and colony and migration suppression. This combination showed more efficacy in cell lines with acquired resistance to erlotinib. CONCLUSIONS: The additional mTOR blockade provided by BEZ235 in combined blockade resulted in increased anticancer effect. The hypersensitivity of ER cell lines to additional mTOR blockade suggested PAM pathway oncogenic dependence via mTOR. Dual downstream combined blockade of MAPK and PAM pathways with MEK and PI3K/mTOR inhibitor appeared most effective and represents an attractive therapeutic strategy against pancreatic cancer and its associated drug resistance.
International Nuclear Information System (INIS)
1995-11-01
This publication summarizes discussions and presents selected papers from a Technical Committee meeting that the IAEA convened in Obninsk, near Moscow, Russia, 7-11 November 1994 at the invitation of the Ministry of the Russian Federation on Atomic Energy, and which was hosted by the Institute of Physics and Power Engineering. The meeting focused on the disposition of plutonium produced from the operation of nuclear power plants in areas related to the nuclear fuel cycle. Plutonium is formed in all existing nuclear power plants and the unconsumed part remaining in spent fuel is a generic by-product of nuclear power generation. Over the next 15 to 20 years, a significant amount of plutonium will be produced in nuclear power stations worldwide, adding to amounts already in storage. Additionally, the world's plutonium stocks are being affected by decisions concerning the management and utilization of plutonium recovered from nuclear weapons which are being dismantled. In this context, national strategies are directed at reducing the stockpiles of separated plutonium worldwide, and in further developing technologies capable of safely and securely using and handling plutonium. The purpose of the IAEA's Technical Committee meeting was to consider unconventional approaches for plutonium disposition, both from the points of view of the fuel cycle as a whole and the specific types of nuclear fuel being used. The aims were to obtain technical descriptions of these approaches, engineering judgements on their technological status and development, and reports on national experience in this field. The meeting's results and conclusions are providing valuable guidance for future activities in this subject area. Refs, figs and tabs
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-11-01
This publication summarizes discussions and presents selected papers from a Technical Committee meeting that the IAEA convened in Obninsk, near Moscow, Russia, 7-11 November 1994 at the invitation of the Ministry of the Russian Federation on Atomic Energy, and which was hosted by the Institute of Physics and Power Engineering. The meeting focused on the disposition of plutonium produced from the operation of nuclear power plants in areas related to the nuclear fuel cycle. Plutonium is formed in all existing nuclear power plants and the unconsumed part remaining in spent fuel is a generic by-product of nuclear power generation. Over the next 15 to 20 years, a significant amount of plutonium will be produced in nuclear power stations worldwide, adding to amounts already in storage. Additionally, the world`s plutonium stocks are being affected by decisions concerning the management and utilization of plutonium recovered from nuclear weapons which are being dismantled. In this context, national strategies are directed at reducing the stockpiles of separated plutonium worldwide, and in further developing technologies capable of safely and securely using and handling plutonium. The purpose of the IAEA`s Technical Committee meeting was to consider unconventional approaches for plutonium disposition, both from the points of view of the fuel cycle as a whole and the specific types of nuclear fuel being used. The aims were to obtain technical descriptions of these approaches, engineering judgements on their technological status and development, and reports on national experience in this field. The meeting`s results and conclusions are providing valuable guidance for future activities in this subject area. Refs, figs and tabs.
Back, L. H.; Massier, P. F.; Roschke, E. J.
1972-01-01
Heat transfer and pressure measurements obtained in the separation, reattachment, and redevelopment regions along a tube and nozzle located downstream of an abrupt channel expansion are presented for a very high enthalpy flow of argon. The ionization energy fraction extended up to 0.6 at the tube inlet just downstream of the arc heater. Reattachment resulted from the growth of an instability in the vortex sheet-like shear layer between the central jet that discharged into the tube and the reverse flow along the wall at the lower Reynolds numbers, as indicated by water flow visualization studies which were found to dynamically model the high-temperature gas flow. A reasonably good prediction of the heat transfer in the reattachment region where the highest heat transfer occurred and in the redevelopment region downstream can be made by using existing laminar boundary layer theory for a partially ionized gas. In the experiments as much as 90 per cent of the inlet energy was lost by heat transfer to the tube and the nozzle wall.
Wind-Driven Ecological Flow Regimes Downstream from Hydropower Dams
Kern, J.; Characklis, G. W.
2012-12-01
Conventional hydropower can be turned on and off quicker and less expensively than thermal generation (coal, nuclear, or natural gas). These advantages enable hydropower utilities to respond to rapid fluctuations in energy supply and demand. More recently, a growing renewable energy sector has underlined the need for flexible generation capacity that can complement intermittent renewable resources such as wind power. While wind power entails lower variable costs than other types of generation, incorporating it into electric power systems can be problematic. Due to variable and unpredictable wind speeds, wind power is difficult to schedule and must be used when available. As a result, integrating large amounts of wind power into the grid may result in atypical, swiftly changing demand patterns for other forms of generation, placing a premium on sources that can be rapidly ramped up and down. Moreover, uncertainty in wind power forecasts will stipulate increased levels of 'reserve' generation capacity that can respond quickly if real-time wind supply is less than expected. These changes could create new hourly price dynamics for energy and reserves, altering the short-term financial signals that hydroelectric dam operators use to schedule water releases. Traditionally, hourly stream flow patterns below hydropower dams have corresponded in a very predictable manner to electricity demand, whose primary factors are weather (hourly temperature) and economic activity (workday hours). Wind power integration has the potential to yield more variable, less predictable flows at hydro dams, flows that at times could resemble reciprocal wind patterns. An existing body of research explores the impacts of standard, demand-following hydroelectric dams on downstream ecological flows; but weighing the benefits of increased reliance on wind power against further impacts to ecological flows may be a novel challenge for the environmental community. As a preliminary step in meeting this
International Nuclear Information System (INIS)
AuCoin, David P.; Colletti, Kelly S.; Cei, Sylvia A.; Papouskova, Iva; Tarrant, Margaret; Pari, Gregory S.
2004-01-01
Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8), has significant sequence homology to Epstein-Barr virus (EBV). In cell culture, HHV8 is primarily latent, and viral genes associated with lytic replication are not expressed. Two lytic origins of DNA replication (oriLyt) are present within the HHV8 genome and are composed of an AT-rich region adjacent to GC-rich DNA sequences. We have now identified essential cis- and trans-acting elements required for oriLyt-dependent DNA replication. The transient replication assay was used to show that two AT-rich elements, three consensus AP1 transcription factor-binding sites, an ORF50 response element (RE), and a consensus TATA box motif are essential for efficient origin-dependent DNA replication. Transient transfection of luciferase reporter constructs indicated that the downstream region of the HHV8 oriLyt responds to ORF50 and suggests that part of the oriLyt may be an enhancer/promoter. In addition, a transient cotransfection-replication assay elucidated the set of trans-acting factors required for lytic DNA replication. These factors consist of homologues to the core replication proteins: ORF6 (ssDNA binding protein), ORF9 (DNA polymerase), ORF40-41 (primase-associated factor), ORF44 (helicase), ORF56 (primase), and ORF59 (polymerase processivity factor) common to all herpesviruses along with ORF50 (K-Rta) and K8 (K-bZIP)
The distribution of wall shear stress downstream of a change in roughness
International Nuclear Information System (INIS)
Loureiro, J.B.R.; Sousa, F.B.C.C.; Zotin, J.L.Z.; Silva Freire, A.P.
2010-01-01
In the present work, six different experimental techniques are used to characterize the non-equilibrium flow downstream of a rough-to-smooth step change in surface roughness. Over the rough surface, wall shear stress results obtained through the form drag and the Reynolds stress methods are shown to be mutually consistent. Over the smooth surface, reference wall shear stress data is obtained through two optical methods: linear velocity profiles obtained through laser-Doppler anemometry and a sensor surface, the diverging fringe Doppler sensor. The work shows that the two most commonly used methods to determine the wall shear stress, the log-law gradient method and the Reynolds shear stress method, are completely inappropriate in the developing flow region. Preston tubes, on the other hand, are shown to perform well in the region of a non-equilibrium flow.
2012-12-18
... Water Quality Standards for the State of Florida's Streams and Downstream Protection Values for Lakes... its numeric water quality standards for nutrients in Florida that were promulgated and published on.... Water Quality Criteria D. EPA Determination Regarding Florida and EPA's Rulemaking E. EPA Promulgation...
Badal, Martí; Xamena, Noel; Cabré, Oriol
2013-09-10
Most foldback elements are defective due to the lack of coding sequences but some are associated with coding sequences and may represent the entire element. This is the case of the NOF sequences found in the FB of Drosophila melanogaster, formerly considered as an autonomous TE and currently proposed as part of the so-called FB-NOF element, the transposon that would be complete and fully functional. NOF is always associated with FB and never seen apart from the FB inverted repeats (IR). This is the reason why the FB-NOF composite element can be considered the complete element. At least one of its ORFs encodes a protein that has always been considered its transposase, but no detailed studies have been carried out to verify this. In this work we test the hypothesis that FB-NOF is an active transposon nowadays. We search for its expression product, obtaining its cDNA, and propose the ORF and the sequence of its potential protein. We found that the NOF protein is not a transposase as it lacks any of the motifs of known transposases and also shows structural homology with hydrolases, therefore FB-NOF cannot belong to the superfamily MuDR/foldback, as up to now it has been classified, and can be considered as a non-autonomous transposable element. The alignment with the published genomes of 12 Drosophila species shows that NOF presence is restricted only to the 6 Drosophila species belonging to the melanogaster group. Copyright © 2013 Elsevier B.V. All rights reserved.
Prediction of regulatory elements
DEFF Research Database (Denmark)
Sandelin, Albin
2008-01-01
Finding the regulatory mechanisms responsible for gene expression remains one of the most important challenges for biomedical research. A major focus in cellular biology is to find functional transcription factor binding sites (TFBS) responsible for the regulation of a downstream gene. As wet......-lab methods are time consuming and expensive, it is not realistic to identify TFBS for all uncharacterized genes in the genome by purely experimental means. Computational methods aimed at predicting potential regulatory regions can increase the efficiency of wet-lab experiments significantly. Here, methods...
Interfaces study of all-polysaccharide composite films
Czech Academy of Sciences Publication Activity Database
Šimkovic, I.; Kelnar, Ivan; Mendichi, R.; Tracz, A.; Filip, J.; Bertók, T.; Kasák, P.
2018-01-01
Roč. 72, č. 3 (2018), s. 711-718 ISSN 0366-6352 Institutional support: RVO:61389013 Keywords : all-polysaccharide composites * elemental analysis * film properties study Subject RIV: JI - Composite Materials OBOR OECD: Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics Impact factor: 1.258, year: 2016
(Pro)renin Receptor Is an Amplifier of Wnt/β-Catenin Signaling in Kidney Injury and Fibrosis.
Li, Zhen; Zhou, Lili; Wang, Yongping; Miao, Jinhua; Hong, Xue; Hou, Fan Fan; Liu, Youhua
2017-08-01
The (pro)renin receptor (PRR) is a transmembrane protein with multiple functions. However, its regulation and role in the pathogenesis of CKD remain poorly defined. Here, we report that PRR is a downstream target and an essential component of Wnt/ β -catenin signaling. In mouse models, induction of CKD by ischemia-reperfusion injury (IRI), adriamycin, or angiotensin II infusion upregulated PRR expression in kidney tubular epithelium. Immunohistochemical staining of kidney biopsy specimens also revealed induction of renal PRR in human CKD. Overexpression of either Wnt1 or β -catenin induced PRR mRNA and protein expression in vitro Notably, forced expression of PRR potentiated Wnt1-mediated β -catenin activation and augmented the expression of downstream targets such as fibronectin, plasminogen activator inhibitor 1, and α -smooth muscle actin ( α -SMA). Conversely, knockdown of PRR by siRNA abolished β -catenin activation. PRR potentiation of Wnt/ β -catenin signaling did not require renin, but required vacuolar H + ATPase activity. In the mouse model of IRI, transfection with PRR or Wnt1 expression vectors promoted β -catenin activation, aggravated kidney dysfunction, and worsened renal inflammation and fibrotic lesions. Coexpression of PRR and Wnt1 had a synergistic effect. In contrast, knockdown of PRR expression ameliorated kidney injury and fibrosis after IRI. These results indicate that PRR is both a downstream target and a crucial element in Wnt signal transmission. We conclude that PRR can promote kidney injury and fibrosis by amplifying Wnt/ β -catenin signaling. Copyright © 2017 by the American Society of Nephrology.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
DEFF Research Database (Denmark)
Kragh, Helge
2009-01-01
of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... and astronomers in the period until the spring of 1895, when William Ramsay serendipitously found the gas in uranium minerals? The hypothetical element helium was fairly well known, yet Ramsay's discovery owed little or nothing to Lockyer's solar element. Indeed, for a brief while it was thought that the two...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....
Energy Technology Data Exchange (ETDEWEB)
Falchook, Aaron D. [Department of Radiation Oncology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (United States); Salloum, Ramzi G. [Department of Health Services Policy and Management, University of South Carolina, Columbia, South Carolina (United States); Hendrix, Laura H. [Department of Radiation Oncology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (United States); Chen, Ronald C., E-mail: ronald_chen@med.unc.edu [Department of Radiation Oncology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (United States); Cecil G. Sheps Center for Health Services Research, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (United States); Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (United States)
2014-06-01
Purpose: For patients with a high likelihood of having metastatic disease (high-risk prostate cancer), bone scan is the standard, guideline-recommended test to look for bony metastasis. We quantified the use of bone scans and downstream procedures, along with associated costs, in patients with high-risk prostate cancer, and their use in low- and intermediate-risk patients for whom these tests are not recommended. Methods and Materials: Patients in the Surveillance, Epidemiology, and End Results (SEER)-Medicare database diagnosed with prostate cancer from 2004 to 2007 were included. Prostate specific antigen (PSA), Gleason score, and clinical T stage were used to define D'Amico risk categories. We report use of bone scans from the date of diagnosis to the earlier of treatment or 6 months. In patients who underwent bone scans, we report use of bone-specific x-ray, computed tomography (CT), and magnetic resonance imaging (MRI) scans, and bone biopsy within 3 months after bone scan. Costs were estimated using 2012 Medicare reimbursement rates. Results: In all, 31% and 48% of patients with apparent low- and intermediate-risk prostate cancer underwent a bone scan; of these patients, 21% underwent subsequent x-rays, 7% CT, and 3% MRI scans. Bone biopsies were uncommon. Overall, <1% of low- and intermediate-risk patients were found to have metastatic disease. The annual estimated Medicare cost for bone scans and downstream procedures was $11,300,000 for low- and intermediate-risk patients. For patients with apparent high-risk disease, only 62% received a bone scan, of whom 14% were found to have metastasis. Conclusions: There is overuse of bone scans in patients with low- and intermediate-risk prostate cancers, which is unlikely to yield clinically actionable information and results in a potential Medicare waste. However, there is underuse of bone scans in high-risk patients for whom metastasis is likely.
Kalderon, Ziva; Kumar, Sathish; Engelberg-Kulka, Hanna
2014-01-01
The Escherichia coli (E. coli) SOS response is the largest, most complex, and best characterized bacterial network induced by DNA damage. It is controlled by a complex network involving the RecA and LexA proteins. We have previously shown that the SOS response to DNA damage is inhibited by various elements involved in the expression of the E. coli toxin-antitoxin mazEF pathway. Since the mazEF module is present on the chromosomes of most E. coli strains, here we asked: Why is the SOS response found in so many E. coli strains? Is the mazEF module present but inactive in those strains? We examined three E. coli strains used for studies of the SOS response, strains AB1932, BW25113, and MG1655. We found that each of these strains is either missing or inhibiting one of several elements involved in the expression of the mazEF-mediated death pathway. Thus, the SOS response only takes place in E. coli cells in which one or more elements of the E. coli toxin-antitoxin module mazEF or its downstream pathway is not functioning.
Directory of Open Access Journals (Sweden)
Nicola V. Huck
2017-12-01
Full Text Available Reversible protein phosphorylation is a widespread posttranslational modification that plays a key role in eukaryotic signal transduction. Due to the dynamics of protein abundance, low stoichiometry and transient nature of protein phosphorylation, the detection and accurate quantification of substrate phosphorylation by protein kinases remains a challenge in phosphoproteome research. Here, we combine tandem metal-oxide affinity chromatography (tandemMOAC with stable isotope 15N metabolic labeling for the measurement and accurate quantification of low abundant, transiently phosphorylated peptides by mass spectrometry. Since tandemMOAC is not biased toward the enrichment of acidophilic, basophilic, or proline-directed kinase substrates, the method is applicable to identify targets of all these three types of protein kinases. The MKK7-MPK3/6 module, for example, is involved in the regulation of plant development and plant basal and systemic immune responses, but little is known about downstream cascade components. Using our here described phosphoproteomics approach we identified several MPK substrates downstream of the MKK7-MPK3/6 phosphorylation cascade in Arabidopsis. The identification and validation of dynamin-related protein 2 as a novel phosphorylation substrate of the MKK7-MPK3/6 module establishes a novel link between MPK signaling and clathrin-mediated vesicle trafficking.
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
Rüdt, Matthias; Briskot, Till; Hubbuch, Jürgen
2017-03-24
Process analytical technologies (PAT) for the manufacturing of biologics have drawn increased interest in the last decade. Besides being encouraged by the Food and Drug Administration's (FDA's) PAT initiative, PAT promises to improve process understanding, reduce overall production costs and help to implement continuous manufacturing. This article focuses on spectroscopic tools for PAT in downstream processing (DSP). Recent advances and future perspectives will be reviewed. In order to exploit the full potential of gathered data, chemometric tools are widely used for the evaluation of complex spectroscopic information. Thus, an introduction into the field will be given. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Christian eFalter
2015-03-01
Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.
International Nuclear Information System (INIS)
Hubert, J.
1979-01-01
The variational finite element method (of the Rayleigh-Ritz type) has been applied to solve the standard diffusion-convection equation of radial flow in a dispersive medium. It was shown that the imposing of the boundary condition ΔC/Δx = 0 (=null concentration gradient) introduced great errors in computation results. To remedy it this condition was imposed at the free end of the artifical domain. Its other end joined to the downstream boundary of the investigated domain. The results of calculations compared with the known analytical solutions of the parallel flow show their good accuracy. The method was used to discuss the applicability of the approximate analytical solutions of the radial flow. (author)
Persistence of Metal-rich Particles Downstream Zones of Acid Drainage Mixing in Andean Rivers
Pasten, P.; Montecinos, M.; Guerra, P. A.; Bonilla, C. A.; Escauriaza, C. R.; Dabrin, A.; Coquery, M.
2016-12-01
The Andes mountain range provides the setting for watersheds with high natural background of metals and for mining operations that enhance contaminant mobilization, notably in Northern and Central Chile. Dissolved and solid metal species are actively transported by streams to the Pacific Ocean from area and point sources, like acid drainage. We examine the response of metal rich particle suspensions downstream zones of mixing where shifts in the chemical environment occur. We propose a conceptual model which is used to analyze the fate of copper in the upper Mapocho watershed. The main source of copper is the Yerba Loca river, a naturally impacted stream with pH ranging from 3 to 7 and high concentrations of Cu (0.8 - 6.3 mg/L), Al (1.3 - 7.6 mg/L) and Fe (0.4 - 4.2 mg/L). Steep chemical shifts occur after the confluences with the San Francisco and the Molina rivers. We characterized stream chemistry, hydrological variables and suspended particles, including particle size distribution (PSD), turbidity, and total suspended solids. A marked seasonal behavior was observed, with a higher total Cu flux during smelting periods and a shift towards the dissolved phase during summer. When acid drainage is discharged into a receiving stream, incomplete mixing occurs thereby promoting the formation of a range of metal-rich solids with a characteristic PSD. Similarly, areas of chemical heterogeneity control the partition of metals associated to suspended geomaterials coming from bank and slope erosion. A highly dynamic process ensues where metastable phases shift to new equilibria as fully mixed conditions are reached. Depending on the reaction kinetics, some particles persist despite being exposed to thermodynamically unfavorable chemical environments. The persistence of metal-rich particles downstream zones of acid drainage mixing is important because it ultimately controls the flux of metals being delivered to the ocean by watersheds impacted by acid drainage. Funding from
Timovsky, J.; Gankema, Paulien; Pierik, Ronald; Holzinger, Rupert
2014-01-01
A system of two plant chambers and a downstream reaction chamber has been set up to investigate the emission of biogenic volatile organic compounds (BVOCs) and possible effects of pollutants such as ozone. The system can be used to compare BVOC emissions from two sets of differently treated plants,
Incidental potable water reuse in a Catalonian basin: living downstream
Directory of Open Access Journals (Sweden)
R. Mujeriego
2017-09-01
Full Text Available A preliminary assessment of incidental potable water reuse (IPR in the Llobregat River basin has been conducted by estimating the dilution factor of treated effluent discharges upstream of six river flow measurement sections. IPR in the Llobregat River basin is an everyday occurrence, because of the systematic discharge of treated effluents upstream of river sections used as drinking water sources. Average river flows at the Sant Joan Despí measurement section increased from 400,000 m3/d (2007 to 864,000 m3/d (2008 and to 931,000 m3/d (2013, while treated effluent discharges upstream of that section ranged from 109,000 m3/d to 114,000 m3/d in those years. The highest degree of IPR occurs downstream of the Abrera and Sant Joan Despí flow measurement sections, from where about half of the drinking water supplied to the Barcelona Metropolitan Area is abstracted. Based on average annual flows, the likelihood that drinking water produced from that river stretch contained treated effluent varied from 25% (2007 to 13% (2008 and to 12% (2013. Water agencies and drinking water production utilities have strived for decades to ensure that drinking water production satisfies applicable quality requirements and provides the required public health protection.
DEFF Research Database (Denmark)
Delgado-Baquerizo, Manuel; Reich, Peter B.; Khachane, Amit N.
2017-01-01
interactions) and microbial biomass (soil microbe-microbe interactions). In aggregate, these findings provide evidence that nutrient stoichiometry is a strong predictor of bacterial diversity and composition at a regional scale. This article is protected by copyright. All rights reserved....