Microstructures and Mechanical Properties of Austempering SUS440 Steel Thin Plates
Directory of Open Access Journals (Sweden)
Cheng-Yi Chen
2016-02-01
Full Text Available SUS440 is a high-carbon stainless steel, and its martensite matrix has high heat resistance, high corrosion resistance, and high pressure resistance. It has been widely used in mechanical parts and critical materials. However, the SUS440 martempered matrix has reliability problems in thin plate applications and thus research uses different austempering heat treatments (tempering temperature: 200 °C–400 °C to obtain a matrix containing bainite, retained austenite, martensite, and the M7C3 phase to investigate the relationships between the resulting microstructure and tensile mechanical properties. Experimental data showed that the austempering conditions of the specimen affected the volume fraction of phases and distribution of carbides. After austenitizing heat treatment (1080 °C for 30 min, the austempering of the SUS440 thin plates was carried out at a salt-bath temperature 300 °C for 120 min and water quenching was then used to obtain the bainite matrix with fine carbides, with the resulting material having a higher tensile fracture strength and average hardness (HRA 76 makes it suitable for use as a high-strength thin plate for industrial applications.
Shogrin, Bradley; Jones, William R., Jr.; Wilbur, Paul J.; Pilar, Herrera-Fierro; Williamson, Don L.
1995-01-01
The lubricating lifetime of thin films of a perfluoropolyether (PFPE) based on hexafluoropropene oxide in the presence of ion implanted 440C stainless steel is presented. Stainless steel discs, either unimplanted or implanted with N2, C, Ti, Ti + N2, or Ti + C had a thin film of PFPE (60-400 A) applied to them reproducibly (+/- 20 percent) and uniformly (+/- 15 percent) using a device developed for this study. The lifetimes of these films were quantified by measuring the number of sliding-wear cycles required to induce an increase in the friction coefficient from an initial value characteristic of the lubricated wear couple to a final, or failure value, characteristic of an unlubricated, unimplanted couple. The tests were performed in a dry nitrogen atmosphere (less than 1 percent RH) at room temperature using a 3 N normal load with a relative sliding speed of 0.05 m/s. The lubricated lifetime of the 440C couple was increased by an order of magnitude by implanting the disc with Ti. Ranked from most to least effective, the implanted species were: Ti; Ti+C; unimplanted; N2; C approximately equals Ti+N2. The mechanism postulated to explain these results involves the formation of a passivating or reactive layer which inhibits or facilitates the production of active sites. The corresponding surface microstructures induced by ion implantation, obtained using x-ray diffraction and conversion electron Mossbauer spectroscopy, ranked from most to least effective in enhancing lubricant lifetime were: amorphous Fe-Cr-Ti; amorphous Fe-Cr-Ti-C + TiC; unimplanted; epsilon-(Fe,Cr)(sub x)N, x = 2 or 3; amorphous Fe-Cr-C approximately equals amorphous Fe-Cr-Ti-N.
International Nuclear Information System (INIS)
Sasaki, Jun; Hayashi, Kazunori; Sugiyama, Kenji; Ichiko, Osami; Hashiguchi, Yoshihiro
1992-01-01
Titanium, yttrium, molybdenum, silver, chromium, hafnium, tantalum, tungsten and platinum ions generated by a metal vapor vacuum arc (MEVVA) ion source were implanted into 440C stainless steel in the dose region 10 17 ions cm -2 with extraction voltages of up to 70 kV. Glow discharge spectroscopy (GDS), friction coefficient, and Vickers microhardness of the specimens were studied. Grooves made by friction tests were investigated by electron probe microanalysis (EPMA). GDS showed incorporation of carbon in the yttrium, hafnium, tantalum, tungsten and platinum implanted specimens, as well as titanium implanted samples. A large amount of oxygen was observed in the yttrium implanted specimen. The friction coefficient was measured by reciprocating sliding of an unimplanted 440C ball without lubricant at a load of 0.245 N. The friction decreased and achieved a stable state after implantation of titanium, hafnium and tantalum. The friction coefficient of the platinum implanted specimen showed a gradual decrease after several cycles of sliding at high friction coefficient. The yttrium implanted sample exhibited a decreased but slightly unstable friction coefficient. Results from EPMA showed that the implanted elements, which gave decreased friction, remained even after sliding of 200 cycles. Implantation of chromium, molybdenum, silver and tungsten did not provide a decrease in friction and the implants were gone from the wear grooves after the sliding tests. (orig.)
Tribological performance of hard carbon coatings on 440C bearing steel
Energy Technology Data Exchange (ETDEWEB)
Kustas, F M; Misra, M S; Shepard, D F; Froechtenigt, J F [Martin Marietta Astronautics Group, Denver, CO (United States)
1991-11-01
Hard carbon coatings such as amorphous carbon, diamond and diamond-like carbon have received considerable attention for tribological applications owing to their high hardness, high modulus and desirable surface properties. Unfortunately, most of the deposition techniques induce high substrate temperatures that would temper traditional bearing steels and reduce the substrate load-carrying capability. Therefore, to effectively use these desirable coatings, a lower temperature deposition technique is required. Ion beam deposition can provide essentially ambient temperature conditions, accurate control of process parameters and good coating-substrate adhesion. To use these attributes, a test program was initiated to deposit mass-analyzed, high purity C{sup +} and CH{sub 4}{sup +} ions on molybdenum and 440C bearing steel for subsequent characterization by Raman spectroscopy and friction-wear tests. Results for a coating deposited from a carbon monoxide source showed an amorphous carbon-microcrystalline graphtie structure which exhibited very high microhardness and a three fold reduction in coefficient of friction for unlubricated tests compared to untreated 440C steel. In addition, incrementally increasing the applied load (by up to a factor of 5) resulted in progressively lower coefficients of friction, which conforms to solid lubrication theory. End-of-travel wear debris and some limited coating delamination were observed within thinner areas of the coating. Therefore an amorphous carbon-graphite coating applied to 440C steel at ambient temperature exhibits solid lubricating film characteristics with high load-carrying capability. (orig.).
Fundamental processes in ion plating
International Nuclear Information System (INIS)
Mattox, D.M.
1980-01-01
Ion plating is a generic term applied to film deposition processes in which the substrate surface and/or the depositing film is subjected to a flux of high energy particles sufficient to cause changes in the interfacial region of film properties compared to a nonbombarded deposition. Ion plating is being accepted as an alternative coating technique to sputter deposition, vacuum evaporation and electroplating. In order to intelligently choose between the various deposition techniques, the fundamental mechanisms, relating to ion plating, must be understood. This paper reviews the effects of low energy ion bombardment on surfaces, interface formation and film development as they apply to ion plating and the implementation and applications of the ion plating process
Calculation of the local power peaking near WWER-440 control assemblies with Hf plates
International Nuclear Information System (INIS)
Hegyi, Gy.; Hordosy, G.; Kereszturi, A.; Maraszy, Cs.; Temesvari, E.
2003-01-01
The original coupler design of the WWER-440 assemblies had the following well known deficiency: The relatively large amount of water in the coupler between the absorber and fuel port of the control assembly can cause undesirably sharp power peaking in the fuel rods next to the coupler. The power peaking can be especially high after control rod withdrawal when the coupler reached low burnup level region of the adjacent assembly. The modernized coupler design overcomes the original problem by applying a thin Hf plate in the critical region. The very complicated structure of the coupler requires the verification of the core design methods by high precision 3D Monte Carlo calculations. The paper presents an MCNP reference calculation on the control rod coupler benchmark with Hf absorber plates. The benchmark solution with the KARATE-440 code system is also presented. The need for treating the Hf burnout in the reflector region is investigated (Authors)
Alkali ion migration between stacked glass plates by corona discharge treatment
Energy Technology Data Exchange (ETDEWEB)
Kawaguchi, Keiga [Research Institute for Electronic Science, Hokkaido University, N20 W10, Kita-ku, Sapporo, Hokkaido 001-0020 (Japan); Suzuki, Toshio [Research Center, Asahi Glass Co., Ltd., 1150 Hazawa-cho, Kanagawa-ku, Yokohama, Kanagawa 221-8755 (Japan); Ikeda, Hiroshi [Art, Science and Technology Center for Cooperative Research, Kyushu University, 6-1 Kasuga-koen, Kasuga, Fukuoka 816-8580 (Japan); Sakai, Daisuke [Department of Electrical and Electronic Engineering, Kitami Institute of Technology, 165 Koen-cho, Kitami, Hokkaido 090-8507 (Japan); Funatsu, Shiro; Uraji, Keiichiro [Production Technology Center, Asahi Glass Co., Ltd., 1-1 Suehiro-cyo, Tsurumiku, Yokohama, Kanagawa 230-0045 (Japan); Yamamoto, Kiyoshi [Research Center, Asahi Glass Co., Ltd., 1150 Hazawa-cho, Kanagawa-ku, Yokohama, Kanagawa 221-8755 (Japan); Harada, Kenji [Department of Computer Science, Kitami Institute of Technology, 165 Koen-cho, Kitami, Hokkaido 090-8507 (Japan); Nishii, Junji, E-mail: nishii@es.hokudai.ac.jp [Research Institute for Electronic Science, Hokkaido University, N20 W10, Kita-ku, Sapporo, Hokkaido 001-0020 (Japan)
2015-05-30
Highlights: • Two stacked glass plates with a 1 mm gap were treated by corona discharge. • Spatial migration of alkali ion over the gap was demonstrated. • Hydrogen gas was necessary for uniform migration. • Surface modification was done with this process without high temperature or vacuum. - Abstract: Corona discharge reflects the spatial migration of alkali ions over a gap between two glass plates. This study examined stacked glass plates containing different alkali ions treated with the corona discharge plasma generated by applied voltage of 4.5 kV at 200 °C. Protons generated at the anode electrode penetrate into the potassium-ion-containing upper glass plate, which is located 5 mm below the anode electrode. Potassium ions intruded into the lower glass plate containing sodium ions placed on the cathode electrode, even over a 1 mm gap separating the plates. Finally, the sodium ion discharged on the cathode electrode. The hydrogen atmosphere was effective at inhibiting the potassium ion reaction with ambient gases during the spatial migration between the two glass plates.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Inert gas handling in ion plating systems
International Nuclear Information System (INIS)
Goode, A.R.; Burden, M.St.J.
1979-01-01
The results of an investigation into the best methods for production and monitoring of the inert gas environment for ion plating systems are reported. Work carried out on Pirani gauges and high pressure ion gauges for the measurement of pressures in the ion plating region (1 - 50mtorr) and the use of furnaces for cleaning argon is outlined. A schematic of a gas handling system is shown and discussed. (UK)
Applications of ion plating in metals fabrication
International Nuclear Information System (INIS)
Bell, R.T.; Thompson, J.C.
1974-01-01
Use of ion plating at the Oak Ridge Y-12 Plant to solve problems encountered in metals fabrication and processing are discussed. Three typical areas are covered. The first is the use of strike coats on various substrates for subsequent electrodeposition. The second area in which ion plating is shown to contribute to a process is in cold welding or room temperature bonding of metals. The third application involves plating U to promote safe handling, fission-product retention, and corrosion protection in nuclear reactors
International Nuclear Information System (INIS)
Fukutomi, M.; Fujitsuka, M.; Shikama, T.; Okada, M.
1985-01-01
Among the various low-Z coating-substrate systems proposed for fusion reactor first-wall applications, molybdenum coated with titanium carbide is considered very promising since it has a good capability of receiving heat from the plasma. The thermal stabilities of TiC layers ion plated onto the molybdenum substrate are discussed with particular reference to the interfacial reaction between the TiC coating and molybdenum. The deposition of an intermediate tungsten layer was found to be very effective in suppressing the formation of reaction layers, resulting in a marked improvement in thermal stabilities of TiC--Mo systems. Thermal shock test using a pulsed electron beam showed that the TiC coatings remained adherent to the molybdenum substrates during energy depositions high enough to melt the substrates within the area of beam deposition. The melt area of the TiC coatings apparently decreased when a tungsten intermediate layer was applied
An aluminium evaporation source for ion plating
International Nuclear Information System (INIS)
Walley, P.A.; Cross, K.B.
1977-01-01
Ion plating with aluminium is becoming increasingly accepted as a method of anti-corrosion surface passivation, the usual requirements being for a layer between 12 and 50 microns in thickness, (0.0005 to 0.002). The evaporation system described here offers a number of advantages over high power electron beam sources when used for aluminium ion plating. The source consists of a resistively heated, specially shaped, boron nitride-titanium diboride boat and a metering feed system. Its main features are small physical size, soft vacuum compatibility, low power consumption and metered evaporation output. (author)
Tribological behavior of 440C martensitic stainless steel from -184 C to 750 C
Slifka, A. J.; Compos, R.; Morgan, T. J.; Siegwarth, J. D.; Chaudhuri, Dilip K.
1992-01-01
Characterization of the coefficient of friction and wear rate of 440C stainless steel is needed to understand the effects of frictional heating in the bearings of the High Pressure Oxygen Turbopump of the Space Shuttle Main Engine. The coefficient of friction and wear rate have been measured over a range of temperature varying from liquid oxygen temperature (-184 C) to 750 C. The normal load has also been varied resulting in a variation of Hertzian stress from 0.915 to 3.660 GPa while the surface velocity has been varied from 0.5 to 2.0 m/s.
Target Plate Material Influence on Fullerene-C60 Laser Desorption/Ionization Efficiency
Zeegers, Guido P.; Günthardt, Barbara F.; Zenobi, Renato
2016-04-01
Systematic laser desorption/ionization (LDI) experiments of fullerene-C60 on a wide range of target plate materials were conducted to gain insight into the initial ion formation in matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. The positive and negative ion signal intensities of precursor, fragment, and cluster ions were monitored, varying both the laser fluence (0-3.53 Jcm-2) and the ion extraction delay time (0-950 ns). The resulting species-specific ion signal intensities are an indication for the ionization mechanisms that contribute to LDI and the time frames in which they operate, providing insight in the (MA)LDI primary ionization. An increasing electrical resistivity of the target plate material increases the fullerene-C60 precursor and fragment anion signal intensity. Inconel 625 and Ti90/Al6/V4, both highly electrically resistive, provide the highest anion signal intensities, exceeding the cation signal intensity by a factor ~1.4 for the latter. We present a mechanism based on transient electrical field strength reduction to explain this trend. Fullerene-C60 cluster anion formation is negligible, which could be due to the high extraction potential. Cluster cations, however, are readily formed, although for high laser fluences, the preferred channel is formation of precursor and fragment cations. Ion signal intensity depends greatly on the choice of substrate material, and careful substrate selection could, therefore, allow for more sensitive (MA)LDI measurements.
Corrosion resistance of a magnetic stainless steel ion-plated with titanium nitride.
Hai, K; Sawase, T; Matsumura, H; Atsuta, M; Baba, K; Hatada, R
2000-04-01
This in vitro study evaluated the corrosion resistance of a titanium nitride (TiN) ion-plated magnetic stainless steel (447J1) for the purpose of applying a magnetic attachment system to implant-supported prostheses made of titanium. The surface hardness of the TiN ion-plated 447J1 alloy with varying TiN thickness was determined prior to the corrosion testing, and 2 micrometers thickness was confirmed to be appropriate. Ions released from the 447J1 alloy, TiN ion-plated 447J1 alloy, and titanium into a 2% lactic acid aqueous solution and 0.1 mol/L phosphate buffered saline (PBS) were determined by means of an inductively coupled plasma atomic emission spectroscopy (ICP-AES). Long-term corrosion behaviour was evaluated using a multisweep cyclic voltammetry. The ICP-AES results revealed that the 447J1 alloy released ferric ions into both media, and that the amount of released ions increased when the alloy was coupled with titanium. Although both titanium and the TiN-plated 447J1 alloy released titanium ions into lactic acid solution, ferric and chromium ions were not released from the alloy specimen for all conditions. Cyclic voltamograms indicated that the long-term corrosion resistance of the 447J1 alloy was considerably improved by ion-plating with TiN.
Seeding of silicon by copper ion implantation for selective electroless copper plating
Energy Technology Data Exchange (ETDEWEB)
Bhansali, S.; Sood, D.K.; Zmood, R.B. [Microelectronic and Materials Technology Centre, Royal Melbourne Institute of Technolgy, Melbourne, VIC (Australia)
1993-12-31
We report on the successful use of copper(self) ion implantation into silicon to seed the electroless plating of copper on silicon (100) surfaces. Copper ions have been implanted to doses of 5E14-6.4E16 ions/cm{sup 2} using a MEEVA ion implanter at extraction voltage of 40kV. Dose was varied in fine steps to determine the threshold dose of 2E15 Cu ions/cm{sup 2} for `seed` formation of copper films on silicon using a commercial electroless plating solution. Plated films were studied with Rutherford backscattering spectrometry, scanning electron microscopy, EDX and profilometry . The adhesion of films was measured by `scotch tape test`. The adhesion was found to improve with increasing dose. However thicker films exhibited rather poor adhesion and high internal stress. SEM results show that the films grow first as isolated islands which become larger and eventually impinge into a continuous film as the plating time is increased. (authors). 5 refs., 1 tab., 3 figs.
Seeding of silicon by copper ion implantation for selective electroless copper plating
Energy Technology Data Exchange (ETDEWEB)
Bhansali, S; Sood, D K; Zmood, R B [Microelectronic and Materials Technology Centre, Royal Melbourne Institute of Technolgy, Melbourne, VIC (Australia)
1994-12-31
We report on the successful use of copper(self) ion implantation into silicon to seed the electroless plating of copper on silicon (100) surfaces. Copper ions have been implanted to doses of 5E14-6.4E16 ions/cm{sup 2} using a MEEVA ion implanter at extraction voltage of 40kV. Dose was varied in fine steps to determine the threshold dose of 2E15 Cu ions/cm{sup 2} for `seed` formation of copper films on silicon using a commercial electroless plating solution. Plated films were studied with Rutherford backscattering spectrometry, scanning electron microscopy, EDX and profilometry . The adhesion of films was measured by `scotch tape test`. The adhesion was found to improve with increasing dose. However thicker films exhibited rather poor adhesion and high internal stress. SEM results show that the films grow first as isolated islands which become larger and eventually impinge into a continuous film as the plating time is increased. (authors). 5 refs., 1 tab., 3 figs.
Seeding of silicon by copper ion implantation for selective electroless copper plating
International Nuclear Information System (INIS)
Bhansali, S.; Sood, D.K.; Zmood, R.B.
1993-01-01
We report on the successful use of copper(self) ion implantation into silicon to seed the electroless plating of copper on silicon (100) surfaces. Copper ions have been implanted to doses of 5E14-6.4E16 ions/cm 2 using a MEEVA ion implanter at extraction voltage of 40kV. Dose was varied in fine steps to determine the threshold dose of 2E15 Cu ions/cm 2 for 'seed' formation of copper films on silicon using a commercial electroless plating solution. Plated films were studied with Rutherford backscattering spectrometry, scanning electron microscopy, EDX and profilometry . The adhesion of films was measured by 'scotch tape test'. The adhesion was found to improve with increasing dose. However thicker films exhibited rather poor adhesion and high internal stress. SEM results show that the films grow first as isolated islands which become larger and eventually impinge into a continuous film as the plating time is increased. (authors). 5 refs., 1 tab., 3 figs
Zr/ZrC modified layer formed on AISI 440B stainless steel by plasma Zr-alloying
Energy Technology Data Exchange (ETDEWEB)
Shen, H.H.; Liu, L.; Liu, X.Z.; Guo, Q.; Meng, T.X.; Wang, Z.X.; Yang, H.J.; Liu, X.P., E-mail: liuxiaoping@tyut.edu.cn
2016-12-01
Highlights: • A Zr/ZrC modified layer was formed on AISI 440B stainless steel using plasma surface Zr-alloying. • The thickness of the modified layer increases with alloying temperature and time. • Formation mechanism of the modified layer is dependent on the mutual diffusion of Zr and substrate elements. • The modified surface shows an improved wear resistance. - Abstract: The surface Zr/ZrC gradient alloying layer was prepared by double glow plasma surface alloying technique to increase the surface hardness and wear resistance of AISI 440B stainless steel. The microstructure of the Zr/ZrC alloying layer formed at different alloying temperatures and times as well as its formation mechanism were discussed by using scanning electron microscopy, glow discharge optical emission spectrum, X-ray diffraction and X-ray photoelectron spectroscopy. The adhesive strength, hardness and tribological property of the Zr/ZrC alloying layer were also evaluated in the paper. The alloying surface consists of the Zr-top layer and ZrC-subsurface layer which adheres strongly to the AISI 440B steel substrate. The thickness of the Zr/ZrC alloying layer increases gradually from 16 μm to 23 μm with alloying temperature elevated from 900 °C to 1000 °C. With alloying time from 0.5 h to 4 h, the alloyed depth increases from 3 μm to 30 μm, and the ZrC-rich alloyed thickness vs time is basically parabola at temperature of 1000 °C. Both the hardness and wear resistance of the Zr/ZrC alloying layer obviously increase compared with untreated AISI 440B steel.
Ion-plated metal/ceramic interfaces
International Nuclear Information System (INIS)
Rigsbee, J.M.; Scott, P.A.; Knipe, R.K.; Ju, C.P.; Hock, V.F.
1986-01-01
Elemental Cu and Ti films have been deposited onto magnesia-alumina-silica ceramic substrates with a plasma-aided physical vapour deposition (ion-plating) process. Modifications in the structure and chemistry of the film, interface and substrate regions were investigated as a function of deposition process parameters (eg applied bias, voltage and current). The strength of the Cu/ceramic interface was found to be strongly influenced by both applied substrate bias voltage and substrate roughness. Films deposited with an applied substrate bias showed increasing adhesive strength with increasing bias. Microchemical analysis indicated that this enhanced adhesion is directly correlated with the development of a chemically graded interface region. The adhesive strength of the ion plated Cu films was also found to be improved with increasing substrate smoothness. The behaviour of Ti was found to be quite different from that of Cu. Ti generally has superior adhesion. This adhesion decreased for films deposited with a high bias voltage/current. From interfacial TEM it is shown that this is due to the formation of a compound at the Ti/ceramic interface. The thickness of this compound is important in adhesion. (UK)
Zr/ZrC modified layer formed on AISI 440B stainless steel by plasma Zr-alloying
Shen, H. H.; Liu, L.; Liu, X. Z.; Guo, Q.; Meng, T. X.; Wang, Z. X.; Yang, H. J.; Liu, X. P.
2016-12-01
The surface Zr/ZrC gradient alloying layer was prepared by double glow plasma surface alloying technique to increase the surface hardness and wear resistance of AISI 440B stainless steel. The microstructure of the Zr/ZrC alloying layer formed at different alloying temperatures and times as well as its formation mechanism were discussed by using scanning electron microscopy, glow discharge optical emission spectrum, X-ray diffraction and X-ray photoelectron spectroscopy. The adhesive strength, hardness and tribological property of the Zr/ZrC alloying layer were also evaluated in the paper. The alloying surface consists of the Zr-top layer and ZrC-subsurface layer which adheres strongly to the AISI 440B steel substrate. The thickness of the Zr/ZrC alloying layer increases gradually from 16 μm to 23 μm with alloying temperature elevated from 900 °C to 1000 °C. With alloying time from 0.5 h to 4 h, the alloyed depth increases from 3 μm to 30 μm, and the ZrC-rich alloyed thickness vs time is basically parabola at temperature of 1000 °C. Both the hardness and wear resistance of the Zr/ZrC alloying layer obviously increase compared with untreated AISI 440B steel.
DEFF Research Database (Denmark)
Wirz, Lukas; Tonner, Ralf; Avery, James Emil
2013-01-01
The structure and properties of the three smallest nonface-spiral (NS) fullerenes NS-T-C380, NS-D3-C384, NS-D3-C440, and the first isolated pentagon NS-fullerene, NS-D3-C672, are investigated in detail. They are constructed by either a generalized face-spiral algorithm or by vertex insertions......-fullerenes compared to C60, but, as expected, in a lower stability than most stable isomers. None of the many investigated halma transforms on nonspiral fullerenes, NS-T-C380, NS-D3-C384, NS-D3-C440, and NS-D3-C672, admit any spirals, and we conjecture that all halma transforms of NS-fullerenes belong to the class...
46 CFR 153.440 - Cargo temperature sensors.
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo temperature sensors. 153.440 Section 153.440 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS... Temperature Control Systems § 153.440 Cargo temperature sensors. (a) Except as prescribed in paragraph (c) of...
Correlation potential of a test ion near a strongly charged plate.
Lu, Bing-Sui; Xing, Xiangjun
2014-03-01
We analytically calculate the correlation potential of a test ion near a strongly charged plate inside a dilute m:-n electrolyte. We do this by calculating the electrostatic Green's function in the presence of a nonlinear background potential, the latter having been obtained using the nonlinear Poisson-Boltzmann theory. We consider the general case where the dielectric constants of the plate and the electrolyte are distinct. The following generic results emerge from our analyses: (1) If the distance to the plate Δz is much larger than a Gouy-Chapman length, the plate surface will behave effectively as an infinitely charged surface, and the dielectric constant of the plate effectively plays no role. (2) If Δz is larger than a Gouy-Chapman length but shorter than a Debye length, the correlation potential can be interpreted in terms of an image charge that is three times larger than the source charge. This behavior is independent of the valences of the ions. (3) The Green's function vanishes inside the plate if the surface charge density is infinitely large; hence the electrostatic potential is constant there. In this respect, a strongly charged plate behaves like a conductor plate. (4) If Δz is smaller than a Gouy-Chapman length, the correlation potential is dominated by the conventional image charge due to the dielectric discontinuity at the interface. (5) If Δz is larger than a Debye length, the leading order behavior of the correlation potential will depend on the valences of the ions in the electrolyte. Furthermore, inside an asymmetric electrolyte, the correlation potential is singly screened, i.e., it undergoes exponential decay with a decay width equal to the Debye length.
Wear of liquid nitrogen-cooled 440C bearing steels in an oxygen environment
Chaudhuri, Dilip K.; Verma, Ravi
1988-01-01
This paper presents up-to-date findings of the research being conducted to understand the mechanism of sliding wear in unlubricated 440C bearing steels under oxidative conditions. A sliding wear test rig has been designed and built with a cylinder-on-flat geometry. The equipment is capable of testing specimens under high axial loads and sliding speeds in a simulated LOX environment. Samples of 440C steel, quenched and tempered to a hardness of Rc 56, were tested under a load of 890 N and a sliding speed of 2.05 m/sec for total sliding distances of up to 5.54 km. Flash temperatures during these tests were measured with an IR camera and a fast digital recorder. Microstructural and microanalytical data from the worn surfaces and the debris particles are analyzed extensively, along with wear rates, flash temperatures, surface profiles, hardnesses, and residual stresses, in the context of oxidation and wear theories.
International Nuclear Information System (INIS)
Kurisu, Yosuke; Kiriyama, Ryutaro; Takenaka, Tomoya; Nozaki, Dai; Sato, Fuminobu; Kato, Yushi; Iida, Toshiyuki
2012-01-01
We are constructing a tandem-type electron cyclotron resonance ion source (ECRIS). The first stage of this can supply 2.45 GHz and 11-13 GHz microwaves to plasma chamber individually and simultaneously. We optimize the beam current I FC by the mobile plate tuner. The I FC is affected by the position of the mobile plate tuner in the chamber as like a circular cavity resonator. We aim to clarify the relation between the I FC and the ion saturation current in the ECRIS against the position of the mobile plate tuner. We obtained the result that the variation of the plasma density contributes largely to the variation of the I FC when we change the position of the mobile plate tuner.
Process control with optical emission spectroscopy in triode ion plating
International Nuclear Information System (INIS)
Salmenoja, K.; Korhonen, A.S.; Sulonen, M.S.
1985-01-01
Physical vapor deposition (PVD) techniques used to prepare, e.g., hard TiN, HfN, or ZrN coatings include a great variety of processes ranging from reactive evaporation to sputtering and ion plating. In ion plating one effective way to enhance ionization is to use a negatively biased hot filament. The use of an electron emitting filament brings an extra variable to be taken into account in developing the process control. In addition, proper control of the evaporation source is critical in ensuring reproducible results. With optical emission spectroscopy (OES) it should be possible to control the coating process more accurately. The stoichiometry and the composition of the growing coating may then be ensured effectively in subsequent runs. In this work the application of optical emission spectroscopy for process control in triode ion plating is discussed. The composition of the growing coating is determined experimentally using the relative intensities of specific emission lines. Changes in the evaporation rate and the gas flow can be seen directly from emission line intensities. Even the so-called poisoning of the evaporation source with reactive gas can be detected. Several experimental runs were carried out and afterwards the concentration profiles of the deposited coatings were checked with the nuclear resonance broadening (NRB) method. The results show the usefulness of emission spectroscopy in discharge control
40 CFR 440.132 - General definitions.
2010-07-01
... evaporation data. (c) “Appropriate treatment of the recycle water” in subpart J, § 440.104 includes, but is...) “Groundwater infiltration” in § 440.131 means that water which enters the treatment facility as a result of the... mining, cleaning, or concentration of metal ores. (h) “Mine drainage” means any water drained, pumped, or...
International Nuclear Information System (INIS)
Hoehne, T.; Rhode, U.
2000-01-01
The VVER-440 (440 MW) V-230 was considered for analyzing the flow field and mixing processes. The V-230 has no elliptical sieve plate in the lower plenum. Previously, the 3D flow distribution in the downcomer and the lower plenum of the VVER-440 reactor have been calculated by means of the CFD code CFX-4 for operational conditions. The CFX-calculations were compared with the experimental data and the analytical mixing model. In this paper, CFD calculations for the start-up of the first main coolant pump in a VVER-440 type reactor are reported about. This scenario is important in case that there is a plug of lower borated water in one of the primary coolant loops. (orig.)
Electroplating Ni-63 metal ions in chloride bath on the Cu-plate
Energy Technology Data Exchange (ETDEWEB)
Yoo, Kwon Mo; Uhm, Young Rang; Son, Kwang Jae; Park, Keun Yung [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2014-05-15
Ni-63 plating is similar to other electroplating processes that employ soluble metal anodes. The nickel plating solution described by Watts in 1916 eventually replaced all other strategies in use up to that time. Charged Ni ions are formed by sulfate, sulfamate, chloride, and a Watts bath. However, charged Ni-63 ions are formed by dissolving metal Ni-63. Specifically, it requires the passage of direct current (DC) between two electrodes that are immersed in a conductive, aqueous solution of nickel salts. The flow of a DC causes one of the electrodes (the anode) to dissolve and the other electrode (the cathode) to become covered with nickel. The nickel in the solution is present in the form of divalent positively charged ions (Ni{sup 2+}). When the current flows, the positive ions react with two electrons (2e{sup -}) and are converted into metallic nickel (Ni{sup 0}) at the cathode surface. In the present study, we optimize and established process for the electroplating Ni-63 on Cu-plate. Nanocrystalline nickel (Ni) coatings were synthesized by DC electro deposition at a current density of 15 mA/cm{sup 2}. The bath was primarily composed of 0.2 M Ni ions, prepared by dissolving Ni-63 metal particles in HCl. The prototype for electroplating radioactive Ni-63 has been established. The electroplating was carried out by two-step processes such as preparation of ionic solution including Ni-63, and coating processes on the substrate.
Electroplating Ni-63 metal ions in chloride bath on the Cu-plate
International Nuclear Information System (INIS)
Yoo, Kwon Mo; Uhm, Young Rang; Son, Kwang Jae; Park, Keun Yung
2014-01-01
Ni-63 plating is similar to other electroplating processes that employ soluble metal anodes. The nickel plating solution described by Watts in 1916 eventually replaced all other strategies in use up to that time. Charged Ni ions are formed by sulfate, sulfamate, chloride, and a Watts bath. However, charged Ni-63 ions are formed by dissolving metal Ni-63. Specifically, it requires the passage of direct current (DC) between two electrodes that are immersed in a conductive, aqueous solution of nickel salts. The flow of a DC causes one of the electrodes (the anode) to dissolve and the other electrode (the cathode) to become covered with nickel. The nickel in the solution is present in the form of divalent positively charged ions (Ni 2+ ). When the current flows, the positive ions react with two electrons (2e - ) and are converted into metallic nickel (Ni 0 ) at the cathode surface. In the present study, we optimize and established process for the electroplating Ni-63 on Cu-plate. Nanocrystalline nickel (Ni) coatings were synthesized by DC electro deposition at a current density of 15 mA/cm 2 . The bath was primarily composed of 0.2 M Ni ions, prepared by dissolving Ni-63 metal particles in HCl. The prototype for electroplating radioactive Ni-63 has been established. The electroplating was carried out by two-step processes such as preparation of ionic solution including Ni-63, and coating processes on the substrate
C30 Support Plate for Replacing Function of Service Pool 1 at Unit 2
International Nuclear Information System (INIS)
Zsoldos, F.
2006-01-01
the refuelling work. When filling into the spent fuel pool all fuel assemblies we needed to set up the new core, we can start to put them into the reactor, of course the usage of C30 support plate is ready at this moment, it was needed just to carry out spent fuel and fill into the spent fuel pool the fresh fuel. The plant made many of stress calculations, lot of scientific institutions were involved to the problem solution from Hungary and abroad also (from abroad mainly SKODA, the manufacturer of the reactor). The period from finding out and getting permission to manufacture it and to use it at Unit 2 took more than 1 year. A lot of test and probing was done before the usage of this C30 support plate. All in all in 2005, January we used successfully this C30 support plate. This support plate can be used at any VVER 440 reactors, it should be adjusted to the container used for fresh or spent fuel carrying. (author)
International Nuclear Information System (INIS)
Egert, C.M.; Scott, D.G.
1987-01-01
A study of ion-plating parameters (primarily deposition rate and substrate bias voltage), coating structure, and the corrosion protection provided by aluminum coatings on uranium is presented. Ion plating at low temperatures yields a variety of aluminum coating structures on uranium. For example, aluminum coatings produced at high deposition rates and low substrate bias voltages are columnar with voids between columns, as expected for high-rate vapor deposition at low temperatures. On the other hand, low deposition rate and high bias voltage produce a modified coating with a dense, noncolumnar structure. These results are not in agreement with other studies that have found no relationship between deposition rate and coating structure in ion plating. This discrepancy is probably due to the high deposition rates used in these studies. An accelerated, water vapor corrosion test indicates that the columnar aluminum coatings provide some corrosion protection despite their porous nature; however, the dense noncolumnar coatings provide significantly greater protection. These results indicate that ion-plated aluminum coatings produced at low deposition rates and high substrate bias voltages creates dense coating structures that are most effective in protecting uranium from corrosion
Calibration of BAS-TR image plate response to high energy (3-300 MeV) carbon ions
Doria, D.; Kar, S.; Ahmed, H.; Alejo, A.; Fernandez, J.; Cerchez, M.; Gray, R. J.; Hanton, F.; MacLellan, D. A.; McKenna, P.; Najmudin, Z.; Neely, D.; Romagnani, L.; Ruiz, J. A.; Sarri, G.; Scullion, C.; Streeter, M.; Swantusch, M.; Willi, O.; Zepf, M.; Borghesi, M.
2015-12-01
The paper presents the calibration of Fuji BAS-TR image plate (IP) response to high energy carbon ions of different charge states by employing an intense laser-driven ion source, which allowed access to carbon energies up to 270 MeV. The calibration method consists of employing a Thomson parabola spectrometer to separate and spectrally resolve different ion species, and a slotted CR-39 solid state detector overlayed onto an image plate for an absolute calibration of the IP signal. An empirical response function was obtained which can be reasonably extrapolated to higher ion energies. The experimental data also show that the IP response is independent of ion charge states.
Fusaro, R. L.
1982-01-01
The tribological properties of seven polyimide films applied to 440 C high temperature stainless steel substrates were studied at 25 C with a pin-on-disk type of friction and were apparatus. The polyimides fell into two groups according to friction and wear properties. Group I polyimides had slightly lower friction but much higher wear than group II polyimides. The wear mechanism was predominately adhesion, but the wear particles were larger for group I polyimides. For most of the polyimides the transfer films consisted of clumps of compacted wear particles. One polyimide composition produced a very thin transfer film that sheared plastically in the contact area.
International Nuclear Information System (INIS)
Peng Zhijian; Miao Hezhuo; Si Wenjie; Qi Longhao; Li Wenzhi
2003-01-01
Through reviewing the advantages and disadvantages of the existed surface modification techniques, a new technique, ion implantation-assisted multi-arc ion plating, was proposed. Using the proposed technique, the surfaces of silicon nitride ceramics were modified by Ti ion implantation, and then three kinds of ternary coatings, (Ti,Al)N, (Ti,Zr)N and (Ti,Cr)N, were deposited on the as-implanted ceramics. The coatings prepared by this technique are of high-hardness and well adhesive to the ceramic substrates. The maximal hardness measured by nanoindentation tests is more than 40 GPa. The maximal critical load by nanoscratch tests is more than 60 mN. The cutting tools prepared by this technique with the presented coatings are of excellent performance in industrial applications. The technique may be promising for the surface modification of structural ceramics. (orig.)
International Nuclear Information System (INIS)
Waldmann, Thomas; Wohlfahrt-Mehrens, Margret
2017-01-01
During charging at low temperatures, metallic Lithium can be deposited on the surface of graphite anodes of Li-ion cells. This Li plating does not only lead to fast capacity fade, it can also impair the safety behavior. The present study observes the effect of rest periods between Li plating and subsequent accelerated rate calorimetry (ARC) tests. As an example, commercial 3.25 Ah 18650-type cells with graphite anodes and NCA cathodes are cycled at 0 °C to provoke Li plating. It is found that the rest period at 25 °C between Li plating and the ARC tests has a significant influence on the onset temperature of exothermic reactions (T SH ), the onset temperature of thermal runaway (T TR ), the maximum temperature, the self-heating rate, and on damage patterns of 18650 cells. The results are discussed in terms of chemical intercalation of Li plating into adjacent graphite particles during the rest period. The exponential increase of capacity recovery and T SH as a function of time suggests a reaction of 1st order for the relaxation process.
Deposition of indium tin oxide thin films by cathodic arc ion plating
International Nuclear Information System (INIS)
Yang, M.-H.; Wen, J.-C.; Chen, K.-L.; Chen, S.-Y.; Leu, M.-S.
2005-01-01
Indium tin oxide (ITO) thin films have been deposited by cathodic arc ion plating (CAIP) using sintered oxide target as the source material. In an oxygen atmosphere of 200 deg. C, ITO films with a lowest resistivity of 2.2x10 -4 Ω-cm were obtained at a deposition rate higher than 450 nm/min. The carrier mobility of ITO shows a maximum at some medium pressures. Although morphologically ITO films with a very fine nanometer-sized structure were observed to possess the lowest resistivity, more detailed analyses based on X-ray diffraction are attempted to gain more insight into the factors that govern electron mobility in this investigation
Preparation of TiN films by arc ion plating using dc and pulsed biases
International Nuclear Information System (INIS)
Huang, M.D.; Lee, Y.P.; Dong, C.; Lin, G.Q.; Sun, C.; Wen, L.S.
2004-01-01
TiN hard coatings were prepared by arc ion plating with both direct current (dc) and pulsed biases. An extensive investigation was undertaken to determine the effects of the substrate temperature on the mechanical properties and the microstructures of films. The results show that the substrate temperature is decreased evidently when a pulsed bias instead of a dc one is employed. At the same time, the microstructures and the properties are also improved. A low-temperature arc ion plating can be realized by using pulsed biases
International Nuclear Information System (INIS)
Tosaki, M.; Nakamura, M.; Hirose, M.; Matsumoto, H.
2011-01-01
A heavy-ion microbeam system for cell irradiation has been developed using an accelerator at Kyoto University. We have successfully developed proton-, carbon-, fluorine- and silicon-beams in order to irradiate a micro-meter sized area with ion counting, especially single ion irradiation. In the heavy-ion microbeam system, an imaging plate (IP) was utilized for beam diagnostics on the irradiation. The IP is widely used for radiography studies in biology. However, there are a few studies on the low linear energy transfer (LET) by single ions, i.e., low-intensity exposure. Thus we have investigated the energy response for the IP, which can be utilized for microbeam diagnostics.
Plating on difficult-to-plate metals: what's new
International Nuclear Information System (INIS)
Wiesner, H.J.
1980-01-01
Some of the changes since 1970 in procedures for plating on such materials as titanium, molybdenum, silicon, aluminum, and gallium arsenide are summarized. While basic procedures for plating some of these materials were developed as many as 30 to 40 years ago, changes in the end uses of the plated products have necessitated new plating processes. In some cases, vacuum techniques - such as ion bombardment, ion implantation, and vacuum metallization - have been introduced to improve the adhesion of electrodeposits. In other cases, these techniques have been used to deposit materials upon which electrodeposits are required
Ni-based amorphous alloy-coating for bipolar plate of PEM fuel cell by electrochemical plating
International Nuclear Information System (INIS)
Yamaura, S; Kim, S C; Inoue, A
2013-01-01
In this study, the Ni-Cr-P amorphous alloy-coated bipolar plates were produced by electro-plating on the Cu base plates with a flow field. The power generation tests of a single fuel cell with those Ni-Cr-P bipolar plates were conducted at 353 K. It was found that the single fuel cell with those Ni-Cr-P bipolar plates showed excellent I-V performance as well as that with the carbon graphite bipolar plates. It was also found that the single cell with those Ni-Cr-P bipolar plates showed better I-V performance than that with the Ni-P amorphous alloy-coated bipolar plates. Furthermore, the long-time operation test was conducted for 440 h with those Ni-Cr-P bipolar plates at the constant current density of 200 mA·cm −2 . As a result, it was found that the cell voltage gradually decreased at the beginning of the measurement before 300 h and then the voltage was kept constant after 300 h.
Ion and electron parameters in the alcator C tokamak scrape-off region
International Nuclear Information System (INIS)
Wan, A.S.H.
1986-05-01
Janus is a bi-directional, multi-functional edge probe used to diagnose the ion and electron parameters in the Alcator C tokamak scrape-off region. Two mirror image sets of diagnostics are aligned to face the electron and ion sides along magnetic field lines. Each set of diagnostics consists of a retarding-field energy analyzer (RFEA), a Langmuir probe, and a calorimeter. The RFEA can alternatively sample both the ion and electron parallel energy distribution functions during a tokamak discharge. From the Langmuir probe, one can infer electron temperature, density, and the plasma floating potential. Simple Langmuir probe theory is found to yield the best agreement between the measured Langmuir probe characteristics and the RFEA-inferred T/sub e/. The calorimeter independently detects the total parallel heat flux incident to an electrically floating plate. The measured sheath transmission coefficient, however, is typically lower than the theoretically predicted value by a factor of approx.3. Together these diagnostics enable detailed, localized edge plasma characterization on Alcator C
Directory of Open Access Journals (Sweden)
a.h Mahvi
2012-05-01
Full Text Available
Background and Objectives: Sulphate ion is one of the main ions available in natural and waste water. The high rate of sulphate in drinking water causes health problems such as irritation and digestive problems and makes water taste bitter. The purpose of this study was to assess the efficiency of sulphate ion removal from drinking water through Electrocogualation process (EC using plate aluminum electrodes. Methods: This study was conducted as a pilot plant using one glass tank in the volume of 1.3liter containing 6 plate aluminum electrodes. These electrodes were attached to a power supply in a mono-polar and parallel arrangement in order to switch the alternating current to the direct one. That is, each electrode was attached to positive and negative poles directly and alternately. The tank was filled with synthetic water containing sulphate ion with the concentration of 350 & 700mg/L. Percentage of sulphate ion removal in potential range of 10, 20 and 30 V, reaction times of 40, 20 and 60min and pH 7.0, 3.0 & 11.0 were measured. Results: In this study the maximum efficiency of sulphate ion removal was in the electrical potential of 30 V, reaction time of 60min and pH 11.0. With increase of ion concentration, the time needed to achieve a suitable efficiency of removal increased, that is, it indicated the direct effect of pH and difference of electrical potential on removal of sulphate ion through EC process. Conclusion: The results of this research show that Electrocogualation technology can be introduced as a suitable and promising technique to remove sulphate ion from aqueous environments using plate aluminum electrodes.
Directory of Open Access Journals (Sweden)
Rajabizadeh A.
2010-09-01
Full Text Available Background and Objectives: Sulphate ion is one of the main ions available in natural and waste water. The high rate of sulphate in drinking water causes health problems such as irritation and digestive problems and makes water taste bitter. The purpose of this study was to assess the efficiency of sulphate ion removal from drinking water through Electrocogualation process (EC using plate aluminum electrodes.Methods: This study was conducted as a pilot plant using one glass tank in the volume of 1.3liter containing 6 plate aluminum electrodes. These electrodes were attached to a power supply in a mono-polar and parallel arrangement in order to switch the alternating current to the direct one. That is, each electrode was attached to positive and negative poles directly and alternately. The tank was filled with synthetic water containing sulphate ion with the concentration of 350 & 700mg/L. Percentage of sulphate ion removal in potential range of 10, 20 and 30 V, reaction times of 40, 20 and 60min and pH 7.0, 3.0 & 11.0 were measured.Results: In this study the maximum efficiency of sulphate ion removal was in the electrical potential of 30 V, reaction time of 60min and pH 11.0. With increase of ion concentration, the time needed to achieve a suitable efficiency of removal increased, that is, it indicated the direct effect of pH and difference of electrical potential on removal of sulphate ion through EC process.Conclusion: The results of this research show that Electrocogualation technology can be introduced as a suitable and promising technique to remove sulphate ion from aqueous environments using plate aluminum electrodes.
The ion plating of optical thin films for the infrared
International Nuclear Information System (INIS)
Reid, I.M.; Macleod, H.A.; Carter, M.J.; Henderson, E.
1979-01-01
Although excellent humidity resistance was achieved with diode ion plated zinc sulphide antireflection films on germanium substrates the abrasion resistance was found to be poor. This could be attributed to an intense columnar structure with very loose packing. To improve the abrasion resistance it was found necessary to add a third electrode which allowed the discharge to be sustained at lower pressures, and to heat the substrates during deposition. (author)
Hydrogen absorption kinetics of niobium with an ion-plated nickel overlayer
International Nuclear Information System (INIS)
Nakamura, K.
1981-01-01
The hydrogen absorption rate for nickel-ion-plated niobium was measured as a function of hydrogen pressure and temperature. The observed absorption curves of c(mean)/csub(e) against time (c(mean) and csub(e) are the mean and equilibrium hydrogen concentrations respectively) exhibited a marked hydrogen pressure dependence below 628 K but this was less marked above 723 K. The results were analysed on the basis of the proposed model that the rate-determining step is the hydrogen permeation through the nickel overlayer and that the permeation is driven by the hydrogen activity difference between the two interfaces, namely the H 2 -Ni and Ni-Nb interfaces. The marked pressure dependence can be attributed to the fact that the hydrogen activity coefficient in nickel is constant and that in niobium it varies markedly with concentration, i.e. with hydrogen pressure and temperature. It was also found that the change in the nickel overlayer structure caused by the dilatation of bulk niobium during hydrogen absorption enhances the hydrogen absorption rates. The temperature dependence of the hydrogen absorption rate is also discussed in comparison with that for tantalum with a vacuum-deposited nickel overlayer. (Auth.)
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Labor. 440.19 Section 440.19 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION WEATHERIZATION ASSISTANCE FOR LOW-INCOME PERSONS § 440.19 Labor. Payments for labor... supplement wages paid to training participants, public service employment workers, or other Federal or State...
Directory of Open Access Journals (Sweden)
Łępicka Magdalena
2014-09-01
Full Text Available Martensitic stainless steels are used in a large number of various industrial applications, e.g. molds for plastic injections and glass moldings, automotive components, cutting tools, surgical and dental instruments. The improvement of their tribological and corrosion properties is a problem of high interest especially in medical applications, where patient safety becomes a priority. The paper covers findings from plasma nitrided AISI 440B (PN-EN or DIN X90CrMoV18 stainless steel corrosion resistance studies. Conventionally heat treated and plasma nitrided in N2:H2 reaction gas mixture (50:50, 65:35 and 80:20, respectively in two different temperature ranges (380 or 450°C specimens groups were examined. Microscopic observations and electrochemical corrosion tests were performed using a variety of analytical techniques. As obtained findings show, plasma nitriding of AISI 440B stainless steel, regardless of the process temperature, results in reduction of corrosion current density. Nevertheless, applying thermo-chemical process which requires exceeding temperature of about 400°C is not recommended due to increased risk of steel sensitization to intergranular and stress corrosion. According to the results, material ion nitrided in 450°C underwent leaching corrosion processes, which led to significant disproportion in chemical composition of the corroded and corrosion-free areas. The authors suggest further research into corrosion process of plasma nitrided materials and its degradation products.
Slugen, Vladimir
2011-01-01
Safety of VVER-440 Reactors endeavours to promote an increase in the safety of VVER-440 nuclear reactors via the improvement of fission products limitation systems and the implementation of special non-destructive spectroscopic methods for materials testing. All theoretical and experimental studies performed the by author over the last 25 years have been undertaken with the aim of improving VVER-440 defence in depth, which is one of the most important principle for ensuring safety in nuclear power plants. Safety of VVER-440 Reactors is focused on the barrier system through which the safety pri
Doping properties of ZnO thin films for photovoltaic devices grown by URT-IP (ion plating) method
International Nuclear Information System (INIS)
Iwata, K.; Sakemi, T.; Yamada, A.; Fons, P.; Awai, K.; Yamamoto, T.; Matsubara, M.; Tampo, H.; Sakurai, K.; Ishizuka, S.; Niki, S.
2004-01-01
The Uramoto-gun with Tanaka magnetic field (URT)-ion plating (IP) method is a novel ion plating technique for thin film deposition. This method offers the advantage of low-ion damage, low deposition temperatures, large area deposition and high growth rates. Ga-doped ZnO thin films were grown using the URT-IP method, and the doping properties were evaluated. The opposing goals of low Ga composition and low resistivity are required for industrial applications of transparent conductive oxide (TCO). We have carried out a comparison between the carrier concentration and Ga atomic concentration in Ga-doped ZnO thin films and found the trade-off point for optimal TCO performance. The optimum growth conditions were obtained using a 3% Ga 2 O 3 content ZnO target
Comparative study WWER-440/230 reactors and the Juragua-based WWER-440/318 project
International Nuclear Information System (INIS)
1994-01-01
The work consists in a comparative analysis between WWER-440/230 and WWER-440/318 type reactors on the basis of the major findings and recommendations given in the extra budgetary Programme of the International Atomic Energy Agency on the safety of these reactors and summarized in the document 'The safety of WWER-440 model 230 nuclear power plant'. The fundamental emphasis was done in the design concept of these reactors
Energy Technology Data Exchange (ETDEWEB)
Falcnik, M; Brumovsky, M; Pav, T [Czech Nuclear Society, Prague (Czech Republic)
1994-12-31
In Czech and Slovak republics, six units of WWER 440/C type reactors are monitored by surveillance specimens programmes; the specimens are determined for static tensile testing, impact notch toughness testing and fracture toughness evaluation. Results of mechanical properties of these specimens after irradiation in intervals between 1 and 5 years of operation, are summarized and discussed with respect to the effect of individual heats and welded joints, radiation embrittlement, and annealing recovery. (authors). 3 refs., 11 figs., 2 tabs.
International Nuclear Information System (INIS)
Hegyi, G.; Hordosy, G.; Kereszturi, A.; Maraczy, C.; Temesvari, E.
2009-01-01
In this paper the linear pin power calculation in the KARATE-440 code system are presented. The calculation results show that: 1) The coupler mathematical benchmark was solved by the KARATE code system using the same methods and approximations as in case of NPP applications. 2) Without Hf plate in the fuel pin row next to the problematic coupler section pronounced local power peak arises. 4) Though the underprediction of the peak by KARATE-SADR is 4%, it is in accordance with the applied uncertainty of KARATE-SADR. 5) The application of Hf plate solves the problem.
International Nuclear Information System (INIS)
Li, J.J.; Qian, Y.H.; Niu, D.; Zhang, M.M.; Liu, Z.M.; Li, M.S.
2012-01-01
Highlights: ► Cr 2 AlC coating was prepared by arc ion plating combined with post annealing. ► The coating deposited by arc ion plating without heating was amorphous. ► Amorphous coating transformed to crystalline Cr 2 AlC after annealing at 620 °C in Ar. - Abstract: Due to the excellent oxidation and hot corrosion resistance and matched thermal expansion coefficient to normal alloys, Cr 2 AlC has potential applications as high-temperature protective coating. In the present work, the preparation of Cr 2 AlC coating has been achieved through cathodic arc deposition method combined with heat post-treatment. It was found that the coating, deposited from Cr 2 AlC compound target in the unintentional heating condition, was amorphous. After annealing at 620 °C in Ar for 20 h, the amorphous Cr–Al–C coating happened to crystallize and transformed to crystalline Cr 2 AlC as the major phase. It is obvious that the formation temperature of Cr 2 AlC was decreased from about 1050 °C for sintered bulk to around 620 °C for the as-deposited coating, resulting from the homogeneous mixture of the Cr, Al and C at atomic level in the Cr–Al–C coating. Apart from crystalline Cr 2 AlC, the annealed coating also contained AlCr 2 and little Cr 7 C 3 . AlCr 2 formed due to the loss of C during deposition, and little Cr 7 C 3 always existed in the sintered Cr 2 AlC compound target as impurity phase.
8-Nitro-cGMP promotes bone growth through expansion of growth plate cartilage.
Hoshino, Marie; Kaneko, Kotaro; Miyamoto, Yoichi; Yoshimura, Kentaro; Suzuki, Dai; Akaike, Takaaki; Sawa, Tomohiro; Ida, Tomoaki; Fujii, Shigemoto; Ihara, Hideshi; Tanaka, Junichi; Tsukuura, Risa; Chikazu, Daichi; Mishima, Kenji; Baba, Kazuyoshi; Kamijo, Ryutaro
2017-09-01
In endochondral ossification, growth of bones occurs at their growth plate cartilage. While it is known that nitric oxide (NO) synthases are required for proliferation of chondrocytes in growth plate cartilage and growth of bones, the precise mechanism by which NO facilitates these process has not been clarified yet. C-type natriuretic peptide (CNP) also positively regulate elongation of bones through expansion of the growth plate cartilage. Both NO and CNP are known to use cGMP as the second messenger. Recently, 8-nitro-cGMP was identified as a signaling molecule produced in the presence of NO in various types of cells. Here, we found that 8-nitro-cGMP is produced in proliferating chondrocytes in the growth plates, which was enhanced by CNP, in bones cultured ex vivo. In addition, 8-nitro-cGMP promoted bone growth with expansion of the proliferating zone as well as increase in the number of proliferating cells in the growth plates. 8-Nitro-cGMP also promoted the proliferation of chondrocytes in vitro. On the other hand, 8-bromo-cGMP enhanced the growth of bones with expansion of hypertrophic zone of the growth plates without affecting either the width of proliferating zone or proliferation of chondrocytes. These results indicate that 8-nitro-cGMP formed in growth plate cartilage accelerates chondrocyte proliferation and bone growth as a downstream molecule of NO. Copyright © 2017. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Kocek, V.
2005-01-01
The paper focuses on the innovation procedures of physics startup tests instrumentation used in Dukovany NPP (ANMS) connected with I and C system refurbishment of the Dukovany WWER 440/213 units. The following matters are further discussed in this paper: a) changes in ANMS design, whose has been carried out due to reflect the situation connected with I and C innovation; b) process of consistency checking during implementation stage; c) results of the physics startup tests with upgraded ANMS in 2005 (introduction of Gd2 fuel on Dukovany NPP) (Authors)
Effect of ion plating TiN on the oxidation of sputtered NiCrAlY-coated Ti3Al-Nb in air at 850-950 C
International Nuclear Information System (INIS)
Rizzo, F.C.; Zeng, C.; Chinese Academy of Sciences, Shenyang; Wu, W.
1998-01-01
A single sputtered NiCrAlY coating and a complex coating of inner ion-plated TiN and outer sputtered NiCrAlY were prepared on the intermetallic compound Ti 3 Al-Nb. Their oxidation behavior was examined at 850, 900, and 950 C in air by thermal gravimetry combined with XRD, SEM, and EDAX. The results showed that Ti 3 Al-Nb followed approximately parabolic oxidation, forming an outer thin Al 2 O 3 -rich scale and an inner TiO 2 -rich layer doped with Nb at the three temperatures. The TiO 2 -rich layer doped with Nb dominated the oxidation reaction. The single NiCrAlY coating did not follow parabolic oxidation exactly at 850 and 950 C, but oxidized approximately in a parabolic manner, because the instantaneous parabolic constants changed slightly with time. Besides the Al 2 O 3 scale, TiO 2 formed from the coating surface at the coating-substrate interface. The deterioration of the coating accelerated with increasing temperature. The NiCrAlY-TiN coating showed two-stage parabolic oxidation at 850 and 900 C, and an approximate parabolic oxidation at 950 C. The TiN layer was effective as a barrier to inhibit coating-alloy interdiffusion
46 CFR 130.440 - Communications system.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Communications system. 130.440 Section 130.440 Shipping... MISCELLANEOUS EQUIPMENT AND SYSTEMS Automation of Unattended Machinery Spaces § 130.440 Communications system. (a) Each OSV must have a communications system to immediately summon a crew member to the machinery...
21 CFR 573.440 - Ethylene dichloride.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Ethylene dichloride. 573.440 Section 573.440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additive Listing § 573.440 Ethylene dichloride. The food additive ethylene dichloride may be safely used in...
C-terminal peptide extension via gas-phase ion/ion reactions
Peng, Zhou; McLuckey, Scott A.
2015-01-01
The formation of peptide bonds is of great importance from both a biological standpoint and in routine organic synthesis. Recent work from our group demonstrated the synthesis of peptides in the gas-phase via ion/ion reactions with sulfo-NHS reagents, which resulted in conjugation of individual amino acids or small peptides to the N-terminus of an existing ‘anchor’ peptide. Here, we demonstrate a complementary approach resulting in the C-terminal extension of peptides. Individual amino acids or short peptides can be prepared as reagents by incorporating gas phase-labile protecting groups to the reactive C-terminus and then converting the N-terminal amino groups to the active ketenimine reagent. Gas-phase ion/ion reactions between the anionic reagents and doubly protonated “anchor” peptide cations results in extension of the “anchor” peptide with new amide bond formation at the C-terminus. We have demonstrated that ion/ion reactions can be used as a fast, controlled, and efficient means for C-terminal peptide extension in the gas phase. PMID:26640400
Experience in modernization of safety I and C in VVER 440 nuclear power plants Bohunice V1 and Paks
International Nuclear Information System (INIS)
Martin, M.
2000-01-01
For nuclear power plants which have been in operation for more than 15 years, backfitting or even complete replacement of the instrumentation and control (I and C) equipment becomes an increasingly attractive option, motivated not only by the objective to reduce the cost of I and C system maintenance and repair but also to prolong or at least to safeguard the plant life-time: optimized spare-part management through use of standard equipment; reduction of number and variety of different items of equipment by implementing functions stepwise in application software; adding new functionality in the application software which was not possible in the old technology due to lack of space; safeguarding of long-term After-Sales-Service. Some years ago Bohunice V1 NPP, Slovak Republic and Paks NPP, Hungary intended to replace parts of their Safety I and C, mainly the Reactor Trip System, the Reactor Limitation System and the Neutron Flux Excore Instrumentation and Monitoring Systems. After a Basic Engineering Phase in Bohunice V1 and a Feasibility Study in Paks both plants decided to use the Siemens' Digital Safety I and C System TELEPERM XS to modernize their plants. Both Bohunice, Unit 2 and Paks, Unit 1 have been back on line for over six months with the new Digital Safety I and C. At the present time Bohunice, Unit 1 and within the next few months Paks, Unit 2 will be replaced. Trouble-free start-ups and no major problems under operation in the first two plants were based on: thorough understanding of the VVER 440 technology; comprehensive planning together with the plant operators and authorities; the possibility to adapt TELEPERM XS to every plant type; the execution of extensive pre-operational tests. Regarding these modernization measures Siemens, as well as the above Operators, have gained considerable experience in the field of I and C Modernization in VVER 440 NPPs. Important aspects of this experience are: how to transfer the VVER technology to TELEPERM XS; how to
International Nuclear Information System (INIS)
Putra, Nandy; Ariantara, Bambang; Pamungkas, Rangga Aji
2016-01-01
Highlights: • Flat plate loop heat pipe (FPLHP) is studied in the thermal management system for electric vehicle. • Distilled water, alcohol, and acetone on thermal performances of FPLHP were tested. • The FPLHP can start up at fairly low heat load. • Temperature overshoot phenomena were observed during the start-up period. - Abstract: The development of electric vehicle batteries has resulted in very high energy density lithium-ion batteries. However, this growth is accompanied by the risk of thermal runaway, which can cause serious accidents. Heat pipes are heat exchangers that are suitable to be applied in electric vehicle battery thermal management for their lightweight and compact size, and they do not require external power supply. This study examined experimentally a flat plate loop heat pipe (FPLHP) performance as a heat exchanger in the thermal management system of the lithium-ion battery for electric vehicle application. The heat generation of the battery was simulated using a cartridge heater. Stainless steel screen mesh was used as the capillary wick. Distilled water, alcohol, and acetone were used as working fluids with a filling ratio of 60%. It was found that acetone gave the best performance that produces a thermal resistance of 0.22 W/°C with 50 °C evaporator temperature at heat flux load of 1.61 W/cm"2.
46 CFR 154.440 - Allowable stress.
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...
Cell killing and chromosomal aberration induced by heavy-ion beams in cultured human tumor cells
International Nuclear Information System (INIS)
Takakura, K.; Funada, A.; Mohri, M.; Lee, R.; Aoki, M.; Furusawa, Y.; Gotoh, E.
2003-01-01
Full text: To clarify the relation between cell death and chromosomal aberration in cultured human tumor cells irradaited with heavy-ion beams. The analyses were carried out on the basis of the linear energy transfer (LET) values of heavy ion beams as radiation source. Exponentially growing human tumor cells, Human Salivary Gland Tumor cells (HSG cells), were irradiated with various high energy heavy ions, such as 13 keV/micrometer carbon (C) ions as low LET charged particle radiation source, 120 keV/ micrometer carbon (C) ions and 440 keV/micrometer iron (Fe) ions as high LET charged particle radiation sources.The cell death was analysed by the colony formation method, and the chromosomal aberration and its repairing kinetics was analysed by prematurely chromosome condensation method (PCC method) using calyculin A. Chromatid-type breaks, isochromatid breaks and exchanges were scored for the samples from the cells keeping with various incubation time after irradiation. The LET dependence of the cell death was similar to that of the chromosome exchange formation after 12 hours incubation. A maximum peak was around 120 keV/micrometer. However it was not similar to the LET dependence of isochromatid breaks or chromatid breaks after 12 hours incubation. These results suggest that the exchanges formed in chromosome after irradiation should be one of essential causes to lead the cell death. The different quality of induced chromosome damage between high-LET and low-LET radiation was also shown. About 89 % and 88 % chromatid breaks induced by X rays and 13 keV/micrometer C ions were rejoined within 12 hours of post-irradiation, though only 71% and 58 % of chromatid breaks induced by 120 keV/micrometer C ions and 440 keV/micrometer Fe ions were rejoined within 12 hours of post-irradiation
Transmission properties of C60 ions through micro- and nano-capillaries
International Nuclear Information System (INIS)
Tsuchida, Hidetsugu; Majima, Takuya; Tomita, Shigeo; Sasa, Kimikazu; Narumi, Kazumasa; Saitoh, Yuichi; Chiba, Atsuya; Yamada, Keisuke; Hirata, Koichi; Shibata, Hiromi; Itoh, Akio
2013-01-01
We apply the capillary beam-focusing method for the C 60 fullerene projectiles in the velocity range between 0.14 and 0.2 a.u. We study the C 60 transmission properties through two different types of capillaries: (1) borosilicate glass microcapillary with an outlet diameter of 5.5 μm, and (2) Al 2 O 3 multi-capillary foil with a pore size of about 70 nm and a high aspect ratio of about 750. We measured the transmitted particle composition by using the electrostatic deflection method combined with the microchannel plate imaging technique. For the experiments with the single microcapillary, the main transmission component is found to be primary C 60 beams that are focused in the area equal to the capillary outlet diameter. Minor components are charge-exchanged C 60 ions and charged or neutral fragments (fullerene-like C 60-2m and small C n particles), and their fractions decrease with decreasing the projectile velocity. It is concluded that the C 60 transmission fraction is considerably high for both types of the capillaries in the present velocity range
Ion enhanced deposition by dual titanium and acetylene plasma immersion ion implantation
Zeng, Z. M.; Tian, X. B.; Chu, P. K.
2003-01-01
Plasma immersion ion implantation and deposition (PIII-D) offers a non-line-of-sight fabrication method for various types of thin films on steels to improve the surface properties. In this work, titanium films were first deposited on 9Cr18 (AISI440) stainless bearing steel by metal plasma immersion ion implantation and deposition (MePIII-D) using a titanium vacuum arc plasma source. Afterwards, carbon implantation and carbon film deposition were performed by acetylene (C2H2) plasma immersion ion implantation. Multiple-layered structures with superior properties were produced by conducting Ti MePIII-D + C2H2 PIII successively. The composition and structure of the films were investigated employing Auger electron spectroscopy and Raman spectroscopy. It is shown that the mixing for Ti and C atoms is much better when the target bias is higher during Ti MePIII-D. A top diamond-like carbon layer and a titanium oxycarbide layer are formed on the 9Cr18 steel surface. The wear test results indicate that this dual PIII-D method can significantly enhance the wear properties and decrease the surface friction coefficient of 9Cr18 steel.
Ion enhanced deposition by dual titanium and acetylene plasma immersion ion implantation
International Nuclear Information System (INIS)
Zeng, Z.M.; Tian, X.B.; Chu, P.K.
2003-01-01
Plasma immersion ion implantation and deposition (PIII-D) offers a non-line-of-sight fabrication method for various types of thin films on steels to improve the surface properties. In this work, titanium films were first deposited on 9Cr18 (AISI440) stainless bearing steel by metal plasma immersion ion implantation and deposition (MePIII-D) using a titanium vacuum arc plasma source. Afterwards, carbon implantation and carbon film deposition were performed by acetylene (C 2 H 2 ) plasma immersion ion implantation. Multiple-layered structures with superior properties were produced by conducting Ti MePIII-D + C 2 H 2 PIII successively. The composition and structure of the films were investigated employing Auger electron spectroscopy and Raman spectroscopy. It is shown that the mixing for Ti and C atoms is much better when the target bias is higher during Ti MePIII-D. A top diamond-like carbon layer and a titanium oxycarbide layer are formed on the 9Cr18 steel surface. The wear test results indicate that this dual PIII-D method can significantly enhance the wear properties and decrease the surface friction coefficient of 9Cr18 steel
45 CFR 2541.440 - Termination for convenience.
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Termination for convenience. 2541.440 Section 2541.440 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND... LOCAL GOVERNMENTS Reports, Records, Retention and Enforcement § 2541.440 Termination for convenience...
Thermo-mechanical design of the Plasma Driver Plate for the MITICA ion source
Energy Technology Data Exchange (ETDEWEB)
Pavei, Mauro, E-mail: mauro.pavei@igi.cnr.it [Consorzio RFX, EURATOM-ENEA Association, Corso Stati Uniti 4, I-35127 Padova (Italy); Palma, Mauro Dalla; Marcuzzi, Diego [Consorzio RFX, EURATOM-ENEA Association, Corso Stati Uniti 4, I-35127 Padova (Italy)
2010-12-15
In the framework of the activities for the development of the Neutral Beam Injector (NBI) for ITER, the detailed design of the Radio-Frequency (RF) negative ion source has been carried out. One of the most heated components of the RF source is the rear vertical plate, named Plasma Driver Plate (PDP), where the Back-Streaming positive Ions (BSI+) generated from stripping losses in the accelerator and back scattered on the plasma source impinge on. The heat loads that result are huge and concentrated, with first estimate of the power densities up to 60 MW/m{sup 2}. The breakdowns that occur into the accelerator cause such heat loads to act cyclically, so that the PDP is thermo-mechanically fatigue loaded. Moreover, the surface of the PDP facing the plasma is functionally required to be temperature controlled and to be molybdenum or tungsten coated. The thermo-hydraulic design of the plate has been carried out considering active cooling with ultra-pure water. Different heat sink materials, hydraulic circuit layout and manufacturing processes have been considered. The heat exhaust has been optimized by changing the channels geometry, the path of the heat flux in the heat sink, the thickness of the plate and maximizing the Heat Transfer Coefficient. Such optimization has been carried out by utilizing 3D Finite Element (FE) models. Afterwards all the suitable mechanical (aging, structural monotonic and cyclic) verifications have been carried out post-processing the results of the thermo-mechanical 3D FE analyses in accordance to specific procedures for nuclear components exposed to high temperature. The effect of sputtering phenomenon due to the high energy BSI+ impinging on the plate has been considered and combined with fatigue damage for the mechanical verification of the PDP. Alternative solutions having molybdenum (or tungsten coatings) facing the plasma, aiming to reduce the sputtering rate and the consequent plasma pollution, have been evaluated and related 3D FE
42 CFR 440.390 - Assurance of transportation.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Assurance of transportation. 440.390 Section 440...-Equivalent Coverage § 440.390 Assurance of transportation. If a benchmark or benchmark-equivalent plan does not include transportation to and from medically necessary covered Medicaid services, the State must...
Synthesis and characterization of CrCN–DLC composite coatings by cathodic arc ion-plating
Energy Technology Data Exchange (ETDEWEB)
Wang, R.Y. [School of Power and Mechanical Engineering, Wuhan University, Wuhan 430072 (China); Wang, L.L. [Key Laboratory of Artificial Nanomaterials and Nanostructure of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan 430072 (China); Liu, H.D. [School of Power and Mechanical Engineering, Wuhan University, Wuhan 430072 (China); Yan, S.J. [Key Laboratory of Artificial Nanomaterials and Nanostructure of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan 430072 (China); Chen, Y.M. [School of Power and Mechanical Engineering, Wuhan University, Wuhan 430072 (China); Fu, D.J. [Key Laboratory of Artificial Nanomaterials and Nanostructure of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan 430072 (China); Yang, B., E-mail: toyangbing@163.com [School of Power and Mechanical Engineering, Wuhan University, Wuhan 430072 (China)
2013-07-15
CrCN–DLC composite coatings were deposited onto silicon (1 0 0) and cemented carbides substrates using pure Cr targets under C{sub 2}H{sub 2} ambient by cathodic arc ion plating system. The influence of C{sub 2}H{sub 2} flow rate on the structure and mechanical properties of the coatings was investigated systemically. The coatings structure and bonding state were characterized by XRD, Raman and X-ray photoelectron spectroscopy. The chemical composition was measured by EDS. The mechanical performance and tribological behaviour of the coatings were studied by a hardness tester and ball-on-disc wear tester. The results showed that with increasing C{sub 2}H{sub 2} flow rate from 50 to 100 sccm, the corresponding hardness of coatings increased firstly and then decreased with further addition of C{sub 2}H{sub 2} flow rate. The coatings deposited at lower C{sub 2}H{sub 2} flow rate (less than 200 sccm) exhibited a relatively higher hardness value (more than HV{sub 0.025}2000) and then the hardness decrease with increasing C{sub 2}H{sub 2} flow rate. The friction coefficient also exhibited similar variation trend, when the C{sub 2}H{sub 2} flow rate was higher than 100 sccm, the friction coefficient decreased and then maintained in a relatively lower value from 0.18 to 0.24, which may be attribute to the increasing carbon content and the coating exhibited more diamond-like structure.
42 CFR 440.70 - Home health services.
2010-10-01
... an acute illness to avoid the recipient's transfer to a nursing facility. (d) “Home health agency... 42 Public Health 4 2010-10-01 2010-10-01 false Home health services. 440.70 Section 440.70 Public...) MEDICAL ASSISTANCE PROGRAMS SERVICES: GENERAL PROVISIONS Definitions § 440.70 Home health services. (a...
42 CFR 440.370 - Economy and efficiency.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Economy and efficiency. 440.370 Section 440.370...-Equivalent Coverage § 440.370 Economy and efficiency. Benchmark and benchmark-equivalent coverage and any... requirements and other economy and efficiency principles that would otherwise be applicable to the services or...
Development of a parallel plate ion chamber for radiation protection level
International Nuclear Information System (INIS)
Bottaro, Marcio; Landi, Mauricio; Moralles, Mauricio
2011-01-01
A new parallel plate vented ion chamber is proposed in this paper. The application of this chamber was primarily intended to the measurement of stray radiation in interventional procedures, but the energy response of about 2.6%, which was obtained in the first prototype, on the range from 40 to 150 kV using ISO 4037-1 narrow qualities, provided the possibility of a wide modality application on radiation protection. Primary studies with Maxwell 2D electromagnetic field simulator revealed an optimized model regarding effective volume and saturation voltage levels, which conferred to the ion chamber a dual entrance window feature. The development of this ion chamber has the main contribution of Monte Carlo calculations as a support tool to the establishment of the effective volume of the chamber and determination of the best materials for housing mounting and conductive elements, such as guard rings, electrode, and windows. Even the composition of the conductive layers, which would be neglected due to their very small thicknesses (about 35 μm), had important influence on the results and could be better understood with Monte Carlo N-Particle Transport Code System (MCNP) simulations. (author)
Surveillance of WWER-440 fuel performance
International Nuclear Information System (INIS)
Simko, J.; Urban, P.
1999-01-01
In this lecture next problems of surveillance of WWER-440 fuel performance are presented: surveillance of WWER-440 fuel performance at Mochovce NPP; basic data of WWER-440 reactor; in-core reactor measuring system 'SVRK'; basic level of SVRK; information output of basic level of SVRK; surveillance of fuel performance; table of permissible operation conditions of the reactor; limitation of the unit 1 power at the beginning of the operation; cyclic changes of power; future perspectives
International Nuclear Information System (INIS)
Okuyama, Y; Kimura, T; Suzuki, S; Itoh, H
2012-01-01
This paper describes the experimental results for negative ion mobility in O 2 at 0.5-2.0 atm. The ion mobility is observed using a high-pressure ion drift tube with a positive corona gap (Geiger counter), which is constructed from a point plate gap and acts as a negative ion detector. The variation of waveforms in the burst pulse is observed by varying the voltage applied to the ion detector to find the optimum voltage that must be applied across the ion detector in O 2 . This is investigated carefully to ensure the precise determination of mobility. The distortion of the electric field near the mesh electrode, which operates as the cathode of the ion detector and as the anode of the ion drift gap, is then examined to determine the optimum applied voltage to suppress its effect on the measurement of mobility. The mobility is subsequently measured at a reduced electric field intensity of 2.83 × 10 -3 to 2.83. The observed mobility of 2.31 ± 0.03 cm 2 V -1 s -1 in O 2 is concluded to be that of O 2 - . This value is also obtained in experiments over a wide range of gas pressures (0.5-2.0 atm) and drift lengths (1.00-9.00 cm). The mobilities of O 3 - and O - are also obtained experimentally. (paper)
A study of tritium behavior in lithium oxide by ion conductivity measurements
International Nuclear Information System (INIS)
Noda, Kenji; Ishii, Yoshinobu; Ohno, Hideo; Watanabe, Hitoshi
1989-01-01
Ion conductivity of lithium oxide (Li 2 O) irradiated with oxygen ions was measured to obtain information about the effects of irradiation on the behavior of lithium ions and tritium. The conductivity around 490 K decreased with the ion fluence, while around 440 K it increased. The decrease around 490 K and the increase around 440 K were assumed to be attributed to the F + centers and the unspecified radiation defects, respectively. From the point of view that the rate determinant in the mechanism of diffusion of lithium ions in Li 2 O leading to the ion conductivity is the same as that of tritium, the diffusivity of tritium is assumed to be as follows: the diffusivity of tritium is decreased by the F + centers in the range from 490 K to the temperature at which almost all of F + centers are recovered, while it is increased around 440 K by the unspecified radiation defects. In addition, effects of the irradiation on valence states of tritium (i.e., T + , T - ) were discussed in terms of the radiation defects. (orig.)
Temperature etalon of WWER-440 reactor
International Nuclear Information System (INIS)
Stanc, S.; Slanina, M.
2001-01-01
The presentation deals with the description, parameters and advantages of use of the temperature etalon. The system ensures temperature measurement of reactor outlet and inlet temperatures with high accuracy. Accuracy of temperature measurement is 0.18 deg C, accuracy of temperature difference measurement is 0.14 deg C, both with probability 0.95. Using the temperature etalon it is possible to increase accuracy of the standard temperature reactor measurements and to check their accuracy in the course of power reactor statuses in every measurement cycle. Temperature reactor etalon was installed in 12 WWER-440 units in Slovakia, Bohemia and Bulgaria. (Authors)
High-energy-ion depletion in the charge exchange spectrum of Alcator C
International Nuclear Information System (INIS)
Schissel, D.P.
1982-01-01
A three-dimensional, guiding center, Monte Carlo code is developed to study ion orbits in Alcator C. The highly peaked ripple of the magnetic field of Alcator is represented by an analytical expression for the vector potential. The analytical ripple field is compared to the resulting magnetic field generated by a current model of the toroidal plates; agreement is excellent. Ion-Ion scattering is simulated by a pitch angle and an energy scattering operator. The equations of motion are integrated with a variable time step, extrapolating integrator. The code produces collisionless banana and ripple trapped loss cones which agree well with present theory. Global energy distributions have been calculated and show a slight depletion above 8.5 keV. Particles which are ripple trapped and lost are at energies below where depletion is observed. It is found that ions pitch angle scatter less as energy is increased. The result is that, when viewed in velocity space, ions form probability lobes the shape of mouse ears which are fat near the thermal energy. Therefore, particles enter the loss cone at low energies near the bottom of the core. Recommendations for future work include improving the analytic model of the ripple field, testing the effect of del . B not equal to 0 on ion orbits, and improving the efficiency of the code by either using a spline fit for the magnetic fields or by creating a vectorized Monte Carlo code
International Nuclear Information System (INIS)
Gallais, Laurent; Capoulade, Jeremie; Natoli, Jean-Yves; Commandre, Mireille; Cathelinaud, Michel; Koc, Cian; Lequime, Michel
2008-01-01
A comparative study is made of the laser damage resistance of hafnia coatings deposited on fused silica substrates with different technologies: electron beam deposition (from Hf or HfO2 starting material), reactive low voltage ion plating, and dual ion beam sputtering.The laser damage thresholds of these coatings are determined at 1064 and 355 nm using a nanosecond pulsed YAG laser and a one-on-one test procedure. The results are associated with a complete characterization of the samples: refractive index n measured by spectrophotometry, extinction coefficient k measured by photothermal deflection, and roughness measured by atomic force microscopy
Cell-cycle-dependent repair of heavy-ion damage
International Nuclear Information System (INIS)
Blakely, E.A.; Chang, P.Y.; Lommel, L.; Tobias, C.A.
1985-01-01
Synchronized human T-1 cells have been used to investigate the G1-phase age dependence of repair of potentially lethal damage (PLDR). The cells were irradiated with single doses of either 225 kVp X rays or Bragg-peak 425 MeV/μ neon ions at ages between 1.5 and 6.0 hrs after mitotic selection, and then either trypsinized and plated immediately, or held at 37 0 C for 6 hrs in PBS, or PBS containing 60μM of the DNA-polymerase-inhibitor 1-β-D-arabinofurano-syladenine (β-araA) before trypsinization and plating. Delayed plating showed significant PLDR at all ages irradiated with X rays, with the increase of survival varying between 2- to 8-fold. At equivalent survival levels, there was a reduced capacity for PLDT at each cell age irradiated with neon ions. In early G1 after neon-ion exposures, delayed plating actually enhanced cell killing; whereas, in late G1 the survival increased about 2-fold. β-araA almost completely eliminated the PLDR after X rays, reducing the survival to that measured with immediate plating. β-araA slightly enhanced neon-ion cell killing at all cell ages
Improvement of the corrosion resistance on Nd-Fe-B magnet with nickel plating
International Nuclear Information System (INIS)
Minowa, T.; Yoshikawa, M.; Honshima, M.
1989-01-01
The authors describe the corrosion-resistant test humidity test (80 0 C, 90%R.H.) autoclave test (120 0 C, 2atm, saturated with water vapor), salt spray test (35 0 C, 5% NaCl) performed on the sintered Nd magnet treated with nickel plating. Al ion-plating and without coating were also exposed to the corrosion test. After the specified periods of corrosion test, the permanent flux loss of the re-magnetized sample was measured. The changes in the appearance were also observed
Li plating as unwanted side reaction in commercial Li-ion cells - A review
Waldmann, Thomas; Hogg, Björn-Ingo; Wohlfahrt-Mehrens, Margret
2018-04-01
Deposition of Lithium metal on anodes contributes significantly to ageing of Li-ion cells. Lithium deposition is connected not only to a drastic limitation of life-time, but also to fast-charging capability and safety issues. Lithium deposition in commercial Li-ion cells is not limited to operation conditions at low temperatures. In recent publications various types of commercial cells were investigated using complimentary analysis methods. Five cell types studied in literature (18650, 26650, pouch) serve as a basis for comparison when and why Li deposition happens in commercial Li-ion cells. In the present paper, we reviewed literature on (i) causes, (ii) hints and evidences for Li deposition, (iii) macroscopic morphology of Li deposition/plating, (iv) ageing mechanisms and shapes of capacity fade curves involving Li deposition, and (v) influences of Li deposition on safety. Although often discussed, safety issues regarding Li deposition are not only limited to dendrite growth and internal short circuits, but also to exothermic reactions in the presence of Lithium metal. Furthermore, we tried to connect knowledge from different length scales including the macroscopic level (Li-ion cells, operating conditions, gradients in cells, electrochemical tests, safety tests), the microscopic level (electrodes, particles, microstructure), and the atomic level (atoms, ions, molecules, energy barriers).
Plasma-assisted catalytic ionization using porous nickel plate
International Nuclear Information System (INIS)
Oohara, W.; Maeda, T.; Higuchi, T.
2011-01-01
Hydrogen atomic pair ions, i.e., H + and H - ions, are produced by plasma-assisted catalytic ionization using a porous nickel plate. Positive ions in a hydrogen plasma generated by dc arc discharge are irradiated to the porous plate, and pair ions are produced from the back of the irradiation plane. It becomes clear that the production quantity of pair ions mainly depends on the irradiation current of positive ions and the irradiation energy affects the production efficiency of H - ions.
Thin TaC layer produced by ion mixing
DEFF Research Database (Denmark)
Barna, Árpád; Kotis, László; Pécz, Béla
2012-01-01
in strongly asymmetric ion mixing; the carbon was readily transported to the Ta layer, while the reverse process was much weaker. Because of the asymmetrical transport the C/TaC interface remained sharp independently from the applied fluence. The carbon transported to the Ta layer formed Ta......Ion-beam mixing in C/Ta layered systems was investigated. C 8nm/Ta 12nm and C 20nm/Ta 19nm/C 20nm layer systems were irradiated by Ga+ ions of energy in the range of 2–30keV. In case of the 8nm and 20nm thick C cover layers applying 5–8keV and 20–30keV Ga+ ion energy, respectively resulted...
Disintegration of C60 by Xe ion irradiation
International Nuclear Information System (INIS)
Kalish, R.; Samoiloff, A.; Hoffman, A.; Uzan-Saguy, C.
1993-01-01
The Changes in resistivity of fullerene (C 60 ) films subject to 320 keV Xe ion irradiation are investigated as a function of ion dose. From a comparison of this dependence with similar data on other Xe irradiated C containing insulating materials and with data on C implanted fused quartz, it is concluded that upon ion impact C 60 clusters completely disintegrate. This disintegration releases about 60 C atoms which disperse amongst the remaining intact C 60 spheres giving rise to hopping conductivity between isolated C atoms. 16 refs., 3 figs
Mechanical System Analysis of C-Frame for Steel Plate Thickness Gauge
International Nuclear Information System (INIS)
Sri Sudadiyo
2007-01-01
Nuclear base instrument is not only applied in the area of research such as medical and agriculture sciences, but also in the field of industry especially for thickness gauge. To the present at the steel industry, the gauge that is applied to cut plate thickness using infra-red ray method, it cannot result in accurately data. To solve that case, it is developed a thickness gauge of steel plate by using gamma ray method that it is named C-Frame. This thickness gauge is hoped that it could control in cutting the steel plate by on-line, accurate, and safe, therefore, it could socialize the advanced technology in the nuclear field to support the production process in domestic industries (national industries). The present study yields the calculations of mechanical system of that C-Frame including structure, detector support, source container of radioisotope, and transmission system, be also computed by running Professional Microsoft Fortran Version 5.10, NISA-II program, and AutoCAD program. From the obtained results could be known that the design meets the requirement, so that could be employed properly to measure the thickness of plate in the steel industries. (author)
C-2 anterior plate-screw fixation: a quantitative anatomical and morphometric evaluation.
Senoglu, M; Ozbag, D; Gumusalan, Y
2010-01-01
Discectomy and inter-vertebral body fusion combined with the anterior plate-screw fixa tion is the common procedure in cervical spine surgery. But the anterior plate-screw fixation of the C2 spine has been the uncommon surgical procedure. In this study, we analyze the anatomy of the C2 body relevant to C2 anterior plate-screw fixation. Eighty-six dried C2 spines were evaluated directly for this study. Measurements were made on the C2 body width and midsagittal anteroposterior (AP) depth and the anteroposterior parasagittal depth 5 mm lateral to midline on the inferior endplates, in addition to on the middle body. Measurements also were made of anteroposterior parasagittal vertebral depth with both medial and lateral inclination of 10 degrees, with respect to the parasagittal plane of the vertebral body. The ideal maximum screw length and trajectory was found to be AP medial parasagittal depth of inferior surface of the C2 body [Right: 13.7 +/- 1.4 mm (11.0-17.9), Left: 13.6 +/- 1.5 mm (10.7-17.8)]. We report the measurements of the vertebral body of the C2. We think these measurements provide guidelines for operating on the anterior C2 spine, and enhance the confidence interval for the surgeon (Tab. 3, Fig. 1, Ref. 24).
Transmission properties of C{sub 60} ions through micro- and nano-capillaries
Energy Technology Data Exchange (ETDEWEB)
Tsuchida, Hidetsugu, E-mail: tsuchida@nucleng.kyoto-u.ac.jp [Quantum Science and Engineering Center, Kyoto University, Uji, Kyoto 611-0011 (Japan); Department of Nuclear Engineering, Kyoto University, Kyoto 615-8530 (Japan); Majima, Takuya [Quantum Science and Engineering Center, Kyoto University, Uji, Kyoto 611-0011 (Japan); Department of Nuclear Engineering, Kyoto University, Kyoto 615-8530 (Japan); Tomita, Shigeo [Institute of Applied Physics, University of Tsukuba, Tsukuba, Ibaraki 305-8573 (Japan); Sasa, Kimikazu [Tandem Accelerator Complex, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Narumi, Kazumasa; Saitoh, Yuichi; Chiba, Atsuya; Yamada, Keisuke [Takasaki Advanced Radiation Research Institute, Japan Atomic Energy Agency, Takasaki, Gunma 370-1292 (Japan); Hirata, Koichi [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8565 (Japan); Shibata, Hiromi [Department of Nuclear Engineering, Kyoto University, Kyoto 615-8530 (Japan); Itoh, Akio [Quantum Science and Engineering Center, Kyoto University, Uji, Kyoto 611-0011 (Japan); Department of Nuclear Engineering, Kyoto University, Kyoto 615-8530 (Japan)
2013-11-15
We apply the capillary beam-focusing method for the C{sub 60} fullerene projectiles in the velocity range between 0.14 and 0.2 a.u. We study the C{sub 60} transmission properties through two different types of capillaries: (1) borosilicate glass microcapillary with an outlet diameter of 5.5 μm, and (2) Al{sub 2}O{sub 3} multi-capillary foil with a pore size of about 70 nm and a high aspect ratio of about 750. We measured the transmitted particle composition by using the electrostatic deflection method combined with the microchannel plate imaging technique. For the experiments with the single microcapillary, the main transmission component is found to be primary C{sub 60} beams that are focused in the area equal to the capillary outlet diameter. Minor components are charge-exchanged C{sub 60} ions and charged or neutral fragments (fullerene-like C{sub 60-2m} and small C{sub n} particles), and their fractions decrease with decreasing the projectile velocity. It is concluded that the C{sub 60} transmission fraction is considerably high for both types of the capillaries in the present velocity range.
A parallel plate avalanche chamber for relativistic heavy ions
International Nuclear Information System (INIS)
Burgei, R.
1989-01-01
In order to determine the interaction point of relativistic heavy ions in the Diogene target, we have built and tested an X-Y low pressure parallel plate avalanche chamber. It uses three thin metallized foils and is filled with isobutane. A preliminary study shows that it is the only detector with the required specifications: efficiency, accurate position determination and a small uniform amount of material for the particle beam to go through. The electronics system is designed for reliability, easy adjustments and high stability. The interaction point is given on delay-line read-out. This represents the optimum compromise between low price and good performance. Laboratory measurements of gain, efficiency and position accuracy are done with an alpha-particle source. Two of these detectors are working at the Saturne National Laboratory. They allow the trajectory of several tens of particles (among a million per second) to be reconstructed. With an argon beam at 400 MeV per nucleon, the position uncertainty in the target has been measured to be 0.5 mm (standard deviation). This uncertainty is 0.3 mm for each detector, with an efficiency of 94 per cent. Our set-up, which is now operational, improves the accuracy of the results and speed of analysis of Diogene experiments devoted to the study of central collisions between heavy ions [fr
10 CFR 440.18 - Allowable expenditures.
2010-01-01
... part for labor, weatherization materials, and related matters for a renewable energy system, shall not... beginning in calendar year 2010 and the $3,000 average for renewable energy systems will be adjusted... 10 Energy 3 2010-01-01 2010-01-01 false Allowable expenditures. 440.18 Section 440.18 Energy...
A singly charged ion source for radioactive 11C ion acceleration
Katagiri, K.; Noda, A.; Nagatsu, K.; Nakao, M.; Hojo, S.; Muramatsu, M.; Suzuki, K.; Wakui, T.; Noda, K.
2016-02-01
A new singly charged ion source using electron impact ionization has been developed to realize an isotope separation on-line system for simultaneous positron emission tomography imaging and heavy-ion cancer therapy using radioactive 11C ion beams. Low-energy electron beams are used in the electron impact ion source to produce singly charged ions. Ionization efficiency was calculated in order to decide the geometric parameters of the ion source and to determine the required electron emission current for obtaining high ionization efficiency. Based on these considerations, the singly charged ion source was designed and fabricated. In testing, the fabricated ion source was found to have favorable performance as a singly charged ion source.
International Nuclear Information System (INIS)
Ecker, Madeleine; Shafiei Sabet, Pouyan; Sauer, Dirk Uwe
2017-01-01
Highlights: •Investigation of lithium plating to support reliable system integration. •Influence of operational conditions at low temperature on lithium plating. •Comparison of different lithium-ion battery technologies. •Large differences in low-temperature behaviour for different technologies. •Post-mortem analysis reveals inhomogeneous deposition of metallic lithium. -- Abstract: The lifetime and safety of lithium-ion batteries are key requirements for successful market introduction of electro mobility. Especially charging at low temperature and fast charging, known to provoke lithium plating, is an important issue for automotive engineers. Lithium plating, leading both to ageing as well as safety risks, is known to play a crucial role in system design of the application. To gain knowledge of different influence factors on lithium plating, low-temperature ageing tests are performed in this work. Commercial lithium-ion batteries of various types are tested under various operational conditions such as temperature, current, state of charge, charging strategy as well as state of health. To analyse the ageing behaviour, capacity fade and resistance increase are tracked over lifetime. The results of this large experimental survey on lithium plating provide support for the design of operation strategies for the implementation in battery management systems. To further investigate the underlying degradation mechanisms, differential voltage curves and impedance spectra are analysed and a post-mortem analysis of anode degradation is performed for a selected technology. The results confirm the deposition of metallic lithium or lithium compounds in the porous structure and suggest a strongly inhomogeneous deposition over the electrode thickness with a dense deposition layer close to the separator for the considered cell. It is shown that this inhomogeneous deposition can even lead to loss of active material. The plurality of the investigated technologies
Effects of Hydrogen Ion Implantation on TiC-C Coating of Stainless Steel
Institute of Scientific and Technical Information of China (English)
ZHANG Rui-qian; LIU Yao-guang; HUANG Ning-kang
2008-01-01
Titanium carbide coatings are widely used as various wear-resistant material.The hydrogen erosion resistance of TiC-C films and the effect of hydrogen participation on TiC-C films were studied.Seventy-five percent TiC-C films are prepared on stainless steel surface by using ion mixing,where TiC-C films are deposited by rf magnetron sputtering followed by argon ion bombardment.The samples are then submitted to hydrogen ion implantation at 1.2×10-3 Pa.Characterization for the 75% TiC-C films was done with SIMS,XRD,AES,and XPS.Secondary ion mass spectroscopy (SIMS) was used to analyze hydrogen concentration variation with depth,X-Ray diffraction (XRD) was used to identify the phases,and Auger electron spectra (AES) as well as X-ray photoelectron spectra (XPS) were used to check the effects of hydrogen on shifts of chemical bonding states of C and Ti in the TiC-C films.It is found that TiC-C films on stainless steel surface can prevent hydrogen from entering stainless steel.
33 CFR 183.440 - Secondary circuits of ignition systems.
2010-07-01
... systems. 183.440 Section 183.440 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY BOATS AND ASSOCIATED EQUIPMENT Electrical Systems Manufacturer Requirements § 183.440 Secondary circuits of ignition systems. (a) Each conductor in a secondary circuit of an...
Formation mechanism of SiC in C-Si system by ion irradiation
International Nuclear Information System (INIS)
Hishita, Shunichi; Aizawa, Takashi; Suehara, Shigeru; Haneda, Hajime
2003-01-01
The irradiation effects of 2 MeV He + , Ne + , and Ar + ions on the film structure of the C-Si system were investigated with RHEED and XPS. The ion dose dependence of the SiC formation was kinetically analyzed. The SiC formation at moderate temperature was achieved by 2 MeV ion irradiation when the thickness of the initial carbon films was appropriate. The evolution process of the SiC film thickness consisted of the 3 stages. The first stage was the steep increase of the SiC, and was governed by the inelastic collision. The second was the gentle increase of the SiC, and was governed by the diffusion. The last was the decrease of the SiC, and was caused by the sputtering. The formation mechanism of the SiC was discussed. (author)
Microanalysis on the Hydrogen Ion Irradiated 50 wt pct TiC-C Films
Institute of Scientific and Technical Information of China (English)
Hui JIANG; Yaoguang LIU; Ningkang HUANG
2007-01-01
The 50 wt pct TiC-C films were prepared on stainless steel substrates by using a technique of ion beam mixing.These films were irradiated by hydrogen ion beam with a dose of 1×1018 ions/cm2 and an energy of 5 keV.Microanalysis of X-ray photoelectron spectroscopy (XPS) and secondary ion mass spectroscopy (SIMS) were used to analyze the films before and after hydrogen ion irradiation and to study the mechanism of hydrogen resistance.
Shogrin, Bradley A.; Jones, William R., Jr.; Herrera-Fierro, Pilar; Jansen, Mark J.
2001-01-01
The boundary-lubrication performance of two perfluoropolyether (PFPE) thin films in the presence of passivated 440C stainless steel is presented. The study used a standard ball on disk (BoD) tribometer in dry nitrogen and a vacuum spiral orbit tribometer (SOT). Stainless steel surfaces were passivated with one of four techniques: high and low temperature chromic acid bath, a tricresyl phosphate (TCP) soak, or UV/Ozone treated for 15 min. After passivation, each BoD disk had a 400A film of Krytox 16256 (PFPE) applied to it. The lifetimes of these films were quantified by measuring the number of sliding cycles before an increase in friction occurred. The lubricated lifetime of the 440C couple was not altered as a result of the various passivation techniques. The resulting surface chemistry of each passivation technique was examined using X-ray photoelectron spectroscopy (XPS). The SOT was used to examine the effects of the TCP treatment on the lubricated lifetime of another PFPE, Brayco 815Z, under rolling conditions. None of the passivation techniques were found to dramatically increase the oxide film thickness or lubricated lifetimes.
Separation method of heavy-ion particle image from gamma-ray mixed images using an imaging plate
Yamadera, A; Ohuchi, H; Nakamura, T; Fukumura, A
1999-01-01
We have developed a separation method of alpha-ray and gamma-ray images using the imaging plate (IP). The IP from which the first image was read out by an image reader was annealed at 50 deg. C for 2 h in a drying oven and the second image was read out by the image reader. It was found out that an annealing ratio, k, which is defined as a ratio of the photo-stimulated luminescence (PSL) density at the first measurement to that at the second measurement, was different for alpha rays and gamma rays. By subtracting the second image multiplied by a factor of k from the first image, the alpha-ray image was separated from the alpha and gamma-ray mixed images. This method was applied to identify the images of helium, carbon and neon particles of high energies using the heavy-ion medical accelerator, HIMAC. (author)
WWER440 few group data library preparation and its application in MOBY-DICK modular system
International Nuclear Information System (INIS)
Krysl, V.; Mikolas, P.; Svarny, J.
2002-01-01
Paper provides summary of methodology of few-group library preparation with emphasis on new features of assemblies, like fuel assemblies with Gd burnable poison or Control Fuel Assembly with Hf plates. Special attention is devoted to the transient part (coupler) of Control Fuel Assembly from the point of view of boundary conditions preparation. Based of this methodology prepared library is implemented into macro code for different number of axial meshes for both coarse and fine mesh diffusion calculations. Problems with local power peaking calculations in WWER-440 cores are closely connected with the correct modeling of the power perturbations in the neighbourhood of Control Fuel Assembly coupler. The new version of MOBY-DICK provided with the new few group data library can assess most of effects induced by insertion of Control Fuel Assembly in the core including effects of newly designed Hf plates in the coupler of Control Fuel Assembly. Compatibility of transport and diffusion calculation was taken into account in the analysis of Control Fuel Assembly movement without/with Hf plates (Authors)
NOx photocatalytic degradation on gypsum plates modified by TiO2-N,C photocatalysts
Directory of Open Access Journals (Sweden)
Janus Magdalena
2015-09-01
Full Text Available In presented studies the photocatalytic decomposition of NOx on gypsum plates modified by TiO2-N,Cphotocatalysts were presented. The gypsum plates were obtained by addition of 10 or 20 wt.% of different types of titanium dioxide, such as: pure TiO2 and carbon and nitrogen co-modified TiO2 (TiO2-N,C to gypsum. TiO2-N,C photocatalysts were obtained by heating up the starting TiO2 (Grupa Azoty Zakłady Chemiczne Police S.A in the atmosphere of ammonia and carbon at the temperature: 100, 300 i 600ºC. Photocatalyst were characterized by FTIR/DRS, UVVis/DR, BET and XRD methods. Moreover the compressive strength tests of modified gypsum were also done. Photocatalytic activity of gypsum plates was done during NOx decomposition. The highest photocatalytic activity has gypsum with 20 wt.% addition of TiO2-N,C obtained at 300ºC.
Shogrin, Bradley A.; Jones, William R., Jr.; Herrera-Fierro, Pilar
1997-01-01
The boundary-lubrication performance of perfluoropolyether (PFPE) thin films in the presence of passivated 440 C stainless steel is presented. The study utilized a standard ball-on-disc tribometer. Stainless steel surfaces were passivated with one of four techniques: 1) submersion in a chromic acid bath for 30 minutes at 46 C, 2) submersion in a chromic acid bath for 60 minutes at 56 C, 3) submersion in a tricresyl phosphate (TCP) bath for 2 days at 107 C, or 4) UV/Ozone treated for 15 minutes. After passivation, each disc had a 400 A film of PFPE (hexafluoropropene oxide) applied to it reproducibly (+/- 20%) and uniformly (+/- 15%) using a film deposition device. The lifetimes of these films were quantified by measuring the number of sliding wear cycles required to induce an increase in the friction coefficient from an initial value characteristic of the lubricated wear couple to a final, or failure value, characteristic of an unlubricated, unpassivated wear couple. The lubricated lifetime of the 440 C couple was not altered as a result of the various passivation techniques. The resulting surface chemistry of each passivation technique was examined using X-ray Photoelectron Spectroscopy (XPS). It was found that chromic acid passivation altered the Cr to Fe ratio of the surface. TCP passivation resulted in a FePO4 layer on the surface, while UV/Ozone passivation only removed the carbonaceous contamination layer. None of the passivation techniques were found to dramatically increase the oxide film thickness.
Directory of Open Access Journals (Sweden)
Shao-liang Wang
Full Text Available Medical device implants are drawing increasing amounts of interest from modern medical practitioners. However, this attention is not evenly spread across all such devices; most of these implantable devices can cause adverse reactions such as inflammation, fibrosis, thrombosis, and infection. In this work, the biocompatibility of silicone rubber (SR was improved through carbon (C ion implantation. Scanning electron microscopy (SEM, atomic force microscopy (AFM, X-ray photoelectron spectroscopy (XPS, and X-ray diffraction (XRD results confirmed that these newly generated carbon-implanted silicone rubbers (C-SRs had large, irregular peaks and deep valleys on their surfaces. The water contact angle of the SR surface decreased significantly after C ion implantation. C ion implantation also changed the surface charge distribution, silicone oxygen rate, and chemical-element distribution of SR to favor cell attachment. The dermal fibroblasts cultured on the surface C-SR grew faster and showed more typical fibroblastic shapes. The expression levels of major adhesion proteins, including talin-1, zyxin, and vinculin, were significantly higher in dermal fibroblasts cultured on C-SR coated plates than in dermal fibroblasts cultured on SR. Those same dermal fibroblasts on C-SRs showed more pronounced adhesion and migration abilities. Osteopontin (OPN, a critical extracellular matrix (ECM protein, was up-regulated and secreted from dermal fibroblasts cultured on C-SR. Matrix metalloproteinase-9 (MMP-9 activity was also increased. These cells were highly mobile and were able to adhere to surfaces, but these abilities were inhibited by the monoclonal antibody against OPN, or by shRNA-mediated MMP-9 knockdown. Together, these results suggest that C ion implantation significantly improves SR biocompatibility, and that OPN is important to promote cell adhesion to the C-SR surface.
An ion beam tracking system based on a parallel plate avalanche counter
International Nuclear Information System (INIS)
Carter, I. P.; Ramachandran, K.; Dasgupta, M.; Hinde, D. J.; Rafiei, R.; Luong, D. H.; Williams, E.; Cook, K. J.; McNeil, S.; Rafferty, D. C.; Harding, A. B.; Muirhead, A. G.; Tunningley, T.
2013-01-01
A pair of twin position-sensitive parallel plate avalanche counters have been developed at the Australian National University as a tracking system to aid in the further rejection of unwanted beam particles from a 6.5 T super conducting solenoid separator named SOLEROO. Their function is to track and identify each beam particle passing through the detectors on an event-by-event basis. In-beam studies have been completed and the detectors are in successful operation, demonstrating the tracking capability. A high efficiency 512-pixel wide-angle silicon detector array will then be integrated with the tracking system for nuclear reactions studies of radioactive ions. (authors)
Swift heavy ion irradiation effects in Pt/C and Ni/C multilayers
Gupta, Ajay; Pandita, Suneel; Avasthi, D. K.; Lodha, G. S.; Nandedkar, R. V.
1998-12-01
Irradiation effects of 100 MeV Ag ion irradiation on Ni/C and Pt/C multilayers have been studied using X-ray reflectivity measurements. Modifications are observed in both the multilayers at (dE/dx)e values much below the threshold values for Ni and Pt. This effect is attributed to the discontinuous nature of the metal layers. In both the multilayers interfacial roughness increases with irradiation dose. While Ni/C multilayers exhibit large ion-beam induced intermixing, no observable intermixing is observed in the case of Pt/C multilayer. This difference in the behavior of the two systems suggests a significant role for chemically guided defect motion in the mixing process associated with swift heavy ion irradiation.
International Nuclear Information System (INIS)
Pröll, J.; Weidler, P.G.; Kohler, R.; Mangang, A.; Heißler, S.; Seifert, H.J.; Pfleging, W.
2013-01-01
The structure and phase formations of radio frequency magnetron sputtered lithium manganese oxide thin films (Li 1.1 Mn 1.9 O 4 ) under ambient air were studied. The influence of laser annealing and furnace annealing, respectively, on the bulk structure and surface phases was compared by using ex-situ X-ray diffraction and Raman analysis. Laser annealing technique formed a dominant (440)-reflection, furnace annealing led to both, (111)- and (440)-reflections within a cubic symmetry (S.G. Fd3m (227)). Additionally, in-situ Raman and in-situ X-ray diffraction were applied for online detection of phase transformation temperatures. In-situ X-ray diffraction measurements clearly identified the starting temperature for the (111)- and (440)-reflections around 525 °C and 400 °C, respectively. The 2θ Bragg peak positions of the characteristic (111)- and (440)-reflections were in good agreement with those obtained through conventional furnace annealing. Laser annealing of lithium manganese oxide films provided a quick and efficient technique and delivered a dominant (440)-reflection which showed the expected electrochemical behavior of the well-known two-step de-/intercalation process of lithium-ions into the cubic spinel structure within galvanostatic testing and cyclic voltammetry. - Highlights: ► Formation of cubic spinel-like phase of Li–Mn–O thin films by rapid laser annealing ► Laser annealing at 680 °C and 100 s was demonstrated as quick crystallization method. ► 400 °C was identified as characteristic onset temperature for (440)-reflex formation
Energy Technology Data Exchange (ETDEWEB)
Cho, Yong Ki, E-mail: choyk@kitech.re.kr [Heat Treatment and Surface Engineering R and D Group, Korea Institute of Industrial Technology, Incheon 406-840 (Korea, Republic of); Department of Physics, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Kim, Gang Sam; Song, Young Sik; Lim, Tae Hong [Heat Treatment and Surface Engineering R and D Group, Korea Institute of Industrial Technology, Incheon 406-840 (Korea, Republic of); Jung, Donggeun [Department of Physics, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)
2013-12-02
Molybdenum back contact films for Cu(In,Ga)Se{sub 2} (CIGS) solar cells have been deposited using DC magnetron sputtering methods. The electronic pathway properties of the molybdenum film have been highly dependent on the working gas pressure in magnetron sputtering, which should be carefully controlled to obtain high conductivity and adhesion. A coating method, cathodic arc ion plating, was used for molybdenum back contact electrode fabrication. The aim of this work was to find a metallization method for CIGS solar cells, which has less sensitivity on the working pressure. The resistivity, grain size, growth structures, stress, and efficiency of the films in CIGS solar cells were investigated. The results reveal that the growth structures of the molybdenum films mainly affect the conductivity. The lowest electrical resistivity of the ion-plated molybdenum films was 6.9 μΩ-cm at a pressure of 0.7 Pa. The electrical resistivity variation showed a gently increasing slope with linearity under a working gas pressure of 13.3 Pa. However, a high value of the residual stress of over 1.3 GPa was measured. In order to reduce stress, titanium film was selected as the buffer layer material, and the back contact films were optimized by double-layer coating of two kinds of hetero-materials with arc ion plating. CIGS solar cells prepared molybdenum films to measure the efficiency and to examine the effects of the back contact electrode. The resistivity, grain size, and surface morphology of molybdenum films were measured by four-point probe, X-ray diffraction, and a scanning electron microscope. The residual stress of the films was calculated from differences in bending curvatures measured using a laser beam. - Highlights: • Molybdenum back contact films for Cu(In,Ga)Se{sub 2} solar cells were prepared by the cathodic arc ion plating. • The lowest electrical resistivity of molybdenum film was 6.9 μΩ-cm. • Titanium buffer layer reduced the compressive residual stress
Corrosion behaviour of aluminium plates in aqueous medium
International Nuclear Information System (INIS)
Oliveira, M.F. de; Gaio, J.C.
1985-01-01
The process of corrosion concerning the aluminium 1050 plate was studied at room temperatures, 45 and 60 0 C in deionized water, the same Argonauta Reactor Water. Beyond the temperature influence, it was verified the effect of chloride ion and oxygen. It ws found that the amount of oxyde formed at room temperatures is almost negligible; at 45 and 60 0 C the samples were covered with bayerita, the quantity of oxide formed at 45 0 C being higher than at 60 0 C. It was observed that there will be risk of corrosion in the case of Reactor Water to undergo contamination with chloride ions. The results have shown that the material can be used since the medium don't be strongly oxidizing. At potentials higher than - 900M sup(V) ess (-280 m sup(V) sub(H)), the material will undergo pitting corrosion. (Author) [pt
Ion spectra of the metal vapor vacuum arc ion source with compound and alloy cathodes
Sasaki, Jun; Brown, Ian G.
1990-01-01
In metal vapor vacuum arc (MEVVA) ion sources, vacuum arc plasma with cathodes of single, pure elements has been utilized for the production of metal ions. In this study, we have investigated the charge state distributions of ions produced in vacuum arc plasmas in a MEVVA ion source for the case when the cathode is an alloy or a compound material. The ion charge state spectra were analyzed by means of a time-of-flight apparatus. We have compared the ion spectra for a cathode of an alloy or a compound material with its constituent elements: TiC/TiN/TiO2/Ti/C, SiC/Si/C, WC/W/C U/UN/(UN-ZrC)/Zr/C, and brass/Zn/Cu. We find that the MEVVA produces ions of all constituent elements in the compound and the alloy cathodes. The charge state distribution of each element differs, however, from the charge state distribution obtained in the vacuum arc with a cathode made of the pure, single constituent element. Fractional values of the total ion numbers of each constituent element in the extracted beam depart from the stoichiometry of the elements in the cathode material. In an operation with a TiC cathode, we irradiated a 304 stainless-steel plate with the extracted beam. Results from glow-discharge spectroscopy (GDS) of the surface show that both titanium and carbon are implanted in the substrate after the irradiation.
Effect of heavy ion irradiation on C 60
Lotha, S.; Ingale, A.; Avasthi, D. K.; Mittal, V. K.; Mishra, S.; Rustagi, K. C.; Gupta, A.; Kulkarni, V. N.; Khathing, D. T.
1999-06-01
Thin films of C 60 were subjected to swift heavy ion irradiation spanning the region from 2 to 11 keV/nm of electronic excitation. Studies of the irradiated films by Raman spectroscopy indicated polymerization and damage of the film with an ion fluence. The ion track radii are estimated for various ions using the Raman data. Photoluminescence spectroscopy of the irradiated film indicated a decrease in the C 60 phase with a dose, and an increase in the intensity at the 590 nm wavelength, which is attributed to an increase in the oxygen content.
10 CFR 440.1 - Purpose and scope.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Purpose and scope. 440.1 Section 440.1 Energy DEPARTMENT... scope. This part implements a weatherization assistance program to increase the energy efficiency of... with children, high residential energy users, and households with high energy burden. [65 FR 77217, Dec...
International Nuclear Information System (INIS)
Terasako, Tomoaki; Nomoto, Junichi; Makino, Hisao; Yamamoto, Naoki; Shirakata, Sho; Yamamoto, Tetsuya
2015-01-01
Structural properties of highly c-axis oriented polycrystalline Ga-doped ZnO (GZO) films prepared by ion-plating with a DC arc discharge were studied in terms of the oxygen gas flow rate (F O2 ) introduced into the chamber during the deposition process and the Ga 2 O 3 content in the GZO sintered pellet. The X-ray diffraction (XRD) measurements revealed that the GZO films have the residual compressive stress along the a-axis direction (in-plane) and the tensile stress along the c-axis direction (out-of-plane). The increase in F O2 or the increase in Ga 2 O 3 content was effective for relaxing the in-plane compressive stress induced by the so-called atomic peening effect. The positive correlation between the carrier concentration (n) and the primitive cell volume (V) would be due to the incorporation of Ga atoms substituting Zn sites (Ga Zn s) together with the generation of n-type intrinsic defects or complex defects. - Highlights: • Films of Ga-doped ZnO (GZO) films were deposited by ion-plating with a DC arc discharge. • Structural properties of GZO films were examined by X-ray diffraction measurements. • GZO films had the residual compressive stress along the a-axis direction. • There was the correlation between the carrier concentration and the cell volume.
Energy Technology Data Exchange (ETDEWEB)
Terasako, Tomoaki, E-mail: terasako.tomoaki.mz@ehime-u.ac.jp [Graduate School of Science and Engineering, Ehime University, 3 Bunkyo-cho, Matsuyama-shi, Ehime 790-8577 (Japan); Nomoto, Junichi; Makino, Hisao; Yamamoto, Naoki [Research Institute, Kochi University of Technology, 185 Miyanokuchi, Tosayamada-cho, Kami-shi, Kochi 782-8502 (Japan); Shirakata, Sho [Graduate School of Science and Engineering, Ehime University, 3 Bunkyo-cho, Matsuyama-shi, Ehime 790-8577 (Japan); Yamamoto, Tetsuya [Research Institute, Kochi University of Technology, 185 Miyanokuchi, Tosayamada-cho, Kami-shi, Kochi 782-8502 (Japan)
2015-12-01
Structural properties of highly c-axis oriented polycrystalline Ga-doped ZnO (GZO) films prepared by ion-plating with a DC arc discharge were studied in terms of the oxygen gas flow rate (F{sub O2}) introduced into the chamber during the deposition process and the Ga{sub 2}O{sub 3} content in the GZO sintered pellet. The X-ray diffraction (XRD) measurements revealed that the GZO films have the residual compressive stress along the a-axis direction (in-plane) and the tensile stress along the c-axis direction (out-of-plane). The increase in F{sub O2} or the increase in Ga{sub 2}O{sub 3} content was effective for relaxing the in-plane compressive stress induced by the so-called atomic peening effect. The positive correlation between the carrier concentration (n) and the primitive cell volume (V) would be due to the incorporation of Ga atoms substituting Zn sites (Ga{sub Zn}s) together with the generation of n-type intrinsic defects or complex defects. - Highlights: • Films of Ga-doped ZnO (GZO) films were deposited by ion-plating with a DC arc discharge. • Structural properties of GZO films were examined by X-ray diffraction measurements. • GZO films had the residual compressive stress along the a-axis direction. • There was the correlation between the carrier concentration and the cell volume.
42 CFR 440.130 - Diagnostic, screening, preventive, and rehabilitative services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Diagnostic, screening, preventive, and rehabilitative services. 440.130 Section 440.130 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES... Definitions § 440.130 Diagnostic, screening, preventive, and rehabilitative services. (a) “Diagnostic services...
Mobarak, H. M.; Masjuki, H. H.; Mohamad, E. Niza; Kalam, M. A.; Rashedul, H. K.; Rashed, M. M.; Habibullah, M.
2014-10-01
The application of diamond-like carbon (DLC) coatings on automotive components is emerging as a favorable strategy to address the recent challenges in the industry. DLC coatings can effectively lower the coefficient of friction (CoF) and wear rate of engine components, thereby improving their fuel efficiency and durability. The lubrication of ferrous materials can be enhanced by a large amount of unsaturated and polar components of oils. Therefore, the interaction between nonferrous coatings (e.g., DLC) and vegetable oil should be investigated. A ball-on-plate tribotester was used to run the experiments. Stainless steel plates coated with amorphous hydrogenated (a-C:H) DLC and hydrogen-free tetrahedral (ta-C) DLC that slide against 440C stainless steel ball were used to create a ball-on-plate tribotester. The wear track was investigated through scanning electron microscopy. Energy dispersive and X-ray photoelectron spectroscopies were used to analyze the tribofilm inside the wear track. Raman analysis was performed to investigate the structural changes in the coatings. At high temperatures, the CoF in both coatings decreased. The wear rate, however, increased in the a-C:H but decreased in the ta-C DLC-coated plates. The CoF and the wear rate (coated layer and counter surface) were primarily influenced by the graphitization of the coating. Tribochemical films, such as polyphosphate glass, were formed in ta-C and acted as protective layers. Therefore, the wear rate of the ta-C DLC was lower than that of the-C:H DLC.
Solution and implementation of project ''Simulator of WWER-440 nuclear power plant''
International Nuclear Information System (INIS)
Koukal, V.
1985-01-01
The time data are given of the development and construction of the simulator of a WWER-440 nuclear power plant unit. The individual tasks are summed up which are related to the project implementation, and cooperating institutions and enterprises are listed. (J.C.)
High resolution spectrometry for relativistic heavy ions
Energy Technology Data Exchange (ETDEWEB)
Gabor, G; Schimmerling, W; Greiner, D; Bieser, F; Lindstrom, P [California Univ., Berkeley (USA). Lawrence Berkeley Lab.
1975-12-01
Several techniques are discussed for velocity and energy spectrometry of relativistic heavy ions with good resolution. A foil telescope with chevron channel plate detectors is described. A test of this telescope was performed using 2.1 GeV/A C/sup 6 +/ ions, and a time-of-flight resolution of 160 ps was measured. Qualitative information on the effect of foil thickness was also obtained.
The Introduction and Development of Plate Armour in Medieval Western Europe c. 1250-1350
Dowen, Keith
2017-01-01
European underwent a period of rapid development and experimentation in the century after c. 1250. Whilst very little physical material has survived from this time, artistic depictions, wills, inventories and contemporary accounts attest to the use of metal plate defences much earlier than has commonly been assumed. By the turn of the 14th century, all the major elements of plate armour had been developed; with the subsequent half century seeing an increase in the quantity of plate worn on th...
International Nuclear Information System (INIS)
Nakajima, Hisao; Kohara, Shigeo; Kageyama, Tadashi; Kohno, Isao
1977-01-01
The heavy ion source, of electron bombarded hot cathode type, is usually operated by applying direct current for arc discharge. In order to accelerate Ne 6+ ion in the cyclotron, a pulsed operation of this source was attempted. Ne 6+ and O 6+ ions were accelerated successfully up to 160 MeV and more than 0.1 μA of these ion were extracted from the cyclotron. C 5+ , Ne 7+ and 22 Ne 6+ ions were also extracted with a modest intensity of beam. The intensity of C 4+ , N 4+ , N 5+ , and O 5+ ions was increased about ten times. (auth.)
Containment leak-tightness enhancement at VVER 440 NPPs
International Nuclear Information System (INIS)
Prandorfy, M.
2001-01-01
The hermetic compartments of VVER 440 NPPs fulfil the function of the containment used at NPPs all over the word. The purpose of the containment is to protect the NPP personal against radioactive impact as well as to prevent radioactive leakage to the environment during a lost of coolant accident. Leak-tightness enhancement in NPPs with VVER 440/213 and VVER 440/230 reactors is an important safety issue. New procedures, measures and methods were adopted at NPPs in Mochovce, J. Bohunice, Dukovany and Paks for leak identification and sealing works performed by VUEZ Levice. (authors)
Containment leak-tightness enhancement at VVER 440 NPPs
International Nuclear Information System (INIS)
Prandorfy, M.
2000-01-01
The hermetic compartments of WWER 440 NPPs fulfil the function of the containment used at NPPs all over the world. The purpose of the containment is to protect the NPP personnel against radioactive impact as well as to prevent radioactive leakage to the. environ ent during a lost of coolant accident. Leak-tightness enhancement in NPPs with WWER 440/213 and WWER 440/230 reactors is an important safety issue. New procedures, measures and methods were adopted at NPPs in Mochovce, Jaslovske Bohunice, Dukovany and PAKS for leak identification and sealing works performed by VUEZ Levice. (authors)
Optimization of the Adhesion Strength of Arc Ion Plating TiAlN Films by the Taguchi Method
Directory of Open Access Journals (Sweden)
Tong-Yul Cho
2009-06-01
Full Text Available A three-level six-factor (arc power, substrate temperature, pre-treatment bias voltage, working pressure, deposition bias voltage and pretreatment time orthogonal experimental array (L18 to optimize the adhesion strength of arc ion plating (AIP TiAlN films was designed using the Taguchi method. An optimized film process, namely substrate temperature 220 °C, arc power 60 A, negative bias voltage -800 V, nitrogen pressure 10-2 Torr, pretreated voltage -450 V and pretreated time 15 minutes was obtained by the Taguchi program for the purpose of obtaining a larger critical load. The critical load of the optimized TiAlN film (53 N was increased by 43% compared to the film with the highest critical load before optimization. The improvement in the adhesion strength of the films was attributed to the enhancement of hardness and the competitive growth of the (111, (200 and (220 orientations in the film.
42 CFR 440.210 - Required services for the categorically needy.
2010-10-01
... services: (1) The services defined in §§ 440.10 through 440.50, 440.70, and (to the extent nurse-midwives and nurse practitioners are authorized to practice under State law or regulation) the services defined... necessary for the health of the pregnant woman and fetus, or that have become necessary as a result of the...
Synthesis of Fe–C{sub 60} complex by ion irradiation
Energy Technology Data Exchange (ETDEWEB)
Minezaki, Hidekazu, E-mail: dn1000012@toyo.jp [Graduate School of Engineering, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585 (Japan); Oshima, Kosuke [Graduate School of Engineering, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585 (Japan); Uchida, Takashi; Mizuki, Toru [Bio-Nano Electronics Research Centre, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585 (Japan); Racz, Richard [Institute of Nuclear Research (ATOMKI), H-4026, Debrecen, Bem tér 18/C (Hungary); Muramatsu, Masayuki [National Institute of Radiological Sciences (NIRS), 4-9-1 Anagawa, Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Asaji, Toyohisa [Oshima National College of Maritime Technology, 1091-1 Komatsu Suou Oshima City, Oshima, Yamaguchi 742-2193 (Japan); Kitagawa, Atsushi [National Institute of Radiological Sciences (NIRS), 4-9-1 Anagawa, Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Kato, Yushi [Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita-shi, Osaka 565-0871 (Japan); Biri, Sandor [Institute of Nuclear Research (ATOMKI), H-4026, Debrecen, Bem tér 18/C (Hungary); Yoshida, Yoshikazu [Graduate School of Engineering, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585 (Japan); Bio-Nano Electronics Research Centre, Toyo University, 2100 Kujirai, Kawagoe, Saitama 350-8585 (Japan)
2013-09-01
Highlights: •The Fe{sup +} beam was irradiated to the C{sub 60} thin films. •The Fe{sup +}-irradiated C{sub 60} thin films were analyzed by LDI-TOF-MS and by HPLC. •The peak with mass/charge of 776 was observed in the Fe{sup +}-irradiated C{sub 60} thin film. •We could synthesize the Fe–C{sub 60} complex as a new material. -- Abstract: In order to synthesize the Fe@C{sub 60} complex, iron ion beam irradiated to C{sub 60} thin films. The energy of the irradiated iron ions was controlled from 50 eV to 250 eV. The dose of that was controlled from 6.67 × 10{sup 12} to 6.67 × 10{sup 14} ions/cm{sup 2}. By the analysis of the surface of the iron ion irradiated C{sub 60} thin films using laser desorption/ionization time-of-flight mass spectrometry, we could confirm the peak with mass/charge of 776. The mass/charge of 776 corresponds to Fe + C{sub 60}. We obtained the maximum intensity of the peak with mass/charge of 776 under the irradiation iron ion energy and the dose were 50 eV and 3.30 × 10{sup 13} ions/cm{sup 2}, respectively. Then, the separation of the material with mass of 776 was performed by using high performance liquid chromatography. We could separate the Fe + C{sub 60} from the iron ion irradiated C{sub 60} thin film. As a result, we could synthesize the Fe + C{sub 60} complex as a new material.
Fast heavy ion collisions with C60: Collective excitation
International Nuclear Information System (INIS)
Kadhane, Umesh; Kelkar, A.H.; Misra, D.; Kumar, Ajay; Tribedi, L.C.
2006-01-01
Ionization and fragmentation of C 60 in collision with 5 MeV/μm O 6+ ions are studied using recoil ion ToF method. Relative ionization cross sections up to C 60 4+ are determined. The qualitative trend for different C 60 charge states was compared against simple plasmon excitation model
40 CFR 440.40 - Applicability; description of the mercury ore subcategory.
2010-07-01
... mercury ore subcategory. 440.40 Section 440.40 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Mercury Ore Subcategory § 440.40 Applicability; description of the mercury ore subcategory. The provisions of subpart D...
[Treatment of type C intercondylar fractures of distal humerus using dual plating].
Liu, Ya-Ke; Xu, Hua; Liu, Fan; Wang, You-Hua; Tao, Ran; Cao, Yi; Wang, Hong; Zhou, Zhen-Yu; Zhu, Yong
2009-06-15
To evaluate the clinical outcome of dual plating in the treatment of humeral intercondylar type-C fractures in adults. From June 2004 to October 2007, 38 cases of type-C distal humeral fractures were stabilised with dual plating. There were 21 males and 17 females. The average age was 43 years with a range from 21 to 71 years. According to the AO classification, 9 cases were of type C1, 17 of C2 and 12 of C3. The posterior midline approach was selected. Twenty-one cases were exposed through the trans-olecranon osteotomy, 11 through the Campbell (Van Gorder) approach, 6 through triceps sparing approach. Autogenous bone graft was performed in 5 cases because of severe comminution. Thirty-five patients were followed-up for 14-30 months (mean 24.2 months). At the latest follow-up, the elbow flexion averaged 119 degrees (range 90 degrees - 135 degrees ), and the loss of extension averaged 16.2 degrees (range 5 degrees - 25 degrees ). All the patients got bony healing, the average healing period was 14 weeks. The patients were evaluated using the criteria of Aitken and Rorabeek and the scores were 13 excellent, 16 good, 6 fair. Twenty-nine patients (82.9%) had a good or excellent results. Complications included 4 cases of traumatic osteoarthritis, 2 heterotopic ossification, 1 ulnar neuropathy. Infection as well as loosening or breakage of the implant was not found. The dual plating is able to provide rigid fixation for the humeral intercondylar fractures. In addition, it can allow early functional exercise after operation, decrease the related complications significantly, and improve the functional results.
International Nuclear Information System (INIS)
Samohyl, P.
1993-07-01
The fatigue damage of the primary circuit of WWER-440/213c reactors was evaluated proceeding from actual and design operating data of units 3 and 4 of the Bohunice V-2 nuclear power plant. A complex computation model was set up, encompassing the main circulation pipeline, pressurizer pipeline, emergency core aftercooling system pipeline, steam pipeline, and feedwater pipeline. The standardized STATIC code was applied to the stress analysis, and the FATLBB code was used to determine the crack increment for all operating states and primary circuit sections. The probability of fatigue failure of the pipelines was found to be low. (J.B.). 55 tabs., 3 figs., 9 refs
20 CFR 663.440 - What are the requirements for consumer choice?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What are the requirements for consumer choice? 663.440 Section 663.440 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF... Training Accounts § 663.440 What are the requirements for consumer choice? (a) Training services, whether...
Effects of dual-ion irradiation on the swelling of SiC/SiC composites
International Nuclear Information System (INIS)
Kishimoto, Hirotatsu; Kohyama, Akira; Ozawa, Kazumi; Kondo, Sosuke
2005-01-01
Silicon carbide (SiC) matrix composites reinforced by SiC fibers is a candidate structural material of fusion gas-cooled blanket system. From the viewpoint of material designs, it is important to investigate the swelling by irradiation, which results from the accumulation of displacement damages. In the fusion environment, (n, α) nuclear reactions are considered to produce helium gas in SiC. For the microstructural evolution, a dual-ion irradiation method is able to simulate the effects of helium. In the present research, 1.7 MeV tandem and 1 MeV single-end accelerators were used for Si self-ion irradiation and helium implantation, respectively. The average helium over displacement per atom (dpa) ratio in SiC was adjusted to 60 appm/dpa. The irradiation temperature ranged from room temperature to 1400degC. The irradiation-induced swelling was measured by the step height method. Helium that was implanted simultaneously with displacement damages in dual-ion irradiated SiC increased the swelling that was larger than that by single-ion irradiated SiC below 800degC. Since this increase was not observed above 1000degC, the interaction of helium and displacement damages was considered to change above 800degC. In this paper, the microstructural behavior and dimensional stability of SiC materials under the fusion relevant environment are discussed. (author)
Kuleshova, E. A.; Gurovich, B. A.; Maltsev, D. A.; Frolov, A. S.; Bukina, Z. V.; Fedotova, S. V.; Saltykov, M. A.; Krikun, E. V.; Erak, D. Yu; Zhurko, D. A.; Safonov, D. V.; Zhuchkov, G. M.
2018-04-01
This study was carried out to evaluate the possibility of 1st generation VVER-440 reactors lifetime extension by recovery re-annealing with the respect to base metal (BM). Comprehensive studies of the structure and properties of BM templates (samples cut from the inner surface of the shells in beltline region) of operating VVER-440 reactor (after primary standard recovery annealing 475 °C/150 h and subsequent long-term re-irradiation within reactor pressure vessel (RPV)) were conducted. These templates were also subjected to laboratory re-annealing 475 °C/150 h. TEM, SEM and APT studies of BM after laboratory re-annealing revealed significant recovery of radiation-induced hardening elements (Cu-rich precipitates and dislocation loops). Simultaneously a process of strong phosphorus accumulation at grain boundaries occurs since annealing temperature corresponds to the maximum reversible temper brittleness development. The latter is not observed for VVER-440 weld metal (WM). Comparative assessment of the properties return level for the beltline BM templates after recovery re-annealing 475 °C/150 h showed that it does not reach the one typical for beltline WM after the same annealing.
40 CFR 440.90 - Applicability; description of the antimony ore subcategory.
2010-07-01
... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Applicability; description of the antimony ore subcategory. 440.90 Section 440.90 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Antimony Ore Subcategory § 440.90 Applicability;...
Response of Soviet VVER-440 accident localization systems to overpressurization
International Nuclear Information System (INIS)
Kulak, R.F.; Fiala, C.; Sienicki, J.J.
1989-01-01
The Soviet designed VVER-440 model V230 and VVER-440 model V213 reactors do not use full containments to mitigate the effects of accidents. Instead, these VVER-440 units employ a sealed set of interconnected compartments, collectively called the accident localization system (ALS), to reduce the release of radionuclides to the atmosphere during accidents. Descriptions of the VVER accident localization structures may be found in the report DOE NE-0084. The objective of this paper is to evaluate the structural integrity of the VVER-440 ALS at the Soviet design pressure, and to determine their response to pressure loadings beyond the design value. Complex, three-dimensional, nonlinear, finite element models were developed to represent the major structural components of the localization systems of the VVER-440 models V230 and V213. The interior boundary of the localization system was incrementally pressurized in the calculations until the prediction of gross failure. 6 refs., 9 figs
Feasibility of VVER-440 type SFAT
International Nuclear Information System (INIS)
Kaartinen, J.; Tarvainen, M.
1995-05-01
Spent fuel attribute tester, SFAT, has been constructed and tested for gross defect verification of VVER-440 type spent fuel assemblies. Based on earlier optimisation studies, the VVER-440 SFAT is kept hanging from the mast of the fuel handling machine moved by the operator. The device tested includes a standard 2' x 2' NaI(T1) detector connected to a commercial MCA. The results achieved with normal VVER-440 spent fuel assemblies at the Loviisa npp in Finland in November 1994 show that the method is feasible. The design of the so-called fuel follower assemblies, however, prevents SFAT verification, at least with moderate measurement times. Verification of the presence of the assemblies based on the detection of the fission product 137 Cs (662 keV) is possible even in 10-30 seconds. Measurement times of the order of 1-2 minutes make it possible to draw also semi-quantitative conclusions of the burnup and cooling time of the operator declared data (consistency check). (orig.) (7 refs., 11 figs., 3 tabs.)
International Nuclear Information System (INIS)
Sun, C.-C.; Lee, S.-C.; Dai, S.-B.; Tien, S.-L.; Chang, C.-C.; Fu, Y.-S.
2007-01-01
Semiconductor IC packaging molding dies require wear resistance, corrosion resistance and non-sticking (with a low surface free energy). The molding releasing capability and performance are directly associated with the surface free energy between the coating and product material. The serious sticking problem reduces productivity and reliability. Depositing TiN, TiMoS, ZrN, CrC, CrN, NiCr, NiCrN, CrTiAlN and CrNiTiAlN coatings using closed field unbalanced magnetron sputter ion plating, and characterizing their surface free energy are the main object in developing a non-stick coating system for semiconductor IC molding tools. The contact angle of water, diiodomethane and ethylene glycol on the coated surfaces were measured at temperature in 20 deg. C using a Dataphysics OCA-20 contact angle analyzer. The surface free energy of the coatings and their components (dispersion and polar) were calculated using the Owens-Wendt geometric mean approach. The surface roughness was investigated by atomic force microscopy (AFM). The adhesion force of these coatings was measured using direct tensile pull-off test apparatus. The experimental results showed that NiCrN, CrN and NiCrTiAlN coatings outperformed TiN, ZrN, NiCr, CiTiAlN, CrC and TiMoS coatings in terms of non-sticking, and thus have the potential as working layers for injection molding industrial equipment, especially in semiconductor IC packaging molding applications
Nonlinear damage effect in graphene synthesis by C-cluster ion implantation
International Nuclear Information System (INIS)
Zhang Rui; Zhang Zaodi; Wang Zesong; Wang Shixu; Wang Wei; Fu Dejun; Liu Jiarui
2012-01-01
We present few-layer graphene synthesis by negative carbon cluster ion implantation with C 1 , C 2 , and C 4 at energies below 20 keV. The small C-clusters were produced by a source of negative ion by cesium sputtering with medium beam current. We show that the nonlinear effect in cluster-induced damage is favorable for graphene precipitation compared with monomer carbon ions. The nonlinear damage effect in cluster ion implantation shows positive impact on disorder reduction, film uniformity, and the surface smoothness in graphene synthesis.
Low energy ion implantation and high energy heavy ion irradiation in C60 films
International Nuclear Information System (INIS)
Narayanan, K.L.; Yamaguchi, M.; Dharmarasu, N.; Kojima, N.; Kanjilal, D.
2001-01-01
C 60 films have been bombarded with low energy boron ions and high energy swift heavy ions (SHI) of silver and oxygen at different doses. Raman scattering and Fourier transform infrared (FTIR) studies were carried out on the virgin and irradiated films and the results are in good agreement with each other. The films subject to low energy boron ion implantation showed destruction of the bukky balls whereas the films subject to high energy ion irradiation did not show appreciable effects on their structure. These results indicate that C 60 films are more prone to defects by elastic collision and subsequent implantation at lower energy. Irradiation at higher energy was less effective in creating appreciable defects through electronic excitation by inelastic collisions at similar energy density
Beutler, E; Forman, L; West, C; Gelbart, T
1988-03-15
The effect of the xanthone derivative 2-(2-hydroxyethoxy)-6-(1-H-tetrazole-5-yl)xanthen-9-one (BW A440C) on red cells was studied. When added to stored red cells at a concentration of 6 mM, greatly improved preservation of 2,3-diphosphoglycerate (2,3-DPG) was observed. There was no effect on internal pH of the erythrocyte. At a concentration 0.500 mM, many red cell enzyme activities were inhibited completely. At a 0.500 mM concentration, however, inhibition of pyruvate kinase and diphosphoglycerate phosphatase was most striking. Inhibition of either of these enzymes could result in elevation of 2,3-DPG levels. BW A440C in concentrations which elevated 2,3-DPG levels in humans caused a decrease in 2,3-DPG levels in rabbits and markedly impaired the viability of 21-day stored rabbit erythrocytes.
Recovery process for electroless plating baths
Anderson, Roger W.; Neff, Wayne A.
1992-01-01
A process for removing, from spent electroless metal plating bath solutions, accumulated byproducts and counter-ions that have deleterious effects on plating. The solution, or a portion thereof, is passed through a selected cation exchange resin bed in hydrogen form, the resin selected from strong acid cation exchangers and combinations of intermediate acid cation exchangers with strong acid cation exchangers. Sodium and nickel ions are sorbed in the selected cation exchanger, with little removal of other constituents. The remaining solution is subjected to sulfate removal through precipitation of calcium sulfate hemihydrate using, sequentially, CaO and then CaCO.sub.3. Phosphite removal from the solution is accomplished by the addition of MgO to form magnesium phosphite trihydrate. The washed precipitates of these steps can be safely discarded in nontoxic land fills, or used in various chemical industries. Finally, any remaining solution can be concentrated, adjusted for pH, and be ready for reuse. The plating metal can be removed from the exchanger with sulfuric acid or with the filtrate from the magnesium phosphite precipitation forming a sulfate of the plating metal for reuse. The process is illustrated as applied to processing electroless nickel plating baths.
Heavy ion fusion notes 94-1 through 94-9
International Nuclear Information System (INIS)
Judd, D.; Rintamaki, J.; Lund, S.
1995-01-01
This report contains information on the following topics dealing with heavy ion fusion accelerators: steering errors and corrections in a small recirculator; evaluation of a capacitive beam position monitor diagnostic for use on the heavy ion recirculator; beam steering with dipole biased electrostatic quadrupoles; estimate of emittance growth; c-probes for the recirculator; analysis of the dipole plate shape and location; and generation of electric dipole waveforms
Heavy ion fusion notes 94-1 through 94-9
Energy Technology Data Exchange (ETDEWEB)
Judd, D.; Rintamaki, J.; Lund, S. [and others
1995-03-13
This report contains information on the following topics dealing with heavy ion fusion accelerators: steering errors and corrections in a small recirculator; evaluation of a capacitive beam position monitor diagnostic for use on the heavy ion recirculator; beam steering with dipole biased electrostatic quadrupoles; estimate of emittance growth; c-probes for the recirculator; analysis of the dipole plate shape and location; and generation of electric dipole waveforms.
Radiation stability and recovery of WWER-440 materials
Energy Technology Data Exchange (ETDEWEB)
Amaev, A; Kryukov, A; Levit, V; Platonov, P; Sokolov, M
1994-12-31
The main results of a complex investigation of radiation embrittlement of WWER-440 reactor vessel materials, carried out in Russia, are presented. The effect of the annealing temperature and annealing time, neutron fluence, and phosphorous and copper impurity contents on the recovery of the ductile-to-brittle transition temperature are studied. It is shown that the recovery of the transition temperature depends mainly on the annealing temperature. At an annealing temperature of 420 and 460 C, residual post-annealing embrittlement does not depend on neutron fluence. 14 figs., 3 tabs.
Radiation stability and recovery of WWER-440 materials
International Nuclear Information System (INIS)
Amaev, A.; Kryukov, A.; Levit, V.; Platonov, P.; Sokolov, M.
1993-01-01
The main results of a complex investigation of radiation embrittlement of WWER-440 reactor vessel materials, carried out in Russia, are presented. The effect of the annealing temperature and annealing time, neutron fluence, and phosphorous and copper impurity contents on the recovery of the ductile-to-brittle transition temperature are studied. It is shown that the recovery of the transition temperature depends mainly on the annealing temperature. At an annealing temperature of 420 and 460 C, residual post-annealing embrittlement does not depend on neutron fluence. 14 figs., 3 tabs
Alió, Jorge L; Plaza-Puche, Ana B; Javaloy, Jaime; Ayala, María José; Vega-Estrada, Alfredo
2013-04-01
To compare the visual and intraocular optical quality outcomes with different designs of the refractive rotationally asymmetric multifocal intraocular lens (MFIOL) (Lentis Mplus; Oculentis GmbH, Berlin, Germany) with or without capsular tension ring (CTR) implantation. One hundred thirty-five consecutive eyes of 78 patients with cataract (ages 36 to 82 years) were divided into three groups: 43 eyes implanted with the C-Loop haptic design without CTR (C-Loop haptic only group); 47 eyes implanted with the C-Loop haptic design with CTR (C-Loop haptic with CTR group); and 45 eyes implanted with the plate-haptic design (plate-haptic group). Visual acuity, contrast sensitivity, defocus curve, and ocular and intraocular optical quality were evaluated at 3 months postoperatively. Significant differences in the postoperative sphere were found (P = .01), with a more myopic postoperative refraction for the C-Loop haptic only group. No significant differences were detected in photopic and scotopic contrast sensitivity among groups (P ⩾ .05). Significantly better visual acuities were present in the C-Loop haptic with CTR group for the defocus levels of -2.0, -1.5, -1.0, and -0.50 D (P ⩽.03). Statistically significant differences among groups were found in total intraocular root mean square (RMS), high-order intraocular RMS, and intraocular coma-like RMS aberrations (P ⩽.04), with lower values from the plate-haptic group. The plate-haptic design and the C-Loop haptic design with CTR implantation both allow good visual rehabilitation. However, better refractive predictability and intraocular optical quality was obtained with the plate-haptic design without CTR implantation. The plate-haptic design seems to be a better design to support rotational asymmetric MFIOL optics. Copyright 2013, SLACK Incorporated.
International Nuclear Information System (INIS)
Park, J.Y.; Park, K.H.; Kim, W.; Kishimoto, H.; Kohyama, A.
2007-01-01
Full text of publication follows: SiC/SiC composites have been considered as a structural material for advanced fusion concepts. In the core of fusion reactor, those SiC/SiC composites are experienced the complex attacks such as strong neutron, high temperature and transmuted gases. One of the vital data for designing the SiC/SiC composites to the fusion reactor is mechanical properties under the severe neutron irradiation. In this work, various SiC/SiC composites were prepared by the different fabrication processes like CVI (chemical vapor infiltration), WA-CVI (SiC whisker assisted CVI) and hot-pressed method. The expected neutron irradiation was simulated by a silicon self-ion irradiation at a DuET facility; Dual-beam for Energy Technologies, Kyoto University. The irradiation temperature were 600 deg. C and 1200 deg. C, and the irradiation does were 5 dpa and 20 dpa, respectively. The 5.1 MeV Si ions were irradiated to the intrinsic CVI-SiC, SiC whisker reinforced SiC and SiC composites produced by hot-press method. The mechanical properties like hardness, elastic modulus and fracture toughness were characterized by an indentation technique. The ion irradiation caused the increase of the hardness and fracture toughness, which was dependent on the irradiation temperature. SiC whisker reinforcement in the SiC matrix accelerated the increase of the fracture toughness by the ion irradiation. For SiC/SiC composites after the ion irradiation, this work will provide the additional data for the mechanical properties as well as the effect of SiC whisker reinforcement. (authors)
10 CFR 440.23 - Oversight, training, and technical assistance.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Oversight, training, and technical assistance. 440.23... PERSONS § 440.23 Oversight, training, and technical assistance. (a) The Secretary and the appropriate..., directly or indirectly, training and technical assistance to any grantee or subgrantee. Such training and...
APROS multifunctional simulator applications for VVER-440
International Nuclear Information System (INIS)
Porkholm, K.; Kantee, H.; Tiihonen, O.
2000-01-01
Fortum Engineering Ltd and the Technical Research Centre of Finland have developed APROS simulation software since 1986. APROS is a multifunctional simulator, which is used for process and automation design, safety analysis and training simulator applications. APROS has unique features and models developed especially for VVER-440 reactors. At first the paper gives a short overview of APROS multifunctional simulator. The rest of the paper deals with different kind of applications of APROS in VVER-440 reactors' improvement and operation development. (author)
Ion vapor deposition and its application
International Nuclear Information System (INIS)
Bollinger, H.; Schulze, D.; Wilberg, R.
1981-01-01
Proceeding from the fundamentals of ion vapor deposition the characteristic properties of ion-plated coatings are briefly discussed. Examples are presented of successful applications of ion-plated coatings such as coatings with special electrical and dielectric properties, coatings for corrosion prevention, and coatings for improving the surface properties. It is concluded that ion vapor deposition is an advantageous procedure in addition to vapor deposition. (author)
Electrochemical decomposition of fluorinated wetting agents in plating industry waste water.
Fath, Andreas; Sacher, Frank; McCaskie, John E
2016-01-01
Electrochemical decomposition of fluorinated surfactants (PFAS, perfluorinated alkyl substances) used in the plating industry was analyzed and the decomposition process parameters optimized at the laboratory scale and production scale of a 500-liter reactor using lead electrodes. The method and system was successfully demonstrated under production conditions to treat PFAS) with up to 99% efficiency in the concentration range of 1,000-20,000 μg/l (1 ppm-20 ppm). The treatment also reduced hexavalent chromium (Cr(6+)) ions to trivalent chromium (Cr(3+)) ions in the wastewater. If the PFAS-containing wastewater is mixed with other wastewater streams, specifically from nickel plating drag out solution or when pH values >5, the treatment process is ineffective. For the short chain PFAS, (perfluorobutylsulfonate) the process was less efficient than C6-C8 PFAS. The process is automated and has safety procedures and controls to prevent hazards. The PFAS were decomposed to hydrogen fluoride (HF) under the strong acid electrochemical operating conditions. Analytical tests showed no evidence of organic waste products remaining from the process. Conventional alternative PFAS removal systems were tested on the waste streams and compared with each other and with the-E-destruct (electrochemical oxidation) process. For example, ion exchange resin (IX resin) treatment of wastewater to complex and remove PFAS was found to be seven times more efficient when compared to the conventional activated carbon absorption (C-treat) process. However, the E-destruct process is higher in capacity, exhibits longer service life and lower operating costs than either IX or C-treat methods for elimination of PFAS from these electroplating waste streams.
Iron ion implantation into C60 layer
International Nuclear Information System (INIS)
Racz, R.; Biri, S.; Csik, A.; Vad, K.
2011-01-01
Complete text of publication follows. The soccer ball shaped carbon molecule consisting of 60 carbon atoms (C 60 , fullerene) was discovered in 1985. Since that time the fullerene has become intensively studied. This special molecule has much potential in medical care, biotechnology and nanotechnology. We are motivated to produce special type fullerenes, so called endohedral fullerenes (some alien atoms are encapsulated inside the fullerene cage). The spring of our motivation is that the Fe at C 60 could be applied as a contrast material for MRI (Magnetic Resonance Imaging) or microwave heat therapy. One way to make X at C 60 is the surface production using an ECRIS (Electron Cyclotron Resonance Ion Source). An evaporated or preprepared fullerene layer is irradiated by ions to form a new material during the implantation. By this method several kinds of atomic species, such as Li, Na, K, Rb, Xe were encapsulated into the fullerenes. However evidence for the Fe at C 60 has not been found yet. During the analysis of the irradiated samples three questions must be answered. 1. Are there iron atoms in the layer and where? 2. Does the iron bond to the fullerene? 3. How does the iron bond to the fullerene, inside or outside? Using different investigation tools, SNMS (Secondary Neural Mass Spectrometer), MALDI-TOF (Matrix Assisted Laser Desorption Ionization Time of Flight), XPS (Xray Photoelectron Spectroscopy) or HPLC (High-Performance Liquid Chromatography), all these questions could be clarified step by step. In this paper we made the first steps to answer the first question: fullerene layers irradiated by iron ion beam delivered by the ATOMKI-ECRIS have been analyzed by the ATOMKI-SNMS. The evaporated 90 - 120 nm thick fullerene layers on Si holder were irradiated by Fe 5+ and Fe + ion beams produced from Ferrocene vapor. Samples were irradiated with two different doses (5 10 18 ion/cm 3 and 10 22 ion/cm 3 ) at four ion energies (65 keV, 6.5 keV, 0.2 keV and two of
Ballinger, Jared
Diamond thin films have promising applications in numerous fields due to the extreme properties of diamonds in conjunction with the surface enhancement of thin films. Biomedical applications are numerous including temporary implants and various dental and surgical instruments. The unique combination of properties offered by nanostructured diamond films that make it such an attractive surface coating include extreme hardness, low obtainable surface roughness, excellent thermal conductivity, and chemical inertness. Regrettably, numerous problems exist when attempting to coat stainless steel with diamond generating a readily delaminated film: outward diffusion of iron to the surface, inward diffusion of carbon limiting necessary surface carbon precursor, and the mismatch between the coefficients of thermal expansion yielding substantial residual stress. While some exotic methods have been attempted to overcome these hindrances, the most common approach is the use of an intermediate layer between the stainless steel substrate and the diamond thin film. In this research, both 316 stainless steel disks and 440C stainless steel ball bearings were tested with interlayers including discrete coatings and graded, diffusion-based surface enhancements. Titanium nitride and thermochemical diffusion boride interlayers were both examined for their effectiveness at allowing for the growth of continuous and adherent diamond films. Titanium nitride interlayers were deposited by cathodic arc vacuum deposition on 440C bearings. Lower temperature diamond processing resulted in improved surface coverage after cooling, but ultimately, both continuity and adhesion of the nanostructured diamond films were unacceptable. The ability to grow quality diamond films on TiN interlayers is in agreement with previous work on iron and low alloy steel substrates, and the similarly seen inadequate adhesion strength is partially a consequence of the lacking establishment of an interfacial carbide phase
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
C1-continuous Virtual Element Method for Poisson-Kirchhoff plate problem
Energy Technology Data Exchange (ETDEWEB)
Gyrya, Vitaliy [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Mourad, Hashem Mohamed [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2016-09-20
We present a family of C1-continuous high-order Virtual Element Methods for Poisson-Kirchho plate bending problem. The convergence of the methods is tested on a variety of meshes including rectangular, quadrilateral, and meshes obtained by edge removal (i.e. highly irregular meshes). The convergence rates are presented for all of these tests.
International Nuclear Information System (INIS)
Lindner, J.K.N.; Wenzel, S.; Stritzker, B.
2001-01-01
The formation of metal silicide layers contacting an ion beam synthesized buried 3C-SiC layer in silicon by means of high-dose titanium and molybdenum implantations is reported. Two different strategies to form such contact layers are explored. The titanium implantation aims to convert the Si top layer of an epitaxial Si/SiC/Si layer sequence into TiSi 2 , while Mo implantations were performed directly into the SiC layer after selectively etching off all capping layers. Textured and high-temperature stable C54-TiSi 2 layers with small additions of more metal-rich silicides are obtained in the case of the Ti implantations. Mo implantations result in the formation of the high-temperature phase β-MoSi 2 , which also grows textured on the substrate. The formation of cavities in the silicon substrate at the lower SiC/Si interface due to the Si consumption by the growing silicide phase is observed in both cases. It probably constitutes a problem, occurring whenever thin SiC films on silicon have to be contacted by silicide forming metals independent of the deposition technique used. It is shown that this problem can be solved with ion beam synthesized contact layers by proper adjustment of the metal ion dose
International Nuclear Information System (INIS)
Kim, E. H.; Lee, J. S.; Kim, J. H.; Kim, J. I.
2001-01-01
The fatigue life of stainless steel bearings is one of the most critical factors to determine the performance of the driving system. Because the bearings which are installed on the driving mechanism in the nuclear reactor are operated at high temperature and high pressure and especially lubricated with water with low viscosity, the friction and wear characteristics of the bearing material should be investigated thoroughly. In many control element drive mechanisms in the nuclear reactor the support bearings are made of the stainless steel and the sliding bearing ceramic material mainly. This study is focused on the characteristics of support bearing which may be used in the SMART. The ball bearings are made of standardized 440C stainless steel, and it supports thrust load including the weight of the driving system and external force. The friction and wear characteristics of this material operating under severe lubrication condition are not well known yet, however it will be changed with respect to temperature and boundary pressure. In this paper the friction characteristics are investigated experimentally using the reciprocating tribometer which can simulate the SMART operating conditions. Highly purified water is used as lubricant, and the water is warmed up and pressurized. Friction forces on the reciprocating specimens are measured insitu strain gages
Chemical Bonding States of TiC Films before and after Hydrogen Ion Irradiation
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
TiC films deposited by rf magnetron sputtering followed by Ar+ ion bombardment were irradiated with a hydrogen ion beam. X-ray photoelectron spectroscopy (XPS) was used for characterization of the chemical bonding states of C and Ti elements of the TiC films before and after hydrogen ion irradiation, in order to understand the effect of hydrogen ion irradiation on the films and to study the mechanism of hydrogen resistance of TiC films. Conclusions can be drawn that ion bombardment at moderate energy can cause preferential physical sputtering of carbon atoms from the surface of low atomic number (Z) material. This means that ion beam bombardment leads to the formation of a non-stoichiometric composition of TiC on the surface.TiC films prepared by ion beam mixing have the more excellent characteristic of hydrogen resistance. One important cause, in addition to TiC itself, is that there are many vacant sites in TiC created by ion beam mixing.These defects can easily trap hydrogen and effectively enhance the effect of hydrogen resistance.
International Nuclear Information System (INIS)
Rentenier, A; Bordenave-Montesquieu, A; Moretto-Capelle, P; Bordenave-Montesquieu, D
2004-01-01
A quantitative description of the asymmetric fission (AF) of C 60 r+ fullerene ions (r = 2-4), using a multistop coincidence technique between both fragment ions, is presented. Charged light fragment (LF) and heavy fragment (HF) size distributions are discussed together with the corresponding averaged sizes. Complete AF distributions are reported for the first time for C 60 2+ ions. Simple dependences of the more probable channels and averaged fragment sizes on the partner size are found and discussed. The LF ones are not very sensitive to the parent fullerene ion charge r and vary linearly with the HF size at least for the largest ones. On the other hand the HF ones present an oscillating dependence against the LF size, the odd-numbered LFs being correlated to a smaller HF size, and depend on r. In the comparison of branching ratios between AF and the competing pure neutral evaporation channel, some emphasis is given to the behaviour of the unimolecular processes with r which are compared with the evolution of the activation energies and fission barriers. From a close examination of the individual HF distributions the production mechanisms of odd-n fragments are discussed, and the most probable dissociation channels of even-numbered C n + excited carbon clusters identified. Finally, an analysis of the neutral channels is also presented for the first time, the total neutral mass N (in carbon units) being deduced from the mass conservation law. Surprising similarities between the charged LF- and N-distributions are found. AF processes are also identified where light neutrals and ions play a symmetrical role. These findings lead us to suggest that a concerted emission of ions and heavy neutrals is probably a fission mechanism to be considered to understand the AF process of the C 60 molecule in addition to the often assumed multistep fragmentation cascade scheme
42 CFR 440.260 - Methods and standards to assure quality of services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Methods and standards to assure quality of services. 440.260 Section 440.260 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH... and Limits Applicable to All Services § 440.260 Methods and standards to assure quality of services...
Amorphization and the effect of implanted ions in SiC
International Nuclear Information System (INIS)
Snead, L.L.; Zinkle, S.J.
1994-01-01
The effects of implanted ion chemistry and displacement damage on the amorphization threshold dose of SiC were studied using cross-section transmission electron microscopy. Room temperature as well as 200 and 400 C irradiations were carried out with 3.6 MeV Fe, 1.8 MeV Cl, 1 MeV He or 0.56 MeV Si ions. The room temperature amorphization threshold dose in irradiated regions well separated from the implanted ions was found to range from 0.3 to 0.5 dpa for the four different ion species. The threshold dose for amorphization in the He, Si and Fe ion-implanted regions was also ∼0.3 to 0.5 dpa. On the other hand, the amorphization threshold in the Cl-implanted region was only about 0.1 dpa. The volume change associated with amorphization was ∼17%. No evidence for amorphization was obtained in specimens irradiated at 200 or 400 C. An understanding of the microstructural evolution of SiC under irradiation is critical to the application of these materials in fusion energy systems
Fragmentations and rearrangements of metastable [C2H5OS]+ ions
de Vries, Marcel; Oudman, D; Weringa, WD
1992-01-01
Several [C2H5OS]+ ions with different structures were generated from the appropriate precursors and their metastable ion spectra were determined. Deuterium labelled analogues of some of the [C2H5OS]+ ions were used to elucidate the nature of the observed fragmentations and their mechanisms.
Photodetachment of negative C60- ions
International Nuclear Information System (INIS)
Amusia, M.Ya.; Baltenkov, A.S.; Krakov, B.G.
1998-01-01
A model that describes the electron structure of negative fullerene C 60 - ions is proposed. The model contains only two experimentally observed parameters, namely the fullerene radius and the affinity energy of the electron to neutral C 60 . In the frame of this model, cross sections are calculated of elastic scattering of slow electrons on neutral fullerene, of C 60 - photodetachment near the threshold of this process and of radiative recombination of slow electrons with neutral fullerenes. (orig.)
Electron cyclotron resonance (E.C.R.) multiply charged ion sources
International Nuclear Information System (INIS)
Geller, R.
1978-01-01
High charge state ions can be produced by electron bombardment inside targets when the target electron density n (cm -3 ) multiplied by the ion transit time through the target tau (sec) is: n tau > 5.10 9 cm -3 sec. The relative velocity between electrons and ions determines the balance between stripping and capture i.e. the final ion charge state. (In a stripper foil fast ions interact with slow electrons involving typically n approximately 10 24 cm -3 , tau approximately 10 -14 sec). In the E.C.R. source a cold ion plasma created in a first stage diffuses slowly through a second stage containing a hot E.C.R. plasma with n > 3.10 11 cm -3 and tau > 10 -2 sec. Continuous beams of several μA of C 6+ N 7+ Ne 9+ A 11+ are extracted from the second stage with normalized emittances of approximately 0.5 π mm mrad. The absence of cathodes and plasma arcs makes the source very robust, reliable and well-fitted for cyclotron injection. A super conducting source is under development
Polymeric thermal analysis of C + H and C + H + Ar ion implanted UHMWPE samples
International Nuclear Information System (INIS)
Kaya, N.; Oztarhan, Ahmet M.; Urkac, E.S.; Ila, D.; Budak, S.; Oks, E.; Nikolaev, A.; Ezdesir, A.; Tihminlioglu, F.; Tek, Z.; Cetiner, S.; Muntele, C.
2007-01-01
Chemical surface characterization of C + H hybrid ion implanted UHMWPE samples were carried out using DSC (differential scanning calorimeter) and TGA (thermal gravimetric analysis) techniques. Samples were implanted with a fluence of 10 17 ion/cm 2 and an extraction voltage of 30 kV. The study of TGA and DSC curves showed that: (1) Polymeric decomposition temperature increased (2) T m , ΔC p and ΔH m values changed while ΔC p and ΔH m increased. T g value could not be measured, because of some experimental limitations. However, the increase in ΔH m values showed that T g values increased (3) the branch density which indicated the increase in number of cross-link (M c ) decreased in ion implanted samples and (4) increase in ΔH m values indicated increase in crystallinity of implanted surface of UHMWPE samples
Ion Binding Energies Determining Functional Transport of ClC Proteins
Yu, Tao; Guo, Xu; Zou, Xian-Wu; Sang, Jian-Ping
2014-06-01
The ClC-type proteins, a large family of chloride transport proteins ubiquitously expressed in biological organisms, have been extensively studied for decades. Biological function of ClC proteins can be reflected by analyzing the binding situation of Cl- ions. We investigate ion binding properties of ClC-ec1 protein with the atomic molecular dynamics simulation approach. The calculated electrostatic binding energy results indicate that Cl- at the central binding site Scen has more binding stability than the internal binding site Sint. Quantitative comparison between the latest experimental heat release data isothermal titration calorimetry (ITC) and our calculated results demonstrates that chloride ions prefer to bind at Scen than Sint in the wild-type ClC-ec1 structure and prefer to bind at Sext and Scen than Sint in mutant E148A/E148Q structures. Even though the chloride ions make less contribution to heat release when binding to Sint and are relatively unstable in the Cl- pathway, they are still part contributors for the Cl- functional transport. This work provides a guide rule to estimate the importance of Cl- at the binding sites and how chloride ions have influences on the function of ClC proteins.
Method for regeneration of electroless nickel plating solution
Eisenmann, E.T.
1997-03-11
An electroless nickel(EN)/hypophosphite plating bath is provided employing acetic acid/acetate as a buffer and which is, as a result, capable of perpetual regeneration while avoiding the production of hazardous waste. A regeneration process is provided to process the spent EN plating bath solution. A concentrated starter and replenishment solution is provided for ease of operation of the plating bath. The regeneration process employs a chelating ion exchange system to remove nickel cations from spent EN plating solution. Phosphites are then removed from the solution by precipitation. The nickel cations are removed from the ion exchange system by elution with hypophosphorus acid and the nickel concentration of the eluate adjusted by addition of nickel salt. The treated solution and adjusted eluate are combined, stabilizer added, and the volume of resulting solution reduced by evaporation to form the bath starter and replenishing solution. 1 fig.
Method for regeneration of electroless nickel plating solution
Eisenmann, Erhard T.
1997-01-01
An electroless nickel(EN)/hypophosphite plating bath is provided employing acetic acid/acetate as a buffer and which is, as a result, capable of perpetual regeneration while avoiding the production of hazardous waste. A regeneration process is provided to process the spent EN plating bath solution. A concentrated starter and replenishment solution is provided for ease of operation of the plating bath. The regeneration process employs a chelating ion exchange system to remove nickel cations from spent EN plating solution. Phosphites are then removed from the solution by precipitation. The nickel cations are removed from the ion exchange system by elution with hypophosphorous acid and the nickel concentration of the eluate adjusted by addition of nickel salt. The treated solution and adjusted eluate are combined, stabilizer added, and the volume of resulting solution reduced by evaporation to form the bath starter and replenishing solution.
Operation of low-energy ion implanters for Si, N, C ion implantation into silicon and glassy carbon
International Nuclear Information System (INIS)
Carder, D.A.; Markwitz, A.
2009-01-01
This report details the operation of the low-energy ion implanters at GNS Science for C, N and Si implantations. Two implanters are presented, from a description of the components through to instructions for operation. Historically the implanters have been identified with the labels 'industrial' and 'experimental'. However, the machines only differ significantly in the species of ions available for implantation and sample temperature during implantation. Both machines have been custom designed for research purposes, with a wide range of ion species available for ion implantation and the ability to implant two ions into the same sample at the same time from two different ion sources. A fast sample transfer capability and homogenous scanning profiles are featured in both cases. Samples up to 13 mm 2 can be implanted, with the ability to implant at temperatures down to liquid nitrogen temperatures. The implanters have been used to implant 28 Si + , 14 N + and 12 C + into silicon and glassy carbon substrates. Rutherford backscattering spectroscopy has been used to analyse the implanted material. From the data a Si 30 C 61 N 9 layer was measured extending from the surface to a depth of about 77 ± 2 nm for (100) silicon implanted with 12 C + and 14 N + at multiple energies. Silicon and nitrogen ion implantation into glassy carbon produced a Si (40.5 %), C (38 %), N (19.5 %) and O (2%) layer centred around a depth of 50 ± 2 nm from the surface. (author). 8 refs., 20 figs
International Nuclear Information System (INIS)
Khamsuwan, J.; Intarasiri, S.; Kirkby, K.; Chu, P.K.; Singkarat, S.; Yu, L.D.
2012-01-01
This work explored a novel way to synthesize silicon carbide (SiC) nanocrystals for photoluminescence. Carbon ions at 90 keV were implanted in single crystalline silicon wafers at elevated temperature, followed by irradiation using xenon ion beams at an energy of 4 MeV with two low fluences of 5 × 10 13 and 1 × 10 14 ions/cm 2 at elevated temperatures for annealing. X-ray diffraction, Raman scattering, infrared spectroscopy and transmission electron microscopy were used to characterize the formation of nanocrystalline SiC. Photoluminescence was measured from the samples. The results demonstrated that MeV-heavy-ion-beam annealing could indeed induce crystallization of SiC nanocrystals and enhance emission of photoluminescence with violet bands dominance due to the quantum confinement effect.
Graphene synthesis on SiC: Reduced graphitization temperature by C-cluster and Ar-ion implantation
International Nuclear Information System (INIS)
Zhang, R.; Li, H.; Zhang, Z.D.; Wang, Z.S.; Zhou, S.Y.; Wang, Z.; Li, T.C.; Liu, J.R.; Fu, D.J.
2015-01-01
Thermal decomposition of SiC is a promising method for high quality production of wafer-scale graphene layers, when the high decomposition temperature of SiC is substantially reduced. The high decomposition temperature of SiC around 1400 °C is a technical obstacle. In this work, we report on graphene synthesis on 6H–SiC with reduced graphitization temperature via ion implantation. When energetic Ar, C 1 and C 6 -cluster ions implanted into 6H–SiC substrates, some of the Si–C bonds have been broken due to the electronic and nuclear collisions. Owing to the radiation damage induced bond breaking and the implanted C atoms as an additional C source the graphitization temperature was reduced by up to 200 °C
International Nuclear Information System (INIS)
Martin, M.
1997-01-01
The refurbishment of reactor protection systems of nuclear power plants is based on two sets of requirements: engineering aspects such as performance, qualification and licensing, as well as interfaces to other systems; and cost-benefit relationships, ease of service and maintenance as well as installation during scheduled outages. A number of WWER-440 and WWER-1000 nuclear plants have announced their intention to refurbish their protection systems. Since 1994, these plants have been placing orders with Siemens for new protection systems, including the neutron flux monitoring system utilizing the advanced system TELEPERM XS. This exclusively digital IandC system provides an excellent foundation for the remaining plant service life
Structure, properties and applications of TiN coatings produced by sputter ion plating
International Nuclear Information System (INIS)
Rickerby, D.S.
1988-01-01
The potential beneficial effects that wear-resistant coatings have on engineering surfaces depends upon their ability to remain adherent with the treated component. This paper concentrates on the process of sputter ion plating, a simple dc glow discharge sputtering system operating in soft vacuum, and relates the properties of titanium nitride coatings to the degree of ion polishing (substrate bias) which is utilised during deposition. Substrate bias was identified as the most important system parameter since it allowed for some stress relaxation within the coating via its influence on porosity levels in the coating microstructure. The influence that this has on coating adhesion is discussed. The internal stress is a combination of intrinsic growth stresses and thermal mismatch stresses with the latter tending to dominate as substrate bias is increased. In addition to substrate bias, the role that titanium interlayers and substrate cleaning play in improving the adhesion of titanium nitride coatings is discussed, and the potential benefits highlighted. In the last part of the paper some applications of titanium nitride coating are described -it will be shown that increase in component life is by no means the only criterion which should be considered when judging the success, or otherwise, of a coated component. (author)
International Nuclear Information System (INIS)
Mobarak, H.M.; Masjuki, H.H.; Mohamad, E. Niza; Kalam, M.A.; Rashedul, H.K.; Rashed, M.M.; Habibullah, M.
2014-01-01
Highlights: • We tested a-C:H and ta-C DLC coatings as a function of temperature. • Jatropha oil contains large amounts of polar components that enhanced the lubricity of coatings. • CoF decreases with increasing temperature for both contacts. • Wear rate increases with increasing temperature in a-C:H and decreases in ta-C DLC. • At high temperature, ta-C coatings confer more protection than a-C:H coatings. - Abstract: The application of diamond-like carbon (DLC) coatings on automotive components is emerging as a favorable strategy to address the recent challenges in the industry. DLC coatings can effectively lower the coefficient of friction (CoF) and wear rate of engine components, thereby improving their fuel efficiency and durability. The lubrication of ferrous materials can be enhanced by a large amount of unsaturated and polar components of oils. Therefore, the interaction between nonferrous coatings (e.g., DLC) and vegetable oil should be investigated. A ball-on-plate tribotester was used to run the experiments. Stainless steel plates coated with amorphous hydrogenated (a-C:H) DLC and hydrogen-free tetrahedral (ta-C) DLC that slide against 440C stainless steel ball were used to create a ball-on-plate tribotester. The wear track was investigated through scanning electron microscopy. Energy dispersive and X-ray photoelectron spectroscopies were used to analyze the tribofilm inside the wear track. Raman analysis was performed to investigate the structural changes in the coatings. At high temperatures, the CoF in both coatings decreased. The wear rate, however, increased in the a-C:H but decreased in the ta-C DLC-coated plates. The CoF and the wear rate (coated layer and counter surface) were primarily influenced by the graphitization of the coating. Tribochemical films, such as polyphosphate glass, were formed in ta-C and acted as protective layers. Therefore, the wear rate of the ta-C DLC was lower than that of the-C:H DLC
Energy Technology Data Exchange (ETDEWEB)
Mobarak, H.M., E-mail: mobarak.ho31@yahoo.com; Masjuki, H.H.; Mohamad, E. Niza, E-mail: edzrol@um.edu.my; Kalam, M.A.; Rashedul, H.K.; Rashed, M.M.; Habibullah, M.
2014-10-30
Highlights: • We tested a-C:H and ta-C DLC coatings as a function of temperature. • Jatropha oil contains large amounts of polar components that enhanced the lubricity of coatings. • CoF decreases with increasing temperature for both contacts. • Wear rate increases with increasing temperature in a-C:H and decreases in ta-C DLC. • At high temperature, ta-C coatings confer more protection than a-C:H coatings. - Abstract: The application of diamond-like carbon (DLC) coatings on automotive components is emerging as a favorable strategy to address the recent challenges in the industry. DLC coatings can effectively lower the coefficient of friction (CoF) and wear rate of engine components, thereby improving their fuel efficiency and durability. The lubrication of ferrous materials can be enhanced by a large amount of unsaturated and polar components of oils. Therefore, the interaction between nonferrous coatings (e.g., DLC) and vegetable oil should be investigated. A ball-on-plate tribotester was used to run the experiments. Stainless steel plates coated with amorphous hydrogenated (a-C:H) DLC and hydrogen-free tetrahedral (ta-C) DLC that slide against 440C stainless steel ball were used to create a ball-on-plate tribotester. The wear track was investigated through scanning electron microscopy. Energy dispersive and X-ray photoelectron spectroscopies were used to analyze the tribofilm inside the wear track. Raman analysis was performed to investigate the structural changes in the coatings. At high temperatures, the CoF in both coatings decreased. The wear rate, however, increased in the a-C:H but decreased in the ta-C DLC-coated plates. The CoF and the wear rate (coated layer and counter surface) were primarily influenced by the graphitization of the coating. Tribochemical films, such as polyphosphate glass, were formed in ta-C and acted as protective layers. Therefore, the wear rate of the ta-C DLC was lower than that of the-C:H DLC.
Energy Technology Data Exchange (ETDEWEB)
Pourmortazavi, Seied Mahdi [Malek Ashtar University of Technology, Faculty of Material and Manufacturing Technologies, P. O. Box 16765-3454, Tehran (Iran, Islamic Republic of); Rahimi-Nasrabadi, Mehdi [Imam Hossein University, Nano Science Center, Tehran (Iran, Islamic Republic of); Fazli, Yousef [Islamic Azad University, Department of Chemistry, Faculty of Science, Arak Branch, Arak (Iran, Islamic Republic of); Mohammad-Zadeh, Mohammad [Sabzevar University of Medical Sciences, Department of Physiology and Pharmacology, School of Medicine, Sabzevar (Iran, Islamic Republic of)
2015-06-15
Europium (III) molybdate nano-plates were synthesized in this work via chemical precipitation route involving adding of europium (III) ion solution to the aqueous solution of molybdate reagent. Effects of some reaction variables such as concentrations of europium and molybdate ions, flow rate of europium reagent, and reactor temperature on the diameter of the synthesized europium (III) molybdate nano-plates were experimentally investigated by orthogonal array design. The results showed that the size of europium (III) molybdate nano-plates can be optimized by adjusting the concentrations of europium (III) and molybdate ions, as well as the reactional temperature. Europium (III) molybdate nano-plates prepared under the optimum conditions were characterized by X-ray powder diffraction, scanning electron microscopy, and Fourier transform infrared spectroscopy. (orig.)
Development of C6+ laser ion source and RFQ linac for carbon ion radiotherapy
Sako, T.; Yamaguchi, A.; Sato, K.; Goto, A.; Iwai, T.; Nayuki, T.; Nemoto, K.; Kayama, T.; Takeuchi, T.
2016-02-01
A prototype C6+ injector using a laser ion source has been developed for a compact synchrotron dedicated to carbon ion radiotherapy. The injector consists of a laser ion source and a 4-vane radio-frequency quadrupole (RFQ) linac. Ion beams are extracted from plasma and directly injected into the RFQ. A solenoid guides the low-energy beams into the RFQ. The RFQ is designed to accelerate high-intensity pulsed beams. A structure of monolithic vanes and cavities is adopted to reduce its power consumption. In beam acceleration tests, a solenoidal magnetic field set between the laser ion source and the RFQ helped increase both the peak currents before and after the RFQ by a factor of 4.
Development of C6+ laser ion source and RFQ linac for carbon ion radiotherapy
International Nuclear Information System (INIS)
Sako, T.; Yamaguchi, A.; Sato, K.; Goto, A.; Iwai, T.; Nayuki, T.; Nemoto, K.; Kayama, T.; Takeuchi, T.
2016-01-01
A prototype C 6+ injector using a laser ion source has been developed for a compact synchrotron dedicated to carbon ion radiotherapy. The injector consists of a laser ion source and a 4-vane radio-frequency quadrupole (RFQ) linac. Ion beams are extracted from plasma and directly injected into the RFQ. A solenoid guides the low-energy beams into the RFQ. The RFQ is designed to accelerate high-intensity pulsed beams. A structure of monolithic vanes and cavities is adopted to reduce its power consumption. In beam acceleration tests, a solenoidal magnetic field set between the laser ion source and the RFQ helped increase both the peak currents before and after the RFQ by a factor of 4
Means for obtaining a metal ion beam from a heavy-ion cyclotron source
Hudson, E.D.; Mallory, M.L.
1975-08-01
A description is given of a modification to a cyclotron ion source used in producing a high intensity metal ion beam. A small amount of an inert support gas maintains the usual plasma arc, except that it is necessary for the support gas to have a heavy mass, e.g., xenon or krypton as opposed to neon. A plate, fabricated from the metal (or anything that can be sputtered) to be ionized, is mounted on the back wall of the ion source arc chamber and is bombarded by returning energetic low-charged gas ions that fail to cross the initial accelerating gap between the ion source and the accelerating electrode. Some of the atoms that are dislodged from the plate by the returning gas ions become ionized and are extracted as a useful beam of heavy ions. (auth)
10 CFR 1042.440 - Health and insurance benefits and services.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Health and insurance benefits and services. 1042.440... in Education Programs or Activities Prohibited § 1042.440 Health and insurance benefits and services. Subject to § 1042.235(d), in providing a medical, hospital, accident, or life insurance benefit, service...
Retention and damage in 3C-β SiC irradiated with He and H ions
Energy Technology Data Exchange (ETDEWEB)
Deslandes, Alec, E-mail: alec.deslandes@csiro.au [Australian Nuclear Science and Technology Organisation, Locked Bag 2001, Kirrawee DC, New South Wales 2232 (Australia); Guenette, Mathew C. [Australian Nuclear Science and Technology Organisation, Locked Bag 2001, Kirrawee DC, New South Wales 2232 (Australia); Thomsen, Lars [Australian Synchrotron, 800 Blackburn Road, Clayton, Victoria 3168 (Australia); Ionescu, Mihail; Karatchevtseva, Inna; Lumpkin, Gregory R. [Australian Nuclear Science and Technology Organisation, Locked Bag 2001, Kirrawee DC, New South Wales 2232 (Australia)
2016-02-15
3C-β SiC was implanted with He and H ions using plasma immersion ion implantation (PIII). Regions of damage were created at various depths by applying a sample stage bias of 5 kV, 10 kV, 20 kV or 30 kV. Raman spectroscopy results indicate that He irradiation leads to more damage compared to H irradiation, as observed via increased disordered C and Si signals, as well as broadening of the SiC peaks. X-ray photoelectron spectroscopy (XPS) and near edge X-ray absorption fine structure spectroscopy (NEXAFS) results indicate significant change to the SiC structure and that surface oxidation has occurred following irradiation, with the degree of change varying dependent on impinging He fluence. The distributions of implanted species were measured using elastic recoil detection analysis. Despite the varying degree and depth of damage created in the SiC by the He ion irradiations, the retained H distribution was observed to not be affected by preceding He implantation.
Evaluation of the ion-density measurements by the Indian satellite SROSS-C2
Subrahmanyam, P.; Jain, A. R.; Maini, H. K.; Bahl, M.; Das, Rupesh M.; Garg, S. C.; Niranjan, K.
2010-12-01
The ion and electron F region plasma measurements made by the ion and electron Retarding Potential Analyzers (RPAs) onboard the Indian satellite SROSS-C2, have yielded excellent data set over the Indian region for more than half a solar cycle, after the SROSS-C2 launch in May 1994. The absolute ion density, ion temperature, and ion composition parameters are derived from these in situ measurements and used by many workers. In this paper the absolute values of ion density derived from the ion RPA measurements are compared and evaluated with the measurements made by ground-based ionosondes located in the Indian region and close to the SROSS-C2 orbital path. It is shown that a slight adjustment in efficiency factor of the ion RPA sensor brings the in situ measurements much closer to those obtained from the ground-based ionosonde measurements taking into account the model calculations. It may be mentioned that this is a correction to the ion density measurement by SROSS-C2 by a fixed proportion (14-11.4%). The effect of change in efficiency factor on the ion current, which is used to deduce the ion number density, is demonstrated and discussed.
Interactive nuclear plant analyzer for VVER-440 reactor
International Nuclear Information System (INIS)
Shier, W.; Horak, W.; Kennett, R.
1992-05-01
This document discusses an interactive nuclear plant analyzer (NPA) which has been developed for a VVER-440, Model 213 reactor for use in the training of plant personnel, the development and verification of plant operating procedures, and in the analysis of various anticipated operational occurrences and accident scenarios. This NPA is operational on an IBM RISC-6000 workstation and utilizes the RELAP5/MOD2 computer code for the calculation of the VVER-440 reactor response to the interactive commands initiated by the NPA operator
10 CFR 5.440 - Health and insurance benefits and services.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Health and insurance benefits and services. 5.440 Section... Education Programs or Activities Prohibited § 5.440 Health and insurance benefits and services. Subject to § 5.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or...
49 CFR 25.440 - Health and insurance benefits and services.
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Health and insurance benefits and services. 25.440... Basis of Sex in Education Programs or Activities Prohibited § 25.440 Health and insurance benefits and services. Subject to § 25.235(d), in providing a medical, hospital, accident, or life insurance benefit...
29 CFR 36.440 - Health and insurance benefits and services.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Health and insurance benefits and services. 36.440 Section... Education Programs or Activities Prohibited § 36.440 Health and insurance benefits and services. Subject to § 36.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or...
42 CFR 440.255 - Limited services available to certain aliens.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Limited services available to certain aliens. 440... Limits Applicable to All Services § 440.255 Limited services available to certain aliens. (a) FFP for services. FFP is available for services provided to aliens described in this section which are necessary to...
Transmutation potential of reactor WWER-440
International Nuclear Information System (INIS)
Darilek, P.; Sebian, V.; Necas, V.
2001-01-01
Theoretical evaluation of WWER-440 transmutation potential by HELIOS - code is presented. Transmutation method proposal comprising special transmutation pins, combined FA and simple reprocessing is described. Transmutation efficiency of the method is characterized (Authors)
Detection of gold cluster ions by ion-to-ion conversion using a CsI-converter
International Nuclear Information System (INIS)
Nguyen, V.-T.; Novilkov, A.C.; Obnorskii, V.V.
1997-01-01
Gold cluster ions in the m/z range of 10 4 -2 x 10 6 u were produced by bombarding a thin film of gold with 252 Cf-fission fragments. The gold covering a C-Al substrate formed islets having a mean diameter of 44 A. Their size- and mass-distribution was determined by means of electron microscopy. The main task was to measure the m/z distribution of the cluster ions ejected from the sample surface. For this purpose we built a time-of-flight (TOF) mass spectrometer, which could be used as a linear TOF instrument or, alternatively, as a tandem-TOF instrument being equipped with an ion-to-ion converter. Combining the results obtained in both modes, it turned out that the linear TOF instrument equipped with micro-channel plates had a mean detection efficiency for 20 keV cluster ions of about 40%. In the tandem mode, the cluster ions hit a CsI converter with energies of 40z keV (z = charge state), from where secondary ions - mainly Cs + and (CsI) n Cs + cluster ions - were ejected. These ions were used to measure the TOF spectrum of the gold cluster ions. The detection efficiency of the cluster ions was found to vary in the available mass range from 99.7% to 96.5%. The complete mass distribution between 4 x 10 4 and 4 x 10 6 u was determined and compared with the corresponding mass distribution of the gold islets covering the substrate. (orig.)
17 CFR 201.440 - Appeal of determinations by the Public Company Accounting Oversight Board.
2010-04-01
... and Commission Review § 201.440 Appeal of determinations by the Public Company Accounting Oversight... for registration of a public accounting firm, may file an application for review. (b) Procedure. An... the Public Company Accounting Oversight Board. 201.440 Section 201.440 Commodity and Securities...
42 CFR 440.155 - Nursing facility services, other than in institutions for mental diseases.
2010-10-01
... institutions for mental diseases. 440.155 Section 440.155 Public Health CENTERS FOR MEDICARE & MEDICAID... PROVISIONS Definitions § 440.155 Nursing facility services, other than in institutions for mental diseases. (a) “Nursing facility services, other than in an institution for mental diseases” means services...
The further development of WWER-440 fuel design performance
International Nuclear Information System (INIS)
Lushin, V.; Vasilchenko, I.; Ananjev, J.; Abashina, G.
2011-01-01
The most distinguished stages in VVER-440 fuel development of the latest ten years are: designing of second generation FA complex; and designing of sheathless working fuel assembly of the third generation (RK-3) which are presented in this report. Designing of fuel assemblies of the second generation and RK-3 is characterized by the tendency to power increase of VVER-440 operating units with V-213-type reactor, that, in turn, has given a stimulus to further design enhancement of fuel assemblies specified. The further development of the second generation fuel assembly design and the change-over to the third generation working assemblies will allow for fuel utilization to be considerably increased under the conditions of application the more long-term fuel cycles for VVER-440 reactors and operation of the Units at the increased power
Entrance C - New Automatic Number Plate Recognition System
2013-01-01
Entrance C (Satigny) is now equipped with a latest-generation Automatic Number Plate Recognition (ANPR) system and a fast-action road gate. During the month of August, Entrance C will be continuously open from 7.00 a.m. to 7.00 p.m. (working days only). The security guards will open the gate as usual from 7.00 a.m. to 9.00 a.m. and from 5.00 p.m. to 7.00 p.m. For the rest of the working day (9.00 a.m. to 5.00 p.m.) the gate will operate automatically. Please observe the following points: Stop at the STOP sign on the ground Position yourself next to the card reader for optimal recognition Motorcyclists must use their CERN card Cyclists may not activate the gate and should use the bicycle turnstile Keep a safe distance from the vehicle in front of you If access is denied, please check that your vehicle regist...
Ion irradiation and thermal cycling tests of TiC coatings
International Nuclear Information System (INIS)
Yamanaka, S.; Ohara, H.; Son, P.; Miyake, M.
1984-01-01
Ion irradiation of TiC coatings prepared by diffusion annealing was performed with 20-40 keV He + ions for different doses at room temperature. The polished TiCsub(0.99) coatings irradiated with 40 keV He + ions showed the surface damage and erosion due to blistering and exfoliation above a dose of 1.8x10 17 ions/cm 2 , whereas no change in the surface morphology could be detected for the as-prepared coatings up to a dose of 1.4x10 18 ions/cm 2 . The results suggested that surface erosion due to blistering can be effectively reduced on the rough surface of the as-prepared TiC coating. The average blister diameter in the polished TiCsub(0.99) coating increased with increasing projectile energy. For the 40 keV He + ion irradiation of the polished TiCsub(0.5) coatings, general features in blisters were similar to those observed for the TiCsub(0.99) coatings, but the critical dose for blistering shifted to a higher value in comparison with the polished TiCsub(0.99) coating. Thermal cycling between 500 and 1200 0 C caused serious surface damage for the TiCsub(0.99) coating irradiated with 40 keV He + ions below the critical dose for blistering, while the coating with surface damage due to blistering showed no significant change in the surface topography after thermal cycling. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Roshni, V.; Ottoor, Divya, E-mail: divya@chem.unipune.ac.in
2015-05-15
Carbon nanoparticles (CNPs) have been evolved as a promising candidate for the metal sensing applications due to their synthesis from naturally occurring and easily available non-toxic molecular precursors by green chemistry. A simple and one step procedure is reported here for the synthesis of CNPs from coconut milk by thermal pyrolysis at a temperature of 120–150 °C for 2–5 min without using any carbonizing or passivating agent. On pyrolysis the coconut oil is separated from the carbon rich residue and the residue when dissolved in water showed blue fluorescence under UV light. The CNPs produced are found to show an emission maximum at 440 nm when excited at 360 nm. Synthesis by green approach makes CNPs a promising substitute for the metal sensing applications. Series of metal ions which have a hazardous impact on the ecological system have been taken for the analysis and it is observed that the fluorescence of CNPs gets remarkably quenched by mercuric ions. Fluorescence quenching was studied using standard Stern–Volmer quenching model. Limit of detection was found to be 16.5 nM Hg{sup 2+} concentration. - Highlights: • Green and economical synthesis of carbon nanoparticles (CNPs) from naturally abundant material. • Coconut milk is used as molecular precursor, which on thermal pyrolysis at 120 °C yielded CNPs. • Highly fluorescent CNPs show an emission maxima of 440 nm when excited at 360 nm. • Application of CNPs for metal ion sensing using fluorescence quenching phenomena. • Hg{sup 2+} is most effectively sensed with a detection limit of 16.5 nM.
International Nuclear Information System (INIS)
Roshni, V.; Ottoor, Divya
2015-01-01
Carbon nanoparticles (CNPs) have been evolved as a promising candidate for the metal sensing applications due to their synthesis from naturally occurring and easily available non-toxic molecular precursors by green chemistry. A simple and one step procedure is reported here for the synthesis of CNPs from coconut milk by thermal pyrolysis at a temperature of 120–150 °C for 2–5 min without using any carbonizing or passivating agent. On pyrolysis the coconut oil is separated from the carbon rich residue and the residue when dissolved in water showed blue fluorescence under UV light. The CNPs produced are found to show an emission maximum at 440 nm when excited at 360 nm. Synthesis by green approach makes CNPs a promising substitute for the metal sensing applications. Series of metal ions which have a hazardous impact on the ecological system have been taken for the analysis and it is observed that the fluorescence of CNPs gets remarkably quenched by mercuric ions. Fluorescence quenching was studied using standard Stern–Volmer quenching model. Limit of detection was found to be 16.5 nM Hg 2+ concentration. - Highlights: • Green and economical synthesis of carbon nanoparticles (CNPs) from naturally abundant material. • Coconut milk is used as molecular precursor, which on thermal pyrolysis at 120 °C yielded CNPs. • Highly fluorescent CNPs show an emission maxima of 440 nm when excited at 360 nm. • Application of CNPs for metal ion sensing using fluorescence quenching phenomena. • Hg 2+ is most effectively sensed with a detection limit of 16.5 nM
Energy Technology Data Exchange (ETDEWEB)
Vlcak, Petr, E-mail: petr.vlcak@fs.cvut.cz
2016-03-01
Graphical abstract: - Highlights: • C/W/C/B multilayer PVD coating was treated by 45 keV nitrogen ion irradiation. • The effect of ion irradiation and elevated temperature on microstructure was analyzed. • Formation of new compounds and degradation of carbon fraction were observed. • The causes of the observed changes in surface properties were discussed. - Abstract: C/W/C/B multi-layer PVD coating with a layer period of 10 nm and 500 nm in thickness was irradiated with 45 keV N ions at fluence of 1 × 10{sup 17} cm{sup −2}. Ion irradiation was performed at room temperature or at an elevated temperature of 500 °C. The microstructure was investigated by X-ray diffraction, by X-ray photoelectron spectroscopy, and by Raman spectroscopy. The results showed that implanted N ions bond both with W atoms and with C atoms. N ion irradiation induced the formation of WC and WC{sub 1−x} phases. The energetic ions transformed the C bonds in defect sp{sup 2} and defect sp{sup 3} hybridizations, resulting in graphitization of the carbon fraction in the multilayer coating. Ion irradiation reduced the cohesive strength of the monolayers, reduced hardness of the C/W/C/B coating, increased its surface roughness and increased its friction coefficient. An elevated temperature during ion irradiation caused a better arrangement of the WC phase and further graphitization of the carbon fraction, in comparison with a coating treated by ion irradiation at room temperature. There is discussion of the causes of the observed changes in surface properties.
Development of C{sup 6+} laser ion source and RFQ linac for carbon ion radiotherapy
Energy Technology Data Exchange (ETDEWEB)
Sako, T., E-mail: takayuki1.sako@toshiba.co.jp; Yamaguchi, A.; Sato, K. [Toshiba Corporation, Yokohama 235-8522 (Japan); Goto, A.; Iwai, T.; Nayuki, T.; Nemoto, K.; Kayama, T. [Cancer Research Center, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan); Takeuchi, T. [Accelerator Engineering Corporation, Chiba 263-0043 (Japan)
2016-02-15
A prototype C{sup 6+} injector using a laser ion source has been developed for a compact synchrotron dedicated to carbon ion radiotherapy. The injector consists of a laser ion source and a 4-vane radio-frequency quadrupole (RFQ) linac. Ion beams are extracted from plasma and directly injected into the RFQ. A solenoid guides the low-energy beams into the RFQ. The RFQ is designed to accelerate high-intensity pulsed beams. A structure of monolithic vanes and cavities is adopted to reduce its power consumption. In beam acceleration tests, a solenoidal magnetic field set between the laser ion source and the RFQ helped increase both the peak currents before and after the RFQ by a factor of 4.
Experimental ion mobility measurements in Xe-C2H6
Perdigoto, J. M. C.; Cortez, A. F. V.; Veenhof, R.; Neves, P. N. B.; Santos, F. P.; Borges, F. I. G. M.; Conde, C. A. N.
2017-10-01
In this paper we present the results of the ion mobility measurements made in gaseous mixtures of xenon (Xe) with ethane (C2H6) for pressures ranging from 6 to 10 Torr (8-10.6 mbar) and for low reduced electric fields in the 10 Td to 25 Td range (2.4-6.1 kVṡcm-1ṡ bar-1), at room temperature. The time of arrival spectra revealed two peaks throughout the entire range studied which were attributed to ion species with 3-carbons (C3H5+, C3H6+ C3H8+ and C3H9+) and with 4-carbons (C4H7+, C4H9+ and C4H10+). Besides these, and for Xe concentrations above 70%, a bump starts to appear at the right side of the main peak for reduced electric fields higher than 20 Td, which was attributed to the resonant charge transfer of C2H6+ to C2H6 that affects the mobility of its ion products (C3H8+ and C3H9+). The time of arrival spectra for Xe concentrations of 20%, 50%, 70% and 90% are presented, together with the reduced mobilities as a function of the Xe concentration calculated from the peaks observed for the low reduced electric fields and pressures studied.
Damage profiles and ion distribution in Pt-irradiated SiC
Energy Technology Data Exchange (ETDEWEB)
Xue, H.Z. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, TN 37996 (United States); Zhang, Y., E-mail: Zhangy1@ornl.gov [Department of Materials Science and Engineering, University of Tennessee, Knoxville, TN 37996 (United States); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Zhu, Z. [Pacific Northwest National Laboratory, P.O. Box 999, Richland, WA 99352 (United States); Zhang, W.M. [Department of Radiation Therapy, Peking University First Hospital, Beijing 100034 (China); Bae, I.-T. [Small Scale Systems Integration and Packaging Center, State University of New York at Binghamton, P.O. Box 6000, Binghamton, NY 13902 (United States); Weber, W.J. [Department of Materials Science and Engineering, University of Tennessee, Knoxville, TN 37996 (United States); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States)
2012-09-01
Single crystalline 6H-SiC samples were irradiated at 150 K with 2 MeV Pt ions. The local volume swelling was determined by electron energy loss spectroscopy (EELS), and a nearly sigmoidal dependence on irradiation dose is observed. The disorder profiles and ion distribution were determined by Rutherford backscattering spectrometry (RBS), transmission electron microscopy, and secondary ion mass spectrometry. Since the volume swelling reaches 12% over the damage region at high ion fluence, the effect of lattice expansion is considered and corrected for in the analysis of RBS spectra to obtain depth profiles. Projectile and damage profiles are estimated by SRIM (Stopping and Range of Ions in Matter). When compared with the measured profiles, the SRIM code predictions of ion distribution and the damage profiles are underestimated due to significant overestimation of the electronic stopping power for the slow heavy Pt ions. By utilizing the reciprocity method, which is based on the invariance of the inelastic energy loss in ion-solid collisions against interchange of projectile and target atom, a much lower electronic stopping power is deduced. A simple approach, based on reducing the density of SiC target in SRIM simulation, is proposed to compensate the overestimated SRIM electronic stopping power values, which results in improved agreement between predicted and measured damage profiles and ion ranges.
Energy Technology Data Exchange (ETDEWEB)
Stevenson, Cynthia; Marcinek, M.; Hardwick, L.J.; Richardson, T.J.; Song, X.; Kostecki, R.
2008-02-01
In this paper we report results of a novel synthesis method of thin-film composite Sn/C anodes for lithium batteries. Thin layers of graphitic carbon decorated with uniformly distributed Sn nanoparticles were synthesized from a solid organic precursor Sn(IV) tert-butoxide by a one step microwave plasma chemical vapor deposition (MPCVD). The thin-film Sn/C electrodes were electrochemically tested in lithium half cells and produced a reversible capacity of 440 and 297 mAhg{sup -1} at C/25 and 5C discharge rates, respectively. A long term cycling of the Sn/C nanocomposite anodes showed 40% capacity loss after 500 cycles at 1C rate.
International Nuclear Information System (INIS)
Gan Xueping; Wu Yating; Liu Lei; Shen Bin; Hu Wenbin
2008-01-01
Electroless plating of Cu-Ni-P alloy on polyethylene terephthalate (PET) fabrics and effect of plating parameters on the properties of alloy-coated fabrics were investigated. The deposition rate increased with the increase of temperature, pH and nickel ion concentration. The addition of K 4 Fe(CN) 6 to the solution could reduce the deposition rate and make the deposits become more compact. The color of the deposits also had a corresponding improvement, changing from dark-brown to copper-bright with the addition of K 4 Fe(CN) 6 to the plating solution. The deposits have an intensified copper (1 1 1) plane orientation with the addition of K 4 Fe(CN) 6 to the plating bath. The surface electrical resistance of alloy-coated fabrics increased with increase of nickel ions concentration in the solution. The addition of K 4 Fe(CN) 6 to the solution reduced significantly the surface resistance of alloy-coated fabrics. The conductive fabrics with high shielding effectiveness could be prepared at the optimum condition with 0.0038 M nickel ions and 2 ppm K 4 Fe(CN) 6 . As the deposit weight on the fabric was 40 g/m 2 , the shielding effectiveness of alloy-coated fabrics was more than 85 dB at frequency ranging from 100 MHz to 20 GHz
Yi, Peiyun; Zhang, Weixin; Bi, Feifei; Peng, Linfa; Lai, Xinmin
2018-06-06
Proton-exchange membrane fuel cells are one kind of renewable and clean energy conversion device, whose metallic bipolar plates are one of the key components. However, high interfacial contact resistance and poor corrosion resistance are still great challenges for the commercialization of metallic bipolar plates. In this study, we demonstrated a novel strategy for depositing TiC x /amorphous carbon (a-C) nanolayered coatings by synergy of 60 and 300 V bias voltage to enhance corrosion resistance and interfacial conductivity. The synergistic effects of bias voltage on the composition, microstructure, surface roughness, electrochemical corrosion behaviors, and interfacial conductivity of TiC x /a-C coatings were explored. The results revealed that the columnar structures in the inner layer were suppressed and the surface became rougher with the 300 V a-C layer outside. The composition analysis indicated that the sp 2 content increased with an increase of 300 V sputtering time. Due to the synergy strategy of bias voltage, lower corrosion current densities were achieved both in potentiostatic polarization (1.6 V vs standard hydrogen electrode) and potentiodynamic polarization. With the increase of 300 V sputtering time, the interfacial conductivity was improved. The enhanced corrosion resistance and interfacial conductivity of the TiC x /a-C coatings would provide new opportunities for commercial bipolar plates.
New high voltage parallel plate analyzer
International Nuclear Information System (INIS)
Hamada, Y.; Kawasumi, Y.; Masai, K.; Iguchi, H.; Fujisawa, A.; Abe, Y.
1992-01-01
A new modification on the parallel plate analyzer for 500 keV heavy ions to eliminate the effect of the intense UV and visible radiations, is successfully conducted. Its principle and results are discussed. (author)
C60 ion sputtering of layered organic materials
International Nuclear Information System (INIS)
Shard, Alexander G.; Green, Felicia M.; Gilmore, Ian S.
2008-01-01
Two different organic materials, Irganox1010 and Irganox3114, were vacuum deposited as alternating layers. The layers of Irganox3114 were thin (∼2.5 nm) in comparison to the Irganox1010 (∼55 or ∼90 nm); we call these 'organic delta layers'. Both materials are shown to have identical sputtering yields and the alternating layers may be used to determine some of the important metrological parameters for cluster ion beam depth profiling of organic materials. The sputtering yield for C 60 ions is shown to diminish with ion dose. Comparison with atomic force microscopy data from films of pure Irganox1010, demonstrates that the depth resolution is limited by the development of topography. Secondary ion intensities are a well-behaved function of sputtering yield and may be employed to obtain useful analytical information. Organic delta layers are shown to be valuable reference materials for comparing the capabilities of different cluster ion sources and experimental arrangements for the depth profiling of organic materials.
Testing of multigap Resistive Plate Chambers for Electron Ion Collider Detector Development
Hamilton, Hannah; Phenix Collaboration
2015-10-01
Despite decades of research on the subject, some details of the spin structure of the nucleon continues to be unknown. To improve our knowledge of the nucleon spin structure, the construction of a new collider is needed. This is one of the primary goals of the proposed Electron Ion Collider (EIC). Planned EIC spectrometers will require good particle identification. This can be provided by time of flight (TOF) detectors with excellent timing resolutions of 10 ps. A potential TOF detector that could meet this requirement is a glass multigap resistive plate chamber (mRPC). These mRPCs can provide excellent timing resolution at a low cost. The current glass mRPC prototypes have a total of twenty 0.1 mm thick gas gaps. In order to test the feasibility of this design, a cosmic test stand was assembled. This stand used the coincidence of scintillators as a trigger, and contains fast electronics. The construction, the method of testing, and the test results of the mRPCs will be presented.
Production and release of {sup 14}C from a swimming pool reactor
Energy Technology Data Exchange (ETDEWEB)
Krishnamoorthy, T M [Bhabha Atomic Research Centre, Mumbai (India). Environmental Assessment Div.; Sadarangani, S H [Bhabha Atomic Research Centre, Mumbai (India). Radiation Safety Systems Div.; Doshi, G R [Bhabha Atomic Research Centre, Bombay (India). Health Physics Div.
1994-04-01
The annual production rate of {sup 14}C in the Apsara swimming pool reactor works out to be about 2.94 mCi. The concentration distribution of {sup 14}C in different compartments viz. pool water, reactor hall air and ion-exchange resin ranged from 200 to 440 pCi/l, 0.09 to 0.38 pCi/l, an average concentration of 8.16 pCi/g respectively. The mean residence time of {sup 14}C in pool water is evaluated to be about 7 days taking into account various sinks. The study revealed atmospheric exchange at the air-water interface as the dominant process responsible for the loss of {sup 14}C from the pool water. (author). 7 refs., 2 figs., 4 tabs.
Detached divertor plasmas in Alcator C-Mod: A study of the role of atomic physics
International Nuclear Information System (INIS)
Lipschultz, B.; Boswell, C.; Goetz, J.A.
1999-01-01
Detailed profiles of the volumetric recombination occurring in Alcator C-Mod plasmas are presented. During detachment the recombination sink is compared to the divertor plate sink as well as the divertor ion source. Depending on plasma conditions, volume recombination removes between 10 and 75% of the ions before they reach the plates. A second, equally important process that leads to a drop in plate ion current is inferred to be a reduction in divertor ion source, which is correlated with a drop in power flowing into the ionization region and the pressure loss of detachment. For high n e the divertor recombination can cross the separatrix near the x-point, cool the core and lead to a disruption. Experimental measurements show a difference in ion and neutral velocities for H-mode detached plasmas. The resulting ion-neutral collisions are found to be more efficacious than recombination in removing momentum from the ions. The neutral component of volumetric power emission from the divertor has been measured by means of a novel filtering technique to be substantial (∼ 20% of the total divertor volumetric emission). (author)
International Nuclear Information System (INIS)
Song Yicheng; Zhang Junqian; Shao Xianjun; Guo Zhansheng
2013-01-01
This work investigates the stress-assisted diffusion of lithium ions in layered electrodes of Li-ion batteries. Decoupled diffusion governing equations are obtained. Material properties, which are characterized by a single dimensionless parameter, and mechanical constraint between a current collector and an active layer, which is characterized by the elastic modulus ratio and thickness ratio between the layers, are identified as key factors that govern the stress-assisted diffusion. For a symmetric plate electrode, stress is induced by the Li-ion concentration gradient, and stress-assisted diffusion therefore depends only on the material properties. For an asymmetric bilayer electrode, mechanical constraint plays a very important role in the diffusion via generation of bending stress. Diffusion may be facilitated, or inversely impeded, according to the constraint. By summarizing the coupling factors of common active materials and investigating the concentration variation induced by stress-assisted diffusion in various electrodes, this work provides insights on stress-assisted diffusion in a layered electrode, as well as suggestions for relevant modelling works on whether the stress-assisted diffusion should be taken into account according to the selection of material and structure. (paper)
International Nuclear Information System (INIS)
Alejo, A.; Kar, S.; Ahmed, H.; Doria, D.; Green, A.; Jung, D.; Lewis, C. L. S.; Nersisyan, G.; Krygier, A. G.; Freeman, R. R.; Clarke, R.; Green, J. S.; Notley, M.; Fernandez, J.; Fuchs, J.; Kleinschmidt, A.; Roth, M.; Morrison, J. T.; Najmudin, Z.; Nakamura, H.
2014-01-01
A novel method for characterising the full spectrum of deuteron ions emitted by laser driven multi-species ion sources is discussed. The procedure is based on using differential filtering over the detector of a Thompson parabola ion spectrometer, which enables discrimination of deuterium ions from heavier ion species with the same charge-to-mass ratio (such as C 6+ , O 8+ , etc.). Commonly used Fuji Image plates were used as detectors in the spectrometer, whose absolute response to deuterium ions over a wide range of energies was calibrated by using slotted CR-39 nuclear track detectors. A typical deuterium ion spectrum diagnosed in a recent experimental campaign is presented, which was produced from a thin deuterated plastic foil target irradiated by a high power laser
Alejo, A.; Kar, S.; Ahmed, H.; Krygier, A. G.; Doria, D.; Clarke, R.; Fernandez, J.; Freeman, R. R.; Fuchs, J.; Green, A.; Green, J. S.; Jung, D.; Kleinschmidt, A.; Lewis, C. L. S.; Morrison, J. T.; Najmudin, Z.; Nakamura, H.; Nersisyan, G.; Norreys, P.; Notley, M.; Oliver, M.; Roth, M.; Ruiz, J. A.; Vassura, L.; Zepf, M.; Borghesi, M.
2014-09-01
A novel method for characterising the full spectrum of deuteron ions emitted by laser driven multi-species ion sources is discussed. The procedure is based on using differential filtering over the detector of a Thompson parabola ion spectrometer, which enables discrimination of deuterium ions from heavier ion species with the same charge-to-mass ratio (such as C6 +, O8 +, etc.). Commonly used Fuji Image plates were used as detectors in the spectrometer, whose absolute response to deuterium ions over a wide range of energies was calibrated by using slotted CR-39 nuclear track detectors. A typical deuterium ion spectrum diagnosed in a recent experimental campaign is presented, which was produced from a thin deuterated plastic foil target irradiated by a high power laser.
Energy Technology Data Exchange (ETDEWEB)
Alejo, A.; Kar, S., E-mail: s.kar@qub.ac.uk; Ahmed, H.; Doria, D.; Green, A.; Jung, D.; Lewis, C. L. S.; Nersisyan, G. [Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, Belfast BT7 1NN (United Kingdom); Krygier, A. G.; Freeman, R. R. [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States); Clarke, R.; Green, J. S.; Notley, M. [Central Laser Facility, Rutherford Appleton Laboratory, Didcot, Oxfordshire OX11 0QX (United Kingdom); Fernandez, J. [Central Laser Facility, Rutherford Appleton Laboratory, Didcot, Oxfordshire OX11 0QX (United Kingdom); Instituto de Fusión Nuclear, Universidad Politécnica de Madrid, 28006 Madrid (Spain); Fuchs, J. [LULI, École Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau (France); Kleinschmidt, A.; Roth, M. [Institut für Kernphysik, Technische Universität Darmstadt, Schloßgartenstrasse 9, D-64289 Darmstadt (Germany); Morrison, J. T. [Propulsion Systems Directorate, Air Force Research Lab, Wright Patterson Air Force Base, Ohio 45433 (United States); Najmudin, Z.; Nakamura, H. [Blackett Laboratory, Department of Physics, Imperial College, London SW7 2AZ (United Kingdom); and others
2014-09-15
A novel method for characterising the full spectrum of deuteron ions emitted by laser driven multi-species ion sources is discussed. The procedure is based on using differential filtering over the detector of a Thompson parabola ion spectrometer, which enables discrimination of deuterium ions from heavier ion species with the same charge-to-mass ratio (such as C{sup 6+}, O{sup 8+}, etc.). Commonly used Fuji Image plates were used as detectors in the spectrometer, whose absolute response to deuterium ions over a wide range of energies was calibrated by using slotted CR-39 nuclear track detectors. A typical deuterium ion spectrum diagnosed in a recent experimental campaign is presented, which was produced from a thin deuterated plastic foil target irradiated by a high power laser.
Room-Temperature Growth of SiC Thin Films by Dual-Ion-Beam Sputtering Deposition
Directory of Open Access Journals (Sweden)
C. G. Jin
2008-01-01
Full Text Available Silicon carbide (SiC films were prepared by single and dual-ion-beamsputtering deposition at room temperature. An assisted Ar+ ion beam (ion energy Ei = 150 eV was directed to bombard the substrate surface to be helpful for forming SiC films. The microstructure and optical properties of nonirradicated and assisted ion-beam irradicated films have been characterized by transmission electron microscopy (TEM, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FTIR, and Raman spectra. TEM result shows that the films are amorphous. The films exposed to a low-energy assisted ion-beam irradicated during sputtering from a-SiC target have exhibited smoother and compacter surface topography than which deposited with nonirradicated. The ion-beam irradicated improves the adhesion between film and substrate and releases the stress between film and substrate. With assisted ion-beam irradicated, the density of the Si–C bond in the film has increased. At the same time, the excess C atoms or the size of the sp2 bonded clusters reduces, and the a-Si phase decreases. These results indicate that the composition of the film is mainly Si–C bond.
15 CFR 8a.440 - Health and insurance benefits and services.
2010-01-01
... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Health and insurance benefits and services. 8a.440 Section 8a.440 Commerce and Foreign Trade Office of the Secretary of Commerce... benefits and services. Subject to § 8a.235(d), in providing a medical, hospital, accident, or life...
Surface damage on 6H–SiC by highly-charged Xeq+ ions irradiation
International Nuclear Information System (INIS)
Zhang, L.Q.; Zhang, C.H.; Han, L.H.; Xu, C.L.; Li, J.J.; Yang, Y.T.; Song, Y.; Gou, J.; Li, J.Y.; Ma, Y.Z.
2014-01-01
Surface damage on 6H–SiC irradiated by highly-charged Xe q+ (q = 18, 26) ions to different fluences in two geometries was studied by means of AFM, Raman scattering spectroscopy and FTIR spectrometry. The FTIR spectra analysis shows that for Xe 26+ ions irradiation at normal incidence, a deep reflection dip appears at about 930 cm −1 . Moreover, the reflectance on top of reststrahlen band decreases as the ion fluence increases, and the reflectance at tilted incidence is larger than that at normal incidence. The Raman scattering spectra reveal that for Xe 26+ ions at normal incidence, surface reconstruction occurs and amorphous stoichiometric SiC and Si–Si and C–C bonds are generated and original Si–C vibrational mode disappears. And the intensity of scattering peaks decreases with increasing dose. The AFM measurement shows that the surface swells after irradiation. With increasing ion fluence, the step height between the irradiated and the unirradiated region increases for Xe 18+ ions irradiation; while for Xe 26+ ions irradiation, the step height first increases and then decreases with increasing ion fluence. Moreover, the step height at normal incidence is higher than that at tilted incidence by the irradiation with Xe 18+ to the same ion fluence. A good agreement between the results from the three methods is found
Structural and electrical characterization of ion beam synthesized and n-doped SiC layers
Energy Technology Data Exchange (ETDEWEB)
Serre, C.; Perez-Rodriguez, A.; Romano-Rodriguez, A.; Morante, J.R. [Barcelona Univ. (Spain). Dept. Electronica; Panknin, D.; Koegler, R.; Skorupa, W. [Forschungszentrum Rossendorf, Dresden (Germany); Esteve, J.; Acero, M.C. [CSIC, Bellaterra (Spain). Centre Nacional de Microelectronica
2001-07-01
This work reports preliminary data on the ion beam synthesis of n-doped SiC layers. For this, two approaches have been studied: (i) doping by ion implantation (with N{sup +}) of ion beam synthesized SiC layers and (ii) ion beam synthesis of SiC in previously doped (with P) Si wafers. In the first case, the electrical data show a p-type overcompensation of the SiC layer in the range of temperatures between -50 C and 125 C. The structural (XRD) and in-depth (SIMS, Spreading Resistance) analysis of the samples suggest this overcompensation to be induced by p-type active defects related to the N{sup +} ion implantation damage, and therefore the need for further optimization their thermal processing. In contrast, the P-doped SiC layers always show n-type doping. This is also accompanied by a higher structural quality, being the spectral features of the layers similar to those from the not doped material. Electrical activation of P in the SiC lattice is about one order of magnitude lower than in Si. These data constitute, to our knowledge, the first results reported on the doping of ion beam synthesized SiC layers. (orig.)
Mizuno, Tomohisa; Omata, Yuhsuke; Kanazawa, Rikito; Iguchi, Yusuke; Nakada, Shinji; Aoki, Takashi; Sasaki, Tomokazu
2018-04-01
We experimentally studied the optimization of the hot-C+-ion implantation process for forming nano-SiC (silicon carbide) regions in a (100) Si-on-insulator substrate at various hot-C+-ion implantation temperatures and C+ ion doses to improve photoluminescence (PL) intensity for future Si-based photonic devices. We successfully optimized the process by hot-C+-ion implantation at a temperature of about 700 °C and a C+ ion dose of approximately 4 × 1016 cm-2 to realize a high intensity of PL emitted from an approximately 1.5-nm-thick C atom segregation layer near the surface-oxide/Si interface. Moreover, atom probe tomography showed that implanted C atoms cluster in the Si layer and near the oxide/Si interface; thus, the C content locally condenses even in the C atom segregation layer, which leads to SiC formation. Corrector-spherical aberration transmission electron microscopy also showed that both 4H-SiC and 3C-SiC nanoareas near both the surface-oxide/Si and buried-oxide/Si interfaces partially grow into the oxide layer, and the observed PL photons are mainly emitted from the surface SiC nano areas.
Development of a beam ion velocity detector for the heavy ion beam probe
International Nuclear Information System (INIS)
Fimognari, P. J.; Crowley, T. P.; Demers, D. R.
2016-01-01
In an axisymmetric plasma, the conservation of canonical angular momentum constrains heavy ion beam probe (HIBP) trajectories such that measurement of the toroidal velocity component of secondary ions provides a localized determination of the poloidal flux at the volume where they originated. We have developed a prototype detector which is designed to determine the beam angle in one dimension through the detection of ion current landing on two parallel planes of detecting elements. A set of apertures creates a pattern of ion current on wires in the first plane and solid metal plates behind them; the relative amounts detected by the wires and plates determine the angle which beam ions enter the detector, which is used to infer the toroidal velocity component. The design evolved from a series of simulations within which we modeled ion beam velocity changes due to equilibrium and fluctuating magnetic fields, along with the ion beam profile and velocity dispersion, and studied how these and characteristics such as the size, cross section, and spacing of the detector elements affect performance.
Development of a beam ion velocity detector for the heavy ion beam probe
Energy Technology Data Exchange (ETDEWEB)
Fimognari, P. J., E-mail: PJFimognari@XanthoTechnologies.com; Crowley, T. P.; Demers, D. R. [Xantho Technologies, LLC, Madison, Wisconsin 53705 (United States)
2016-11-15
In an axisymmetric plasma, the conservation of canonical angular momentum constrains heavy ion beam probe (HIBP) trajectories such that measurement of the toroidal velocity component of secondary ions provides a localized determination of the poloidal flux at the volume where they originated. We have developed a prototype detector which is designed to determine the beam angle in one dimension through the detection of ion current landing on two parallel planes of detecting elements. A set of apertures creates a pattern of ion current on wires in the first plane and solid metal plates behind them; the relative amounts detected by the wires and plates determine the angle which beam ions enter the detector, which is used to infer the toroidal velocity component. The design evolved from a series of simulations within which we modeled ion beam velocity changes due to equilibrium and fluctuating magnetic fields, along with the ion beam profile and velocity dispersion, and studied how these and characteristics such as the size, cross section, and spacing of the detector elements affect performance.
Power peak in vicinity of WWER-440 control assembly
International Nuclear Information System (INIS)
Mikus, J.
2002-01-01
This paper presents information concerning the WWER-440 local power peaking problem induced by a control assembly and corresponding investigation possibilities on the light-water zero-power reactor LR-O at the Nuclear Research Institute Rez plc. Brief description of the disposable CA model, experimental arrangement and conditions on the LR-O reactor, preparation of the relevant measurements in the WWER-440 type cores with CA model, as well as some preliminary results of the fission density distribution obtained in a core without boron and with fuel assemblies having profiled enrichment are mentioned too (Author)
Application of C_6_0, C_7_2 and carbon nanotubes as anode for lithium-ion batteries: A DFT study
International Nuclear Information System (INIS)
Najafi, Meysam
2017-01-01
The application of C_6_0, C_7_2, CNT (8, 0) and CNT (10, 0) as anode materials for Lithium-ion batteries were investigated by density functional theory (DFT) calculations. Results show that the average values of voltage cell (V_c_e_l_l) and adsorption energy (E_a_d) of CNT (8, 0) and CNT (10, 0) were higher than C_6_0 and C_7_2 ca 0.327 V and 6.52 kcal/mol, respectively. The NH_2 functionalization of studied nanostructures as a strategy to improve the performance of these systems as anode materials of Lithium-ion batteries were investigated. Results show that, NH_2 functionalization of studied nanostructures increase the average values of voltage cell and adsorption energy ca 0.197 V and 8.20 kcal/mol, respectively. Obtained results propose that NH_2 functionalized C_7_2 and CNT (10, 0) have larger V_c_e_l_l and E_a_d values and therefore these nanostructures have higher potential as anode material for Lithium-ion battery. - Highlights: • C_6_0 and CNT (10, 0) as anode materials for Lithium-ion batteries were investigated. • V_c_e_l_l and E_a_d of CNT (8, 0) and CNT (10, 0) were higher than C_6_0 and C_7_2 ca. • NH_2 functionalization of C_6_0 improve the performance of it as anode materials of Lithium-ion batteries.
Energy Technology Data Exchange (ETDEWEB)
Rentenier, A; Bordenave-Montesquieu, A; Moretto-Capelle, P; Bordenave-Montesquieu, D [LCAR-IRSAMC, UMR 5589 Universite Paul Sabatier-CNRS, 118 rte de Narbonne, 31062 Toulouse Cedex (France)
2004-06-28
A quantitative description of the asymmetric fission (AF) of C{sub 60}{sup r+} fullerene ions (r = 2-4), using a multistop coincidence technique between both fragment ions, is presented. Charged light fragment (LF) and heavy fragment (HF) size distributions are discussed together with the corresponding averaged sizes. Complete AF distributions are reported for the first time for C{sub 60}{sup 2+} ions. Simple dependences of the more probable channels and averaged fragment sizes on the partner size are found and discussed. The LF ones are not very sensitive to the parent fullerene ion charge r and vary linearly with the HF size at least for the largest ones. On the other hand the HF ones present an oscillating dependence against the LF size, the odd-numbered LFs being correlated to a smaller HF size, and depend on r. In the comparison of branching ratios between AF and the competing pure neutral evaporation channel, some emphasis is given to the behaviour of the unimolecular processes with r which are compared with the evolution of the activation energies and fission barriers. From a close examination of the individual HF distributions the production mechanisms of odd-n fragments are discussed, and the most probable dissociation channels of even-numbered C{sub n}{sup +} excited carbon clusters identified. Finally, an analysis of the neutral channels is also presented for the first time, the total neutral mass N (in carbon units) being deduced from the mass conservation law. Surprising similarities between the charged LF- and N-distributions are found. AF processes are also identified where light neutrals and ions play a symmetrical role. These findings lead us to suggest that a concerted emission of ions and heavy neutrals is probably a fission mechanism to be considered to understand the AF process of the C{sub 60} molecule in addition to the often assumed multistep fragmentation cascade scheme.
The hydrolysis of iron(III) and iron(ll) ions between 25 deg C and 375 deg C
Energy Technology Data Exchange (ETDEWEB)
Lewis, Derek
1971-11-15
Some data on the stabilities of the known iron (III) and iron (II) ions are presented, that have been obtained in a theoretical study of the iron-water system at temperatures up to the critical temperature. In this study, estimates of the stability constants of the various ions in dilute solution have been made by a method based on the equations of classical thermodynamics and empirical equations for the change with temperature of ionic heat capacity. The data indicate that hydrolysis increases so rapidly with temperature that the Fe+3 - ion is practically non-existent above about 150 deg C and, except in very acid solutions, the Fe+2 - ion is a relatively minor constituent above about 250 deg C. The most stable of the ions over a wide range of conditions are probably Fe(OH){sub 2}+ , Fe(OH)+ and HFeO{sub 2}-
Single ion counting with a MCP (microchannel plate) detector
Energy Technology Data Exchange (ETDEWEB)
Tawara, Hiroko; Sasaki, Shinichi; Miyajima, Mitsuhiro [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan); Shibamura, Eido
1996-07-01
In this study, a single-ion-counting method using alpha-particle-impact ionization of Ar atoms is demonstrated and the preliminary {epsilon}{sub mcp} for Ar ions with incident energies of 3 to 4.7 keV is determined. The single-ion counting by the MCP is aimed to be performed under experimental conditions as follows: (1) A signal from the MCP is reasonably identified as incidence of single Ar-ion. (2) The counting rate of Ar ions is less than 1 s{sup -1}. (3) The incident Ar ions are not focused on a small part of an active area of the MCP, namely, {epsilon}{sub mcp} is determined with respect to the whole active area of the MCP. So far, any absolute detection efficiency has not been reported under these conditions. (J.P.N.)
Park, Hyun-Wook; Jang, Jae-Won; Lee, Young-Jin; Kim, Jin-Ho; Jeon, Dae-Woo; Lee, Jong-Heun; Hwang, Hae-jin; Lee, Mi-Jai
2017-11-01
This study aims to develop an anode catalyst for a solid oxide fuel cell (SOFC) using electroless nickel plating. We have proposed a new method for electroless plating of Ni metal on yttria-stabilized zirconia (YSZ) particles. We examine the uniformity of the Ni layer on the plated core-shell powder, in addition to the content of Ni and the reproducibility of the plating. We have also evaluated the carbon deposition rate and characteristics of the SOFC anode catalyst. To synthesize Ni-plated YSZ particles, the plated powder is heat-treated at 1200 °C. The resultant particles, which have an average size of 50 μm, were subsequently used in the experiment. The size of the Ni particles and the Ni content both increase with increasing plating temperature and plating time. The X-ray diffraction pattern reveals the growth of Ni particles. After heat-treatment, Ni is oxidized to NiO, leading to the co-existence of Ni and NiO; Ni3P is also observed due to the presence of phosphorous in the plating solution. Following heat treatment for 1 h at 1200 °C, Ni is mostly oxidized to NiO. The carbon deposition rate of the reference YSZ powder is 135%, while that of the Ni-plated YSZ is 1%-6%.
Energetic ion loss detector on the Alcator C-Mod tokamak.
Pace, D C; Granetz, R S; Vieira, R; Bader, A; Bosco, J; Darrow, D S; Fiore, C; Irby, J; Parker, R R; Parkin, W; Reinke, M L; Terry, J L; Wolfe, S M; Wukitch, S J; Zweben, S J
2012-07-01
A scintillator-based energetic ion loss detector has been successfully commissioned on the Alcator C-Mod tokamak. This probe is located just below the outer midplane, where it captures ions of energies up to 2 MeV resulting from ion cyclotron resonance heating. After passing through a collimating aperture, ions impact different regions of the scintillator according to their gyroradius (energy) and pitch angle. The probe geometry and installation location are determined based on modeling of expected lost ions. The resulting probe is compact and resembles a standard plasma facing tile. Four separate fiber optic cables view different regions of the scintillator to provide phase space resolution. Evolving loss levels are measured during ion cyclotron resonance heating, including variation dependent upon individual antennae.
International Nuclear Information System (INIS)
Komiya, S.; Mizuno, M.; Narusawa, T.; Maeda, H.; Yoshikawa, M.
1974-01-01
Preparation and evaluation of a clean Au film are investigated. Development of a preparation method for obtaining clean surface on a copper shell in the JFT-2a (DIVA) TOKAMAK toroidal vacuum chamber is the aim of the present work. Au films prepared by ion plating and vacuum evaporation have been analysed by a cylindrical mirror Auger electron analyser in combination with a quadrupole mass spectrometer during 2 keV Xe ion bombardment from a sputter ion gun over the whole range of thickness of several microns. Contaminants are found to segregate on the top surface and at the interface. To expose a clean Au surface by the ion bombardment, surface layers within 1000 A had to be removed from the surfaces contaminated by touching with either a naked hand or a nylon glove or covered by a small amount of Ti. Mutual diffusions across the interfaces are also analyzed as a function of the substrate temperature. A Nb sandwich layer inhibites effectively the mutual diffusion. (auth.)
Lifescience Database Archive (English)
Full Text Available 69.1 Tor7097 Gametophyte rehydration Library Tortula ruralis cDNA, mRNA sequence. 78 2e-10 1 CN591465 |CN591...;, mRNA sequence. 70 5e-08 1 CN206834 |CN206834.1 Tor7258 Gametophyte rehydration
45 CFR 170.440 - ONC-ATCB status.
2010-10-01
... Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Temporary Certification Program for HIT § 170.440 ONC-ATCB status...
Energy Technology Data Exchange (ETDEWEB)
Park, Hyeji [School of Materials Science and Engineering, Kookmin University, Seoul 136-702 (Korea, Republic of); Um, Ji Hyun [School of Chemical and Biological Engineering, Seoul National University, Seoul 151-742 (Korea, Republic of); Center for Nanoparticle Research, Institute for Basic Science (IBS), Seoul 151-742 (Korea, Republic of); Choi, Hyelim [School of Materials Science and Engineering, Kookmin University, Seoul 136-702 (Korea, Republic of); Yoon, Won-Sub [Department of Energy Science, Sungkyunkwan University, Suwon, 440-746 (Korea, Republic of); Sung, Yung-Eun [School of Chemical and Biological Engineering, Seoul National University, Seoul 151-742 (Korea, Republic of); Center for Nanoparticle Research, Institute for Basic Science (IBS), Seoul 151-742 (Korea, Republic of); Choe, Heeman, E-mail: heeman@kookmin.ac.kr [School of Materials Science and Engineering, Kookmin University, Seoul 136-702 (Korea, Republic of); Cellmotive Co. Ltd., #518, Engineering Building, Kookmin University, Seoul 136-702 (Korea, Republic of)
2017-03-31
Highlights: • Sn-Cu scaffold anode fabricated by freeze-casting and electroless plating. • Sn-Cu scaffold architecture shows superior capacity and cyclic stability at high current density. • Sn-Cu scaffold electrode is commercially promising. - Abstract: A Novel 3D porous Sn-Cu architecture is prepared as an anode material for use in an advanced lithium-ion battery. Micro-lamellar-structured 3D porous Cu foam, which is electroless-plated with Sn as an active material, is used as anode current collector. Compared to Sn-coated Cu foil, the 3D Sn-Cu foam exhibits superior Li-ion capacity and stable capacity retention, demonstrating the advantage of 3D porous architecture by preserving its structural integrity. In addition, the effect of heat-treatment after Sn plating is investigated. Sn/Sn{sub 6}Cu{sub 5} and SnO{sub 2}/Cu{sub 10}Sn{sub 3} were formed on and in the 3D Sn-Cu foam under the heat-treatment at 150 °C and 500 °C, respectively. The development of Cu{sub 10}Sn{sub 3} in the 3D Sn-Cu foam heat-treated at 500 °C can be a key factor for the enhanced cyclic stability because the Cu{sub 10}Sn{sub 3} inactively reacts with Li-ion and alleviates the volume expansion of SnO{sub 2} as an inactive matrix.
46 CFR 129.440 - Emergency lighting.
2010-10-01
... INSTALLATIONS Lighting Systems § 129.440 Emergency lighting. (a) A vessel of less than 100 gross tons must have... working (machinery) spaces below the main deck. (b) The emergency lighting required by paragraph (a) of... to an automatic battery-charger; and (4) Of enough capacity for 6 hours of continuous operation. ...
Modernization of the WWER 440/230 nuclear power plant environmental protection system
Energy Technology Data Exchange (ETDEWEB)
Mikheev, N.V.; Kamenskaya, A.N.; Kulyukhin, S.A.; Novichenko, V.L.; Rumer, I.A. [Russian Academy of Sciences, Institute of Physical Chemistry, Moscow (Russian Federation); Antonov, B.V.; Kornienko, A.G.; Meshkov, V.M.; Rogov, M.F. [Rosenergoatom Concern, Moscow (Russian Federation)
2001-07-01
The papers reports a new approach to the problem of increasing environmental protection during severe accidents at WWER 440/230 nuclear power plants. The environmental protection system that we propose has three, not two protection levels, and can be introduced with minor modernization of the equipment available at WWER 440/230 nuclear power plants: 1. a jet-vortex condenser; 2. the sprinkler system; 3. a sorption module. The proposed modernization not only makes it possible to avoid emergency discharge of radioactive air and steam mix into the environment under any accident scenario, but also would substantially contribute to the safety of WWER 440/230 nuclear power plants. (author)
C6 plate puncture testing report.
Energy Technology Data Exchange (ETDEWEB)
Vangoethem, Douglas J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Cordova, Theresa Elena [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Reu, Phillip L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2013-04-01
There are numerous scenarios where critical systems could be subject to penetration by projectiles or fixed objects (e.g., collision, natural disaster, act of terrorism, etc.). It is desired to use computational models to examine these scenarios and make risk-informed decisions; however, modeling of material failure is an active area of research, and new models must be validated with experimental data. The purpose of this report is to document the experimental work performed from FY07 through FY08 on the Campaign Six Plate Puncture project. The goal of this project was to acquire experimental data on the puncture and penetration of metal plates for use in model validation. Of particular interest is the PLH failure model also known as the multilinear line segment model. A significant amount of data that will be useful for the verification and validation of computational models of ductile failure were collected during this project were collected and documented herein; however, much more work remains to be performed, collecting additional experimental data that will further the task of model verification.
Strengthening of structurally damaged wide shallow RC beams using externally bonded CFRP plates
Directory of Open Access Journals (Sweden)
Rajeh A. Al-Zaid
Full Text Available Reinforced concrete wide shallow beams (WSBs are commonly used in the joist flooring systems. The structural behavior of WSBs strengthened with carbon fiber reinforced polymer (CFRP reinforcement was studied on isolated beams and as part of full-scale building. The effect of structural damage on the performance of WSBs flexurally strengthened with CFRP plates was investigated and presented in this paper. Eight full-scale WSBs were tested under four-point bending up to failure. Seven beams were strengthened with CFRP plates bonded to the soffit of the beams and one beam was unstrengthened serving as control. Prior to strengthening, the beams were subjected to different levels of damaging by preloading to 30-95% of the beams' flexural capacity. One beam was fully damaged by preloading to failure and repaired before strengthening by replacing the crushed concrete. The data showed that the pre-damaged strengthened beams exhibited ultimate capacities up to 8% lower than those of the undamaged strengthened beams. However, the load carrying capacities of pre-damaged strengthened beams were more than those predicted by ACI 440 design guide, fib Bulletin 14, and JSCE design recommendations. Both fib Bulletin 14 and JSCE design recommendations gave very conservative predictions with average ratios of experimental to predicted ultimate capacity of 2.02 and 2.35, respectively. More accurate predictions were obtained by ACI 440 design guide as the corresponding ratio was 1.24. These results indicate that strong confidence and reliability can be placed in applying CFRP strengthening to structurally damaged WSBs.
Simulation of tungsten erosion and transport near the divertor plate during ELMs by a kinetic method
Energy Technology Data Exchange (ETDEWEB)
Sun, Zhenyue; Sang, Chaofeng; Hu, Wanpeng; Du, Hailong; Wang, Dezhen, E-mail: wangdez@dlut.edu.cn
2016-11-01
Highlights: • A kinetic method is used to simulate tungsten erosion and transport during ELMs. • The erosion of tungsten plate by different species (deuterium and carbon ions) is shown. • The charge states of sputtered tungsten particles are given statistically. - Abstract: Tungsten (W) is fore seen as one of the most important candidates of the plasma-facing materials (PFM) for future fusion devices, due to its beneficial properties. However, the high-Z characteristic makes it a potential contamination to the core plasma. Divertor is the main component that directly contacts the plasma, therefore, it is very important to understand the erosion of W divertor plate and the corresponding transport of the eroded wall impurity, especially during edge localized modes (ELMs). In this work, a one-dimension-in-space and three-dimensions-in-velocity particle-in-cell code (EPPIC1D) is used to simulate the erosion of W divertor plate, and the transport of eroded W impurity near the divertor plate is studied by a Monte Carlo code. Benefiting from the kinetic simulation, energy/particle flux to the target could be calculated accurately, and the erosion of W plate by different species is simulated during ELMs. The trajectories and distributions of eroded W impurity particles are demonstrated, which shows us a basic idea of how these impurity particles are generated and transported. It is found that C{sup 3+} plays a dominated role on the erosion of W divertor plate during ELMs even when its concentration is low. Both W atoms and ions distribute mainly near the divertor plate, indicating only a very small fraction of W impurity particles could escape from divertor region and penetrate into the core plasma.
Energy Technology Data Exchange (ETDEWEB)
Najafi, Meysam, E-mail: meysamnajafi2016@gmail.com
2017-07-01
The application of C{sub 60}, C{sub 72}, CNT (8, 0) and CNT (10, 0) as anode materials for Lithium-ion batteries were investigated by density functional theory (DFT) calculations. Results show that the average values of voltage cell (V{sub cell}) and adsorption energy (E{sub ad}) of CNT (8, 0) and CNT (10, 0) were higher than C{sub 60} and C{sub 72} ca 0.327 V and 6.52 kcal/mol, respectively. The NH{sub 2} functionalization of studied nanostructures as a strategy to improve the performance of these systems as anode materials of Lithium-ion batteries were investigated. Results show that, NH{sub 2} functionalization of studied nanostructures increase the average values of voltage cell and adsorption energy ca 0.197 V and 8.20 kcal/mol, respectively. Obtained results propose that NH{sub 2} functionalized C{sub 72} and CNT (10, 0) have larger V{sub cell} and E{sub ad} values and therefore these nanostructures have higher potential as anode material for Lithium-ion battery. - Highlights: • C{sub 60} and CNT (10, 0) as anode materials for Lithium-ion batteries were investigated. • V{sub cell} and E{sub ad} of CNT (8, 0) and CNT (10, 0) were higher than C{sub 60} and C{sub 72} ca. • NH{sub 2} functionalization of C{sub 60} improve the performance of it as anode materials of Lithium-ion batteries.
Characterization of the crystalline quality of β-SiC formed by ion beam synthesis
International Nuclear Information System (INIS)
Intarasiri, S.; Hallen, A.; Kamwanna, T.; Yu, L.D.; Possnert, G.; Singkarat, S.
2006-01-01
The ion beam synthesis (IBS) technique is applied to form crystalline silicon carbide (SiC) for future optoelectronics applications. Carbon ions at 80 and 40 keV were implanted into (1 0 0) high-purity p-type silicon wafers at room temperature and 400 deg. C, respectively, to doses in excess of 10 17 ions/cm 2 . Subsequent thermal annealing of the implanted samples was performed in a vacuum furnace at temperatures of 800, 900 and 1000 deg. C, respectively. Elastic recoil detection analysis was used to investigate depth distributions of the implanted ions and infrared transmittance (IR) measurement was used to characterize formation of SiC in the implanted Si substrate. Complementary to IR, Raman scattering measurements were also carried out. Levels of the residual damage distribution of the samples annealed at different temperatures were compared with that of the as-implanted one by Rutherford backscattering spectrometry (RBS) in the channeling mode. The results show that C-ion implantation at the elevated temperature, followed by high-temperature annealing, enhances the synthesis of crystalline SiC
Lifescience Database Archive (English)
Full Text Available um discoideum cDNA clone:ddv23p10, 3' ... 1086 0.0 2 ( FJ172159 ) Human enterovirus 71 isolate NUH0075/SIN/0...8, comp... 52 0.029 1 ( EU868611 ) Human enterovirus 71 isolate NUH0075/SIN/08 polyp... 52 0.029 1 ( CS32767
The C2H3O+ chemi-ion acetyl cation or O-protonated ketene
DEFF Research Database (Denmark)
Egsgaard, H.; Carlsen, L.
1995-01-01
The C2H3O+ chemi-ion sampled from a premixed methane/oxygen flame has been demonstrated to be the acetyl cation based on ion-molecule reactions with isoprene and 1,3-dioxolane.......The C2H3O+ chemi-ion sampled from a premixed methane/oxygen flame has been demonstrated to be the acetyl cation based on ion-molecule reactions with isoprene and 1,3-dioxolane....
Directory of Open Access Journals (Sweden)
Rauf Foroutan
2017-06-01
Full Text Available The biomass of Aspergillus flavus was modified by calcium chloride to achieve a bioadsorbent for treating nickel, cobalt, and zinc ions from aqueous solutions. The information of pH, bioadsorbent dose, contact time, and temperature effect on the removal efficiency are presented. The data of Freundlich and Langmuir isotherm and pseudo-first-order and pseudo-second-order kinetic models are also depicted. The data showed that the maximum bioadsorption capacity of nickel, cobalt, and zinc ions is 32.26, 31.06 and 27.86 mg/g, respectively. The suitability of the bioadsorbent in heavy metals removal at field condition was tested with a real wastewater sample collected from a plating plant in the final part of this dataset. Based on the findings, the bioadsorbent was shown to be an affordable alternative for the removal of metals in the wastewater.
International Nuclear Information System (INIS)
Mink, F.J.
1991-01-01
The modernization of the VVER-440/230s is not fundamentally different from backfit projects on older pressurized water reactors which Westinghouse has completed elsewhere. However, carrying out such programmes only makes sense if the plants are expected to continue operation for their projected life or beyond. This clearly requires some licensing and political stability; both are essential if investors in the upgrading project are to be found. (author)
Modelling of ion implantation in SiC crystals
Energy Technology Data Exchange (ETDEWEB)
Chakarov, Ivan [SILVACO International, 4701 Patrick Henry Drive, Building 2, Santa Clara, CA 95054 (United States)]. E-mail: ivan.chakarov@silvaco.com; Temkin, Misha [SILVACO International, 4701 Patrick Henry Drive, Building 2, Santa Clara, CA 95054 (United States)
2006-01-15
An advanced electronic stopping model for ion implantation in SiC has been implemented within the binary collision approximation. The model has been thoroughly tested and validated for Al implantation into 4H-, 6H-SiC under different initial implant conditions. A very good agreement between calculated and experimental profiles has been achieved. The model has been integrated in an industrial technology CAD process simulator.
Modelling of ion implantation in SiC crystals
International Nuclear Information System (INIS)
Chakarov, Ivan; Temkin, Misha
2006-01-01
An advanced electronic stopping model for ion implantation in SiC has been implemented within the binary collision approximation. The model has been thoroughly tested and validated for Al implantation into 4H-, 6H-SiC under different initial implant conditions. A very good agreement between calculated and experimental profiles has been achieved. The model has been integrated in an industrial technology CAD process simulator
Nanostructured Si/TiC composite anode for Li-ion batteries
International Nuclear Information System (INIS)
Zeng, Z.Y.; Tu, J.P.; Yang, Y.Z.; Xiang, J.Y.; Huang, X.H.; Mao, F.; Ma, M.
2008-01-01
Si/TiC nanocomposite anode was synthesized by a surface sol-gel method in combination with a following heat-treatment process. Through this process, nanosized Si was homogeneously distributed in a titanium carbide matrix. The electrochemically less active TiC working as a buffer matrix successfully prevented Si from cracking/crumbling during the charging/discharging process. The interspaces in the Si/TiC nanocomposite could offer convenient channels for Li ions to react with active Si. The Si/TiC composite exhibited a reversible charge/discharge capacity of about 1000 mAh g -1 with average discharge capacity fading of 1.8 mAh g -1 (0.18%) from 2nd to 100th cycle, indicating its excellent cyclability when used as anode materials for lithium-ion batteries
Energy Technology Data Exchange (ETDEWEB)
Melnikov, N [Opytno-Konstruktorskoe Byuro Gidropress, Podol` sk (Russian Federation)
1996-12-31
Modernization of WWER-440/V-230 reactors is considered according to the WANO project `Proposal for reconstruction of WWER-440/V-230 reactors` (1990). The main technical measures to be taken relate to: 1. Expanding the considered spectrum of design basis accidents; 2. Provision of first loop integrity; 3. Safety system structure and components reliability enhancement; 4. Reduction o initiating events probability; 5. Enhancement of hermeticity and integrity of the area surrounding the first loop; 6. Fire fighting system upgrade; 7. Radiation control system upgrade; 8. Provision of seismic resistance. Details of the recommended technical steps for some NPPs are presented. 1 tab.
Plasma diagnostics with electrostatic probes in the reactive low voltage ion plating process
International Nuclear Information System (INIS)
Lechleitner, T.; Huber, D.; Pulker, H.K.
2002-01-01
The analysis of cold plasmas, which are used in thin film coating techniques, is mainly important for the understanding of the correlation between the film properties and the plasma (or the process) parameters. With the knowledge of these correlations, one is able to optimise and eventually improve the coating processes for the production of films with certain desirable properties. The plasma for the reactive-low-voltage-ion-plating processes is a cold non-isothermal plasma produced by a low-pressure dc non-self sustained arc discharge, controlled by two main parameters, the arc current and the total gas pressure in the chamber. It was shown that the arc current is in a direct linear relation to the degree of ionization and the increase of the total gas pressure has a contrary effect. Besides, it was also demonstrated, that the usage of electrostatic probes for the plasma analysis od deposition processes is a powerful tool to complete the common plasma monitor measurements (energy analysing quadrupol mass spectrometer) and to improve the understanding of industrially used plasma. (nevyjel)
Fragment ion and electron emission from C sub 6 sub 0 by fast heavy ion impact
Mizuno, T; Itoh, A; Tsuchida, H; Nakai, Y
2003-01-01
Correlation between electron emission and fragmentation of C sub 6 sub 0 was studied using 847keV Si sup + ions. Mass distribution of fragment ions, number distribution of secondary electrons, and final charge distribution of outgoing projectiles were successfully measured by means of a triple coincidence time-of-flight method. Strong correlation was observed for electron emission and fragmentation.
International Nuclear Information System (INIS)
Romppanen, A.-J.; Immonen, E.
2013-12-01
The residual stresses formed as a result of Electronic Beam welding (EB-welding) in copper are investigated by Posiva. In the present study, residual stresses of EB-welded copper plates were studied with contour method. In the method eleven copper plates (X436 - X440 and X453 - X458) were cut in half with wire electric discharge machining (EDM) after which the deformation due to stress relaxation was measured with coordinate measurement system. The measured data was then used as boundary displacement data for the FEM analyses, in which the corresponding residual stresses were calculated. Before giving the corresponding displacement boundary conditions to the FE models, the deformation data was processed and smoothed appropriately. The residual stress levels of the copper plates were found to be around 40 - 55 MPa at maximum. This corresponds to other reported residual stress measurements and current state of knowledge with this material in Posiva. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Song, Hong-Lian; Yu, Xiao-Fei; Zhang, Lian; Wang, Tie-Jun; Qiao, Mei; Zhang, Jing; Liu, Peng; Wang, Xue-Lin, E-mail: xuelinwang@sdu.edu.cn
2015-11-01
We report on MgAl{sub 2}O{sub 4} planar waveguides produced using different energies and fluences of C-ion implantation at room temperature. Based on the prism coupling method and end-face coupling measurements, light could propagate in the C-ion-implanted samples. The Raman spectra results indicate that the MgAl{sub 2}O{sub 4} crystal lattice was damaged during the multi-energy C implantation process, whereas the absorption spectra were hardly affected by the C-ion implantation in the visible and infrared bands.
Additional ion bombardment in PVD processes generated by a superimposed pulse bias voltage
International Nuclear Information System (INIS)
Olbrich, W.; Kampschulte, G.
1993-01-01
The superimposed pulse bias voltage is a tool to apply an additional ion bombardment during deposition in physical vapour deposition (PVD) processes. It is generated by the combination of a d.c. ground voltage and a higher d.c. pulse voltage. Using a superimposed pulse bias voltage in ion-assisted PVD processes effects an additional all-around ion bombardment on the surface with ions of higher energy. Both metal and reactive or inert-gas ions are accelerated to the surface. The basic principles and important characteristics of this newly developed process such as ion fluxes or deposition rates are shown. Because of pulsing the high voltage, the deposition temperature does not increase much. The adhesion, structure, morphology and internal stresses are influenced by these additional ion impacts. The columnar growth of the deposited films could be suppressed by using the superimposed pulse bias voltage without increasing the deposition temperature. Different metallizations (Cr and Cu) produced by arc and sputter ion plating are investigated. Carbon-fibre-reinforced epoxy are coated with PVD copper films for further treatment in electrochemical processes. (orig.)
Inhibitory effect of 12C6+ ion and X-ray on angiogenesis in HMEC-1
International Nuclear Information System (INIS)
Liu Yuanyuan; Zhang Hong; Liu Yang; Wu Zhenhua; Sun Chao; Li Hongyan
2013-01-01
The study aims to explore the effect of 12 C 6+ ion and X-ray on proliferation, migration, tube formation and MMPS of human microvascular endothelial cells (HMEC-1). Transwell migration experiment showed that the radiation could inhibit the migration of HMEC-1 in sub-lethal dose 24 h after irradiation. Furthermore, the inhibition ability of 12 C 6+ ion was stronger than that of X-ray. Matrigel experiment indicated that 12 C 6+ ion suppressed the tube formation of HMEC-1 spontaneously. However, the inhibitory effect of X-ray had no significance. Meanwhile, Gelatin Zymography showed the expression of MMP-2 was inhibited obviously by 12 C 6+ ion, while X-ray had little effect on the expression of MMP-2. In conclusion, 12 C 6+ ion is superior to X-ray in radiotherapy of tumor. (authors)
Photodetachment of negative C{sub 60}{sup -} ions
Energy Technology Data Exchange (ETDEWEB)
Amusia, M.Ya.; Baltenkov, A.S.; Krakov, B.G. [Ioffe Physico-Technical Inst., St. Petersburg (Russian Federation)]|[U.A. Arifov Institute of Electronics, Tashkent, 700143 (Uzbekistan)
1998-06-15
A model that describes the electron structure of negative fullerene C{sub 60}{sup -} ions is proposed. The model contains only two experimentally observed parameters, namely the fullerene radius and the affinity energy of the electron to neutral C{sub 60}. In the frame of this model, cross sections are calculated of elastic scattering of slow electrons on neutral fullerene, of C{sub 60}{sup -} photodetachment near the threshold of this process and of radiative recombination of slow electrons with neutral fullerenes. (orig.) 21 refs.
Comparative evaluation of metal ions release from titanium and Ti-6Al-7Nb into bio-fluids
Directory of Open Access Journals (Sweden)
Lori A Joseph
2009-01-01
Full Text Available Background: The study was designed to investigate the effects of pH, chloride ions and nature of some bio-fluids on the amount of metal ions released from titanium and TiAl 6 Nb 7 plates following incubation in actual and simulated bio-fluids over time. Methods: The amounts of released metal ions from commercially pure titanium (CpTi and TiAl 6 Nb 7 of surgical grade on immersion in 20 mL Hank′s solution of pH 4.0 or 7.0, Hank′s solution of high chloride ions concentration, Whole Blood Serum (WBS and Phosphate Buffered Saline (PBS at 37° C were determined over an incubation time of 20 weeks using atomic absorption spectrophotometry. The levels of released metal ions were compared by two-way ANOVA and Duncan′s post-hoc tests. The amounts of titanium ions released by the samples were analyzed by Pearson′s correlation. Results: TiAl 6 Nb 7 plate showed no release of Ti ions into the test solutions until after 12 weeks of incubation, while Ti ions were released from the CpTi plate from the 1 day immersion time. The re-lease of measurable amount of Al ions from TiAl 6 Nb 7 was after 12 weeks of incubation. The rate of release of Ti and Al ions from the samples increased initially with incubation time and then stabilized due to adsorption-desorption equilibrium. Conclusion: The results showed that variations in pH and chloride ions of the test media has a sig-nificant effect on the amounts of Ti ions released, while increase in chloride ions concentration sig-nificantly elevates the release of Al ions into the bio-fluids.
Finite element analysis of a solar collector plate using two plate geometries
Directory of Open Access Journals (Sweden)
Diego Manuel Medina Carril
2016-09-01
Full Text Available The thermal behavior of an absorber plate in a solar collector is investigated using finite element analysis. The thermal behavior and efficiency of two absorber plate geometries are studied, using a typical solar collector with a rectangular profile as reference, and a proposed absorber plate with curved geometry. An analysis of the most important parameters involved in the design of the absorber plate was carried out, indicating that the curved geometry of the absorber plate yields an average efficiency ~25% higher than the conventional rectangular geometry. The results suggest that a curved profile made of materials such as aluminum with thermal conductivity higher than 200W/m°C, plate thickness of the order of 2-3mm and with a large density of tubes per unit area of the collector´s plate greatly benefits the thermal efficiency of the solar collector.
40 CFR 300.440 - Procedures for planning and implementing off-site response actions.
2010-07-01
... unless the Remedial Project Manager or OSC assures the proper management of the CERCLA waste samples or... OIL AND HAZARDOUS SUBSTANCES POLLUTION CONTINGENCY PLAN Hazardous Substance Response § 300.440... § 300.440(d). (5) Off-site transfers of those laboratory samples and treatability study CERCLA wastes...
20 CFR 670.440 - What are the responsibilities of outreach and admissions agencies?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What are the responsibilities of outreach and admissions agencies? 670.440 Section 670.440 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB CORPS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Recruitment, Eligibility...
Raman spectroscopy of few-layer graphene prepared by C2–C6 cluster ion implantation
International Nuclear Information System (INIS)
Wang, Z.S.; Zhang, R.; Zhang, Z.D.; Huang, Z.H.; Liu, C.S.; Fu, D.J.; Liu, J.R.
2013-01-01
Few-layer graphene has been prepared on 300 nm-thick Ni films by C 2 –C 6 cluster ion implantation at 20 keV/cluster. Raman spectroscopy reveals significant influence of the number of atoms in the cluster, the implantation dose, and thermal treatment on the structure of the graphene layers. In particular, the graphene samples exhibit a sharp G peak at 1584 cm −1 and 2D peaks at 2711–2717 cm −1 . The I G /I 2D ratios higher than 1.70 and I G /I D ratio as high as 1.95 confirm that graphene sheets with low density of defects have been synthesized with much improved quality by ion implantation with larger clusters of C 4 –C 6
Solid-state microwave annealing of ion-implanted 4H-SiC
International Nuclear Information System (INIS)
Sundaresan, Siddarth G.; Tian, Yong-lai; Ridgway, Mark C.; Mahadik, Nadeemullah A.; Qadri, Syed B.; Rao, Mulpuri V.
2007-01-01
Solid-state microwave annealing was performed at temperatures up to 2120 deg, C for 30 s on ion-implanted 4H-SiC in N 2 ambient. The surface roughness in the samples annealed without a surface cap at 1950 deg, C is 2.65 nm for 10 μm x 10 μm atomic force microscopy scans. The sheet resistances measured on Al + - and P + -implanted 4H-SiC, annealed by microwaves, are lower than the best conventional furnace annealing results reported in literature. X-ray diffraction spectra indicate alleviation of the lattice damage induced by the ion-implantation and also incorporation of most of the implanted species into substitutional lattice sites
Improving the VVER-440 fuel design and technology
International Nuclear Information System (INIS)
Aksenov, P.; Bondar, Y.; Kolosovsky, Y.; Kochergin, V.; Luzan, Y.; Malakhov, A.; Krapivtsev, V.; Bauman, N.; Shumeev, A.; Filippov, V.
2009-01-01
Operational performance of VVER-440 fuel has long been demonstrating good reliability of the fuel. However, assembly failures occur, and fuel suppliers should always take measures to maintain its reliability. For several years, OAO MSZ has been fabricating working assemblies with detachable shrouds and removable fuel rods. The next step is the supply of demountable assemblies to allow inspection or repair of fuel rods after removal of the shroud. With the help of corresponding program the Russian organizations have carried out research and development work to advance and study operational features of demountable VVER-440 CFAs. The main engineering solutions are consistent with the working assemblies. The pilot demountable CFAs are running in the Kola-4 core. The obtained results can be used when deciding on the demountable CFAs delivery issues. The experiment-calculated research results of coolant mixing in the present design VVER-440 have been analysed. It has been found out that coolant mixing in the WA head is incomplete and that is why leading to conservatism when determining the reactor operational limits. The proposed WA head design includes an upgraded bumper grid with additional planes intensifying coolant mixing in the head. The bumper grid drawing and a pilot model is available. The thermohydraulics and rigidity features of the proposed design have been studied by experiment-calculated methods
Nano-jewellery: C5Au12--a gold-plated diamond at molecular level.
Naumkin, F
2006-06-07
A mixed carbon-metal cluster is designed by combining the tetrahedral C(5) radical (with a central atom-the skeleton of the C(5)H(12) molecule) and the spherical Au(12) layer (the external atomic shell of the Au(13) cluster). The C(5)Au(12) cluster and its negative and positive ionic derivatives, C(5)Au(12)(+/-), are investigated ab initio (DFT) in terms of optimized structures and relative energies of a few spin-states, for the icosahedral-like and octahedral-like isomers. The cluster is predicted to be generally more stable in its octahedral shape (similar to C(5)H(12)) which prevails for the negative ion and may compete with the icosahedral shape for the neutral system and positive ion. Adiabatic ionization energies (AIE) and electron affinities (AEA) of C(5)Au(12), vertical electron-detachment (VDE) energies of C(5)Au(12)(-), and vertical ionization and electron-attachment energies (VIE, VEA) of C(5)Au(12) are calculated as well, and compared with those for the corresponding isomers of the Au(13) cluster. The AIE and VIE values are found to be close for the two systems, while the AEA and VDE values are significantly reduced for the radical-based species. A simple fragment-based model is proposed for the decomposition of the total interaction into carbon-gold and gold-gold components.
The influence of retention on the plate height in ion-exchange chromatography
DEFF Research Database (Denmark)
Hansen, Ernst; Mollerup, Jørgen
2004-01-01
The plate heights for the amino acid tyrosine (anion exchange) and the polypeptide aprotinin (cation exchange) were determined on a porous media (Resource 15) and a get filled media (HyperD 20) at salt concentrations ranging from weak to strong retention. At a constant velocity, measurements showed....... In this article, the rate of mass transfer in the particles is described by three different rate mechanisms, pore diffusion, solid diffusion, and parallel diffusion. The van Deemter equation was used to model the data to determine the mass-transfer properties. The development of the plate height with increasing...... retention revealed a characteristic behavior for each rate mechanism. In the pore diffusion model, the plate height increased toward a constant value at strong retention, while the plate height in the solid diffusion model decreased, approaching a constant value at strong retention. In the parallel...
Lida, Tsutomu; Makita, Yunosuke; Kimura, Shinji; Winter, Stefan; Yamada, Akimasa; Fons, Paul; Uekusa, Shin-Ichiro
1995-01-01
A combined ion-beam and molecular-beam-epitaxy (CIBMBE) system has been developed. This system consists of an ion implanter capable of producing ions in the energy range of 30 eV - 30 keV and conventional solid-source MBE. As a successful application of CIBMBE, low-energy (100 eV) carbon ion (C(+)) irradiation during MBE growth of GaAs was carried out at substrate temperatures T(sub g) between 500 and 590 C. C(+)-doped layers were characterized by low-temperature (2 K) photoluminescence (PL), Raman scattering, and van der Pauw measurements. PL spectra of undoped GaAs grown by CIBMBE revealed that unintentional impurity incorporation into the epilayer is extremely small and precise doping effects are observable. C(sub As) acceptor-related emissions such as 'g', (g-g), and (g-g)(sub beta) are observed and their spectra are significantly changed with increasing C(+) beam current density I(sub c). PL measurements showed that C atoms were efficiently incorporated during MBE growth by CIBMBE and were optically well activated as an acceptor in the as-grown condition even for T(sub g) as low as 500 C. Raman measurement showed negligible lattice damage of the epilayer bombarded with 100 eV C(+) with no subsequent heat treatment. These results indicate that contamination- and damage-free impurity doping without postgrowth annealing can be achieved by the CIBMBE method.
International Nuclear Information System (INIS)
Zou, Y.; Wang, L.W.; Huang, N.K.
2007-01-01
C-TiC films with a content of 75% TiC were prepared with magnetron sputtering deposition followed by Ar + ion bombardment. Effect of heating on the behaviors of hydrogen in C-TiC films before and after heating was studied with Auger Electron Spectroscopy and Secondary Ion Mass Spectroscopy (SIMS) analyses. SIMS depth profiles of hydrogen after H + ion implantation and thermal treatment show different hydrogen concentrations in C-TiC coatings and stainless steel. SIMS measurements show the existence of TiH, TiH 2 , CH 3 , CH 4 , C 2 H 2 bonds in the films after H + ion irradiation and the changes in the Ti LMM, Ti LMV and C KLL Auger line shape reveal that they have a good hydrogen retention ability after heating up to the temperature 393 K. All the results show that C-TiC coatings can be used as a hydrogen retainer or hydrogen permeable barrier on stainless steel to protect it from hydrogen brittleness
The effect of ions on the magnetic moment of vacancy for ion-implanted 4H-SiC
Peng, B.; Zhang, Y. M.; Dong, L. P.; Wang, Y. T.; Jia, R. X.
2017-04-01
The structural properties and the spin states of vacancies in ion implanted silicon carbide samples are analyzed by experimental measurements along with first-principles calculations. Different types and dosages of ions (N+, O+, and B+) were implanted in the 4H-silicon carbide single crystal. The Raman spectra, positron annihilation spectroscopy, and magnetization-magnetic field curves of the implanted samples were measured. The fitting results of magnetization-magnetic field curves reveal that samples implanted with 1 × 1016 cm-2 N+ and O+ ions generate paramagnetic centers with various spin states of J = 1 and J = 0.7, respectively. While for other implanted specimens, the spin states of the paramagnetic centers remain unchanged compared with the pristine sample. According to the positron annihilation spectroscopy and first-principles calculations, the change in spin states originates from the silicon vacancy carrying a magnetic moment of 3.0 μB in the high dosage N-implanted system and 2.0 μB in the O-doped system. In addition, the ratio of the concentration of implanted N ions and silicon vacancies will affect the magnetic moment of VSi. The formation of carbon vacancy which does not carry a local magnetic moment in B-implanted SiC can explain the invariability in the spin states of the paramagnetic centers. These results will help to understand the magnetic moments of vacancies in ion implanted 4H-SiC and provide a possible routine to induce vacancies with high spin states in SiC for the application in quantum technologies and spintronics.
Growing imbedded Ni3C-rich layer with sharp interfaces by means of ion beam mixing of C/Ni layers
International Nuclear Information System (INIS)
Barna, Arpad; Kotis, Laszlo; Labar, Janos; Sulyok, Attila; Toth, Attila L; Menyhard, Miklos; Panjan, Peter
2011-01-01
C/Ni bilayers of various layer thicknesses (20-40 nm) were ion bombarded using Ga + and Ni + projectiles of energies 20 and 30 keV. Ion bombardment resulted in the growth of a Ni 3 C rich layer with the following features: (a) sharp carbon/Ni 3 C rich layer interface, (b) the amount of Ni 3 C produced by the irradiation proportional to the square root of the fluence and dependent on the type of projectile, (c) good correlation between the distribution of vacancies produced by the ion bombardment and the distribution of Ni 3 C. The formation of the metastable Ni 3 C compound was explained by a vacancy-assisted process. The sharp interface is the consequence of a relaxation process removing the intermixed Ni from the carbon layer. The square root of fluence dependence of the thickness of the Ni 3 C-rich layer can be explained by a usual diffusion equation considering moving boundaries.
Freeman, C G; Fiksel, G; Stoeckl, C; Sinenian, N; Canfield, M J; Graeper, G B; Lombardo, A T; Stillman, C R; Padalino, S J; Mileham, C; Sangster, T C; Frenje, J A
2011-07-01
A Thomson parabola ion spectrometer has been designed for use at the Multiterawatt (MTW) laser facility at the Laboratory for Laser Energetics (LLE) at the University of Rochester. This device uses parallel electric and magnetic fields to deflect particles of a given mass-to-charge ratio onto parabolic curves on the detector plane. Once calibrated, the position of the ions on the detector plane can be used to determine the particle energy. The position dispersion of both the electric and magnetic fields of the Thomson parabola was measured using monoenergetic proton and alpha particle beams from the SUNY Geneseo 1.7 MV tandem Pelletron accelerator. The sensitivity of Fujifilm BAS-TR imaging plates, used as a detector in the Thomson parabola, was also measured as a function of the incident particle energy over the range from 0.6 MeV to 3.4 MeV for protons and deuterons and from 0.9 MeV to 5.4 MeV for alpha particles. The device was used to measure the energy spectrum of laser-produced protons at MTW.
Energy Technology Data Exchange (ETDEWEB)
Freeman, C. G.; Canfield, M. J.; Graeper, G. B.; Lombardo, A. T.; Stillman, C. R.; Padalino, S. J. [Physics Department, SUNY Geneseo, Geneseo, New York 14454 (United States); Fiksel, G.; Stoeckl, C.; Mileham, C.; Sangster, T. C. [Laboratory for Laser Energetics, University of Rochester, Rochester, New York 14623 (United States); Sinenian, N.; Frenje, J. A. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)
2011-07-15
A Thomson parabola ion spectrometer has been designed for use at the Multiterawatt (MTW) laser facility at the Laboratory for Laser Energetics (LLE) at University of Rochester. This device uses parallel electric and magnetic fields to deflect particles of a given mass-to-charge ratio onto parabolic curves on the detector plane. Once calibrated, the position of the ions on the detector plane can be used to determine the particle energy. The position dispersion of both the electric and magnetic fields of the Thomson parabola was measured using monoenergetic proton and alpha particle beams from the SUNY Geneseo 1.7 MV tandem Pelletron accelerator. The sensitivity of Fujifilm BAS-TR imaging plates, used as a detector in the Thomson parabola, was also measured as a function of the incident particle energy over the range from 0.6 MeV to 3.4 MeV for protons and deuterons and from 0.9 MeV to 5.4 MeV for alpha particles. The device was used to measure the energy spectrum of laser-produced protons at MTW.
International Nuclear Information System (INIS)
Drentje, A.G.; Muramatsu, M.; Kitagawa, A.
2006-01-01
With the prototype electron cyclotron resonance ion source for the next carbon therapy facility in Japan a series of measurements has been performed in order (a) to find the best condition for producing high beam currents of C 4+ ions, and (b) to study the effect of 'special' gas mixing by using a chemical compound as a feed gas. The effect would then appear as an increase in high charge state production in this case of C 5+ ions. In 'regular' gas-mixing experiments it is well known that an isotopic phenomenon occurs: a heavier isotope of the mixing gas is increasing the production of high charge states of the beam gas ions. A similar isotopic effect has been found in the present experiment: with deuterated methane (CD 4 gas) the C 5+ beam currents are about 10% higher than with regular methane (CH 4 gas). The 'mixing-gas' ratio D (or H) to C can be decreased by choosing, e.g., butane gas; in this case the isotopic effect for C 5+ production is even stronger (>15%). For production of C 4+ ions the isotopic effect appears to be absent. Clearly this is related to the much easier production. It turns out that the relative amount of carbon is much more important: butane gives about 10% higher C 4+ -ion currents than methane
Performance of a C{sub 60}{sup +} ion source on a dynamic SIMS instrument
Energy Technology Data Exchange (ETDEWEB)
Fahey, Albert J. [Surface and Microanalysis Science Division, National Institute of Standards and Technology, 100 Bureau Dr. Stop 8371, Gaithersburg, MD 20899-8371 (United States)]. E-mail: albert.fahey@nist.gov; Gillen, Greg [Surface and Microanalysis Science Division, National Institute of Standards and Technology, 100 Bureau Dr. Stop 8371, Gaithersburg, MD 20899-8371 (United States); Chi, Peter [Surface and Microanalysis Science Division, National Institute of Standards and Technology, 100 Bureau Dr. Stop 8371, Gaithersburg, MD 20899-8371 (United States); Mahoney, Christine M. [Surface and Microanalysis Science Division, National Institute of Standards and Technology, 100 Bureau Dr. Stop 8371, Gaithersburg, MD 20899-8371 (United States)
2006-07-30
An IonOptika C{sub 60}{sup +} ion source has been fitted onto a CAMECA{sup 1} ims-4f. Stable ion beams of C{sub 60}{sup +} and C{sub 60}{sup 2+} have been obtained with typical currents approaching 20nA under conditions that allow for several days of source operation. The beam has been able to be focussed into a spot size of {approx}3{mu}m with an anode voltage of 10keV and scanning ion images have been acquired. We have performed analyses to characterize the performance of C{sub 60}{sup +} and C{sub 60}{sup 2+}. Depth profiles of a Cr-Ni multi-layer and polymer films with C{sub 60}{sup +} have produced excellent results. We have discovered that, under bombardment energies of <12keV on Si, C{sub 60}{sup +} will sputter material from the sample but will also produce deposition at a rate that exceeds the sputter rate. The performance of the source and our experiences with its operation will be discussed and some characteristic analysis data will be shown.
Energy Technology Data Exchange (ETDEWEB)
Bordenave-Montesquieu, D; Bordenave-Montesquieu, A; Rentenier, A; Moretto-Capelle, P [LCAR-IRSAMC, UMR 5589 Universite Paul Sabatier-CNRS, 118 rte de Narbonne, 31062 Toulouse Cedex (France)
2005-04-14
The behaviour of the asymmetrical fission (AF) scheme (correlated ion distributions) against the collision conditions is investigated using H{sup +}{sub x} (x = 1-3) and He{sup +} projectiles in the 1-130 keV collision energy range. The present work is an extension of our recent publications on this topic using 11 keV protons (Rentenier et al 2004 J. Phys. B: At. Mol. Opt. Phys. 37 2429 and 2455). The threshold for AF is observed at 2 keV proton energy corresponding to a maximum deposited energy equal to about 41 eV. The main result concerns the fragment distributions resulting from AF of C{sup r+}{sub 60} ions, and secondary dissociation of even-n C{sup +}{sub n} fragments, which are both found to remain independent of the projectile species and collision velocity. These findings indicate that they are insensitive to the internal energy distributions of the parent ions. In addition, a contribution of binary collisions between the projectile and individual carbon atoms of the C{sub 60} molecule to AF is identified in the C{sup +}{sub 1} production at the lowest collision velocities, the so-called impulsive fragmentation.
Energy Technology Data Exchange (ETDEWEB)
Allan, J.A.F.
1976-10-28
Micro-porous insulation plates are dealt with, for example, how they are used in the insulation of heat storage devices. Since one side of such plates is exposed to a temperature of over 700/sup 0/C, a shrinkage of the glass texture of the covering can occur, which can exceed the shrinkage of the inner micro-porous material, so that cracks and splits in the high temperature side of the covering can come about. The task of the invention is to design the plate in such a way as to prevent this from happening. For this purpose the plate is provided, according to invention specifications, with flutes, waves, ribs, waffle or grid patterns and the covering is set into the recesses originating from this.
International Nuclear Information System (INIS)
Eguchi-Kasai, Kiyomi; Tsujita, Sena
2006-01-01
We studied the localization of phosphorylated H2AX (γ-H2AX) in cultured human fibroblasts after irradiation with heavy ion beams. Asynchronous human normal fibroblasts (NB1RGB) were irradiated with X-rays, C (LET≅85 keV/μm), Si (240 keV/μm), Ar (85 keV/μm), and Fe (440 keV/μm) ion beams. Gamma-H2AX was measured in irradiated cells from 0 to 24 h after irradiation using flow cytometry. The fluorescent signal of γ-H2AX increased just after irradiation of each radiation and reached maximum around 30 nun and then, decreased. At 30 min after irradiation, γ-H2AX signal increased with increasing the radiation dose for both X-rays and Fe ion. The slope of fitting line for the Fe ion was bigger than that of X-rays. Foci of γ-H2AX on cell nuclei were counted under the laser scanning confocal microscopy at 30 min after. Number of foci per nucleus was increased with increasing dose of each radiation. (author)
White Light Photorefractive Phase Zone Plates
International Nuclear Information System (INIS)
Yuan-Mei, Gao; Si-Min, Liu
2008-01-01
Incoherent white light from an incandescent source is employed to fabricate volume phase zone plates in LiNbO 3 : Fe, for the first time to our knowledge, which can guide and modulate the input white light or laser light. The diffractive efficiency of the white light volume phase zone plates fabricated can reach as high as 12%. In addition, we test the volume phase zone plates by a probe beam and find that the volume phase zone plate is present in the direction perpendicular to the c-axis and absent in the direction parallel to the c-axis. This directly proves the existence of photovoltaic photorefractive anisotropy of white light
Variable-temperature sample system for ion implantation at -192 to +5000C
International Nuclear Information System (INIS)
Fuller, C.T.
1978-04-01
A variable-temperature sample system based on exchange-gas coupling was developed for ion-implantation use. The sample temperature can be controlled from -192 0 C to +500 0 C with rapid cooling. The system also has provisions for focusing and alignment of the ion beam, electron suppression, temperature monitoring, sample current measuring, and cryo-shielding. Design considerations and operating characteristics are discussed. 5 figures
Control assembly ejection accident analysis for WWER-440 (Armenian NPP)
International Nuclear Information System (INIS)
Bznuni, S.; Malakyan, Ts.; Amirjanyan, A.; Ghasabyan, L.
2007-01-01
Control Assembly ejection in WWER-440 initiated by the loss of integrity of the Control Assemblies drive housing has been analyzed. This event causes a very rapid reactivity insertion to the core and small break LOCA which potentially could lead to rapid power increase and redistribution of heat release in the core resulting in a fuel, cladding and coolant temperature rise; primary pressure increase, radiological consequences due to loss of primary coolant and potential loss of cladding integrity and fuel disintegration (if applicable). Methodology of the analysis is based on conservative assumptions as well as on deterministic approach for selection of functioning logic of systems and equipment's to maximize reactor core power and minimize power decreasing reactivity feedback. Computational analyses were performed by 3D kinetics PARCS-RELAP coupled code. WWER-440 fuel cross-section libraries, diffusion coefficients and kinetics parameters were calculated by HELOS code. In this paper analysis of accident for Hot Full Power was presented. Results of analysis show that ANPP WWER-440 reactor design meets acceptance criteria prescribed for RIA type design based accidents (Authors)
Jeong, Tae Won; Singh, P. K.; Scullion, C.; Ahmed, H.; Kakolee, K. F.; Hadjisolomou, P.; Alejo, A.; Kar, S.; Borghesi, M.; Ter-Avetisyan, S.
2016-08-01
The absolute calibration of a microchannel plate (MCP) assembly using a Thomson spectrometer for laser-driven ion beams is described. In order to obtain the response of the whole detection system to the particles' impact, a slotted solid state nuclear track detector (CR-39) was installed in front of the MCP to record the ions simultaneously on both detectors. The response of the MCP (counts/particles) was measured for 5-58 MeV carbon ions and for protons in the energy range 2-17.3 MeV. The response of the MCP detector is non-trivial when the stopping range of particles becomes larger than the thickness of the detector. Protons with energies E ≳ 10 MeV are energetic enough that they can pass through the MCP detector. Quantitative analysis of the pits formed in CR-39 and the signal generated in the MCP allowed to determine the MCP response to particles in this energy range. Moreover, a theoretical model allows to predict the response of MCP at even higher proton energies. This suggests that in this regime the MCP response is a slowly decreasing function of energy, consistently with the decrease of the deposited energy. These calibration data will enable particle spectra to be obtained in absolute terms over a broad energy range.
Enhanced defects recombination in ion irradiated SiC
International Nuclear Information System (INIS)
Izzo, G.; Litrico, G.; Grassia, F.; Calcagno, L.; Foti, G.
2010-01-01
Point defects induced in SiC by ion irradiation show a recombination at temperatures as low as 320 K and this process is enhanced after running current density ranging from 80 to 120 A/cm 2 . Ion irradiation induces in SiC the formation of different defect levels and low-temperature annealing changes their concentration. Some levels (S 0 , S x and S 2 ) show a recombination and simultaneously a new level (S 1 ) is formed. An enhanced recombination of defects is besides observed after running current in the diode at room temperature. The carriers introduction reduces the S 2 trap concentration, while the remaining levels are not modified. The recombination is negligible up to a current density of 50 A/cm 2 and increases at higher current density. The enhanced recombination of the S 2 trap occurs at 300 K, which otherwise requires a 400 K annealing temperature. The process can be related to the electron-hole recombination at the associated defect.
Structural and optical modification in 4H-SiC following 30 keV silver ion irradiation
Kaushik, Priya Darshni; Aziz, Anver; Siddiqui, Azher M.; Lakshmi, G. B. V. S.; Syväjärvi, Mikael; Yakimova, Rositsa; Yazdi, G. Reza
2018-05-01
The market of high power, high frequency and high temperature based electronic devices is captured by SiC due to its superior properties like high thermal conductivity and high sublimation temperature and also due to the limitation of silicon based electronics in this area. There is a need to investigate effect of ion irradiation on SiC due to its application in outer space as outer space is surrounded both by low and high energy ion irradiations. In this work, effect of low energy ion irradiation on structural and optical property of 4H-SiC is investigated. ATR-FTIR is used to study structural modification and UV-Visible spectroscopy is used to study optical modifications in 4H-SiC following 30 keV Ag ion irradiation. FTIR showed decrease in bond density of SiC along the ion path (track) due to the creation of point defects. UV-Visible absorption spectra showed decrease in optical band gap from 3.26 eV to 2.9 eV. The study showed degradation of SiC crystallity and change in optical band gap following low energy ion irradiation and should be addressed while fabricationg devices based on SiC for outer space application. Additionally, this study provides a platform for introducing structural and optical modification in 4H-SiC using ion beam technology in a controlled manner.
The air oxidation behavior of lanthanum ion implanted zirconium at 500 deg. C
Peng, D Q; Chen, X W; Zhou, Q G
2003-01-01
The beneficial effect of lanthanum ion implantation on the oxidation behavior of zirconium at 500 deg. C has been studied. Zirconium specimens were implanted by lanthanum ions using a MEVVA source at energy of 40 keV with a fluence range from 1x10 sup 1 sup 6 to 1x10 sup 1 sup 7 ions/cm sup 2 at maximum temperature of 130 deg. C, The weight gain curves were measured after being oxidized in air at 500 deg. C for 100 min, which showed that a significant improvement was achieved in the oxidation behavior of zirconium ion implanted with lanthanum compared with that of the as-received zirconium. The valence of the oxides in the scale was analyzed by X-ray photoemission spectroscopy; and then the depth distributions of the elements in the surface of the samples were obtained by Auger electron spectroscopy. Glancing angle X-ray diffraction at 0.3 deg. incident angles was employed to examine the modification of its phase transformation because of the lanthanum ion implantation in the oxide films. It was obviously fou...
International Nuclear Information System (INIS)
Taguchi, T.; Wakai, E.; Igawa, N.; Nogami, S.; Snead, L.L.; Hasegawa, A.; Jitsukawa, S.
2002-01-01
The effect of simultaneous triple ion irradiation of He, H and Si on microstructural evolution of two kinds of SiC/SiC composites (HNS composite (using Hi-Nicalon type S SiC fiber) and TSA composite (using Tyranno SA SiC fiber)) at 1000 deg. C has been investigated. The microstructure observations of SiC/SiC composites irradiated to 10 dpa were examined by transmission electron microscopy. He bubbles were hardly formed in matrix of TSA composite, but many helium bubbles and some cracks were observed at grain boundaries of matrix of HNS composite. He bubbles and cracks were not, on the other hand, observed in the both fiber fabrics of HNS and TSA composites. Debonding between fiber and carbon layer following irradiation region was not observed in the both composites. Under these irradiation conditions, TSA composite showed the better microstructural stability against ion beams irradiation than one of HNS composite
Plate impact experiments on DC745U cooled to ~ -60 °C
Energy Technology Data Exchange (ETDEWEB)
Gustavsen, Richard L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Dattelbaum, Dana M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Bartram, Brian Douglas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Gibson, Lloyd Lee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Jones, Justin Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Goodbody, Austin Bernard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics
2016-08-11
Using gas-gun driven plate impact experiments, we have measured the US - up Hugoniot of the silicone elastomer DC745U cooled to -60 °C. In summary, the initial density changes from p0 (23°C) = 1.312 ± 0.010 g/cm3 to p0 (-60°C) = 1.447 ± 0.011 g/cm3. The linear US - up Hugoniot changes from US = 1.62 + 1.74up km/s at +23°C, to US = 2.03 ± 0.06 + (2.03 ± 0.06) up km/s at -60°C. DC745U, therefore is much stiffer at -60°C than at +23°C, probably due to the crystallization that occurs at ~ -50°C. Caveats/deficiencies: 1) This report does not provide an adequate pedigree of the DC745U used. 2) References to unpublished room temperature shock compression data on the elastomer are inadequate. 3) The report has not been fact checked by a DC745 subject matter expert.
Iida, Tsutomu; Makita, Yunosuke; Kimura, Shinji; Winter, Stefan; Yamada, Akimasa; Fons, Paul; Uekusa, Shin-ichiro
1995-01-01
A combined ion-beam and molecular-beam-epitaxy (CIBMBE) system has been developed. This system consists of an ion implanter capable of producing ions in the energy range of 30 eV-30 keV and conventional solid-source MBE. As a successful application of CIBMBE, low-energy (100 eV) carbon ion (C+) irradiation during MBE growth of GaAs was carried out at substrate temperatures Tg between 500 and 590 °C. C+-doped layers were characterized by low-temperature (2 K) photoluminescence (PL), Raman scattering, and van der Pauw measurements. PL spectra of undoped GaAs grown by CIBMBE revealed that unintentional impurity incorporation into the epilayer is extremely small and precise doping effects are observable. CAs acceptor-related emissions such as ``g,'' [g-g], and [g-g]β are observed and their spectra are significantly changed with increasing C+ beam current density Ic. PL measurements showed that C atoms were efficiently incorporated during MBE growth by CIBMBE and were optically well activated as an acceptor in the as-grown condition even for Tg as low as 500 °C. Raman measurement showed negligible lattice damage of the epilayer bombarded with 100 eV C+ with no subsequent heat treatment. These results indicate that contamination- and damage-free impurity doping without postgrowth annealing can be achieved by the CIBMBE method.
Preliminary Ionization Efficiencies of 11C and 14O with the LBNL ECR Ion Sources
International Nuclear Information System (INIS)
Xie, Z.Q.; Cerny, J.; Guo, F.Q.; Joosten, R.; Larimer, R.M.; Lyneis, C.M.; McMahan, P.; Norman, E.B.; O'Neil, J.P.; Powell, J.; Rowe, M.W.; VanBrocklin, H.F.; Wutte, D.; Xu, X.J.; Haustein, P.
1998-01-01
High charge states, up to fully stripped 11 C and 14 O ion, beams have been produced with the electron cyclotron resonance ion sources (LBNL, ECR and AECR-U) at Lawrence Berkeley National Laboratory. The radioactive atoms of 11 C and 14 O were collected in batch mode with an LN 2 trap and then bled into the ECR ion sources. Ionization efficiency as high as 11% for 11 C 4+ was achieved
Heavy ion irradiation induces autophagy in irradiated C2C12 myoblasts and their bystander cells
International Nuclear Information System (INIS)
Hino, Mizuki; Tajika, Yuki; Hamada, Nobuyuki
2010-01-01
Autophagy is one of the major processes involved in the degradation of intracellular materials. Here, we examined the potential impact of heavy ion irradiation on the induction of autophagy in irradiated C2C12 mouse myoblasts and their non-targeted bystander cells. In irradiated cells, ultrastructural analysis revealed the accumulation of autophagic structures at various stages of autophagy (id est (i.e.) phagophores, autophagosomes and autolysosomes) within 20 min after irradiation. Multivesicular bodies (MVBs) and autolysosomes containing MVBs (amphisomes) were also observed. Heavy ion irradiation increased the staining of microtubule-associated protein 1 light chain 3 and LysoTracker Red (LTR). Such enhanced staining was suppressed by an autophagy inhibitor 3-methyladenine. In addition to irradiated cells, bystander cells were also positive with LTR staining. Altogether, these results suggest that heavy ion irradiation induces autophagy not only in irradiated myoblasts but also in their bystander cells. (author)
Power peak in vicinity of WWER-440 control rod at end of fuel cycle
International Nuclear Information System (INIS)
Mikus, J.
2003-01-01
This paper presents some results of the axial power distribution measurements carried out in a WWER-440 type core on the light-water, zero-power reactor LR-O in the vicinity of the WWER-440 control rod model at zero boron concentration in moderator. Further presented information concern the description of the control rod model, LR-0 core arrangement, specification of the fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available 'power peaking database' to enable the calculation codes validation also by means of data that correspond to the end of WWER-440 fuel cycle (Authors)
DEFF Research Database (Denmark)
Brorson, Stig; Rasmussen, Jeppe Vejlgaard; Frich, Lars Henrik
2012-01-01
stable plates in AO/OTA Type C fractures of the proximal humerus. METHODS: We conducted an iterative search in PubMed, Embase, Cochrane Library, Web of Science, Cinahl, and PEDro in all languages from 1999 to November 2010. Eligible studies should study the outcome for Type C fractures after primary...... according to study type and synthesised qualitatively. No randomised clinical trials were identified. Two comparative, observational studies reported a mean CS of 71 (relative to contralateral shoulder) and 75 (non-adjusted Constant Score) for Type C fractures. For all studies mean non-adjusted CS ranged......INTRODUCTION: Locking plate osteosynthesis of proximal humeral fractures are widely recommended and used, even in complex intraarticular fracture patterns such as AO/OTA Type C fractures. We systematically reviewed clinical studies assessing the benefits and harms of osteosynthesis with angle...
Highly conductive composites for fuel cell flow field plates and bipolar plates
Jang, Bor Z; Zhamu, Aruna; Song, Lulu
2014-10-21
This invention provides a fuel cell flow field plate or bipolar plate having flow channels on faces of the plate, comprising an electrically conductive polymer composite. The composite is composed of (A) at least 50% by weight of a conductive filler, comprising at least 5% by weight reinforcement fibers, expanded graphite platelets, graphitic nano-fibers, and/or carbon nano-tubes; (B) polymer matrix material at 1 to 49.9% by weight; and (C) a polymer binder at 0.1 to 10% by weight; wherein the sum of the conductive filler weight %, polymer matrix weight % and polymer binder weight % equals 100% and the bulk electrical conductivity of the flow field or bipolar plate is at least 100 S/cm. The invention also provides a continuous process for cost-effective mass production of the conductive composite-based flow field or bipolar plate.
Ion beam alignment in the MSX-4 mass spectrometer
International Nuclear Information System (INIS)
Busygin, A.I.; Nevzorov, A.A.; Ul'masbaev, B.Sh.
1977-01-01
A method for electrically adjusting an ion beam in an MSKh-4 mass-spectrometer has been developed. The adjusting system consists of two deflecting plates fastened to the frame of the ion source. By adjusting the potential difference at the plates in the range 0-150 v, one can increase the intensity of the mass-spectrum by a factor of 3 to 5
Residual stress measurement of electron beam welded copper plates using prism hole drilling method
International Nuclear Information System (INIS)
Laakkonen, M.
2013-12-01
Eleven electron beam (EB) welded copper plates were measured in this investigation with Prism hole drilling equipment made by Stresstech Oy. All samples contained a linear weld in their center. Two different sets of plates were measured in this investigation. The first set included five samples (X436, X437, X438, X439 and X440) which were welded using four different welding speeds. Samples X439 and X440 were welded with the same speed but X440 is the only sample of the set that received a cosmetic pass. The second set received heat treatments at four different temperatures. Samples X456 and X458 were annealed at the same temperature but sample X456 received a cosmetic pass while X458 did not. Samples X455 and X457 were both annealed at a different temperature, with (X455) or without (X457) the cosmetic pass. Two areas were machined from the samples. About five millimeters was machined from the surfaces on the both of areas. Machined surfaces located on the top surfaces. The measurement points on the top surface are located on the weld and 20 mm and 120 mm from the weld on machined areas. Lower surface measurements are located -20 mm, 20 mm and 120 mm from the weld. All measurements were about 122 mm from the edges perpendicular to the weld. The top surfaces of all samples were machined in two areas across the weld. About 5 mm were removed. Stress measurements on the top surfaces were performed in these two areas, on the weld and 20 mm and 120 mm away from the weld. Stresses were also measured on the back sides, at -20 mm, 20 mm and 120 mm distance from the weld. All measurement locations were about 122mm from the sample edges. Most of the measurements give tensile strengths from 0 MPa to 30 MPa. Stresses parallel to the weld were slightly higher than weld stresses in transverse direction. The machined surfaces have residual stress values above 30 MPa near the surface. (orig.)
Residual stress measurement of electron beam welded copper plates using prism hole drilling method
Energy Technology Data Exchange (ETDEWEB)
Laakkonen, M. [Stresstech Oy, Jyvaeskylae (Finland)
2013-12-15
Eleven electron beam (EB) welded copper plates were measured in this investigation with Prism hole drilling equipment made by Stresstech Oy. All samples contained a linear weld in their center. Two different sets of plates were measured in this investigation. The first set included five samples (X436, X437, X438, X439 and X440) which were welded using four different welding speeds. Samples X439 and X440 were welded with the same speed but X440 is the only sample of the set that received a cosmetic pass. The second set received heat treatments at four different temperatures. Samples X456 and X458 were annealed at the same temperature but sample X456 received a cosmetic pass while X458 did not. Samples X455 and X457 were both annealed at a different temperature, with (X455) or without (X457) the cosmetic pass. Two areas were machined from the samples. About five millimeters was machined from the surfaces on the both of areas. Machined surfaces located on the top surfaces. The measurement points on the top surface are located on the weld and 20 mm and 120 mm from the weld on machined areas. Lower surface measurements are located -20 mm, 20 mm and 120 mm from the weld. All measurements were about 122 mm from the edges perpendicular to the weld. The top surfaces of all samples were machined in two areas across the weld. About 5 mm were removed. Stress measurements on the top surfaces were performed in these two areas, on the weld and 20 mm and 120 mm away from the weld. Stresses were also measured on the back sides, at -20 mm, 20 mm and 120 mm distance from the weld. All measurement locations were about 122mm from the sample edges. Most of the measurements give tensile strengths from 0 MPa to 30 MPa. Stresses parallel to the weld were slightly higher than weld stresses in transverse direction. The machined surfaces have residual stress values above 30 MPa near the surface. (orig.)
100 MeV Ag{sup 7+} ion induced physicochemical changes in isotactic polypropylene
Energy Technology Data Exchange (ETDEWEB)
Mathakari, N.L. [Microtron Accelerator Laboratory, Department of Physics, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Kanjilal, D. [Inter University Accelerator Center, New Delhi (India); Bhoraskar, V.N. [Microtron Accelerator Laboratory, Department of Physics, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Dhole, S.D. [Microtron Accelerator Laboratory, Department of Physics, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)], E-mail: sanjay@physics.unipune.ernet.in
2008-04-15
Thin films of isotactic polypropylene having 500 {mu}m thickness were irradiated with 100 MeV Ag{sup 7+} ions at the fluences varying from 10{sup 11} to 5 x 10{sup 12} ions/cm{sup 2}. The properties such as chemical, optical, structural and surface morphology were characterized by techniques namely FTIR, UV-visible, photoluminescence, XRD, SEM and contact angle method. The FTIR spectra show the scissioning of C-H and C-C bonds, whereas, in photoluminescence, the intensities of the peaks at 440 and 480 nm in emission spectra and at 236 nm in excitation spectra observed to be decreased with increase in ion fluence. This may be due to the decomposition of luminescent centers. The UV-visible spectra also show a remarkable red shift from 218 to 367 nm and the subsequent large reduction in the optical band gap from 5.37 to 3.39 eV. This attributes to the carbonization or graphitization of polypropylene. On the contrary, the intensities of XRD peaks, particularly the peak due to 1 1 0 planes, shows sufficient enhancement which signifies overall increase in crystallinity. This ascribes to relief in the local strain on the crystallites due to scissioning of tie molecules in the amorphous zones. The contact angle has increased from 78 deg. to 97 deg. which reveals the absence of hydrophilic functional groups, carbonization and surface roughening. The result is also supported by SEM analysis.
Fully-kinetic Ion Simulation of Global Electrostatic Turbulent Transport in C-2U
Fulton, Daniel; Lau, Calvin; Bao, Jian; Lin, Zhihong; Tajima, Toshiki; TAE Team
2017-10-01
Understanding the nature of particle and energy transport in field-reversed configuration (FRC) plasmas is a crucial step towards an FRC-based fusion reactor. The C-2U device at Tri Alpha Energy (TAE) achieved macroscopically stable plasmas and electron energy confinement time which scaled favorably with electron temperature. This success led to experimental and theoretical investigation of turbulence in C-2U, including gyrokinetic ion simulations with the Gyrokinetic Toroidal Code (GTC). A primary objective of TAE's new C-2W device is to explore transport scaling in an extended parameter regime. In concert with the C-2W experimental campaign, numerical efforts have also been extended in A New Code (ANC) to use fully-kinetic (FK) ions and a Vlasov-Poisson field solver. Global FK ion simulations are presented. Future code development is also discussed.
Simulator of nuclear power plant with WWER-440 units
International Nuclear Information System (INIS)
Krcek, V.
1985-01-01
The use is discussed of simulators in the training of qualified personnel for the construction and operation of nuclear power plants. Simulators are used for training all activities and thinking processes related to the control of a nuclear reactor in the course of quasi-steady and non-steady states. The development and implementation is summed up of the construction of such a simulator for WWER-440 nuclear power plants. The main parts of the simulator include the unit control room, the computer system, the teacher's workplace and the interface system. The possibility of simulating the functions of the unit for personnel training is based on the description of the behaviour of the simulated object in form of mathematical models of its basic technological subsystems and their interrelations within the range of operating patterns. (J.C.)
One-dimensional position readout from microchannel plates
International Nuclear Information System (INIS)
Connell, K.A.; Przybylski, M.M.
1982-01-01
The development of a one-dimensional position readout system with microchannel plates, is described, for heavy ion detectors for use in a particle time-of-flight telescope and as a position sensitive device in front of an ionisation counter at the Nuclear Structure Facility. (U.K.)
Ettringite and C-S-H Portland cement phases for waste ion immobilization: A review
International Nuclear Information System (INIS)
Gougar, M.L.D.; Scheetz, B.E.; Roy, D.M.
1996-01-01
The formation, structure and chemistry of the ettringite and C-S-H phases of Portland cement have been reviewed as they relate to waste ion immobilization. The purpose of this review was to investigate the use of Portland cement as a host for priority metallic pollutants as identified by the Environmental Protection Agency and as a host for radioactive waste ions as identified in 40 CFR 191. Ettringite acts as host to a number of these ions in both the columnar and channel sections of the crystal structure. Substitutions have been made at the calcium, aluminum, hydroxide and sulfate sites. C-S-H also hosts a number of the waste species in both ionic and salt form. Immobilization mechanisms for C-S-H include sorption, phase mixing and substitution. The following ions have not apparently been reported as specifically immobilized by one of these phases: Ag, Am, Np, Pu, Ra, Tc, Th and Sn; however, some of these ions are immobilized by Portland cement
Calculation of spatial weight functions for WWER-440 ex-core neutron detectors
International Nuclear Information System (INIS)
Csom, Gy.; Czifrus, Sz.; Feher, S.; Berki, T.
2001-01-01
The objective of the work presented in this paper was determination of a spatial weight function for WWER-440 ex-core detectors to be used for the interpretation of reload startup rod drop measurements. In view of the complexity of the geometry of the core as well as the detector, furthermore the presence of a cavity between the vessel and the concrete shield, Monte Carlo calculations were applied. In spite of the fact that in the corresponding literature the use of adjoint methods dominates, in the present case the forward method was chosen and implemented using MCNP4C (Authors)
Energy Technology Data Exchange (ETDEWEB)
Dogan, O.N.; Hawk, J.A.; Schrems, K.K.
2006-06-01
A new class of materials, namely TiC-reinforced cast chromium (Cr) steels, was developed for applications requiring high abrasion resistance and good fracture toughness. The research approach was to modify the carbide structure of commercial AISI 440C steel for better fracture resistance while maintaining the already high abrasion resistance. The new alloys contained 12Cr, 2.5–4.5Ti, and 1–1.5C (wt.%) and were melted in a vacuum induction furnace. Their microstructure was composed primarily of a martensitic matrix with a dispersion of TiC precipitates. Modification of TiC morphology was accomplished through changing the cooling rate during solidification. Wear rates of the TiC-reinforced Cr steels were comparable to that of AISI 440C steel, but the impact resistance was much improved.
Doğan, Ö. N.; Hawk, J. A.; Schrems, K. K.
2006-06-01
A new class of materials, namely TiC-reinforced cast chromium (Cr) steels, was developed for applications requiring high abrasion resistance and good fracture toughness. The research approach was to modify the carbide structure of commercial AISI 440C steel for better fracture resistance while maintaining the already high abrasion resistance. The new alloys contained 12Cr, 2.5-4.5Ti, and 1-1.5C (wt.%) and were melted in a vacuum induction furnace. Their microstructure was composed primarily of a martensitic matrix with a dispersion of TiC precipitates. Modification of TiC morphology was accomplished through changing the cooling rate during solidification. Wear rates of the TiC-reinforced Cr steels were comparable to that of AISI 440C steel, but the impact resistance was much improved.
Mutation effects of C2+ ion irradiation on the greasy Nitzschia sp
International Nuclear Information System (INIS)
Yang, Y.N.; Liu, C.L.; Wang, Y.K.; Xue, J.M.
2013-01-01
Highlights: • The optimal conditions of C 2+ ion irradiation on Nitzschia sp. were discussed. • Get the “saddle type” survival curve. • One mutant whose lipid content improved significantly was selected. • The C 2+ ion irradiation didn’t change the algae's morphology and growth rate. - Abstract: Screening and nurturing algae with high productivity, high lipid content and strong stress resistance are very important in algae industry. In order to increase the lipid content, the Nitzschia sp. was irradiated with a 3 MeV C 2+ beam. The sample pretreatment method was optimized to obtain the best mutagenic condition and the survival ratio curve. The positive mutants with a significant improvement in lipid content were screened and their C 2+ mutagenic effects were analyzed by comparing the greasiness and growth characteristics with the wild type algae. Results showed that when the Nitzschia sp. was cultivated in nutritious medium containing 10% glycerol solution, and dried on the filter for 5 min after centrifugation, the realization of the microalgae heavy ion mutagenesis could be done. The survival ratio curve caused by C 2+ irradiation was proved to be “saddle-shaped”. A positive mutant was screened among 20 survivals after irradiation, the average lipid content of the mutation increased by 9.8% than the wild type after 4 generations. But the growth rate of the screened mutation didn’t change after the heavy ion implantation compared to the wild type algae
International Nuclear Information System (INIS)
Pasquale, M.A.; Gassa, L.M.; Arvia, A.J.
2008-01-01
Copper electrodeposition on copper from still plating solutions of different compositions was investigated utilising electrochemical impedance spectroscopy (EIS), cyclic voltammetry, and scanning electron microscopy (SEM). An acid copper sulphate plating base solution was employed either with or without sodium chloride in the presence of a single additive, either polyethylene glycol (PEG) or 3-mercapto-2-propanesulphonic acid (MPSA), and their mixture. Thallium underpotential deposition/anodic stripping was employed to determine the adsorption capability of additives on copper. In the absence of chloride ions, MPSA shows a moderate adsorption on copper, whereas PEG is slightly adsorbed. At low cathodic overpotentials, the simultaneous presence of MPSA and chloride ions accelerates copper electrodeposition through the formation of an MPSA-chloride ion complex in the solution, particularly for about 220 μM sodium chloride. The reverse effect occurs in PEG-sodium chloride plating solutions. In this case, from EIS data the formation of a film that interferes with copper electrodeposition can be inferred. At higher cathodic overpotentials, when copper electrodeposition is under mass transport control, the cathode coverage by a PEG-copper chloride-mediated film becomes either partially or completely detached as the concentration of chloride ions at the negatively charged copper surface diminishes. The copper cathode grain topography at the μm scale depends on the cathodic overpotential, plating solution composition and average current density. Available data about the solution constituents and their adsorption on copper make it possible to propose a likely complex mechanism to understand copper electrodeposition from these media, including the accelerating effect of MPSA and the dynamics of PEG-copper chloride complex adsorbate interfering with the surface mobility of depositing copper ad-ions/ad-atoms
Investigation of station blackout scenario in VVER440/v230 with RELAP5 computer code
Energy Technology Data Exchange (ETDEWEB)
Gencheva, Rositsa Veselinova, E-mail: roseh@mail.bg; Stefanova, Antoaneta Emilova, E-mail: antoanet@inrne.bas.bg; Groudev, Pavlin Petkov, E-mail: pavlinpg@inrne.bas.bg
2015-12-15
Highlights: • We have modeled SBO in VVER440. • RELAP5/MOD3 computer code has been used. • Base case calculation has been done. • Fail case calculation has been done. • Operator and alternative operator actions have been investigated. - Abstract: During the development of symptom-based emergency operating procedures (SB-EOPs) for VVER440/v230 units at Kozloduy Nuclear Power Plant (NPP) a number of analyses have been performed using the RELAP5/MOD3 (Carlson et al., 1990). Some of them investigate the response of VVER440/v230 during the station blackout (SBO). The main purpose of the analyses presented in this paper is to identify the behavior of important VVER440 parameters in case of total station blackout. The RELAP5/MOD3 has been used to simulate the SBO in VVER440 NPP model (Fletcher and Schultz, 1995). This model was developed at the Institute for Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences (INRNE-BAS), Sofia, for analyses of operational occurrences, abnormal events and design based scenarios. The model provides a significant analytical capability for specialists working in the field of NPP safety.
40 CFR 440.24 - New Source performance standards (NSPS).
2010-07-01
... GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Aluminum Ore Subcategory § 440.24 New... pollutants discharged in mine drainage from mines producting bauxite ores shall not exceed: Effluent...
DEFF Research Database (Denmark)
Simonsen, Bo Cerup
1998-01-01
The present paper is concerned with steady-state plate tearing by a cone. This is a scenario where a cone is forced through a ductile metal plate with a constant lateral tip penetration in a motion in the plane of the plate. The considered process could be an idealisation of the damage, which...... as for the out-of-plane reaction force. (C) 1998 Elsevier Science Ltd. All rights reserved....
Energy Technology Data Exchange (ETDEWEB)
Ayedh, H. M.; Svensson, B. G. [University of Oslo, Department of Physics/Center for Materials Science and Nanotechnology, P.O. Box 1048 Blindern, N-0316 Oslo (Norway); Hallén, A. [School of Information and Communication Technology (ICT), Royal Institute of Technology, SE-164 40 Kista-Stockholm (Sweden)
2015-11-07
The carbon vacancy (V{sub C}) is a prevailing point defect in high-purity 4H-SiC epitaxial layers, and it plays a decisive role in controlling the charge carrier lifetime. One concept of reducing the V{sub C}-concentration is based on carbon self-ion implantation in a near surface layer followed by thermal annealing. This leads to injection of carbon interstitials (C{sub i}'s) and annihilation of V{sub C}'s in the epi-layer “bulk”. Here, we show that the excess of C atoms introduced by the self-ion implantation plays a negligible role in the V{sub C} annihilation. Actually, employing normalized implantation conditions with respect to displaced C atoms, other heavier ions like Al and Si are found to be more efficient in annihilating V{sub C}'s. Concentrations of V{sub C} below ∼2 × 10{sup 11} cm{sup −3} can be reached already after annealing at 1400 °C, as monitored by deep-level transient spectroscopy. This corresponds to a reduction in the V{sub C}-concentration by about a factor of 40 relative to the as-grown state of the epi-layers studied. The negligible role of the implanted species itself can be understood from simulation results showing that the concentration of displaced C atoms exceeds the concentration of implanted species by two to three orders of magnitude. The higher efficiency for Al and Si ions is attributed to the generation of collision cascades with a sufficiently high energy density to promote C{sub i}-clustering and reduce dynamic defect annealing. These C{sub i}-related clusters will subsequently dissolve during the post-implant annealing giving rise to enhanced C{sub i} injection. However, at annealing temperatures above 1500 °C, thermodynamic equilibrium conditions start to apply for the V{sub C}-concentration, which limit the net effect of the C{sub i} injection, and a competition between the two processes occurs.
International Nuclear Information System (INIS)
Zolnai, Z.; Ster, A.; Khanh, N. Q.; Battistig, G.; Lohner, T.; Gyulai, J.; Kotai, E.; Posselt, M.
2007-01-01
The influence of crystallographic orientation and ion fluence on the shape of damage distributions induced by 500 keV N + implantation at room temperature into 6H-SiC is investigated. The irradiation was performed at different tilt angles between 0 degree sign and 4 degree sign with respect to the crystallographic axis in order to consider the whole range of beam alignment from channeling to random conditions. The applied implantation fluence range was 2.5x10 14 -3x10 15 cm -2 . A special analytical method, 3.55 MeV 4 He + ion backscattering analysis in combination with channeling technique (BS/C), was employed to measure the disorder accumulation simultaneously in the Si and C sublattices of SiC with good depth resolution. For correct energy to depth conversion in the BS/C spectra, the average electronic energy loss per analyzing He ion for the axial channeling direction was determined. It was found that the tilt angle of nitrogen implantation has strong influence on the shape of the induced disorder profiles. Significantly lower disorder was found for channeling than for random irradiation. Computer simulation of the measured BS/C spectra showed the presence of a simple defect structure in weakly damaged samples and suggested the formation of a complex disorder state for higher disorder levels. Full-cascade atomistic computer simulation of the ion implantation process was performed to explain the differences in disorder accumulation on the Si and C sublattices. The damage buildup mechanism was interpreted with the direct-impact, defect-stimulated amorphization model in order to understand damage formation and to describe the composition of structural disorder versus the ion fluence and the implantation tilt angle
Directory of Open Access Journals (Sweden)
Do Ngoc Hieu
2017-06-01
Full Text Available An optimization process of electroless plating of nickel was carried out with NiCl2 as the nickel ion source, NaH2PO2 as the reduction agent, CH3COONa and Na3C6H5O7 as complexing agents. Electroless plated nickel layers on sputtered aluminum corning glass substrates with a resistivity of about 75.9 μΩ cm and a nickel concentration higher than 93% were obtained. This optimum process was successfully applied in growing nickel micropillars at selected areas with a well-controlled height. The microstructure of the masking layers was fabricated by means of optical photolithography for subsequent growth of nickel micropillars on selected areas. Micropillars size was defined by the opening size and the height was controlled by adjusting the plating time at a growth rate of 0.41 μm/min. This result shows that electroless nickel plating could be a good candidate for growing micropillars for applications in microbolometers.
Direct ToF-SIMS analysis of organic halides and amines on TLC plates
Energy Technology Data Exchange (ETDEWEB)
Parent, Alexander A. [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States); Anderson, Thomas M. [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States); Michaelis, David J. [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States); Jiang, Guilin [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States); Savage, Paul B. [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States); Linford, Matthew R. [Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602 (United States)]. E-mail: mrlinford@chem.byu.edu
2006-07-30
It has been reported that: 'direct analysis of thin layer chromatography (TLC) plates with secondary ion mass spectrometry (SIMS) yields no satisfactory results' (J. Chromatogr. A 1084 (2005) 113-118). While this statement appears to be true in general, we have identified two important classes of compounds, organic halides and amines, that appear to yield to such direct analyses. For example, five organic halides with diverse structures were eluted on normal phase TLC plates. In all cases the halide signals in the negative ion time-of-flight secondary ion mass spectrometry (ToF-SIMS) spectra were notably stronger than the background signals. Similarly, a series of five organic amines with diverse structures were directly analyzed by positive ion ToF-SIMS. In all but one of the spectra characteristic, and sometimes even quasi-molecular ions, were observed. Most likely, the good halide ion yields are largely a function of the electronegativity of the halogens. We also propose that direct analysis of amines on normal phase silica gel is facilitated by the acidity, i.e., proton donation, of surface silanol groups.
Direct ToF-SIMS analysis of organic halides and amines on TLC plates
International Nuclear Information System (INIS)
Parent, Alexander A.; Anderson, Thomas M.; Michaelis, David J.; Jiang, Guilin; Savage, Paul B.; Linford, Matthew R.
2006-01-01
It has been reported that: 'direct analysis of thin layer chromatography (TLC) plates with secondary ion mass spectrometry (SIMS) yields no satisfactory results' (J. Chromatogr. A 1084 (2005) 113-118). While this statement appears to be true in general, we have identified two important classes of compounds, organic halides and amines, that appear to yield to such direct analyses. For example, five organic halides with diverse structures were eluted on normal phase TLC plates. In all cases the halide signals in the negative ion time-of-flight secondary ion mass spectrometry (ToF-SIMS) spectra were notably stronger than the background signals. Similarly, a series of five organic amines with diverse structures were directly analyzed by positive ion ToF-SIMS. In all but one of the spectra characteristic, and sometimes even quasi-molecular ions, were observed. Most likely, the good halide ion yields are largely a function of the electronegativity of the halogens. We also propose that direct analysis of amines on normal phase silica gel is facilitated by the acidity, i.e., proton donation, of surface silanol groups
International Nuclear Information System (INIS)
Wang Qimin; Kim, Kwang Ho
2008-01-01
Chromium nitride (CrN) films were deposited on Si wafers by arc ion plating (AIP) at various negative bias voltages and several groups of N 2 /Ar gas flux ratios and chamber gas pressures. The authors systematically investigated the influence of negative bias voltage on the synthesis, composition, microstructure, and properties of the AIP CrN films. In this part (Part I), the investigations were mainly focused on the macroparticle distributions and film-growth characteristics. The results showed that macroparticle densities on the film surfaces decreased greatly by applying negative bias voltage, which can be affected by partial pressure of N 2 and Ar gases. From the statistical analysis of the experimental results, they proposed a new hybrid mechanism of ion bombardment and electrical repulsion. Also, the growth of the AIP CrN films was greatly altered by applying negative bias voltage. By increasing the bias voltage, the film surfaces became much smoother and the films evolved from apparent columnar microstructures to an equiaxed microstructure. The impinging high-energy Cr ions accelerated by negative bias voltages were deemed the inherent reason for the evolution of growth characteristics
Modified Thomson spectrometer design for high energy, multi-species ion sources
International Nuclear Information System (INIS)
Gwynne, D.; Kar, S.; Doria, D.; Ahmed, H.; Hanton, F.; Cerchez, M.; Swantusch, M.; Willi, O.; Fernandez, J.; Gray, R. J.; MacLellan, D. A.; McKenna, P.; Green, J. S.; Neely, D.; Najmudin, Z.; Streeter, M.; Ruiz, J. A.; Schiavi, A.; Zepf, M.; Borghesi, M.
2014-01-01
A modification to the standard Thomson parabola spectrometer is discussed, which is designed to measure high energy (tens of MeV/nucleon), broad bandwidth spectra of multi-species ions accelerated by intense laser plasma interactions. It is proposed to implement a pair of extended, trapezoidal shaped electric plates, which will not only resolve ion traces at high energies, but will also retain the lower energy part of the spectrum. While a longer (along the axis of the undeflected ion beam direction) electric plate design provides effective charge state separation at the high energy end of the spectrum, the proposed new trapezoidal shape will enable the low energy ions to reach the detector, which would have been clipped or blocked by simply extending the rectangular plates to enhance the electrostatic deflection
Effects of C+ ion implantation on electrical properties of NiSiGe/SiGe contacts
International Nuclear Information System (INIS)
Zhang, B.; Yu, W.; Zhao, Q.T.; Buca, D.; Breuer, U.; Hartmann, J.-M.; Holländer, B.; Mantl, S.; Zhang, M.; Wang, X.
2013-01-01
We have investigated the morphology and electrical properties of NiSiGe/SiGe contact by C + ions pre-implanted into relaxed Si 0.8 Ge 0.2 layers. Cross-section transmission electron microscopy revealed that both the surface and interface of NiSiGe were improved by C + ions implantation. In addition, the effective hole Schottky barrier heights (Φ Bp ) of NiSiGe/SiGe were extracted. Φ Bp was observed to decrease substantially with an increase in C + ion implantation dose
Plasma-laser ion discrimination by TOF technique applied to coupled SiC detectors.
Cavallaro, Salvatore
2018-01-01
The rate estimation of nuclear reactions induced in high intensity laser-target interaction (≥1016 W/cm2), is strongly depending on the neutron detection efficiency and ion charge discrimination, according to particles involved in exit open-channels. Ion discrimination is basically performed by means of analysis of pits observed on track detector, which is critically dependent on calibration and/or fast TOF devices based on SiC and diamond detectors. Last setup is used to determine the ion energy and to obtain a rough estimation of yields. However, for each TOF interval, the dependence of yield from the energy deposited in the detector sensitive region, introduces a distortion in the ion spectra. Moreover, if two ion species are present in the same spectrum, the discrimination of their contribution is not attainable. In this paper a new method is described which allows to discriminate the contribution of two ion species in the wide energy range of nuclear reactions induced in laser-target interactions. The method is based on charge response of two TOF-SiC detectors, of suitable thicknesses, placed in adjacent positions. In presence of two ion species, the response of the detectors, associated with different energy losses, can determine the ion specific contribution to each TOF interval.
Investigation of vertebral ''end plate sclerosis''
International Nuclear Information System (INIS)
Lee, S.W.; Mathie, A.G.; Jackson, J.E.; Hughes, S.P.F.
2001-01-01
To evaluate the association between vertebral ''end plate sclerosis'' and neck pain. A retrospective study was carried out of lateral cervical spine radiographs with a Picture Archive and Communication System (PACS). Two hundred patients' files were randomly assessed, comprising four equal groups, A to D. The mean ages of the patients were 62±7.4 years, 61±7.5 years, 40±5.6 years and 23±5.6 years respectively. In group A, all patients had symptoms of neck pain and a radiographic diagnosis of ''end plate sclerosis'' of the cervical spine. In groups B to D, asymptomatic patients were recruited and their age groups were 50-69, 30-49 and 10-29 years respectively. Using the PACS, the radiographic density and the sagittal diameter, thickness and area of the end plates at the C5 level were measured. Results and conclusions: No significant differences were found in the radiographic density of the end plates either between the symptomatic and asymptomatic groups (groups A and B), or between different age groups (groups B, C and D). A significant increase in end plate area and thickness was found, however, in both group B (P<0.005) and group C (P<0.01) in comparison with group D. This indicates that the extent of end plate sclerosis increases with age. Our results suggest that the radiographic density of cervical vertebral end plates correlates neither with neck pain nor with increasing age. The radiological sign of ''end plate sclerosis'' may be over-reported, further limiting its value in the assessment of patients with cervical spondylosis. (orig.)
Study of the electric field inside microchannel plate multipliers
International Nuclear Information System (INIS)
Gatti, E.; Oba, K.; Rehak, P.
1982-01-01
Electric field inside high gain microchannel plate multipliers was studied. The calculations were based directly on the solution of the Maxwell equations applied to the microchannel plate (MCP) rather than on the conventional lumped RC model. The results are important to explain the performance of MCP's, (1) under a pulsed bias tension and, (2) at high rate conditions. The results were tested experimentally and a new method of MCP operation free from the positive ion feedback was demonstrated
Directory of Open Access Journals (Sweden)
Ch.Ram Reddy
2017-12-01
Full Text Available This paper analyzes the heat and mass transfer characteristics on mixed convective fully developed flow in an electrically conducting Newtonian fluid between vertical parallel plates. The chemical reaction, heat generation, Hall and ion-slip effects are taken into consideration. By using similarity transformations the nonlinear governing equations are reduced into dimensionless form and hence solved using Adomian decomposition method (ADM. The influence of magnetic parameter, Hall parameter, ion-slip parameter, chemical reaction parameter, and heat generation/absorption parameter on non-dimensional velocities, temperature and concentration profiles are exhibited graphically. In addition, the numerical data for skin friction, heat and mass transfer rates are shown in tabular form.
International Nuclear Information System (INIS)
Jeong, Tae Won; Ter-Avetisyan, S.; Singh, P. K.; Kakolee, K. F.; Scullion, C.; Ahmed, H.; Hadjisolomou, P.; Alejo, A.; Kar, S.; Borghesi, M.
2016-01-01
The absolute calibration of a microchannel plate (MCP) assembly using a Thomson spectrometer for laser-driven ion beams is described. In order to obtain the response of the whole detection system to the particles’ impact, a slotted solid state nuclear track detector (CR-39) was installed in front of the MCP to record the ions simultaneously on both detectors. The response of the MCP (counts/particles) was measured for 5–58 MeV carbon ions and for protons in the energy range 2–17.3 MeV. The response of the MCP detector is non-trivial when the stopping range of particles becomes larger than the thickness of the detector. Protons with energies E ≳ 10 MeV are energetic enough that they can pass through the MCP detector. Quantitative analysis of the pits formed in CR-39 and the signal generated in the MCP allowed to determine the MCP response to particles in this energy range. Moreover, a theoretical model allows to predict the response of MCP at even higher proton energies. This suggests that in this regime the MCP response is a slowly decreasing function of energy, consistently with the decrease of the deposited energy. These calibration data will enable particle spectra to be obtained in absolute terms over a broad energy range.
Energy Technology Data Exchange (ETDEWEB)
Jeong, Tae Won; Ter-Avetisyan, S. [Center for Relativistic Laser Science, Institute of Basic Science (IBS), Gwangju 61005 (Korea, Republic of); Department of Physics and Photon Science, Gwangju Institute of Science and Technology (GIST), Gwangju 61005 (Korea, Republic of); Singh, P. K.; Kakolee, K. F. [Center for Relativistic Laser Science, Institute of Basic Science (IBS), Gwangju 61005 (Korea, Republic of); Scullion, C.; Ahmed, H.; Hadjisolomou, P.; Alejo, A.; Kar, S.; Borghesi, M. [School of Mathematics and Physics, The Queen’s University of Belfast, Belfast BT7 1NN (United Kingdom)
2016-08-15
The absolute calibration of a microchannel plate (MCP) assembly using a Thomson spectrometer for laser-driven ion beams is described. In order to obtain the response of the whole detection system to the particles’ impact, a slotted solid state nuclear track detector (CR-39) was installed in front of the MCP to record the ions simultaneously on both detectors. The response of the MCP (counts/particles) was measured for 5–58 MeV carbon ions and for protons in the energy range 2–17.3 MeV. The response of the MCP detector is non-trivial when the stopping range of particles becomes larger than the thickness of the detector. Protons with energies E ≳ 10 MeV are energetic enough that they can pass through the MCP detector. Quantitative analysis of the pits formed in CR-39 and the signal generated in the MCP allowed to determine the MCP response to particles in this energy range. Moreover, a theoretical model allows to predict the response of MCP at even higher proton energies. This suggests that in this regime the MCP response is a slowly decreasing function of energy, consistently with the decrease of the deposited energy. These calibration data will enable particle spectra to be obtained in absolute terms over a broad energy range.
Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis
2016-08-24
To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.
Large aperture contact ionized Cs+1 ion source for an induction linac
International Nuclear Information System (INIS)
Abbott, S.; Chupp, W.; Faltens, A.; Herrmannsfeldt, W.; Hoyer, E.; Keefe, D.; Kim, C.H.; Rosenblum, S.; Shiloh, J.
1979-03-01
A 500 KeV one-ampere Cs +1 ion beam has been generated by contact ionization with a 30 cm dia. iridium hot plate. Reproducibility of space charge limited ion current wave forms at repetition rates up to 1 Hz has been verified. The beam is characterized to be very bright and suitable as an ion source for the induction linac based heavy ion fusion scheme. The hot anode plate was found to be reliable and self-cleaning during the operation
Zinc terephthalates ZnC_8H_4O_4 as anodes for lithium ion batteries
International Nuclear Information System (INIS)
Wang, Liping; Zou, Jian; Chen, Shulin; Yang, Jingyi; Qing, Fangzhu; Gao, Peng; Li, Jingze
2017-01-01
Graphical abstract: Both of well-crystalline and amorphous zinc terephthalates ZnC_8H_4O_4 are synthesized and amorphous structure demonstrates a higher capacity and better cycling performance. - Highlights: • Crystalline and amorphous ZnC_8H_4O_4 are obtained. • Both crystalline and amorphous ZnC_8H_4O_4 have σ_e of 10"−"7 S m"−"1. • Lithium ion diffusion is the rate-determine process. • Amorphous has a high capacity and durable performance. • Amorphous ZnC_8H_4O_4 has a high apparent lithium ion diffusion coefficient. - Abstract: Organic materials offer the advantages of cost-effective, environmental benignity, and molecular structural diversity as applications of electrode materials for lithium ion batteries. In fact, their lithium storage behaviors in terms of dynamics and kinetics intrinsically lie in ion migration in solids. Thus the solid forms including crystalline and amorphous states are crucial for the properties. In this study, a conventional carbonyl type organic material, namely zinc terephthalate (ZnC_8H_4O_4), is obtained in both well-crystalline and amorphous forms and applied as anodes for lithium ion batteries. ZnC_8H_4O_4 with amorphous structure shows higher lithium storage capacity and better capacity retention compared with that of crystalline one. It is ascribed that the amorphous phase provides a higher lithium ion diffusion coefficient than the crystalline one under the conditions of similar electronic conductivity.
Ion beam assisted deposition of nano-structured C:Ni films
Energy Technology Data Exchange (ETDEWEB)
Abrasonis, G.; Muecklich, A.; Heller, R.; Heinig, K.H.; Gemming, S.; Moeller, W. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Krause, M. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Institute of Physics, TU Dresden (Germany)
2012-07-01
Nanostructures influence material properties dramatically due to size, shape and interface effects. Thus the control of the structure at the nanoscale is a key issue in nanomaterials science. The interaction of hyperthermal ions with solids is confined to the nanometer scale. Thus, it can be used to control the morphology evolution during multiphase film deposition. Ion-induced displacements occur in a thin surface layer of the growing film where they increase the atomic mobility for the phase separation. Here the growth-structure relationship of C:Ni (15 at.%) nanocomposite films grown by oblique incidence (45 ) ion beam assisted deposition is reported. The influences of the flux of an assisting Ar+ ion beam (0-140 eV) as well as of an elevated substrate temperature have been studied. The formation of elongated nickel nanoparticles is strongly promoted by the ion beam assistance. Moreover, the metal nanocolumns no longer align with the advancing surface, but with the incoming ions. A window of conditions is established within which the ion assistance leads to the formation of regular composition modulations with a well defined periodicity and tilt. As the dominating driving force for the pattern formation is of physical origin, this approach might be applicable to other immiscible systems.
International Nuclear Information System (INIS)
Mao, Fei; Zhang, Chao; Gao, Cong-Zhang; Dai, Jinxia; Zhang, Feng-Shou
2014-01-01
Electronic energy loss in the collision processes of slow ions with a graphene fragment is investigated by combining ab initio time-dependent density functional theory calculations for electrons with molecular dynamics simulations for ions in real time and real space. We study the electronic energy loss of slow He 2+ , C 2+ , and C 4+ ions penetrating the graphene fragment as a function of the ion velocity, and establish the velocity-proportional energy loss for low-charged ions down to 0.1 a.u. One mechanism clarified in the simulations for electron transfer is polarization capture, which is effective for bare ions at low velocities. The other one is resonance capture, by which the incident ion can capture electrons from the graphene fragment to its electron affinity levels, which have the same, or nearly the same, energy as those of the electron donor levels. The results demonstrate that the nonlinear behavior of energy loss of C 4+ is attributed to the large number of electrons captured by this multi-charged ion during the collision. (paper)
Fragment ion distribution in charge-changing collisions of 2-MeV Si ions with C60
Itoh, A.; Tsuchida, H.; Miyabe, K.; Majima, T.; Nakai, Y.
2001-09-01
We have measured positive fragment ions produced in collisions of 2 MeV Siq+ (q=0, 1, 2, 4) projectiles with a C60 molecular target. The measurement was performed with a time-of-flight coincidence method between fragment ions and charge-selected outgoing projectiles. For all the charge-changing collisions investigated here, the mass distribution of small fragment ions C+n (n=1-12) can be approximated fairly well by a power-law form of n-λ as a function of the cluster size n. The power λ derived from each mass distribution is found to change strongly according to different charge-changing collisions. As a remarkable experimental finding, the values of λ(loss) in electron loss collisions are almost the same for the same final charge states k irrespective of the initial charge q, exhibiting a nearly perfect linear relationship with k. We also performed calculations of the projectile ionization on the basis of the semiclassical approximation and obtained inelastic energy deposition for individual collision processes. The estimated energy deposition is found to have a simple correlation with the experimentally determined values of λ(loss).
42 CFR 440.330 - Benchmark health benefits coverage.
2010-10-01
...) Federal Employees Health Benefit Plan Equivalent Coverage (FEHBP—Equivalent Health Insurance Coverage). A... coverage. Health benefits coverage that is offered and generally available to State employees in the State... 42 Public Health 4 2010-10-01 2010-10-01 false Benchmark health benefits coverage. 440.330 Section...
Formation of SiC using low energy CO2 ion implantation in silicon
International Nuclear Information System (INIS)
Sari, A.H.; Ghorbani, S.; Dorranian, D.; Azadfar, P.; Hojabri, A.R.; Ghoranneviss, M.
2008-01-01
Carbon dioxide ions with 29 keV energy were implanted into (4 0 0) high-purity p-type silicon wafers at nearly room temperature and doses in the range between 1 x 10 16 and 3 x 10 18 ions/cm 2 . X-ray diffraction analysis (XRD) was used to characterize the formation of SiC in implanted Si substrate. The formation of SiC and its crystalline structure obtained from above mentioned technique. Topographical changes induced on silicon surface, grains and evaluation of them at different doses observed by atomic force microscopy (AFM). Infrared reflectance (IR) and Raman scattering measurements were used to reconfirm the formation of SiC in implanted Si substrate. The electrical properties of implanted samples measured by four point probe technique. The results show that implantation of carbon dioxide ions directly leads to formation of 15R-SiC. By increasing the implantation dose a significant changes were also observed on roughness and sheet resistivity properties.
Zhang, Jian; Lin, Xu; Zhong, Zeli; Wu, Chao; Tan, Lun
2017-07-01
To compare the effectiveness of suspension fixation plus hinged external fixator with double plate internal fixation in the treatment of type C humeral intercondylar fractures. Between January 2014 and April 2016, 30 patients with type C (Association for the Study of Internal Fixation, AO/ASIF) humeral intercondylar fractures were treated. Kirschner wire suspension fixation plus hinged external fixator was used in 14 cases (group A), and double plate internal fixation in 16 cases (group B). There was no significant difference in gender, age, injury cause, disease duration, injury side, and type of fracture between 2 groups ( P >0.05). There was no significant difference in operation time and hospitalization stay between 2 groups ( P >0.05). But the intraoperative blood loss in group A was significantly less than that in group B ( P internal fixation removal, the intraoperative blood loss, and VAS score at 1 day and 3 days after operation in group A were significant better than those in group B ( P external fixator and double plate internal fixation for the treatment of type C humeral intercondylar fractures have ideal outcome in elbow function. But the suspension fixation plus hinged external fixator is better than double plate internal fixation in intraoperative blood loss, postoperative VAS score, and time of internal fixation removal.
Experimental investigation of power peak in vicinity of WWER-440 control rod at end of fuel cycle
International Nuclear Information System (INIS)
Mikus, J.
2004-01-01
This paper presents some results of the axial power (fission density) distribution measurements carried out on the light-water, zero-power reactor LR-0 in a WWER-440 type core in vicinity of the WWER-440 control rod model at zero boron concentration in moderator, modelling the conditions at the end of the WWER-440 fuel cycle. Further information concerns the control rod model description, specification of the LR-0 core, fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available power peaking database to enable the validation of the calculation codes by means of the measured data that correspond to the end of WWER-440 fuel cycle. (author)
Olah, George A; Surya Prakash, G K; Rasul, Golam
2008-07-16
The structures and energies of the carbocations C 4H 7 (+) and C 5H 9 (+) were calculated using the ab initio method. The (13)C NMR chemical shifts of the carbocations were calculated using the GIAO-CCSD(T) method. The pisigma-delocalized bisected cyclopropylcarbinyl cation, 1 and nonclassical bicyclobutonium ion, 2 were found to be the minima for C 4H 7 (+) at the MP2/cc-pVTZ level. At the MP4(SDTQ)/cc-pVTZ//MP2/cc-pVTZ + ZPE level the structure 2 is 0.4 kcal/mol more stable than the structure 1. The (13)C NMR chemical shifts of 1 and 2 were calculated by the GIAO-CCSD(T) method. Based on relative energies and (13)C NMR chemical shift calculations, an equilibrium involving the 1 and 2 in superacid solutions is most likely responsible for the experimentally observed (13)C NMR chemical shifts, with the latter as the predominant equilibrating species. The alpha-methylcyclopropylcarbinyl cation, 4, and nonclassical bicyclobutonium ion, 5, were found to be the minima for C 5H 9 (+) at the MP2/cc-pVTZ level. At the MP4(SDTQ)/cc-pVTZ//MP2/cc-pVTZ + ZPE level ion 5 is 5.9 kcal/mol more stable than the structure 4. The calculated (13)C NMR chemical shifts of 5 agree rather well with the experimental values of C 5H 9 (+).
ASTEC applications to VVER-440/V213 reactors
Energy Technology Data Exchange (ETDEWEB)
Matejovic, Peter, E-mail: ivstt@nextra.sk; Barnak, Miroslav; Bachraty, Milan; Vranka, Lubomir
2014-06-01
Since the beginning of ASTEC development by IRSN and GRS the code was widely applied to VVER reactors. In this paper, at first specific features of VVER-440/V213 reactor design that are important from the modelling point of view are briefly described. Then the validation of ASTEC code with focus on its applicability to VVER reactors is briefly summarised and the results obtained with the ASTEC V2.0-rev1 version for the ISP-33 PACTEL natural circulation experiment are presented. In the next section the application of ASTEC V2.0-rev1 code in upgrade of VVER-440/V213 NPPs to cope with consequences of severe accidents is described. This upgrade includes adoption of in-vessel retention via external reactor vessel cooling and installation of large capacity passive autocatalytic recombiners. Results of analysis with focus on corium localisation and stabilisation inside reactor vessel, hydrogen control in confinement and prevention of long-term confinement pressurisation are presented.
Structural stability of C60 films under irradiation with swift heavy ions
International Nuclear Information System (INIS)
Jin Yunfan; Yao Cunfeng; Wang Zhiguang; Xie Erqing; Song Yin; Sun Youmei; Zhang Chonghong; Liu Jie; Duan Jinglai
2005-01-01
In order to investigate the structural stability of fullerene (C 60 ) under swift heavy ion irradiation, the irradiation experiments of thin C 60 films were performed with 22 MeV/amu Fe 56 ions delivered by HIRFL at Lanzhou in China. The irradiated C 60 films were analyzed by means of Raman scattering and Fourier transform infrared (FTIR) spectroscopes. The analysis results indicated that the damage cross-sections σ of the C 60 molecule deduced from the data of the Raman spectra are between 1.1 and 4.5 x 10 -14 cm 2 for the electronic energy loss from 3.5 to 8.7 keV/nm and electronic energy transfer dominates the damage process of C 60 films. The partial recovery of the damage in irradiated C 60 films at certain electronic energy loss is attributed to an annealing effect of strong electronic excitation
Fragmentation of C2H4 by charge-changing collisions of O2+ ions
International Nuclear Information System (INIS)
Sato, S.; Mizuno, T.; Yamada, T.; Imai, M.; Shibata, H.; Itoh, A.; Tsuchida, H.
2009-01-01
We investigated molecular fragmentation of C 2 H 4 in charge-changing collisions of 1.14MeV O 2+ ions. Branching ratios associated with decaying from temporary produced (C 2 H 4 ) r+ ions into various fragment channels were obtained. Dissociation via a C-C bond breaking is preferential in 1-electron loss collisions in comparison with 1-electron capture collisions. We confirmed that multiple ionization and dissociation rarely occur in electron capture collisions, while they occur rather strongly in electron loss collisions. (author)
International Nuclear Information System (INIS)
Rentenier, A; Bordenave-Montesquieu, A; Moretto-Capelle, P; Bordenave-Montesquieu, D
2004-01-01
In this paper, a quantitative comparison of our experimental data for the asymmetrical fission (AF) and neutral evaporation of the C 60 molecule under proton impact (part I) is made with data published by other authors and often obtained in rather different collisional systems. The comparison with multicharged ions for which more quantitative data are available is focused on. It is demonstrated that size distributions of fragments, averaged fragment sizes, branching ratios between AF and evaporation or between AF channels, are common to all the collisional systems. Differences only appear when the comparison includes the undissociated stable fullerene ion signals
Chen, Yen-Ming; Hsu, Shih-Ting; Tseng, Yu-Hsien; Yeh, Te-Fu; Hou, Sheng-Shu; Jan, Jeng-Shiung; Lee, Yuh-Lang; Teng, Hsisheng
2018-03-01
This study uses graphene oxide quantum dots (GOQDs) to enhance the Li + -ion mobility of a gel polymer electrolyte (GPE) for lithium-ion batteries (LIBs). The GPE comprises a framework of poly(acrylonitrile-co-vinylacetate) blended with poly(methyl methacrylate) and a salt LiPF 6 solvated in carbonate solvents. The GOQDs, which function as acceptors, are small (3-11 nm) and well dispersed in the polymer framework. The GOQDs suppress the formation of ion-solvent clusters and immobilize PF6- anions, affording the GPE a high ionic conductivity and a high Li + -ion transference number (0.77). When assembled into Li|electrolyte|LiFePO 4 batteries, the GPEs containing GOQDs preserve the battery capacity at high rates (up to 20 C) and exhibit 100% capacity retention after 500 charge-discharge cycles. Smaller GOQDs are more effective in GPE performance enhancement because of the higher dispersion of QDs. The minimization of both the ion-solvent clusters and degree of Li + -ion solvation in the GPEs with GOQDs results in even plating and stripping of the Li-metal anode; therefore, Li dendrite formation is suppressed during battery operation. This study demonstrates a strategy of using small GOQDs with tunable properties to effectively modulate ion-solvent coordination in GPEs and thus improve the performance and lifespan of LIBs. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electroplating condition for Ni nanocrystalline on metal (Ni and Cu) plates
Energy Technology Data Exchange (ETDEWEB)
Park, Keun Yung; Uhm, Young Rang; Son, Kwang Jae; Shim, Young Ho; Choi, Sun Ju [KAERI, Daejeon (Korea, Republic of)
2012-10-15
Ni 63, a beta radiation source, is prepared by the electrical deposition of radioactive Ni 63 ions on a thin non radioactive nickel foil or Cu plate. Given a half life of 100 years, a nuclear battery will still produce half of its initial starting power after 100 years. A speck of a radioisotope like nickel 63, for example, contains enough energy to power a nano nuclear battery for decades, and to do so safely. Ni 63 plating is similar to other electroplating processes that employ soluble metal anodes. It requires the passage of a direct current between two electrodes that are immersed in a conductive, aqueous solution of nickel salts. The charged Ni ions are formed by sulfate, sulfamate, chloride, and a Watts bath. However, the charged Ni 63 ions are formed by dissolving metal Ni 63. To established the coating condition of Ni 63, non radioactive metal Ni particles are dissolved an acid solution and electroplated on a Ni sheet. The nickel plating process is used extensively for decorative, engineering and electro forming purposes because the appearance and other properties of electrodeposited nickel can be varied over a wide range by controlling the composition and operating parameters of the plating solution. A continuous increase in the grain size versus current density has also been recognized in the direct current electrodeposition of nickel coating. On the other hand, A runa et al. reported that the current density has no significant effect on the grain size of nickel electro deposits. A review of the literature shows that saccharin has often been added to a nickel plating bath since the 1980s to improve the ductility and brightness, and in later periods as a grain refiner agent. In the present paper, not only the preparation of a Ni plating solution prepared by dissolving metal particles, but also an optimization of the deposition conditions, such as the current density, saccharin concentration in the bath, and different metal substrates were investigated
Electroplating condition for Ni nanocrystalline on metal (Ni and Cu) plates
International Nuclear Information System (INIS)
Park, Keun Yung; Uhm, Young Rang; Son, Kwang Jae; Shim, Young Ho; Choi, Sun Ju
2012-01-01
Ni 63, a beta radiation source, is prepared by the electrical deposition of radioactive Ni 63 ions on a thin non radioactive nickel foil or Cu plate. Given a half life of 100 years, a nuclear battery will still produce half of its initial starting power after 100 years. A speck of a radioisotope like nickel 63, for example, contains enough energy to power a nano nuclear battery for decades, and to do so safely. Ni 63 plating is similar to other electroplating processes that employ soluble metal anodes. It requires the passage of a direct current between two electrodes that are immersed in a conductive, aqueous solution of nickel salts. The charged Ni ions are formed by sulfate, sulfamate, chloride, and a Watts bath. However, the charged Ni 63 ions are formed by dissolving metal Ni 63. To established the coating condition of Ni 63, non radioactive metal Ni particles are dissolved an acid solution and electroplated on a Ni sheet. The nickel plating process is used extensively for decorative, engineering and electro forming purposes because the appearance and other properties of electrodeposited nickel can be varied over a wide range by controlling the composition and operating parameters of the plating solution. A continuous increase in the grain size versus current density has also been recognized in the direct current electrodeposition of nickel coating. On the other hand, A runa et al. reported that the current density has no significant effect on the grain size of nickel electro deposits. A review of the literature shows that saccharin has often been added to a nickel plating bath since the 1980s to improve the ductility and brightness, and in later periods as a grain refiner agent. In the present paper, not only the preparation of a Ni plating solution prepared by dissolving metal particles, but also an optimization of the deposition conditions, such as the current density, saccharin concentration in the bath, and different metal substrates were investigated
Zhang, Rui; Chen, Fenghua; Wang, Jinbin; Fu, Dejun
2018-03-01
Here we demonstrate the synthesis of graphene directly on SiC substrates at 900 °C using ion beam mixing technique with energetic carbon cluster ions on Ni/SiC structures. The thickness of 7-8 nm Ni films was evaporated on the SiC substrates, followed by C cluster ion bombarding. Carbon cluster ions C4 were bombarded at 16 keV with the dosage of 4 × 1016 atoms/cm2. After thermal annealing process Ni silicides were formed, whereas C atoms either from the decomposition of the SiC substrates or the implanted contributes to the graphene synthesis by segregating and precipitating process. The limited solubility of carbon atoms in silicides, involving SiC, Ni2Si, Ni5Si2, Ni3Si, resulted in diffusion and precipitation of carbon atoms to form graphene on top of Ni and the interface of Ni/SiC. The ion beam mixing technique provides an attractive production method of a transfer-free graphene growth on SiC and be compatible with current device fabrication.
Hydrogen/deuterium exchange of multiply-protonated cytochrome c ions
International Nuclear Information System (INIS)
Wood, T.D.; Guan, Ziqiang; O'Connor, P.B.
1995-01-01
Low resolution measurements show gaseous multiply-protonated cytochrome c ions undergo hydrogen/deuterium (H/D) exchange with pseudo first-order kinetics at three distinct exchange levels, suggesting the co-existence of gaseous protein conformations. Although exchange levels first increase with increasing charge values, they decrease at the highest charge values, consistent with solution-phase behavior of cytochrome c, where the native structure unfolds with decreasing pH until folding into a compact A-state at lowest pH. High resolution measurements indicate the presence of at least six H/D exchange levels. Infrared (IR) laser heating and fast collisions via quadrupolar excitation (QE) increase H/D exchange levels (unfolding) while charge-stripping ions to lower charge values can increase or decrease H/D exchange levels (unfolding or folding). Wolynes has suggested studying proteins in vacuo could play an important role in delineating the contributions various forces play in the protein folding process, provided appropriate comparisons can be made between gas-phase and solution-phase structures
Microstructure and tribology of ion-mixed Fe/Ti/C multilayers on AISI 304 stainless steel
International Nuclear Information System (INIS)
Nastasi, M.; Hirvonen, J.P.; Zocco, T.G.; Jervis, T.R.
1991-01-01
A multilayered Fe/Ti/C structure consisting of eleven alternating sublayers, four Fe, four Ti and three C, was ion mixed on an AISI 304 stainless steel substrate with 400 keV Xe 2+ . Complete mixing was observed after an irradiation of 1x10 17 Xe/cm 2 at 550degC. Electron diffraction revealed the formation of the compounds TiC and Fe 3 C and a small amount of an amorphous phase. Some samples were given a second irradiation with 5x10 15 Xe/cm 2 at 0degC. The phases present following the second irradiation were TiC, α-Fe and an amorphous phase. Tribological and nanoindentation measurements revealed that both types of samples possessed similar hardness and friction properties. The ion mixed samples possessed an increased hardness and a decreased friction coefficient relative to untreated polished stainless-steel substrate. However, the wear life of the hot ion mixed sample was consistently longer than the wear life of the sample processed at both 550 and 0degC. These results are explained by differences in adhesive wear which result from differences in the chemical reactivity of the phases formed during ion beam processing. (orig.)
International Nuclear Information System (INIS)
Dybczynski, R.S.; Kulisa, K.; Danko, B.; Samczynski, Z.
2007-01-01
The analytical procedure for the isolation and preconcentration of La, Y and the lanthanides from biological materials and their determination by ion chromatography (IC) with the use of Dionex Ion Pac CS3 + CG3 column (sulfonic acid type), α-hydroxyisobutyric acid (α-HIBA) as an eluent, and PAR or Arsenazo III as color forming reagents, was elaborated. The scheme originally devised for NAA, involving microwave assisted digestion and multi step separation employing ion exchange and extraction chromatography columns was used to selectively recover REE fraction (without scandium) with 100% yield. The REE fraction was analyzed by IC at 25 and 70 o C. The run at 70 o C enabled resolution of Y and Dy peaks and as a result made possible quantitative determination of La, Y, and all lanthanides. Investigation on the mechanism of band spreading revealed that longitudinal diffusion in the stationary phase considerably contributed to the total plate height. Surprisingly, the plate height (H) calculated from Y peak was distinctly lower than H values of the adjacent lanthanides. The method was validated by analyzing several certified reference materials (CRMs). (authors)
Verification of high efficient broad beam cold cathode ion source
Energy Technology Data Exchange (ETDEWEB)
Abdel Reheem, A. M., E-mail: amreheem2009@yahoo.com [Accelerators and Ion Sources Department, Nuclear Research Center, Atomic Energy Authority, P.N.13759, Cairo (Egypt); Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT), Atomic Energy Authority (AEA), Cairo (Egypt); Ahmed, M. M. [Physics Department, Faculty of Science, Helwan University, Cairo (Egypt); Abdelhamid, M. M.; Ashour, A. H. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT), Atomic Energy Authority (AEA), Cairo (Egypt)
2016-08-15
An improved form of cold cathode ion source has been designed and constructed. It consists of stainless steel hollow cylinder anode and stainless steel cathode disc, which are separated by a Teflon flange. The electrical discharge and output characteristics have been measured at different pressures using argon, nitrogen, and oxygen gases. The ion exit aperture shape and optimum distance between ion collector plate and cathode disc are studied. The stable discharge current and maximum output ion beam current have been obtained using grid exit aperture. It was found that the optimum distance between ion collector plate and ion exit aperture is equal to 6.25 cm. The cold cathode ion source is used to deposit aluminum coating layer on AZ31 magnesium alloy using argon ion beam current which equals 600 μA. Scanning electron microscope and X-ray diffraction techniques used for characterizing samples before and after aluminum deposition.
Streamer free operation of a 2 mm gap resistive plate chamber with $C_{2}F_{5}H$
Cerron-Zeballos, E; Hatzifotiadou, D; Lamas-Valverde, J; Williams, M C S; Zichichi, A
1999-01-01
It is necessary to operate the resistive plate chamber (RPC) in avalanche mode to obtain high efficiency at elevated particle fluxes. We examine this mode of operation with a 2 mm gap RPC using gas mixtures containing C/sub 2/F/sub 4/H/sub 2/ and C/sub 2/F/sub 5/H. In order to explain the data we propose that the avalanche growth is strongly limited by space charge effects. (10 refs).
Energy Technology Data Exchange (ETDEWEB)
Kelkar, A H; Misra, D; Tribedi, L C [Tata Institute of Fundamental Research, Colaba, Mumbai -5 (India)
2007-09-15
We study the various inelastic processes such ionization, fragmentation and evaporation of C{sub 60} molecule in collisions with fast heavy ions. We have used 2.33 MeV/u C, O and F projectile ion beams. Various ionization and fragmentation products were detected using time-of-flight mass spectrometer. The multiply charged C{sub 60}{sup r+} ions were detected for maximum r = 4. The projectile charge state (q{sub p}) dependence of the single and double ionization cross sections is well reproduced by a model based on the giant dipole plasmon resonance (GDPR). The q{sub p}-dependence of the fragmentation yields, was found to be linear. Variation of relative yields of the evaporation products of C{sub 60}{sup 2+} (i.e. C{sub 58}{sup 2+}, C{sub 56}{sup 2+} etc) and C{sub 60}{sup 3+} (i.e. C{sub 58}{sup 3+}, C{sub 56}{sup 3+} etc) with q{sub p} has also been investigated for various projectiles.
Heteroepitaxy of zinc-blende SiC nano-dots on Si substrate by organometallic ion beam
International Nuclear Information System (INIS)
Matsumoto, T.; Kiuchi, M.; Sugimoto, S.; Goto, S.
2006-01-01
The self-assembled SiC nano-dots were fabricated on Si(111) substrate at low-temperatures using the organometallic ion beam deposition technique. The single precursor of methylsilicenium ions (SiCH 3 + ) with the energy of 100 eV was deposited on Si(111) substrate at 500, 550 and 600 deg. C. The characteristics of the self-assembled SiC nano-dots were analyzed by reflection high-energy electron diffraction (RHEED), Raman spectroscopy and atomic force microscope (AFM). The RHEED patterns showed that the crystal structure of the SiC nano-dots formed on Si(111) substrate was zinc-blende SiC (3C-SiC) and it was heteroepitaxy. The self-assembled SiC nano-dots were like a dome in shape, and their sizes were the length of 200-300 nm and the height of 10-15 nm. Despite the low-temperature of 500 deg. C as SiC crystallization the heteroepitaxial SiC nano-dots were fabricated on Si(111) substrate using the organometallic ion beam
Yang, Xiang; Zhao, You-ming; Chen, Lin; Ye, Cong-cong; Guo, Wei-jun; Wang, Bo
2013-12-01
To compare efficacy of unilateral external fixators and locking compression plates in treating type C fractures of the distal radius. From January 2009 to June 2010, 76 patients with distal radius fracture were treated with LCP and external fixators, 54 patients were followed up. Among them, 29 cases were male and 25 cases were female with an average age of 45.31 (ranged, 24 to 68) years old. There were 29 patients in LCP group. According to AO classification, 8 cases were type C1, 7 cases were type C2 and 14 cases were type C3. There were 25 cases in external fixators group. According to AO classification, 6 cases were type C1, 8 cases were type C2 and 11 cases were type C3. Radial height, volar tilt and radial inclination were compared, advanced Gartland-Werley scoring were used to assessed wrist joint function after 6 and 12 months' following up. Two cases were suffered from nail infection in external fixators group. Fifty-four patients were followed up from 12 to 24 months with an average of 21.3 months. Radial height was (9.60 +/- 0.72) mm, volar tilt was (9.55 +/- 0.80) degrees and radial inclination was (21.40 +/- 0.78) degrees in LCP group,while those were (9.40 +/- 0.70) mm, (9.47 +/- 0.71) degrees and (21.20 +/- 0.73) degrees in external fixtors group, and with no statistical significance (P>0.05). Advanced Gartland-Werley score after 6 months' following up was 3.31 +/- 1.17 in LCP group, 5.56 +/- 1.58 in external fixtors group, and with significant difference (t=-5.99,Pmeaning (t=-1.55, P>0.05). LCP and external fixtors can receive good curative effects in treating type C distal radius fracture, and LCP can obtain obviously short-term efficacy, while there is no significant difference between two groups in long-term results. For serious distal radius comminuted fracture which unable to plate internal fixation, external fixators is a better choice.
32 CFR 644.440 - Application of antitrust laws.
2010-07-01
... 32 National Defense 4 2010-07-01 2010-07-01 true Application of antitrust laws. 644.440 Section... Application of antitrust laws. Section 207 of the Federal Property Act provides that real property and related... the antitrust laws. Prior to obligating the Government on any such disposal, the District Engineer...
High resolution Thomson Parabola Spectrometer for full spectral capture of multi-species ion beams
International Nuclear Information System (INIS)
Alejo, A.; Kar, S.; Ahmed, H.; Doria, D.; Borghesi, M.; Tebartz, A.; Ding, J.; Neumann, N.; Astbury, S.; Carroll, D. C.; Scott, G. G.; Higginson, A.; McKenna, P.; Wagner, F.; Roth, M.
2016-01-01
We report on the experimental characterisation of laser-driven ion beams using a Thomson Parabola Spectrometer (TPS) equipped with trapezoidally shaped electric plates, proposed by Gwynne et al. [Rev. Sci. Instrum. 85, 033304 (2014)]. While a pair of extended (30 cm long) electric plates was able to produce a significant increase in the separation between neighbouring ion species at high energies, deploying a trapezoidal design circumvented the spectral clipping at the low energy end of the ion spectra. The shape of the electric plate was chosen carefully considering, for the given spectrometer configuration, the range of detectable ion energies and species. Analytical tracing of the ion parabolas matches closely with the experimental data, which suggests a minimal effect of fringe fields on the escaping ions close to the wedged edge of the electrode. The analytical formulae were derived considering the relativistic correction required for the high energy ions to be characterised using such spectrometer.
High resolution Thomson Parabola Spectrometer for full spectral capture of multi-species ion beams
Energy Technology Data Exchange (ETDEWEB)
Alejo, A.; Kar, S., E-mail: s.kar@qub.ac.uk; Ahmed, H.; Doria, D.; Borghesi, M. [Centre for Plasma Physics, School of Mathematics and Physics, Queen’s University Belfast, Belfast BT7 1NN (United Kingdom); Tebartz, A.; Ding, J.; Neumann, N. [Institut für Kernphysik, Technische Universität Darmstadt, Schloßgartenstrasse 9, D-64289 Darmstadt (Germany); Astbury, S.; Carroll, D. C.; Scott, G. G. [Central Laser Facility, Rutherford Appleton Laboratory, Didcot, Oxfordshire OX11 0QX (United Kingdom); Higginson, A.; McKenna, P. [Department of Physics, SUPA, University of Strathclyde, Glasgow G4 0NG (United Kingdom); Wagner, F. [GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Roth, M. [Institut für Kernphysik, Technische Universität Darmstadt, Schloßgartenstraße 9, D-64289 Darmstadt (Germany)
2016-08-15
We report on the experimental characterisation of laser-driven ion beams using a Thomson Parabola Spectrometer (TPS) equipped with trapezoidally shaped electric plates, proposed by Gwynne et al. [Rev. Sci. Instrum. 85, 033304 (2014)]. While a pair of extended (30 cm long) electric plates was able to produce a significant increase in the separation between neighbouring ion species at high energies, deploying a trapezoidal design circumvented the spectral clipping at the low energy end of the ion spectra. The shape of the electric plate was chosen carefully considering, for the given spectrometer configuration, the range of detectable ion energies and species. Analytical tracing of the ion parabolas matches closely with the experimental data, which suggests a minimal effect of fringe fields on the escaping ions close to the wedged edge of the electrode. The analytical formulae were derived considering the relativistic correction required for the high energy ions to be characterised using such spectrometer.
High resolution Thomson Parabola Spectrometer for full spectral capture of multi-species ion beams
Alejo, A.; Kar, S.; Tebartz, A.; Ahmed, H.; Astbury, S.; Carroll, D. C.; Ding, J.; Doria, D.; Higginson, A.; McKenna, P.; Neumann, N.; Scott, G. G.; Wagner, F.; Roth, M.; Borghesi, M.
2016-08-01
We report on the experimental characterisation of laser-driven ion beams using a Thomson Parabola Spectrometer (TPS) equipped with trapezoidally shaped electric plates, proposed by Gwynne et al. [Rev. Sci. Instrum. 85, 033304 (2014)]. While a pair of extended (30 cm long) electric plates was able to produce a significant increase in the separation between neighbouring ion species at high energies, deploying a trapezoidal design circumvented the spectral clipping at the low energy end of the ion spectra. The shape of the electric plate was chosen carefully considering, for the given spectrometer configuration, the range of detectable ion energies and species. Analytical tracing of the ion parabolas matches closely with the experimental data, which suggests a minimal effect of fringe fields on the escaping ions close to the wedged edge of the electrode. The analytical formulae were derived considering the relativistic correction required for the high energy ions to be characterised using such spectrometer.
Faraji, Masoud; Mohaghegh, Neda; Abedini, Amir
2018-01-01
A series of g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plates were fabricated via simple dipping of TiO 2 nanotubes/Ti in a solution containing SnCl 2 and g-C 3 N 4 nanosheets and finally annealing of the plates. Synthesized plates were characterized by various techniques. The SEM analysis revealed that the g-C 3 N 4 -SnO 2 nanosheets with high physical stability have been successfully deposited onto the surface of TiO 2 nanotubes/Ti plate. Photocatalytic activity was investigated using two probe chemical reactions: oxidative decomposition of acetic acid and oxidation of 2-propanol under irradiation. Antibacterial activities for Escherichia coli (E. coli) bacteria were also investigated in dark and under UV/Vis illuminations. Detailed characterization and results of photocatalytic and antibacterial activity tests revealed that semiconductor coupling significantly affected the photocatalyst properties synthesized and hence their photocatalytic and antibacterial activities. Modification of TiO 2 nanotubes/Ti plates with g-C 3 N 4 -SnO 2 deposits resulted in enhanced photocatalytic activities in both chemical and microbial systems. The g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plate exhibited the highest photocatalytic and antibacterial activity, probably due to the heterojunction between g-C 3 N 4 -SnO 2 and TiO 2 nanotubes/Ti in the ternary composite plate and thus lower electron/hole recombination rate. Based on the obtained results, a photocatalytic and an antibacterial mechanism for the degradation of E. coli bacteria and chemical pollutants over g-C 3 N 4 -SnO 2 /TiO 2 nanotubes/Ti plate were proposed and discussed. Copyright © 2017 Elsevier B.V. All rights reserved.
Hot tungsten plate based ionizer for cesium plasma in a multi-cusp field experiment
International Nuclear Information System (INIS)
Patel, Amitkumar D.; Sharma, Meenakshee; Ramasubramanian, Narayanan; Chattopadhyay, Prabal K.
2015-01-01
In a newly proposed basic experiment, contact-ionized cesium ions will be confined by a multi cups magnetic field configuration. The cesium ion will be produced by impinging collimated neutral atoms on an ionizer consisting of the hot tungsten plate. The temperature of the tungsten plate will also be made high enough (∼2700 K) such that it will contribute electrons also to the plasma. It is expected that at this configuration the cesium plasma would be really quiescent and would be free from even the normal drift waves observed in the classical Q-machines. For the ionizer a design based on F. F. Chen's design was made. This ionizer is very fine machining and exotic material like Tungsten plate, Molybdenum screws, rings, and Boron Nitride ceramics etc. The fine and careful machining of these materials was very hard. In this paper, the experience about to join the tungsten wire to molybdenum plate and alloy of tantalum and molybdenum ring is described. In addition experimental investigations have been made to measure 2D temperature distribution profile of the Tungsten hot plate using infrared camera and the uniformity of temperature distribution over the hot plate surface is discussed. (author)
Polyamine replacement by magnesium ions in BHK-21/C13 cells
Melvin, Maureen A. L.; Keir, Hamish M.
1979-01-01
Cultures of BHK-21/C13 cells, whose growth was inhibited by deprivation of serum, were stimulated to grow by addition of serum to the culture medium. Addition of MgCl2 to the medium, to increase the concentration of Mg2+ ions by 15mm, 30min before addition of serum, had no effect on the stimulation of cell growth, but inhibited the accumulation of cellular spermidine, so that the spermidine/spermine molar ratio was lower in these cultures than in cultures that had received no additional cations. The increase in the activity of ornithine decarboxylase that occurs 4–5h after serum `step-up' was substantially diminished by increasing the concentration of Mg2+ ions, but not of Na+ or K+ ions, in the medium by 30mm, 30min before addition of serum, and this inhibition was maintained for at least 24h. Methylglyoxal bis(guanylhydrazone), added to serum-deprived cultures to a concentration of 20μm, 30min before addition of serum, severely inhibited the increase in cell growth. The inhibitory effects of the drug were prevented by simultaneous addition of spermidine to the medium (to 100μm), and were partly prevented by the simultaneous addition of Mg2+ ions (to 30mm). Mg2+ ions were particularly effective in overcoming the inhibitory effect of methylglyoxal bis(guanylhydrazone) on the synthesis of DNA. Thus although a certain lack of specificity for cations exists in BHK-21/C13 cells, in that Mg2+ ions can be substituted for polyamines, particularly spermidine, to some extent, there are cellular processes for which the requirement for polyamines as cations is specific. PMID:444220
Energy Technology Data Exchange (ETDEWEB)
Papineau, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1956-07-01
The relationship between the path and energy of ions with 3{<=}Z{<=}10 in Ilford C2 nuclear emulsions is studied. It determined the average state of charge of ions in each velocity intervals. Results are given in a table for {sub 2}He, {sub 3}Li, {sub 4}Be, {sub 5}B, {sub 6}C, {sub 7}N, {sub 8}O and {sub 10}Ne. For each velocity interval, it is possible to apply the Blackett relation which links, for the same velocity, the path {delta}R of a particle with M (mass) and Z (charge) to the path {delta}R' of a particle with M' and Z'. Results are given in tables and graphics representing the particles energy with the particles path. (M.P.)
Evaluation of efficiency of axial profiling in WWER-440 fuel assemblies
International Nuclear Information System (INIS)
Ananjev, Yu. A.; Kurakin, K. Yu.; Artemov, V.G.; Ivanov, A.S.
2005-01-01
The present report deals with consideration of fuel enrichment axial profiling in WWER-440 assemblies. The study is performed on improving the effectiveness of fuel utilization using the example of implementing the axial profiling in the assemblies of the second generation. For simulation of fuel loadings the computer code package SAPFIR 9 5 and RC is used that allows for correct consideration of specific features of assemblies design changes. The methodical approach to assessment of effectiveness of implementing the axial profiling is considered with the use of capabilities of the mentioned code package. In conclusion the recommendations are given on using the fuel enrichment axial profiling in WWER-440 assemblies (Authors)
Development of anti-debris filter for WWER-440 working fuel assembly
International Nuclear Information System (INIS)
Kolosovsky, V.; Aksyonov, P.; Kukushkin, Y.; Molchanov, V.; Kolobaev, A.
2006-01-01
Mechanical damaging of the fuel rod claddings caused by debris is one of the main reasons for fuel assembly failures. The paper focuses on the program and results of experimental and design activities carried out by Russian organizations relating to the development and investigation of operational characteristics of anti-debris filters for WWER-440 working fuel assemblies. Lead working fuel assemblies equipped with anti-debris filters have been loaded in the core of Kola-2 NPP. The results obtained can be used for making the decision concerning the application of anti-debris filter for WWER-440 working fuel assemblies with the purpose of enhancing their debris-resistance properties. (authors)
Photoionization and photofragmentation of multiply charged Lu3N@C80 ions
International Nuclear Information System (INIS)
Hellhund, J; Borovik, A Jr; Holste, K; Ricz, S; Schippers, S; Müller, A; Klumpp, S; Martins, M
2015-01-01
Relative cross sections for photoionization and photofragmentation of endohedral fullerene Lu 3 N@C 80 q+ (q=1,2,3) ions have been measured employing the new photon-ion spectrometer PIPE at PETRA III. Prominent structures related to the carbon K-shell ionization threshold were observed in the energy range 280 to 330 eV. (paper)
31 CFR 535.440 - Commercially reasonable interest rates.
2010-07-01
... Interpretations § 535.440 Commercially reasonable interest rates. (a) For purposes of §§ 535.212 and 535.213, what... transferred as, or as part of, the interest at “commercially reasonable rates” required to be transferred... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Commercially reasonable interest...
Destruction of C60 films by boron ion bombardment
International Nuclear Information System (INIS)
Ren Zhongmin; Du Yuancheng; Ying Zhifeng; Xiong Xiaxing; Li Fuming
1995-01-01
C 60 films are bombarded by 100 keV boron ion beams at doses ranging from 3x10 14 to 1x10 16 /cm 2 . The bombarded films are analyzed using Fourier transform infrared spectroscopy (FTIR), Raman spectra and X-ray diffraction (XRD) measurements. Most C 60 soccer-balls in the implanted region in the films are found to be broken at a dose over 1x10 15 /cm 2 , while at a dose less than 6x10 14 /cm 2 a few C 60 molecules remain undestroyed and maintain some crystal structure. The results of the analyses suggest a complete disintegration of a C 60 molecule under B + bombardment. ((orig.))
Sensitivity study applied to the CB4 VVER-440 benchmark on burnup credit
International Nuclear Information System (INIS)
Markova, Ludmila
2003-01-01
A brief overview of four completed portions (CB1, CB2, CB3, CB3+, CB4) of the international VVER-440 benchmark focused on burnup credit and a sensitivity study as one of the final views of the benchmark results are presented in the paper. Finally, the influence of real and conservative VVER-440 fuel assembly models taken for the isotopics calculation by SCALE sas2 on the system k eff is shown in the paper. (author)
An Investigation of Ionic Flows in a Sphere-Plate Electrode Gap
International Nuclear Information System (INIS)
Alisoy, H. Z.; Alagoz, B. B.; Alagoz, S.; Alisoy, G. T.
2013-01-01
This paper presents analyses of ion flow characteristics and ion discharge pulses in a sphere-ground plate electrode system. As a result of variation in electric field intensity in the electrode gap, the ion flows towards electrodes generate non-uniform discharging pulses. Inspection of these pulses provides useful information on ionic stream kinetics, the effective thickness of ion cover around electrodes, and the timing of ion clouds discharge pulse sequences. A finite difference time domain (FDTD) based space-charge motion simulation is used for the numerical analysis of the spatio-temporal development of ionic flows following the first Townsend avalanche, and the simulation results demonstrate expansion of the positive ion flow and compression of the negative ion flow, which results in non-uniform discharge pulse characteristics
An Investigation of Ionic Flows in a Sphere-Plate Electrode Gap
Z. Alisoy, H.; Alagoz, S.; T. Alisoy, G.; B. Alagoz, B.
2013-10-01
This paper presents analyses of ion flow characteristics and ion discharge pulses in a sphere-ground plate electrode system. As a result of variation in electric field intensity in the electrode gap, the ion flows towards electrodes generate non-uniform discharging pulses. Inspection of these pulses provides useful information on ionic stream kinetics, the effective thickness of ion cover around electrodes, and the timing of ion clouds discharge pulse sequences. A finite difference time domain (FDTD) based space-charge motion simulation is used for the numerical analysis of the spatio-temporal development of ionic flows following the first Townsend avalanche, and the simulation results demonstrate expansion of the positive ion flow and compression of the negative ion flow, which results in non-uniform discharge pulse characteristics.
Chromosomal aberrations induced by 12C6+ ions and 6Co γ-rays in mouse immature oocytes
International Nuclear Information System (INIS)
Zhang Hong; Duan Xin; Yuan Zhigang; Li Wenjian; Zhou Guangming; Zhou Qingming; Bing Liu; Min Fengling; Li Xiaoda; Xie Yi
2006-01-01
The ovaries of Kun-Ming strain mice (3 weeks) were irradiated with different doses of 12 C 6+ ion or 6 Co γ-ray. Chromosomal aberrations were analyzed in metaphase II oocytes at 7 weeks after irradiation. The relative biological effectiveness (RBE) of 12 C 6+ ion was calculated with respect to 6 Co γ-ray for the induction of chromosomal aberrations. The 12 C 6+ ion and 6 Co γ-ray dose-response relationships for chromosomal aberrations were plotted by linear quadratic models. The data showed that there was a dose-related increase in frequency of chromosomal aberrations in all the treated groups compared to controls. The RBE values for 12 C 6+ ions relative to 6 Co γ-rays were 2.49, 2.29, 1.57, 1.42 or 1.32 for the doses of 0.5, 1.0, 2.0, 4.0 or 6.0 Gy, respectively. Moreover, a different distribution of the various types of aberrations has been found for 12 C 6+ ion and 6 Co γ-ray irradiations. The dose-response relationships for 12 C 6+ ion and 6 Co γ-ray exhibited positive correlations. The results from the present study may be helpful for assessing genetic damage following exposure of immature oocytes to ionizing radiation
Disorder accumulation and recovery in gold-ion irradiated 3C-SiC
Energy Technology Data Exchange (ETDEWEB)
Jiang, Weilin; Weber, William J.; Lian, Jie; Kalkhoran, N. M.
2009-01-12
A single-crystal 3C-SiC film on the Si/SiO2/Si (SIMOX) substrate was irradiated in different areas at 156 K with Au2+ ions to low fluences. The disorder profiles as a function of dose on both the Si and C sublattices have been determined in situ using a combination of 0.94 MeV D+ Rutherford backscattering spectrometry and nuclear reaction analysis in channeling geometry along the <100>, <110> and <111> axes. The results indicate that for the same damage state, the level of disorder on the Si sublattice in 3C-SiC follows a decreasing order along the <111>, <100> and <110> axes, while that on the C sublattice shows comparable values. Similar levels of Si and C disorder are observed along the <111> axis over the applied dose range. However, the level of C disorder is higher than that of Si disorder along either <100> or <110>. The amount of disorder recovery during thermal annealing processes depends on the sublattice (Si or C) and crystallographic orientation. Room-temperature recovery occurs for both sublattices in 3C-SiC irradiated to a dose of 0.047 dpa or lower. Significant recovery is observed along all directions during thermal annealing at 600 K. The results will be discussed and compared to those for 6H- and 4H-SiC under similar irradiation conditions.
Release of fission products from miniature fuel plates at elevated temperature
International Nuclear Information System (INIS)
Posey, J.C.
1982-01-01
Three miniature fuel plates were tested at progressively higher temperatures. A U 3 Si plated blistered and released fission gases at 500 0 C. Two U 3 O 8 filled plates blistered and released fission gases at 550 0 C
2010-10-01
... an institution for mental diseases. 440.10 Section 440.10 Public Health CENTERS FOR MEDICARE... for mental diseases. (a) Inpatient hospital services means services that— (1) Are ordinarily furnished... and treatment of patients with disorders other than mental diseases; (ii) Is licensed or formally...
Energy Technology Data Exchange (ETDEWEB)
Bedington, Robert, E-mail: r.bedington@nus.edu.sg; Kataria, Dhiren; Smith, Alan
2015-09-01
The CATS (Cylindrical And Tiny Spectrometer) electrostatic optics geometry features multiple nested cylindrical analysers to simultaneously measure multiple energies of electron and multiple energies of ion in a configuration that is targeted at miniaturisation and MEMS fabrication. In the prototyped model, two configurations of cylindrical analyser were used, featuring terminating side-plates that caused particle trajectories to either converge (C type) or diverge (D type) in the axial direction. Simulations show how these different electrode configurations affect the particle focussing and instrument parameters; C-type providing greater throughputs but D-type providing higher resolving powers. The simulations were additionally used to investigate unexpected plate spacing variations in the as-built model, revealing that the k-factors are most sensitive to the width of the inter-electrode spacing at its narrowest point. - Highlights: • A new nested cylindrical miniaturised electrostatic analyser geometry is described. • “Converging” (C) and “diverging” (D) type channel properties are investigated. • C channels are shown to have greater throughputs and D greater resolving powers. • Plate factors are shown to be sensitive to the minimum in inter-electrode spacing.
Ion Bernstein wave experiments on the Alcator C tokamak
International Nuclear Information System (INIS)
Moody, J.D.
1988-09-01
Ion Bernstein wave experiments are carried out on the Alcator C tokamak to study wave excitation, propagation, absorption, and plasma heating due to wave power absorption. It is shown that ion Bernstein wave power is coupled into the plasma and follows the expected dispersion relation. The antenna loading is maximized when the hydrogen second harmonic layer is positioned just behind the antenna. Plasma heating results at three values of the toroidal magnetic field are presented. Central ion temperature increases of ΔT/sub i//Ti /approx lt/ 0.1 and density increases Δn/n 6 s/sup /minus/1/ for plasmas within the density range 0.6 /times/ 10 20 m/sup /minus/3/ ≤ /bar n//sub e/ ≤ 4 /times/ 10 20 m/sup /minus/3/ and magnetic fields 2.4 ≥ ω/Ω/sub H/ ≥ 1.1. The density increases is usually accompanied by an improvement in the global particle confinement time relative to the Ohmic value. The ion heating rate is measured to be ΔT/sub i//P/sub rf/ ≅ 2-4.5 eV/kW at low densities. At higher densities /bar n//sub e/ ≤ 1.5 /times/ 10 20 m/sup /minus/3/ the ion heating rate dramatically decreases. It is shown that the decrease in the ion heating rate can be explained by the combined effects of wave scattering through the edge turbulence and the decreasing on energy confinement of these discharges with density. The effect of observed edge turbulence is shown to cause a broadening of the rf power deposition profile with increasing density. It is shown that the inferred value of the Ohmic ion thermal conduction, when compared to the Chang-Hinton neoclassical prediction, exhibits an increasing anomaly with increasing plasma density
Power peak in vicinity of WWER-440 control rod
International Nuclear Information System (INIS)
Mikus, J.
2003-01-01
The measurements of axial power (fission density) distribution have been performed by means of gamma activity determination (gamma scanning method) of the irradiated fuel pins detecting gamma quanta in the La peak area - 1596.5 keV of their selected parts having 20 mm length in the axial coordinates range 50-950 mm with a 10 mm step using a rectangular collimator (dimensions 20x10 mm). Two NaI(Tl) scintillation crystals (one as a monitor) with diameter of 40 mm were used, each of them in Pb shielding (thickness 150 mm). The obtained results enlarge the available 'power peaking database' and enable validation of the codes also in important case of zero-boron concentration that corresponds to the end of WWER-440 fuel cycle. This validation can improve the reliability of the calculation results of the power distribution in WWER-440 cores, re-loading schemes etc
Interactive nuclear plant analyzer for the VVER-440 reactor
International Nuclear Information System (INIS)
Shier, W.; Kennett, R.
1993-01-01
An interactive nuclear plant analyzer (NPA) has been developed for a VVER-440 model 213 reactor for use in the training of plant personnel, the development and verification of plant operating procedures, and in the analysis of various anticipated operational occurrences and accident scenarios. This NPA is operational on an IBM RISC-6000 workstation and utilizes the RELAP5/MOD2 computer code for the calculation of the VVER-440 reactor response to the interactive commands initiated by the NPA operator. Results of the interactive calculation can be through the user-defined, digital display of various plant parameters and through color changes that reflect changes in primary system fluid temperatures, fuel and clad temperatures, and the temperatures of other metal structures. In addition, changes in the status of various components and system can be initiated and/or displayed both numerically and graphically on the mask
Ranking of safety issues for WWER-440 model 230 nuclear power plants
International Nuclear Information System (INIS)
1992-02-01
In response to requests from Member States operating Soviet designed WWER-440/230 nuclear power plants (NPPs) for assistance through the IAEA's nuclear safety services, a major international project was established to evaluate these first generation reactors as a complement to relevant ongoing national, bilateral and multilateral activities. The objective is to assist countries operating WWER-440/230 NPPs in performing comprehensive safety reviews aimed at identifying design and operational weaknesses. The scope of the project includes a review of the conceptual design of WWER-440/230 NPPs, safety review missions to each one of the operating reactors to review design and operational aspects and studies to resolve issues of generic safety concern. This report was prepared by a group of international experts and the IAEA staff and discussed by the Project Steering Committee, December 9-13, 1991 in Vienna. An overview of the safety issues identified is presented indicating their effect on the performance of the basic safety functions. Conceptual recommendations related to design issues are given as a technical basis for the safety modifications required
Simulation of the channelling of ions from MeV C60 in crystalline solids
International Nuclear Information System (INIS)
Fetterman, A; Sinclair, L; Tanushev, N; Tombrello, T; Nardi, E
2007-01-01
Simulations were performed describing the motion and breakup of energetic C 60 ions interacting with crystalline targets. A hybrid algorithm was used that employs a binary collision model for the scattering of the carbon ions by the atoms of the solid, and molecular dynamics for the Coulomb interactions of the 60 carbon ions with one another. For the case of yttrium iron garnet (YIG), directions such as [1 1 0], [1 0 0], [0 1 0] and [0 0 1] demonstrate channelling for a large fraction of the C ions. For directions such as [1 1 1], [2 1 1] and [7 5 3] the trajectories show no more channelling than for random directions. The effects of tilt, shielding and wake-field interactions were investigated for YIG and α-quartz
Mou, Yan; Luo, Haiyu; Mao, Ziling; Shan, Tijiang; Sun, Weibo; Zhou, Kaiyi; Zhou, Ligang
2013-01-07
The influences of eight metal ions (i.e., Na+, Ca2+, Ag+, Co2+, Cu2+, Al3+, Zn2+, and Mn4+) on mycelia growth and palmarumycins C(12) and C(13) production in liquid culture of the endophytic fungus Berkleasmium sp. Dzf12 were investigated. Three metal ions, Ca2+, Cu2+ and Al3+ were exhibited as the most effective to enhance mycelia growth and palmarumycin production. When calcium ion (Ca2+) was applied to the medium at 10.0 mmol/L on day 3, copper ion (Cu2+) to the medium at 1.0 mmol/L on day 3, aluminum ion (Al3+) to the medium at 2.0 mmol/L on day 6, the maximal yields of palmarumycins C(12) plus C(13) were obtained as 137.57 mg/L, 146.28 mg/L and 156.77 mg/L, which were 3.94-fold, 4.19-fold and 4.49-fold in comparison with that (34.91 mg/L) of the control, respectively. Al3+ favored palmarumycin C(12) production when its concentration was higher than 4 mmol/L. Ca2+ had an improving effect on mycelia growth of Berkleasmium sp. Dzf12. The combination effects of Ca2+, Cu2+ and Al3+ on palmarumycin C(13) production were further studied by employing a statistical method based on the central composite design (CCD) and response surface methodology (RSM). By solving the quadratic regression equation between palmarumycin C(13) and three metal ions, the optimal concentrations of Ca2+, Cu2+ and Al3+ in medium for palmarumycin C(13) production were determined as 7.58, 1.36 and 2.05 mmol/L, respectively. Under the optimum conditions, the predicted maximum palmarumycin C(13) yield reached 208.49 mg/L. By optimizing the combination of Ca2+, Cu2+ and Al3+ in medium, palmarumycin C(13) yield was increased to 203.85 mg/L, which was 6.00-fold in comparison with that (33.98 mg/L) in the original basal medium. The results indicate that appropriate metal ions (i.e., Ca2+, Cu2+ and Al3+) could enhance palmarumycin production. Application of the metal ions should be an effective strategy for palmarumycin production in liquid culture of the endophytic fungus Berkleasmium sp. Dzf12.
Release of fission products from miniature fuel plates at elevated temperature
International Nuclear Information System (INIS)
Posey, John C.
1983-01-01
Three miniature fuel plates were tested at progressively higher temperatures. A U 3 Si filled plate blistered and released fission gases at 500 deg. C. Two U 3 O 8 filled plates blistered and released fission gases at 550 deg. C. (author)
Depth profile of In and As in Si measured by RBS with He and C ions
Energy Technology Data Exchange (ETDEWEB)
Yang, Q.; Fang, Z. [Newcastle Univ., NSW (Australia). Dept. of Physics; Ophel, T.R. [Australian National Univ., Canberra, ACT (Australia). Dept. of Nuclear Physics
1993-12-31
The depth profile of As and In implanted into Si have been measured by RBS (Rutherford Backscattering Spectrometry) with 2 MeV He ions and 6 MeV C ions. Advantages of enhanced depth and mass resolution with C ions have been demonstrated over the conventional He RBS. More reliable information for the depth profile of In and As in Si has been obtained. 12 refs., 3 figs.
Depth profile of In and As in Si measured by RBS with He and C ions
Energy Technology Data Exchange (ETDEWEB)
Yang, Q; Fang, Z [Newcastle Univ., NSW (Australia). Dept. of Physics; Ophel, T R [Australian National Univ., Canberra, ACT (Australia). Dept. of Nuclear Physics
1994-12-31
The depth profile of As and In implanted into Si have been measured by RBS (Rutherford Backscattering Spectrometry) with 2 MeV He ions and 6 MeV C ions. Advantages of enhanced depth and mass resolution with C ions have been demonstrated over the conventional He RBS. More reliable information for the depth profile of In and As in Si has been obtained. 12 refs., 3 figs.
Pandey, R. S.; Singh, Vikrant; Rani, Anju; Varughese, George; Singh, K. M.
2018-05-01
In the present paper Oblique propagating electromagnetic ion-cyclotron wave has been analyzed for anisotropic multi ion plasma (H+, He+, O+ ions) in earth magnetosphere for the Dione shell of L=7 i.e., the outer radiation belt of the magnetosphere for Loss-cone distribution function with a spectral index j in the presence of A.C. electric field. Detail for particle trajectories and dispersion relation has been derived by using the method of characteristic solution on the basis of wave particle interaction and transformation of energy. Results for the growth rate have been calculated numerically for various parameters and have been compared for different ions present in magnetosphere. It has been found that for studying the wave over wider spectrum, anisotropy for different values of j should be taken. The effect of frequency of A.C. electric field and angle which propagation vector make with magnetic field, on growth rate has been explained.
DEFF Research Database (Denmark)
Alfonso Lopez, Angel; Juul Jensen, Dorte; Luo, G.-N.
2015-01-01
plastic strain by 90% thickness reduction was investigated by isothermal annealing for up to 190 h in the temperature range between 1100 °C and 1250 °C. Vickers hardness testing allowed tracking the changes in mechanical properties caused by recovery and recrystallization. The hardness evolution could......Pure tungsten is considered as armor material for the most critical parts of fusion reactors (i.e. the divertor and the first wall), among other reasons due to its high melting point (3422 °C) and recrystallization temperature. The thermal stability of a pure tungsten plate warm-rolled to a high...... suggest that large plastic deformations (e.g. applied during shaping) are only suitable to produce tungsten components to be used at relatively low temperatures (up to 900 °C for a 2 years lifespan). Higher operation temperatures will lead to fast degradation of the microstructure during operation....
International Nuclear Information System (INIS)
Santos, Guilherme M.; Mello, Victor Barreto Braga; Mello Neto, Joao R.T. de
2016-01-01
This study aims to simulate protons, 4 He ions and 12 C ions beams, radiating the head of an average-sized man with the purpose of treating a hypothalamic tumor. GEANT4 was used to simulate the head (skin, skull and brain), and the beam, giving their characteristics and also the physical processes involved. The results sought herein are graphs of depth for relative dose for each of the three particles incident on the settings mentioned above. (author)
Mutation effects of C{sup 2+} ion irradiation on the greasy Nitzschia sp
Energy Technology Data Exchange (ETDEWEB)
Yang, Y.N., E-mail: ynyangbuaa@gmail.com [School of Chemistry and Environment, Beihang University, 37th Xueyuan Road, Haidian District, P.O. Box 106, 100191 Beijing (China); Liu, C.L.; Wang, Y.K. [School of Chemistry and Environment, Beihang University, 37th Xueyuan Road, Haidian District, P.O. Box 106, 100191 Beijing (China); Xue, J.M. [State Key Lab of Nuclear Physics and Nuclear Technology, Peking University, 100084 Beijing (China)
2013-11-15
Highlights: • The optimal conditions of C{sup 2+} ion irradiation on Nitzschia sp. were discussed. • Get the “saddle type” survival curve. • One mutant whose lipid content improved significantly was selected. • The C{sup 2+} ion irradiation didn’t change the algae's morphology and growth rate. - Abstract: Screening and nurturing algae with high productivity, high lipid content and strong stress resistance are very important in algae industry. In order to increase the lipid content, the Nitzschia sp. was irradiated with a 3 MeV C{sup 2+} beam. The sample pretreatment method was optimized to obtain the best mutagenic condition and the survival ratio curve. The positive mutants with a significant improvement in lipid content were screened and their C{sup 2+} mutagenic effects were analyzed by comparing the greasiness and growth characteristics with the wild type algae. Results showed that when the Nitzschia sp. was cultivated in nutritious medium containing 10% glycerol solution, and dried on the filter for 5 min after centrifugation, the realization of the microalgae heavy ion mutagenesis could be done. The survival ratio curve caused by C{sup 2+} irradiation was proved to be “saddle-shaped”. A positive mutant was screened among 20 survivals after irradiation, the average lipid content of the mutation increased by 9.8% than the wild type after 4 generations. But the growth rate of the screened mutation didn’t change after the heavy ion implantation compared to the wild type algae.
Physiochemical parameters optimization for enhanced nisin production by Lactococcus lactis (MTCC 440
Directory of Open Access Journals (Sweden)
Puspadhwaja Mall
2010-02-01
Full Text Available The influence of various physiochemical parameters on the growth of Lactococcus lactis sub sp. lactis MTCC 440 was studied at shake flask level for 20 h. Media optimization (MRS broth was studied to achieve enhanced growth of the organism and also nisin production. Bioassay of nisin was done with agar diffusion method using Streptococcus agalactae NCIM 2401 as indicator strain. MRS broth (6%, w/v with 0.15μg/ml of nisin supplemented with 0.5% (v/v skimmed milk was found to be the best for nisin production as well as for growth of L lactis. The production of nisin was strongly influenced by the presence of skimmed milk and nisin in MRS broth. The production of nisin was affected by the physical parameters and maximum nisin production was at 30(0C while the optimal temperature for biomass production was 37(0C.
2010-04-01
... limitations apply to the State's Workforce Flexibility Plan authority under WIA? (a)(1) Under work-flex waiver... flexibility plan. Once approved, a State's work-flex designation is conditioned on the State demonstrating it... Workforce Flexibility Plan authority under WIA? 661.440 Section 661.440 Employees' Benefits EMPLOYMENT AND...
International Nuclear Information System (INIS)
Mizov, J.; Svec, P.; Rajci, T.
1987-01-01
Assemblies with patly spent fuel of enrichment within 5 and 36 MWd/kg U or lower than the maximum enrichment of freshly charged fuel are placed in at least one of the peripheral positions of each hexagonal sector of the WWER-440 reactor type core. This increases fuel availability and reduces the integral neutron dose to the reactor vessel. The duration is extended of the reactor campaign and/or the mean fuel enrichment necessary for the required duration of the period between refuellings is reduced. Thus, fuel costs are reduced by 1 up to 3%. The results obtained in the experiment are tabulated. (J.B.). 1 fig., 3 tabs
Geng, Sheng; Verkhoturov, Stanislav V.; Eller, Michael J.; Della-Negra, Serge; Schweikert, Emile A.
2017-02-01
We present here the study of the individual hypervelocity massive projectiles (440-540 keV, 33-36 km/s Au4004+ cluster) impact on 1-layer free-standing graphene. The secondary ions were detected and recorded separately from each individual impact in the transmission direction using a time-of-flight mass spectrometer. We observed C1-10± ions emitted from graphene, the projectiles which penetrated the graphene, and the Au1-3± fragment ions in mass spectra. During the projectile-graphene interaction, the projectile loses ˜15% of its initial kinetic energy (˜0.18 keV/atom, 72 keV/projectile). The Au projectiles are neutralized when approaching the graphene and then partially ionized again via electron tunneling from the hot rims of the holes on graphene, obtaining positive and negative charges. The projectile reaches an internal energy of ˜450-500 eV (˜4400-4900 K) after the impact and then undergoes a ˜90-100 step fragmentation with the ejection of Au1 atoms in the experimental time range of ˜0.1 μs.
International Nuclear Information System (INIS)
Wang, Hsiang-Cheng; Hou, Kung-Hsu; Lu, Chen-En; Ger, Ming-Der
2014-01-01
In this study, the trivalent Cr–C coatings were electroplated on stainless steel 304 (SS304) substrates for an application in bipolar plates (BPPs) that was because of coating's excellent electric conductivity and corrosion resistance. The images of scanning electron microscope showed that the thickness of the coatings was between 1.4 and 11.4 μm, which increased with increase of coating current density. The surface morphology of Cr–C plated at coating current density of 10 A/dm 2 was smooth, crack- and pinhole-free, while cracks and pinholes appearing in networks were observed apparently in the deposits plated at a higher coating current density. Additionally, the C content in the coating decreased with increasing the coating current density. Moreover, the polarization curve with different coating current densities (10, 30, 50 A/dm 2 ) exhibited the coating prepared at 10 A/dm 2 and 10 min possessing the best corrosion resistance (I corr = 9.360 × 10 −8 A/cm 2 ). The contact resistance of Cr–C plated at coating current density of 10 A/dm 2 was the lowest (16.54 mΩ cm 2 at 150 N cm −2 ), which showed great potential of application. The single cell test with Cr–C coated SS304 prepared at coating current density of 10 A/dm 2 as BPPs showed the highest current density (about 791.532 mA/cm 2 ) and power density (about 270.150 mW/cm 2 ). - Highlights: • The Cr–C coatings on steel are electroplated for utilization as bipolar plate. • The electrical conductivity and corrosion resistance increase with carbon content. • The power density of Cr–C coated steel is superior to the bare steel
Energy Technology Data Exchange (ETDEWEB)
Wang, Hsiang-Cheng [Graduate School of Defense Science, Chung Cheng Institute of Technology, National Defense University, Taoyuan, Taiwan (China); Hou, Kung-Hsu, E-mail: khou@ndu.edu.tw [Department of Power Vehicle and Systems Engineering, Chung Cheng Institute of Technology, National Defense University, Taoyuan, Taiwan (China); Lu, Chen-En [Graduate School of Defense Science, Chung Cheng Institute of Technology, National Defense University, Taoyuan, Taiwan (China); Ger, Ming-Der [Department of Applied Chemistry and Materials Engineering, Chung Cheng Institute of Technology, National Defense University, Taoyuan, Taiwan (China)
2014-11-03
In this study, the trivalent Cr–C coatings were electroplated on stainless steel 304 (SS304) substrates for an application in bipolar plates (BPPs) that was because of coating's excellent electric conductivity and corrosion resistance. The images of scanning electron microscope showed that the thickness of the coatings was between 1.4 and 11.4 μm, which increased with increase of coating current density. The surface morphology of Cr–C plated at coating current density of 10 A/dm{sup 2} was smooth, crack- and pinhole-free, while cracks and pinholes appearing in networks were observed apparently in the deposits plated at a higher coating current density. Additionally, the C content in the coating decreased with increasing the coating current density. Moreover, the polarization curve with different coating current densities (10, 30, 50 A/dm{sup 2}) exhibited the coating prepared at 10 A/dm{sup 2} and 10 min possessing the best corrosion resistance (I{sub corr} = 9.360 × 10{sup −8} A/cm{sup 2}). The contact resistance of Cr–C plated at coating current density of 10 A/dm{sup 2} was the lowest (16.54 mΩ cm{sup 2} at 150 N cm{sup −2}), which showed great potential of application. The single cell test with Cr–C coated SS304 prepared at coating current density of 10 A/dm{sup 2} as BPPs showed the highest current density (about 791.532 mA/cm{sup 2}) and power density (about 270.150 mW/cm{sup 2}). - Highlights: • The Cr–C coatings on steel are electroplated for utilization as bipolar plate. • The electrical conductivity and corrosion resistance increase with carbon content. • The power density of Cr–C coated steel is superior to the bare steel.
Sandwich-like C@SnO2/Sn/void@C hollow spheres as improved anode materials for lithium ion batteries
Wang, Huijun; Jiang, Xinya; Chai, Yaqin; Yang, Xia; Yuan, Ruo
2018-03-01
As lithium ion batteries (LIBs) anode, SnO2 suffers fast capacity fading due to its large volume expansion during discharge/charge process. To overcome the problem, sandwich-like C@SnO2/Sn/void@C hollow spheres (referred as C@SnO2/Sn/void@C HSs) are prepared by in-situ polymerization and carbonization, using hollow SnO2 as self-template and dopamine as carbon source. The C@SnO2/Sn/void@C HSs possesses the merits of hollow and core/void/shell structure, so that they can accommodate the volume change under discharge/charge process, shorten the transmission distance of Li ions, own more contact area for the electrolyte. Thanks to these advantages, C@SnO2/Sn/void@C HSs display excellent electrochemical performance as anode materials for LIBs, which deliver a high capacity of 786.7 mAh g-1 at the current density of 0.5 A g-1 after 60 cycles. The simple synthesis method for C@SnO2/Sn/void@C HSs with special structure will provide a promising method for preparing other anode materials for LIBs.
Determination of zirconium by fluoride ion selective electrode
International Nuclear Information System (INIS)
Mahanty, B.N.; Sonar, V.R.; Gaikwad, R.; Raul, S.; Das, D.K.; Prakash, A.; Afzal, Md.; Panakkal, J.P.
2010-01-01
Full text: Zirconium is used in a wide range of applications including nuclear clad, catalytic converters, surgical appliances, metallurgical furnaces, superconductors, ceramics, lamp filaments, anti corrosive alloys and photographical purposes. Irradiation testing of U-Zr and U-Pu-Zr fuel pins has also demonstrated their feasibility as fuel in liquid metal reactors. Different methods that are employed for the determination of zirconium are spectrophotometry, potentiometry, neutron activation analysis and mass spectrometry. Ion-selective electrode (ISE), selective to zirconium ion has been studied for the direct potentiometric measurements of zirconium ions in various samples. In the present work, an indirect method has been employed for the determination of zirconium in zirconium nitrate sample using fluoride ion selective electrode. This method is based on the addition of known excess amount of fluoride ion to react with the zirconium ion to produce zirconium tetra fluoride at about pH 2-3, followed by determination of residual fluoride ion selective electrode. The residual fluoride ion concentrations were determined from the electrode potential data using calibration plot. Subsequently, zirconium ion concentrations were determined from the concentration of consumed fluoride ions. A precision of about 2% (RSD) with the mean recovery of more than 94% has been achieved for the determination of zirconium at the concentration of 4.40 X 10 -3 moles lit -1
Energy Technology Data Exchange (ETDEWEB)
Mokuno, Yoshiaki, E-mail: mokuno-y@aist.go.jp; Kato, Yukako; Tsubouchi, Nobuteru; Chayahara, Akiyoshi; Yamada, Hideaki; Shikata, Shinichi [Research Institute for Ubiquitous Energy Devices, National Institute of Advanced Industrial Science and Technology (AIST), 1-8-31 Midorigaoka, Ikeda, Osaka 563-8577 (Japan)
2014-06-23
A nitrogen-doped single crystal diamond plate with a low dislocation density is fabricated by chemical vapor deposition (CVD) from a high pressure high temperature synthetic type IIa seed substrate by ion implantation and lift-off processes. To avoid sub-surface damage, the seed surface was subjected to deep ion beam etching. In addition, we introduced a nitrogen flow during the CVD step to grow low-strain diamond at a relatively high growth rate. This resulted in a plate with low birefringence and a dislocation density as low as 400 cm{sup −2}, which is the lowest reported value for a lift-off plate. Reproducing this lift-off process may allow mass-production of single crystal CVD diamond plates with low dislocation density and consistent quality.
2008-05-30
Tribological behavior and graphitization of carbon nanotubes grown on 440C stainless steel . Tribo. Lett., 19(2):119-125, 2005. D-2 ...with a stainless steel parallel plate configuration as shown in figure 1. Due to the radial variation of the local shear stress T in the parallel...using a force transducer that is mounted below the surface. B-1 Exploded View Stainless Steel Plate Lower Fixture Microscale View Figure 1:
42 CFR 440.180 - Home or community-based services.
2010-10-01
...) If the recipients are compensated, they are compensated at less than 50 percent of the minimum wage... or above the minimum wage is unlikely and who, because of their disabilities, need intensive ongoing... SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS SERVICES: GENERAL PROVISIONS Definitions § 440.180 Home or...
A multichannel deflection plates control system for the ALF facility at the APS
International Nuclear Information System (INIS)
Deriy, B.
2006-01-01
A deflection plates control system was developed as part of SPIRIT (Single Photon Ionization/Resonant Ionization to Threshold), a new secondary neutral mass spectrometry (SNMS) instrument that uses tunable vacuum ultraviolet light from the APS ALF (Argonne Linear Free-electron laser) facility for postionization. The system comprises a crate controller with PC104 embedded computer, 32 amplifiers, and two 1-kV power supplies. Thirty-two D/A converters are used to control voltages at the deflection plates within ± 400 V with 100-mV resolution. An algorithm for simultaneous sweeping of up to 16 XY areas with 10-(micro)s time resolution also has been implemented in the embedded computer. The purpose of the system is to supply potentials to various ion optical elements for electrostatic control of keV primary and secondary ion beams in this SNMS instrument. The control system is of particular value in supplying (1) bipolar potentials for steering ions, (2) multiple potentials for octupole lenses that shape the ion beams, and (3) ramped deflection potentials for rastering the primary ion beam. The system has been in use as part of the SPIRIT instrument at the ALF facility since 2002.
Ayedh, H. M.; Hallén, A.; Svensson, B. G.
2015-11-01
The carbon vacancy (VC) is a prevailing point defect in high-purity 4H-SiC epitaxial layers, and it plays a decisive role in controlling the charge carrier lifetime. One concept of reducing the VC-concentration is based on carbon self-ion implantation in a near surface layer followed by thermal annealing. This leads to injection of carbon interstitials (Ci's) and annihilation of VC's in the epi-layer "bulk". Here, we show that the excess of C atoms introduced by the self-ion implantation plays a negligible role in the VC annihilation. Actually, employing normalized implantation conditions with respect to displaced C atoms, other heavier ions like Al and Si are found to be more efficient in annihilating VC's. Concentrations of VC below ˜2 × 1011 cm-3 can be reached already after annealing at 1400 °C, as monitored by deep-level transient spectroscopy. This corresponds to a reduction in the VC-concentration by about a factor of 40 relative to the as-grown state of the epi-layers studied. The negligible role of the implanted species itself can be understood from simulation results showing that the concentration of displaced C atoms exceeds the concentration of implanted species by two to three orders of magnitude. The higher efficiency for Al and Si ions is attributed to the generation of collision cascades with a sufficiently high energy density to promote Ci-clustering and reduce dynamic defect annealing. These Ci-related clusters will subsequently dissolve during the post-implant annealing giving rise to enhanced Ci injection. However, at annealing temperatures above 1500 °C, thermodynamic equilibrium conditions start to apply for the VC-concentration, which limit the net effect of the Ci injection, and a competition between the two processes occurs.
Improving nuclear safety of VVER-440 units
International Nuclear Information System (INIS)
Nochev, T.; Sabinov, S.
2001-01-01
In this paper authors deals with improvement of nuclear safety of WWER-440 units in Kozloduy NPP. Main directions for improving nuclear safety of WWER-440 units were: - to expand number of the design accident; - to increase reliability of equipment important for the safety; - to decrease the probability of initiating events; - improvements the integrity of the primary circuit (application LBB concept, qualification of the pressure safety valves to avoid pressurized thermal shock); - improvement of the fire protection; - improvement of the operation including upgrading and improvement of operational documents, implementation of new system for training the operators and etc.; - reassessment of the seismic response of the plant. Main actions were made at NPP Kozloduy to increase nuclear safety of VVER-440 units. 1. Modernization of Emergency High Pressure Safety Injection System. The modernization includes dividing of independent channels with reservation of active elements. Pumps were exchanged with more effective and reliable ones. HPSIS was increased reliability in general through decrease number of active elements and exchanged with passive. 2. For the purpose of avoiding fast cooling at the primary circuit and obtaining thermal shock of reactor vessel, Main Safety Insulation Valves are installed at NPP Kozloduy. 3. Modernization of Emergency power supplies AC. Oil breakers VMP-10 are exchanged with gas FS-4. 4. Generator breakers are installed to decrease probability of loss power supply and blackout. They provide reliable power supply to the system important for the safety in case of failure on generator. 5. I and C system has been qualified and optimized. 6. Reassessments of Limiting Conditions of Operation and new scram signals have been introduced. 7. An operators-oriented Informational System has been developed. It includes ensuring and updating of equipment data, new informational support of operator and etc. 8. A new auxiliary independent system for
Directory of Open Access Journals (Sweden)
Linqin Mu
2018-01-01
Full Text Available Organic materials, especially the carbonyl compounds, are promising anode materials for room temperature sodium-ion batteries owing to their high reversible capacity, structural diversity as well as eco-friendly synthesis from bio-mass. Herein, we report a novel anthraquinone derivative, C14H6O4Na2 composited with carbon nanotube (C14H6O4Na2-CNT, used as an anode material for sodium-ion batteries in ether-based electrolyte. The C14H6O4Na2-CNT electrode delivers a reversible capacity of 173 mAh g−1 and an ultra-high initial Coulombic efficiency of 98% at the rate of 0.1 C. The capacity retention is 82% after 50 cycles at 0.2 C and a good rate capability is displayed at 2 C. Furthermore, the average Na insertion voltage of 1.27 V vs. Na+/Na makes it a unique and safety battery material, which would avoid Na plating and formation of solid electrolyte interface. Our contribution provides new insights for designing developed organic anode materials with high initial Coulombic efficiency and improved safety capability for sodium-ion batteries.
Wang, H. B.; Wen, W. Q.; Huang, Z. K.; Zhang, D. C.; Hai, B.; Zhu, X. L.; Zhao, D. M.; Yang, J.; Li, J.; Li, X. N.; Mao, L. J.; Mao, R. S.; Wu, J. X.; Yang, J. C.; Yuan, Y. J.; Eidam, L.; Winters, D.; Beck, T.; Kiefer, D.; Rein, B.; Walther, Th.; Loeser, M.; Schramm, U.; Siebold, M.; Bussmann, M.; Ma, X.
2017-10-01
We report on an experiment that was conducted in preparation of laser cooling experiments at the heavy-ion storage ring CSRe. The lifetimes of ion beams made up of 12C3+ and 16O4+ ions stored at an energy of 122 MeV/u in the CSRe were determined by two independent methods, firstly via a DC current transformer (DCCT) and secondly via a Schottky resonator. Using electron-cooling, the signals of the 12C3+ and 16O4+ ions could be separated and clearly observed in the Schottky spectrum. The obtained individual lifetimes of the 12C3+ and 16O4+ components were 23.6 s and 17.8 s, respectively. The proportion of 12C3+ ions in the stored ion beam was measured to be more than 70% at the beginning of the injection and increasing as a function of time. In addition to these measurements, the operation and remote control of a pulsed laser system placed directly next to the storage ring was tested in a setup similar to the one envisaged for future laser experiments.
International Nuclear Information System (INIS)
Bernard, J.; Wei, B.; Bourgey, A.; Bredy, R.; Chen, L.; Kerleroux, M.; Martin, S.; Montagne, G.; Salmoun, A.; Terpend-Ordaciere, B.
2007-01-01
We employed a conic-electrode electrostatic ion resonator (ConeTrap) to store the recoil ions (C 60 r+ ) resulting from collision between 56keV Ar 8+ ions and C 60 in order to study their stability over a long time range (several milliseconds). The originality of our method, based on the trapping of a single ion to preserve the detection in coincidence of all the products of the collision, is presented in detail. Our results show that C 60 ions produced in such collisions are stable in the considered observation time. By employing the ConeTrap as a secondary mass spectrometer in order to let the ions oscillate only for a single period, we have been able to observe delayed evaporation of cold C 60 3+ ions 20μs after the collision. We interpret quantitatively the relative yields of daughter ions with a cascade model in which the transition rates are estimated via the commonly used Arrhenius law, taking into account the contribution of the radiative decay
Energy Technology Data Exchange (ETDEWEB)
Pavlov, D.; Nikolov, P.; Rogachev, T. [Institute of Electrochemistry and Energy Systems, Bulgarian Academy of Sciences, Acad. Georgi Bonchev Street, bl. 10, Sofia 1113 (Bulgaria)
2010-07-15
Lead-acid batteries operated in the high-rate partial-state-of-charge (HRPSoC) duty rapidly lose capacity on cycling, because of sulfation of the negative plates. As the battery operates from a partially discharged state, the small PbSO{sub 4} crystals dissolve and precipitate onto the bigger crystals. The latter have low solubility and hence PbSO{sub 4} accumulates progressively in the negative plates causing capacity loss. In order to suppress this process, the rate of the charge process should be increased. In a previous publication of ours we have established that reduction of Pb{sup 2+} ions to Pb may proceed on the surface of both Pb and carbon black particles. Hence, the reversibility of the charge-discharge processes improves, which leads to improved cycle life performance of the batteries in the HRPSoC mode. However, not all carbon forms accelerate the charge processes. The present paper discusses the electrochemical properties of two groups of carbon blacks: Printex and active carbons. The influence of Vaniseprse A and BaSO{sub 4} (the other two components of the expander added to the negative plates) on the reversibility of the charge-discharge processes on the negative plates is also considered. It has been established that lignosulfonates are adsorbed onto the lead surface and retard charging of the battery. BaSO{sub 4} has the opposite effect, which improves the reversibility of the processes on cycling and hence prolongs battery life in the HRPSoC duty. It has been established that the cycle life of lead-acid cells depends on the type of carbon black or active carbon added to the negative plates. When the carbon particles are of nano-sizes (<180 nm), the HRPSoC cycle life is between 10,000 and 20,000 cycles. Lignosulfonates suppress this beneficial effect of carbon black and activated carbon additives to about 10,000 cycles. Cells with active carbons have the longest cycle life when they contain also BaSO{sub 4} but no lignosulfonate. A summary of
International Nuclear Information System (INIS)
Richards, Justin Frederick
2015-01-01
A crucial aspect of advancing in renewable energies is the development of affordable decentralized storage systems for the local or regional distribution grid. A technology with great potential is the all-vanadium redox-flow battery (VRFB) with the distinct feature of individual scalable power and capacity. The present work focusses on one of the essential parts in the redox-flow cell; the bipolar plates. By the application of metallic substrates instead of state-of-the-arte graphite composite plates, the design of the cell isn't limited anymore to the mechanical properties or fabrication process of the material. Although metals possess high ductility, which eases the production of such plates, they are prone to corrosion in the high acidic environment of the battery electrolyte. Therefore in this study amorphous carbon coatings (a-C:H) are investigated for corrosion protection. To attain the need of high electrical conductivity the carbon matrices is doped with a metallic element. Preferably refractory metals such as titanium, vanadium, chromium and tungsten were investigated as possible dopants. The electrochemical tests of the samples revealed less degradation the higher the coating thickness was. This can be found on all metallic substrates (material number: 1.4301, 3.7165 and 3.3535). Regarding the hydrogen overpotential, which is an essential value for the suppression of side reactions on the anode, the dominating factor was found to be the sort of doping material as well as the composition of the metallic adhesive layer between coating and substrate. Pores in the coating originate from defects in the substrates as well as from contaminations during the coating process. To understand the degradation mechanism an in-situ-corrosion cell was developed. By the means of these results, delamination could be found to be the predominant factor concerning degradation mechanisms at cathodic potentials. The degradation is initialized at the defects or at the edges
Gas separation techniques with liquid Ar for production of 11C ions
International Nuclear Information System (INIS)
Hojo, Satoru; Honma, Toshihiro; Kanazawa, Mitsutaka; Muramatsu, Masayuki; Sakamoto, Yukio; Sugiura, Akinori; Suzuki, Naokata; Noda, Koji
2009-01-01
Heavy-ion cancer therapy with 12 C-beam has been carried out at HIMAC (Heavy Ion Medical Accelerator in Chiba) in NIRS (National Institute of Radiological Sciences) since 1994. One of the feasibility study in HIMAC is to use a positron emitter beam such as 11 C-beam for the cancer therapy. A nuclear reaction, 14 N (p,α) 11 C will be applied in the present study; it can be expected to obtain a considerably large number of 11 C-particles by utilizing the commonly used short-lives RI production techniques for PET (Positron Emission Tomography). The amount of 11 C gas is limited in this technique. The 11 CO 2 gas was produced from N 2 gas that is irradiated high-energy proton beam. Therefore, CO 2 gas separation from N 2 gas is very important. The gas-separation techniques with cryogenic system utilizing a liquid Ar were tested by dummy gas (N 2 + 12 CO 2 ). Details of the gas-separation techniques and measurement of CO 2 partial pressure are discussed. (author)
International Nuclear Information System (INIS)
Miller, J.W.; Appleton, E.R.; Murphree, Q.C.; Gavaler, J.R.
1976-01-01
Thin films of high-T/sub c/ (21-22 0 K) Nb--Ge were analyzed using three ion bombardment techniques. The depth dependence of stoichiometry in these superconducting thin films is determined by the deconvolution of a series of Rutherford backscattering spectra using 2.0-3.2 MeV 4 He ions at several incidence and scattering angles. Confirmation of these results is provided by studying the yields of Nb and Ge characteristic X-rays as a function of the angle of beam incidence. The depth dependence of oxygen, or oxides of Nb and Ge, is of particular interest, but more difficult to determine. A very sharp ion scattering resonance 16 O (α,α) at 3.045 MeV was utilized to enhance the backscattered yield and depth sensitivity of oxygen determination. The combined use of these three techniques now provides a nearly complete and nondestructive means for the characterization of such films
Park, Jong-Moon; Kim, Ki-Young; Kim, Kyoung-Kyun; Ito, Kazuhiro; Takahashi, Makoto; Oh, Myung-Hoon
2018-03-01
Although the welding zone of direct bonding between a TiAl alloy and SCM440 can be obtained by friction welding, martensitic transformation and the formation of intermetallic compounds (IMCs) and cracks result in a lower tensile strength of the joints relative to those of other welding techniques. Insert metals were used as a buffer layer to relieve stress while increasing the bond strength. In this study, the microstructure and mechanical properties on welded joints of a TiAl alloy and SCM440 with various insert metals, were investigated. The TiAl/Cu/SCM440 and TiAl/Ni/SCM440 joints were fabricated using a servo-motor-type friction welding machine. As a result, it was confirmed that the formation of a welding flash was dependent on the insert metal type, and the strength of the base metal. At the TiAl/Cu/SCM440 interface, the formation of IMCs CuTiAl and Cu2TiAl was observed at TiAl/Cu, while no IMC formation was observed at Cu/SCM440. On the other hand, at the TiAl/Ni/SCM440 interface, several IMCs with more than 100 μm thickness were found, and roughly two compositions, viz., Ti2NiAl3 and TiNi2Al, were observed at the TiAl/Ni interface. At the Ni/SCM440 interface, 10 μm-thick FeNi and others were found.
Park, Jong-Moon; Kim, Ki-Young; Kim, Kyoung-Kyun; Ito, Kazuhiro; Takahashi, Makoto; Oh, Myung-Hoon
2018-05-01
Although the welding zone of direct bonding between a TiAl alloy and SCM440 can be obtained by friction welding, martensitic transformation and the formation of intermetallic compounds (IMCs) and cracks result in a lower tensile strength of the joints relative to those of other welding techniques. Insert metals were used as a buffer layer to relieve stress while increasing the bond strength. In this study, the microstructure and mechanical properties on welded joints of a TiAl alloy and SCM440 with various insert metals, were investigated. The TiAl/Cu/SCM440 and TiAl/Ni/SCM440 joints were fabricated using a servo-motor-type friction welding machine. As a result, it was confirmed that the formation of a welding flash was dependent on the insert metal type, and the strength of the base metal. At the TiAl/Cu/SCM440 interface, the formation of IMCs CuTiAl and Cu2TiAl was observed at TiAl/Cu, while no IMC formation was observed at Cu/SCM440. On the other hand, at the TiAl/Ni/SCM440 interface, several IMCs with more than 100 μm thickness were found, and roughly two compositions, viz., Ti2NiAl3 and TiNi2Al, were observed at the TiAl/Ni interface. At the Ni/SCM440 interface, 10 μm-thick FeNi and others were found.
Influence of Si ion implantation on structure and morphology of g-C{sub 3}N{sub 4}
Energy Technology Data Exchange (ETDEWEB)
Varalakshmi, B.; Sreenivasulu, K.V. [School of Engineering Sciences and Technology (SEST), University of Hyderabad, Hyderabad 500046 (India); Asokan, K. [Inter University Accelerator Centre (IUAC), Aruna Asaf Ali Marg, Near Vasant Kunj, New Delhi 110067 (India); Srikanth, V.V.S.S., E-mail: vvsssse@uohyd.ernet.in [School of Engineering Sciences and Technology (SEST), University of Hyderabad, Hyderabad 500046 (India)
2016-07-15
Effect of Si ion implantation on structural and morphological features of graphite-like carbon nitride (g-C{sub 3}N{sub 4}) was investigated. g-C{sub 3}N{sub 4} was prepared by using a simple atmospheric thermal decomposition process. The g-C{sub 3}N{sub 4} pellets were irradiated with a Si ion beam of energy 200 keV with different fluencies. Structural, morphological and elemental, and phase analysis of the implanted samples in comparison with the pristine samples was carried out by using X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM) with energy dispersive spectroscopy (EDS) and Fourier transform infrared spectroscopy (FTIR) techniques, respectively. The observations revealed that Si ion implantation results in a negligible change in the crystallite size and alteration of the network-like to the sheet-like morphology of g-C{sub 3}N{sub 4} and Si ions in the g-C{sub 3}N{sub 4} network.
Study of the H+, F- and C2O42- ions effect on the Columbo-Tantalites dissolution
International Nuclear Information System (INIS)
Rodriguez, Mario; Ruiz, Maria del Carmen
2003-01-01
The dissolution reaction of Nb, Ta, Fe and Mn in aqueous solutions of HF, HF-H 2 C 2 O 4 , HF-Na 2 C 2 O 4 and H 2 C 2 O 4 -NaF mixtures, using columbo-tantalites of the San Luis Province, has been studied using a Parr autoclave.The temperature range investigated in this work is between 340 and 396 K.At the moment, the experimental data show that the presence of H + and F - ions in the leaching solution is necessary to produce an appreciable dissolution of columbo-tantalite.Also, the presence of C 2 O 4 2- ions favors the mineral dissolution.On the other hand, both the rise of the H + , F - and C 2 O 4 2- ions concentrations and the increase temperature lead to higher Nb and Ta extractions.Moreover, the presence of the Na + of ion in the leaching media induce the formation of Nb and/or Ta insoluble complexes that settle on the residue
SnTe-TiC-C composites as high-performance anodes for Li-ion batteries
Son, Seung Yeon; Hur, Jaehyun; Kim, Kwang Ho; Son, Hyung Bin; Lee, Seung Geol; Kim, Il Tae
2017-10-01
Intermetallic SnTe composites dispersed in a conductive TiC/C hybrid matrix are synthesized by high-energy ball milling (HEBM). The electrochemical performances of the composites as potential anodes for Li-ion batteries are evaluated. The structural and morphological characteristics of the SnTe-TiC-C composites with various TiC contents are investigated by X-ray diffraction (XRD) and high-resolution transmission electron microscopy, which reveal that SnTe and TiC are uniformly dispersed in a carbon matrix. The electrochemical performance is significantly improved by introducing TiC to the SnTe-C composite; higher TiC contents result in better performances. Among the prepared composites, the SnTe-TiC (30%)-C and SnTe-TiC (40%)-C electrodes exhibit the best electrochemical performance, showing the reversible capacities of, respectively, 652 mAh cm-3 and 588 mAh cm-3 after 400 cycles and high rate capabilities with the capacity retentions of 75.4% for SnTe-TiC (30%)-C and 82.2% for SnTe-TiC (40%)-C at 10 A g-1. Furthermore, the Li storage reaction mechanisms of Te or Sn in the SnTe-TiC-C electrodes are confirmed by ex situ XRD.
International Nuclear Information System (INIS)
2005-06-01
This TECDOC has been developed under an International Atomic Energy Agency Coordinated Research Project (CRP) entitled Evaluation of Radiation Damage of WWER Reactor Pressure Vessels (RPV) using Database on RPV Materials to develop the guidelines for prediction of radiation damage to WWER-440 PRVs. The WWER-440 RPV was designed by OKB Gidropress, Russian Federation, the general designer. Prediction of irradiation embrittlement of RPV materials is usually done in accordance with relevant codes and standards that are based on the large amounts of information from surveillance and research programmes. The existing Russian code (standard for strength calculations of components and piping in NPPs - PNAE G 7-002-86) for the WWER RPV irradiation embrittlement assessment was approved more than twenty years ago and based mostly on the experimental data obtained in research reactors with accelerated irradiation. Nevertheless, it is still in use and generally consistent with new data. The present publication presents the analyses using all available data required for more precise prediction of radiation embrittlement of WWER-440 RPV materials. Based on the fact that it contains a large amount of data from surveillance programmes as well as research programmes, the IAEA International Database on RPV Materials (IDRPVM) is used for the detailed analysis of irradiation embrittlement of WWER RPV materials. Using IDRPVM, the guideline is developed for assessment of irradiation embrittlement of RPV ferritic materials as a result of degradation during operation. Two approaches, i.e. transition temperatures based on Charpy impact notch toughness, as well as based on static fracture toughness tests, are used in RPV integrity evaluation. The objectives of the TECDOC are the analysis of irradiation embrittlement data for WWER- 440 RPV materials using IDRPVM database, evaluation of predictive formulae depending on chemical composition of the material, neutron fluence, flux, and
Physico-chemical modification of polyethersulphone induced by high energy proton, C+ and Ne6+ ions
International Nuclear Information System (INIS)
Vinodh Kumar, S.; Biswavarathi, V.; Jal, P.; Dey, K.; Krishna, J.B.M.; Saha, A.
2004-01-01
Polyehersulphone (PES) was irradiated with 4 MeV proton, 3.6 MeV C + and 145 MeV Ne 6+ ions at different ion fluences. The ion induced spectral changes were analyzed by UV-visible and fluorescence spectroscopy. The increase in optical absorption, which shifts gradually from near UV to the visible region with increase in fluence for the three different types of bombarding ions was observed. A significant loss in fluorescence intensity with increase in fluence for three different ions was observed. (author)
Post mortem investigations of the NPP Greifswald WWER-440 reactor pressure vessels
International Nuclear Information System (INIS)
Schuhknecht, Jan; Viehrig, Hans-Werner; Weiss, Frank-Peter; Rindelhardt, Udo
2008-01-01
The paper presents first results of the post mortem investigations performed at the reactor pressure vessels (RPV) of the Russian WWER-440 type reactors. Trepans were taken from the core weld SN0.1.4 and base metal of the unit 1 RPV. This RPV was annealed after 15 years of operation and operated for two more years. At first the trepan of the core welding seam was investigated by Master Curve (MC) testing. Specimens from 5 locations through the thickness of the welding seam were tested according to ASTM E1921-05. The reference temperature T 0 was calculated with the measured fracture toughness values, K Jc , at brittle failure of the specimen. Generally the K Jc values measured on pre-cracked and side-grooved Charpy size SE(B) specimens of the investigated weld metal follow the course of the Master Curve. The K Jc values show a remarkable scatter. More values than expected lie below the 5% fractile. In addition the MC SINTAP procedure was applied to determine T 0 SINTAP of the brittle fraction of the data set. There are remarkable differences between T 0 and T 0 SINTAP indicating macroscopic inhomogeneous weld metal. The highest T 0 was about 50 C at a distance of 22 mm from the inner surface of the weld. It is 40 K higher compared with T 0 at the inner surface. This is important for the assessment of ductile-to-brittle temperatures measured with sub size Charpy specimens made of weld metal from the inner RPV wall. This material may not represent the most conservative condition. The results presented in this paper show that the Master Curve approach as adopted in the test standard ASTM E1921-05 is applicable to the investigated WWER-440 multilayer weld metal. The results are of direct importance for an advanced WWER-440 RPV integrity assessment. On the other hand the data pool is broadened for a general introduction of the MC based RPV integrity assessment in the national codes. Furthermore general experiences in the cutting of irradiated RPV steels are collected
Post mortem investigations of the NPP Greifswald WWER-440 reactor pressure vessels
Energy Technology Data Exchange (ETDEWEB)
Schuhknecht, Jan; Viehrig, Hans-Werner; Weiss, Frank-Peter; Rindelhardt, Udo [Forschungszentrum Dresden-Rossendorf e.V., Dresden (Germany). Inst. for Safety Research; Keller, Werner [Studsvik GmbH und Co. KG, Stutensee (Germany)
2008-07-01
The paper presents first results of the post mortem investigations performed at the reactor pressure vessels (RPV) of the Russian WWER-440 type reactors. Trepans were taken from the core weld SN0.1.4 and base metal of the unit 1 RPV. This RPV was annealed after 15 years of operation and operated for two more years. At first the trepan of the core welding seam was investigated by Master Curve (MC) testing. Specimens from 5 locations through the thickness of the welding seam were tested according to ASTM E1921-05. The reference temperature T{sub 0} was calculated with the measured fracture toughness values, K{sub Jc}, at brittle failure of the specimen. Generally the K{sub Jc} values measured on pre-cracked and side-grooved Charpy size SE(B) specimens of the investigated weld metal follow the course of the Master Curve. The K{sub Jc} values show a remarkable scatter. More values than expected lie below the 5% fractile. In addition the MC SINTAP procedure was applied to determine T{sub 0}{sup SINTAP} of the brittle fraction of the data set. There are remarkable differences between T{sub 0} and T{sub 0}{sup SINTAP} indicating macroscopic inhomogeneous weld metal. The highest T{sub 0} was about 50 C at a distance of 22 mm from the inner surface of the weld. It is 40 K higher compared with T{sub 0} at the inner surface. This is important for the assessment of ductile-to-brittle temperatures measured with sub size Charpy specimens made of weld metal from the inner RPV wall. This material may not represent the most conservative condition. The results presented in this paper show that the Master Curve approach as adopted in the test standard ASTM E1921-05 is applicable to the investigated WWER-440 multilayer weld metal. The results are of direct importance for an advanced WWER-440 RPV integrity assessment. On the other hand the data pool is broadened for a general introduction of the MC based RPV integrity assessment in the national codes. Furthermore general experiences in
Neurological disease mutations compromise a C-terminal ion pathway in the Na(+)/K(+)-ATPas
DEFF Research Database (Denmark)
Poulsen, Hanne; Khandelia, Himanshu; Morth, Jens Preben
2010-01-01
severe neurological diseases. This novel model for ion transport by the Na(+)/K(+)-ATPase is established by electrophysiological studies of C-terminal mutations in familial hemiplegic migraine 2 (FHM2) and is further substantiated by molecular dynamics simulations. A similar ion regulation is likely...
Neurological disease mutations compromise a C-terminal ion pathway in the Na(+)/K(+)-ATPase
DEFF Research Database (Denmark)
Poulsen, Hanne; Khandelia, Himanshu; Morth, J Preben
2010-01-01
severe neurological diseases. This novel model for ion transport by the Na(+)/K(+)-ATPase is established by electrophysiological studies of C-terminal mutations in familial hemiplegic migraine 2 (FHM2) and is further substantiated by molecular dynamics simulations. A similar ion regulation is likely...
International Nuclear Information System (INIS)
Häberlen, M.; Murphy, B.; Stritzker, B.; Lindner, J.K.N.
2012-01-01
In this paper we report on the successful reduction of tensile strain in a thin strained ion-beam synthesized 3C-SiC(1 1 1) layer on silicon. The creation of a near-interface defect structure consisting of nanometric voids and stacking fault type defects by He ion implantation and subsequent annealing yields significant relaxation in the top SiC film. The microstructure of the defect layer is studied by transmission electron microscopy, and the strain state of the 3C-SiC layer was studied by high-resolution X-ray diffraction in a parallel beam configuration. Typical process conditions for the growth of GaN films on the SiC layer were emulated by high temperature treatments in a rapid thermal annealer or a quartz tube furnace. It is found that prolonged annealing at high temperatures leads to ripening of the voids and to a weaker reduction of the tensile strain. It is shown that this problem can be overcome by the co-implantation of oxygen ions to form highly thermally stable void/extended defect structures.
Ion Acceleration by Double Layers with Multi-Component Ion Species
Good, Timothy; Aguirre, Evan; Scime, Earl; West Virginia University Team
2017-10-01
Current-free double layers (CFDL) models have been proposed to explain observations of magnetic field-aligned ion acceleration in plasmas expanding into divergent magnetic field regions. More recently, experimental studies of the Bohm sheath criterion in multiple ion species plasma reveal an equilibration of Bohm speeds at the sheath-presheath boundary for a grounded plate in a multipole-confined filament discharge. We aim to test this ion velocity effect for CFDL acceleration. We report high resolution ion velocity distribution function (IVDF) measurements using laser induced fluorescence downstream of a CFDL in a helicon plasma. Combinations of argon-helium, argon-krypton, and argon-xenon gases are ionized and measurements of argon or xenon IVDFs are investigated to determine whether ion acceleration is enhanced (or diminished) by the presence of lighter (or heavier) ions in the mix. We find that the predominant effect is a reduction of ion acceleration consistent with increased drag arising from increased gas pressure under all conditions, including constant total gas pressure, equal plasma densities of different ions, and very different plasma densities of different ions. These results suggest that the physics responsible for acceleration of multiple ion species in simple sheaths is not responsible for the ion acceleration observed in these expanding plasmas. Department of Physics, Gettysburg College.
Diffusion zinc plating of structural steels
International Nuclear Information System (INIS)
Kazakovskaya, Tatiana; Goncharov, Ivan; Tukmakov, Victor; Shapovalov, Vyacheslav
2004-01-01
The report deals with the research on diffusion zinc plating of structural steels when replacing their cyanide cadmium plating. The results of the experiments in the open air, in vacuum, in the inert atmosphere, under various temperatures (300 - 500 deg.C) for different steel brands are presented. It is shown that diffusion zinc plating in argon or nitrogen atmosphere ensures obtaining the qualitative anticorrosion coating with insignificant change of mechanical properties of steels. The process is simple, reliable, ecology pure and cost-effective. (authors)
Modeling particulate removal in plate-plate and wire-plate electrostatic precipitators
Directory of Open Access Journals (Sweden)
S Ramechecandane
2016-09-01
Full Text Available The present study is concerned with the modeling of electrically charged particles in a model plate-plate and a single wire-plate electrostatic precipitator (ESP. The particle concentration distributions for both a plate-plate and a wire-plate ESP are calculated using a modified drift flux model. Numerical investigations are performed using the modified drift flux model for particle number concentration, in addition to the RNG k - ε model for the mean turbulent flow field and the Poisson equation for the electric field. The proposed model and the outlined methodology for coupling the flow field, electric field, charging kinetics and particle concentration is applied to two model precipitators that are truly representative of a wide class of commercialized ESPs. The present investigation is quite different from the earlier studies as it does not make assumptions like a homogeneous electric field or an infinite turbulent diffusivity. The electric field calculated is a strong function of position and controls the migration velocity of particles. Hence, the proposed model can be implemented in a flow solver to obtain a full-fledged solution for any kind of ESP with no limitations on the particle number concentration, as encountered in a Lagrangian approach. The effect of turbulent diffusivity on particle number concentration in a plate-plate ESP is investigated in detail and the results obtained are compared with available experimental data. Similarly, the effect of particle size/diameter and applied electric potential on the accumulative collection performance in the case of a wire-plate ESP is studied and the results obtained are compared with available numerical data. The numerical results obtained using the modified drift flux model for both the plate-plate and wire-plate ESP are in close agreement with available experimental and numerical data.
Recombination: An important effect in multigap resistive plate chambers
International Nuclear Information System (INIS)
Doroud, K.; Afarideh, H.; Hatzifotiadou, D.; Rahighi, J.; Williams, M.C.S.; Zichichi, A.
2009-01-01
We have simulated the gas avalanche in a multigap resistive plate chamber (MRPC). The results were then compared with our data from the MRPC . Up to now, the total amount of charge produced in a gas gap is considered to be given by the total number of positive ions generated by the gas avalanches. However, the total charge generated by the simulation program is much too large and is in conflict with our data. Our data indicate that nearly 100% of the negative ions recombine with the positive ions. The recombination effect dramatically reduces the amount of charge in the gas gap: a very important feature for MRPC technology especially for the rate capability.
Simulation of the channelling of ions from MeV C{sub 60} in crystalline solids
Energy Technology Data Exchange (ETDEWEB)
Fetterman, A [Basic and Applied Physics, California Institute of Technology, Pasadena, CA (United States); Sinclair, L [Basic and Applied Physics, California Institute of Technology, Pasadena, CA (United States); Tanushev, N [Basic and Applied Physics, California Institute of Technology, Pasadena, CA (United States); Tombrello, T [Basic and Applied Physics, California Institute of Technology, Pasadena, CA (United States); Nardi, E [Department of Particle Physics, Weizmann Institute of Science Rehovot, 76100 (Israel)
2007-06-14
Simulations were performed describing the motion and breakup of energetic C{sub 60} ions interacting with crystalline targets. A hybrid algorithm was used that employs a binary collision model for the scattering of the carbon ions by the atoms of the solid, and molecular dynamics for the Coulomb interactions of the 60 carbon ions with one another. For the case of yttrium iron garnet (YIG), directions such as [1 1 0], [1 0 0], [0 1 0] and [0 0 1] demonstrate channelling for a large fraction of the C ions. For directions such as [1 1 1], [2 1 1] and [7 5 3] the trajectories show no more channelling than for random directions. The effects of tilt, shielding and wake-field interactions were investigated for YIG and {alpha}-quartz.
Mixed mobile ion effect on a.c. conductivity of boroarsenate glasses
Indian Academy of Sciences (India)
In this article we report the study of mixed mobile ion effect (MMIE) in boroarsenate glasses. DSC and a.c. electrical conductivity studies have been carried out for MgO–(25−)Li2O–50B2O3–25As2O3 glasses. It is observed that strength of MMIE in a.c. conductivity is less pronounced with increase in temperature and ...
Contribution to the WWER-440 Gd-assembly evolution
International Nuclear Information System (INIS)
Cudrnak, P.; Darilek, P.; Necas, V.
2009-01-01
Development activities, presented in the paper, contribute to the evolution of gadolinium fuel for the WWER-440 reactors. Short overview of existing and already proposed Gd-assemblies is given. Two new assembly types with improved features are described. Multiplication coefficients and pin power peaking factors of all mentioned gadolinium assemblies are compared. Animations of power distribution behaviour in selected Gd-assemblies are shown. (Authors)
International Nuclear Information System (INIS)
Bordenave-Montesquieu, D; Bordenave-Montesquieu, A; Rentenier, A; Moretto-Capelle, P
2005-01-01
The behaviour of the asymmetrical fission (AF) scheme (correlated ion distributions) against the collision conditions is investigated using H + x (x = 1-3) and He + projectiles in the 1-130 keV collision energy range. The present work is an extension of our recent publications on this topic using 11 keV protons (Rentenier et al 2004 J. Phys. B: At. Mol. Opt. Phys. 37 2429 and 2455). The threshold for AF is observed at 2 keV proton energy corresponding to a maximum deposited energy equal to about 41 eV. The main result concerns the fragment distributions resulting from AF of C r+ 60 ions, and secondary dissociation of even-n C + n fragments, which are both found to remain independent of the projectile species and collision velocity. These findings indicate that they are insensitive to the internal energy distributions of the parent ions. In addition, a contribution of binary collisions between the projectile and individual carbon atoms of the C 60 molecule to AF is identified in the C + 1 production at the lowest collision velocities, the so-called impulsive fragmentation
International Nuclear Information System (INIS)
Brunner, D; LaBombard, B; Churchill, R M; Hughes, J; Lipschultz, B; Ochoukov, R; Theiler, C; Walk, J; Rognlien, T D; Umansky, M V; Whyte, D
2013-01-01
The ion temperature is not frequently measured in the boundary of magnetic fusion devices. Comparisons among different ion temperature techniques and simulations are even rarer. Here we present a comparison of ion temperature measurements in the boundary of the Alcator C-Mod tokamak from three different diagnostics: charge exchange recombination spectroscopy (CXRS), an ion sensitive probe (ISP), and a retarding field analyzer (RFA). Comparison between CXRS and the ISP along with close examination of the ISP measurements reveals that the ISP is space charge limited. It is thus unable to measure ion temperature in the high density (>10 19 m −3 ) boundary plasma of C-Mod with its present geometry. Comparison of ion temperatures measured by CXRS and the RFA shows fair agreement. Ion and electron parallel heat flow is analyzed with a simple 1D fluid code. The code takes divertor measurements as input and results are compared to the measured ratios of upstream ion to electron temperature, as inferred respectively by CXRS and a Langmuir probe. The analysis reveals the limits of the fluid model at high Knudsen number. The upstream temperature ratio is under predicted by a factor of 2. Heat flux limiters (kinetic corrections) to the fluid model are necessary to match experimental data. The values required are found to be close to those reported in kinetic simulations. The 1D code is benchmarked against the 2D plasma fluid code UEDGE with good agreement. (paper)
Brunner, D.; LaBombard, B.; Churchill, R. M.; Hughes, J.; Lipschultz, B.; Ochoukov, R.; Rognlien, T. D.; Theiler, C.; Walk, J.; Umansky, M. V.; Whyte, D.
2013-09-01
The ion temperature is not frequently measured in the boundary of magnetic fusion devices. Comparisons among different ion temperature techniques and simulations are even rarer. Here we present a comparison of ion temperature measurements in the boundary of the Alcator C-Mod tokamak from three different diagnostics: charge exchange recombination spectroscopy (CXRS), an ion sensitive probe (ISP), and a retarding field analyzer (RFA). Comparison between CXRS and the ISP along with close examination of the ISP measurements reveals that the ISP is space charge limited. It is thus unable to measure ion temperature in the high density (>1019 m-3) boundary plasma of C-Mod with its present geometry. Comparison of ion temperatures measured by CXRS and the RFA shows fair agreement. Ion and electron parallel heat flow is analyzed with a simple 1D fluid code. The code takes divertor measurements as input and results are compared to the measured ratios of upstream ion to electron temperature, as inferred respectively by CXRS and a Langmuir probe. The analysis reveals the limits of the fluid model at high Knudsen number. The upstream temperature ratio is under predicted by a factor of 2. Heat flux limiters (kinetic corrections) to the fluid model are necessary to match experimental data. The values required are found to be close to those reported in kinetic simulations. The 1D code is benchmarked against the 2D plasma fluid code UEDGE with good agreement.
Energy Technology Data Exchange (ETDEWEB)
Rentenier, A; Bordenave-Montesquieu, A; Moretto-Capelle, P; Bordenave-Montesquieu, D [LCAR-IRSAMC, UMR 5589 Universite Paul Sabatier-CNRS, 118 rte de Narbonne, 31062 Toulouse Cedex (France)
2004-06-28
In this paper, a quantitative comparison of our experimental data for the asymmetrical fission (AF) and neutral evaporation of the C{sub 60} molecule under proton impact (part I) is made with data published by other authors and often obtained in rather different collisional systems. The comparison with multicharged ions for which more quantitative data are available is focused on. It is demonstrated that size distributions of fragments, averaged fragment sizes, branching ratios between AF and evaporation or between AF channels, are common to all the collisional systems. Differences only appear when the comparison includes the undissociated stable fullerene ion signals.
Design of the WWER-440 pressurizer
International Nuclear Information System (INIS)
Bednarek, L.
1978-01-01
The main specifications are presented of a pressurizer for the WWER-440 reactor as are factors securing operating reliability and the required life of the equipment. Ferritic-pearlite steel 22K is the basic material for the manufacture of the shell, support and couplings. The internal parts and the heads are manufactured from the 08KH18N10T chromium-nickel austenitic steel, the bolts and nuts of manholes from chromium-molybdenum steels 25KH1MF and 25KH2MFA. Quality testing of basic materials and quality control during the process of manufacture are briefly described. (Z.M.)
Precipitation formation in recrystallized nickel-plated non-sag tungsten wire
International Nuclear Information System (INIS)
Lai, Z.H.
1994-01-01
It is well established that some metals, such as palladium and nickel, can easily penetrate into tungsten by fast diffusion via crystal defects such as grain boundaries and dislocations. As a result of the fast penetration of these so called activators the recrystallization temperature of heavily drawn non-sag tungsten wire can be lower from about 2,000 C to about 1,000 C, thus the application of the tungsten wire, serving as reinforcement material in metal matrix composites used at high temperatures, is limited. An interesting question is in which form these activators exist in the recrystallized tungsten wire. It is generally believed that W-Ni intermediate compounds could form in the recrystallized material, presumably at grain boundaries. The free energy difference between the pure tungsten fibbers and the precipitating W(Ni) solid solution was suggested as the chemical driving force which governed the recrystallization process. The presence of nickel in small particles had also been observed in recrystallized grains of nickel plated tungsten wires using scanning electron microscopy (SEM) and secondary ion mass spectroscopy. These particles were considered to be nickel rich precipitates. However, a detailed investigation of the precipitation process has not been reported. In the present work an investigation of the structure, composition and distribution of nickel rich particles precipitated in recrystallized grains of nickel plated heavily drawn non-sage tungsten wires was carried out using analytical electron microscopy (AEM)
International Nuclear Information System (INIS)
Poleunis, Claude; Everaert, Emmanuel P.; Delcorte, Arnaud; Bertrand, Patrick
2006-01-01
This study deals with the secondary ion yield improvement induced by using C 60 + primary ions instead of Ga + ones to characterize human hair surfaces by ToF-SIMS. For that purpose, a bunch of hair fibres has been analysed with both ion sources. A high improvement is observed for the detection of amino acids with C 60 + primary ions as compared to Ga + ions. As an example, a yield enhancement factor greater than 3000 is found for the CNO - peak. A similar gain is observed for the positive secondary ions characteristic of the amino acids. Most of the atomic ions, such as Ca + , O - and S - , constitute minor peaks with C 60 + ions while they often dominate the spectrum in the case of Ga + ions. However, with the C 60 + source, a series of inorganic combination peaks with the elements Ca, S and O are observed in the positive spectra (i.e. HCaSO 4 + ), while they are marginal with the Ga + source. For the mass range beyond 100 m/z and in both polarities, the hair fingerprints are similar with both sources. In average, for a comparable number of primary ions per spectrum, the C 60 + ion source gives intensities between two and three orders of magnitude higher than the Ga + one
Computer simulation of range and damage distributions of He ions in SiC
International Nuclear Information System (INIS)
Miyagawa, Yoshiko; Ato, Yasuro; Miyagawa, Soji
1984-01-01
The experimental projected ranges of various heavy ions in an amorphous Si target in the energy region where the nuclear stopping dominates are compared with calculations using the computer simulation program SASAMAL with the Lenz-Jensen, Moliere, Thomas-Fermi and Kalbitzer-Oetzmann (KO) screening parameters. In most cases. the best agreement was obtained with the KO screening parameters. The projected range distributions of He ions implanted in an SiC target were calculated using SASAMAL with KO screening parameters. The agreement between the SASAMAL(KO) results and our experimental data was satisfactory when the electronic stopping parameter k=1.3 k sub(NS) was used. The energy and the depth distributions of the primary knock-on atoms and the depth distributions of the recoil energy density with various values of the displacement energy Esub(d) were also calculated using SASAMAL(KO) for He ions in SiC. (author)
Investigations of SPND noise signals in VVER-440 reactors
International Nuclear Information System (INIS)
Kiss, S.; Lipcsei, S.; Hazi, G.
2001-01-01
This paper describes and characterises SPND noise measurements of an operating VVER-440 nuclear reactor. Characteristics of the signal can be radically influenced by the geometrical properties of the detector and the cable and by the measuring arrangement. Structure of phase spectra showing propagating perturbations measured on uncompensated SPN detectors is studied through models.(author)
Multiple charge states of titanium ions in laser produced plasma
Indian Academy of Sciences (India)
An Nd:glass laser (KAMETRON) delivering 50 J energy (λ = 0.53 μm) in ... voltage on the deflection plates decides the energy (E/Z) of the charged particles to be ... of two ion groups viz fast ions (+22 to +12) and thermal ions (+11 to +1) as shown in ... ions survive the recombination losses in the early phase of expansion.
Construction safety management guide for use with DOE Order 440.1
International Nuclear Information System (INIS)
1997-01-01
DOE Order (DOE O) 440.1, Worker Protection Management for DOE Federal and Contractor Employees, establishes the framework for an effective worker protection program to reduce or eliminate accidental losses, injuries, and illnesses by providing workers with places of employment free of recognized hazards. In addition to prescribing program requirements applicable to all activities performed by DOE and its contractors, DOE O 440.1 provides specific requirements applicable only to construction activities. The intent of these construction-specific requirements is to compel the proactive management of construction safety on a project-by-project basis and, to the greatest extent possible, integrate the management of safety and health, both in terms of project personnel and management methodologies, with the management of the other primary elements of construction project performance: quality, cost and schedule
Iminium ion chemistry of mitosene DNA alkylating agents. Enriched 13C NMR and isolation studies.
Ouyang, A; Skibo, E B
2000-05-16
Described herein is a study of the reductive alkylation chemistry of mitosene antitumor agents. We employed a 13C-enriched electrophilic center to probe the fate of the iminium ion resulting from reductive activation. The 13C-labeled center permitted the identification of complex products resulting from alkylation reactions. In the case of DNA reductive alkylation, the type and number of alkylation sites were readily assessed by 13C NMR. Although there has been much excellent work done in the area of mitosene chemistry and biochemistry, the present study provides a number of new findings: (1) The major fate of the iminium ion is head-to-tail polymerization, even in dilute solutions. (2) Dithionite reductive activation results in the formation of mitosene sulfite esters as well as the previously observed sulfonate adducts. (3) The mitosene iminium ion alkylates the adenosine 6-amino group as well as the guanosine 2-amino group. The identification of the latter adduct was greatly facilitated by the 13C-label at the electrophilic center. (4) The mitosene iminium ion alkylates DNA at both nitrogen and oxygen centers without any apparent base selectivity. The complexity of mitosene reductive alkylation of DNA will require continued adduct isolation studies.
Effects of multi-pass arc welding on mechanical properties of carbon steel C25 plate
International Nuclear Information System (INIS)
Adedayo, S.M.; Babatunde, A.S.
2013-01-01
The effects of multi-pass welding on mechanical properties of C25 carbon steel plate were examined. Mild steel plate workpieces of 90 x 55 mm 2 area and 10 mm thickness with a 30 degrees vee weld-grooves were subjected to single and multi-pass welding. Toughness, hardness and tensile tests of single and multi-pass welds were conducted. Toughness values of the welds under double pass welds were higher than both single pass and unwelded alloy, at respective maximum values of 2464, 2342 and 2170 kN/m. Hardness values were reduced under double pass relative to single pass welding with both being lower than the value for unwelded alloy; the values were 40.5, 43.2 and 48.5 Rs respectively at 12 mm from the weld line. The tensile strength of 347 N/mm 2 under multi-pass weld was higher than single pass weld with value of 314 N/mm 2 . Therefore, the temperature distribution and apparent pre-heating during multi-pass welding increased the toughness and tensile strength of the weldments, but reduced the hardness. (au)
Zhang, Yan; Guo, Jingjing; Li, Lanlan; Liu, Xuewei; Yao, Xiaojun; Liu, Huanxiang
2016-10-01
The interactions of complement receptor 2 (CR2) and the degradation fragment C3d of complement component C3 play important links between the innate and adaptive immune systems. Due to the importance of C3d-CR2 interaction in the design of vaccines and inhibitors, a number of studies have been performed to investigate C3d-CR2 interaction. Many studies have indicated C3d-CR2 interactions are ionic strength-dependent. To investigate the molecular mechanism of C3d-CR2 interaction and the origin of effects of ionic strength, molecular dynamics simulations for C3d-CR2 complex together with the energetic and structural analysis were performed. Our results revealed the increased interactions between charged protein and ions weaken C3d-CR2 association, as ionic strengths increase. Moreover, ion strengths have similar effects on antigen-binding site and CR2 binding site. Meanwhile, Ala17 and Gln20 will transform between the activated and non-activated states mediated by His133 and Glu135 at different ion strengths. Our results reveal the origins of the effects of ionic strengths on C3d-CR2 interactions are due to the changes of water, ion occupancies and distributions. This study uncovers the origin of the effect of ionic strength on C3d-CR2 interaction and deepens the understanding of the molecular mechanism of their interaction, which is valuable for the design of vaccines and small molecule inhibitors. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Yanagisawa, Kazuaki
1991-10-01
Pulse irradiation at Nuclear Safety Research Reactor (NSRR) was performed using low-enriched (19.89 w% 235 U) unirradiated silicide plate-type miniature fuel which had a density of 4.8 gU/cm 3 . Experimental aims are to understand the dimensional stability and to clarify the failure threshold of the silicide plate-type miniature fuel under power transient conditions through post-pulse detail metallographic examinations. A silicide plate-type miniature fuel was loaded into an irradiation capsule and irradiated by a single pulse. Deposited energies given in the experiments were 62, 77, 116 and 154 cal/g·fuel, which lead to corresponding peak fuel plate temperatures, 201 ± 28degC, 187 ± 10degC, 418 ± 74degC and 871 ± 74degC, respectively. Below 400degC, reliability and dimensional stability of the silicide plate fuel was sustained, and the silicide plate fuel was intact. Up to 540degC, wall-through intergranular crackings occurred in the Al-3%Mg alloy cladding. With the increase of the temperature, the melting of the aluminum cladding followed by recrystallization, the denudation of fuel core and the plate-through intergranular cracking were observed. With the increase of the temperature beyond 400degC, the bowing of fuel plate became significant. Above the temperature of 640degC molten aluminum partially reacted with the fuel core, partially flowed downward under the influence of surface tension and gravity, and partially formed agglomerations. Judging from these experimental observations, the fuel-plate above 400degC tends to reduce its dimensional stability. Despite of the apparent silicide fuel-plate failure, neither generation of pressure pulse nor that of mechanical energy occurred at all. (J.P.N.)
International Nuclear Information System (INIS)
Ilieva, K.; Belousov, S.; Apostolov, T.
1998-01-01
The verification of calculated neutron fluence onto the WWER-440/230 pressure vessel is very topical task in particular referring that some of this type of reactors have been operated the major part of its design lifetime. Since the induced activity from the neutron irradiation onto the elements is a simple response of neutron flux the neutron fluence verification usually is done using the measured activity of radionuclides produced during reactor operation. Calculational and experimental results of 54 Mn induced activity of scraps from inner wall of Unit 1 reactor pressure vessel after 18th cycle and detectors irradiated behind the vessel during the 18th cycle of Unit 1 at Kozloduy NPP as well as neutron flux attenuation through the WWER-440/230 pressure vessel are presented. Neutron cross sections libraries generated on the base of ENDF/B-IV and ENDF/B-VI have been used in the calculations. The comparative analysis of evaluated activities and attenuation coefficient demonstrates the better reliability of the neutron fluence calculations by the libraries based on ENDF/B-VI than by ones on ENDF/B-IV. The extreme rarity of data for the activity of scraps from the WWER-440 reactor vessel and its combination with the data for the detectors irradiated behind the vessel makes them especially attractive for verification of calculational methods of neutron fluence onto the WWER-440 vessel with dummy cassettes loading. (author)
Negative ion emission at field electron emission from amorphous (alpha-C:H) carbon
Bernatskij, D P; Ivanov-Omskij, V I; Pavlov, V G; Zvonareva, T K
2001-01-01
The study on the electrons field emission from the plane cathode surface on the basis of the amorphous carbon film (alpha-C:H) is carried out. The methodology, making it possible to accomplish simultaneously the registration of the emission currents and visually observe the distribution of the emission centers on the plane emitter surface is developed. The analysis of the oscillograms indicated that apart from the proper electron constituent the negative ions of hydrogen (H sup - and H sub 2 sup -), carbon (C sup -) and hydrocarbon (CH sub n sup -) are observed. The ions emission is connected with the processes of formation and degradation of the local emission centers
International Nuclear Information System (INIS)
Liu Fang; Li, Carolina H.; Pisano, Albert P.; Carraro, Carlo; Maboudian, Roya
2010-01-01
Low-energy Ar + ion bombardment of polycrystalline 3C-silicon carbide (poly-SiC) films is found to be a promising surface modification method to tailor the mechanical and interfacial properties of poly-SiC. The film average stress decreases as the ion energy and the bombardment time increase. Furthermore, this treatment is found to change the strain gradient of the films from positive to negative values. The observed changes in stress and strain gradient are explained by ion peening and thermal spikes models. In addition, the poly-SiC films show a significant enhancement in corrosion resistance by this treatment, which is attributed to a reduction in surface energy and to an increase in the compressive stress in the near-surface region.
Modification of WC-Co Hard Metal by Ion Implantation with Ti+, AI+, N+, C+ and B+
International Nuclear Information System (INIS)
Rassoul, El.M.A.; Saleh, Z.A.; Waheed, A.F.; Abdel- Samad, S.M.; EI- Awadi, G.A.
2010-01-01
WC/Co hard metal was implanted by Ti + , AI + , N + , C + , and B + ions at a dose of 5x 10 17 ions/cm 2 at different energies ranging from 50 keV to 200 keV. The implanted layers were investigated by means of nano indentation, calotte measurements, SEM, X-ray diffraction XRD, tribometer and EDX. The maximum implanted zone was about 0.13 μm. The hardness of WC-Co was increased by a factor of 140% after its implantation by Ti, AI, and N and increased by a factor of 170 % after implantation by Ti + , AI + , C + , N + and B + ions as compared to the original value. Also friction coefficient of WC/Co was improved after ion implantation.
Fitriani, Pipit; Sharma, Amit Siddharth; Yoon, Dang-Hyok
2018-05-01
SiCf/SiC composites containing three different types of sintering additives viz. Sc-nitrate, Al2O3-Sc2O3, and Al2O3-Y2O3, were subjected to ion irradiation using 0.2 MeV H+ ions with a fluence of 3 × 1020 ions/m2 at room temperature. Although all composites showed volumetric swelling upon ion irradiation, SiCf/SiC with Sc-nitrate showed the smallest change followed by those with the Al2O3-Sc2O3 and Al2O3-Y2O3 additives. In particular, SiCf/SiC containing the conventional Al2O3-Y2O3 additive revealed significant microstructural changes, such as surface roughening and the formation of cracks and voids, resulting in reduced fiber pullout upon irradiation. On the other hand, the SiCf/SiC with Sc-nitrate showed the highest resistance against ion irradiation without showing any macroscopic changes in surface morphology and mechanical strength, indicating the importance of the sintering additive in NITE-based SiCf/SiC for nuclear structural applications.
SoC Estimation for Lithium-ion Batteries: Review and Future Challenges
Directory of Open Access Journals (Sweden)
Juan Pablo Rivera-Barrera
2017-11-01
Full Text Available Energy storage emerged as a top concern for the modern cities, and the choice of the lithium-ion chemistry battery technology as an effective solution for storage applications proved to be a highly efficient option. State of charge (SoC represents the available battery capacity and is one of the most important states that need to be monitored to optimize the performance and extend the lifetime of batteries. This review summarizes the methods for SoC estimation for lithium-ion batteries (LiBs. The SoC estimation methods are presented focusing on the description of the techniques and the elaboration of their weaknesses for the use in on-line battery management systems (BMS applications. SoC estimation is a challenging task hindered by considerable changes in battery characteristics over its lifetime due to aging and to the distinct nonlinear behavior. This has led scholars to propose different methods that clearly raised the challenge of establishing a relationship between the accuracy and robustness of the methods, and their low complexity to be implemented. This paper publishes an exhaustive review of the works presented during the last five years, where the tendency of the estimation techniques has been oriented toward a mixture of probabilistic techniques and some artificial intelligence.
Electron string ion sources for carbon ion cancer therapy accelerators
Boytsov, A. Yu.; Donets, D. E.; Donets, E. D.; Donets, E. E.; Katagiri, K.; Noda, K.; Ponkin, D. O.; Ramzdorf, A. Yu.; Salnikov, V. V.; Shutov, V. B.
2015-08-01
The type of the Electron String Ion Sources (ESIS) is considered to be the appropriate one to produce pulsed C4+ and C6+ ion beams for cancer therapy accelerators. In fact, the new test ESIS Krion-6T already now provides more than 1010 C4+ ions per pulse and about 5 × 109 C6+ ions per pulse. Such ion sources could be suitable to apply at synchrotrons. It has also been found that Krion-6T can provide more than 1011 C6+ ions per second at the 100 Hz repetition rate, and the repetition rate can be increased at the same or larger ion output per second. This makes ESIS applicable at cyclotrons as well. ESIS can be also a suitable type of ion source to produce the 11C radioactive ion beams. A specialized cryogenic cell was experimentally tested at the Krion-2M ESIS for pulse injection of gaseous species into the electron string. It has been shown in experiments with stable methane that the total conversion efficiency of methane molecules to C4+ ions reached 5%÷10%. For cancer therapy with simultaneous irradiation and precise dose control (positron emission tomography) by means of 11C, transporting to the tumor with the primary accelerated 11C4+ beam, this efficiency is preliminarily considered to be large enough to produce the 11C4+ beam from radioactive methane and to inject this beam into synchrotrons.
Directory of Open Access Journals (Sweden)
Dong Wang
2018-04-01
Full Text Available Purpose: Distal radial fracture is one of the most common fractures. Up to now, locking plates (LP and external fixation (EF are two conventional surgical approaches to type C radius fracture. Which method is superior has not yet reached a consensus. We try to assess the clinical effectiveness of the two interventions by this meta-analysis. Methods: We used network to search the PubMed, Embase, and Cochrane Medical Library of randomized controlled clinical trials about the type C distal radius fractures performed according to the search strategy mentioned in Cochrane Handbook 5.1.0 from Jan. 2005 to Jan. 2016. Patients in the experimental group were used LP, in the control group were included EF and other surgical approaches. Publication language was restricted to English. Studies that patient population and surgical indication did not define had been excluded. Studies must report at least one of the outcomes as follow: radial inclination, palmar tilt, ulnar variance, range of wrist flexion and extension, and range of wrist supination and pronation. The trials in which participants included children were excluded. We used Jadad study scores to appraise the study. Results: Seven studies included 162 patients (LP group and 190 patients (EF group. We compared the radial inclination, palmar tilt, ulnar variance, range of wrist flexion and extension, and range of wrist supination and pronation. The radial inclination were revealed a difference favoring LP over EF [WMD = 1.84, 95% CI (0.17, 3.50, p = 0.03] and the palmar tilt and ulnar variance was no significant difference between the two groups [(WMD = 3.61, 95% CI (0.00, 7.23, p = 0.05; WMD = 0.05, 95% CI (−0.99, 1.09, p = 0.93]. The functional activities of range of flexion and extension and range of supination and pronation between the two groups was no difference [WMD = 10.04, 95% CI (−6.88, 26.96, p = 0.24; WMD = 12.53, 95% CI (−9.99, 35.06, p = 0.28]. Conclusion
Jang, Bor Z [Centerville, OH; Zhamu, Aruna [Centerville, OH; Guo, Jiusheng [Centerville, OH
2011-02-15
This invention provides a moldable, multiple-layer composite composition, which is a precursor to an electrically conductive composite flow field plate or bipolar plate. In one preferred embodiment, the composition comprises a plurality of conductive sheets and a plurality of mixture layers of a curable resin and conductive fillers, wherein (A) each conductive sheet is attached to at least one resin-filler mixture layer; (B) at least one of the conductive sheets comprises flexible graphite; and (C) at least one resin-filler mixture layer comprises a thermosetting resin and conductive fillers with the fillers being present in a sufficient quantity to render the resulting flow field plate or bipolar plate electrically conductive with a conductivity no less than 100 S/cm and thickness-direction areal conductivity no less than 200 S/cm.sup.2.
Splitting in Dual-Phase 590 high strength steel plates
International Nuclear Information System (INIS)
Yang Min; Chao, Yuh J.; Li Xiaodong; Tan Jinzhu
2008-01-01
Charpy V-notch impact tests on 5.5 mm thick, hot-rolled Dual-Phase 590 (DP590) steel plate were evaluated at temperatures ranging from 90 deg. C to -120 deg. C. Similar tests on 2.0 mm thick DP590 HDGI steel plate were also conducted at room temperature. Splitting or secondary cracks was observed on the fractured surfaces. The mechanisms of the splitting were then investigated. Fracture surfaces were analyzed by optical microscope (OM) and scanning electron microscope (SEM). Composition of the steel plates was determined by electron probe microanalysis (EPMA). Micro Vickers hardness of the steel plates was also surveyed. Results show that splitting occurred on the main fractured surfaces of hot-rolled steel specimens at various testing temperatures. At temperatures above the ductile-brittle-transition-temperature (DBTT), -95 deg. C, where the fracture is predominantly ductile, the length and amount of splitting decreased with increasing temperature. At temperatures lower than the DBTT, where the fracture is predominantly brittle, both the length and width of the splitting are insignificant. Splitting in HDGI steel plates only appeared in specimens of T-L direction. The analysis revealed that splitting in hot-rolled plate is caused by silicate and carbide inclusions while splitting in HDGI plate results from strip microstructure due to its high content of manganese and low content of silicon. The micro Vickers hardness of either the inclusions or the strip microstructures is higher than that of the respective base steel
High-capacity FeTiO3/C negative electrode for sodium-ion batteries with ultralong cycle life
Ding, Changsheng; Nohira, Toshiyuki; Hagiwara, Rika
2018-06-01
The development of electrode materials which improve both the energy density and cycle life is one of the most challenging issues facing the practical application of sodium-ion batteries today. In this work, FeTiO3/C nanoparticles are synthesized as negative electrode materials for sodium-ion batteries. The electrochemical performance and charge-discharge mechanism of the FeTiO3/C negative electrode are investigated in an ionic liquid electrolyte at 90 °C. The FeTiO3/C negative electrode delivers a high reversible capacity of 403 mAh g-1 at a current rate of 10 mA g-1, and exhibits high rate capability and excellent cycling stability for up to 2000 cycles. The results indicate that FeTiO3/C is a promising negative electrode material for sodium-ion batteries.
International Nuclear Information System (INIS)
Lin Xiaodong
2000-01-01
Making use of a Fabry-Perot interferometer driven by a piezoelectric crystal and selecting the suitable separation of plates, the ion temperature is defined by measuring the superimposed profile of the spectral line pair of the same ionized state ions in Tokamak. The advantage of this method is to higher spectral resolution and wider spectral range select
Electron and Negative Ion Densities in C2F6 and CHF3 Containing Inductively Coupled Discharges
International Nuclear Information System (INIS)
HEBNER, GREGORY A.; MILLER, PAUL A.
1999-01-01
Electron and negative ion densities have been measured in inductively coupled discharges containing C 2 F 6 and CHF 3 . Line integrated electron density was determined using a microwave interferometer, negative ion densities were inferred using laser photodetachment spectroscopy, and electron temperature was determined using a Langmuir probe. For the range of induction powers, pressures and bias power investigated, the electron density peaked at 9 x 10 12 cm -2 (line-integrated) or approximately 9 x 10 11 cm -3 . The negative ion density peaked at approximately 1.3 x 10 11 cm -3 . A maximum in the negative ion density as a function of induction coil power was observed. The maximum is attributed to a power dependent change in the density of one or more of the potential negative ion precursor species since the electron temperature did not depend strongly on power. The variation of photodetachment with laser wavelength indicated that the dominant negative ion was F - . Measurement of the decay of the negative ion density in the afterglow of a pulse modulated discharge was used to determine the ion-ion recombination rate for CF 4 , C 2 F 6 and CHF 3 discharges
Heat analysis of the magnetic limiter plate for JT-60
International Nuclear Information System (INIS)
Nakamura, Hiroo; Ninomiya, Hiromasa; Shimizu, Masatsugu; Ohta, Mitsuru
1977-03-01
Heat analysis has been made of the magnetic limiter plate for JT-60. Test materials of the magnetic limiter plate are molybdenum, graphite, pyrolytic graphite and silicon carbide. It is assumed in calculation of the heat analysis that 10MW is deposited on the 2 cm wide surface of the magnetic limiter plate in about 10 sec. The magnetic limiter plate of pyrolytic graphite is a stack of pyrolytic graphite sheets, heat input is in the deposition plane to take advantage of the large heat conductivity along this plane. Pyrolytic graphite is the best in terms of temperature rise. The temperature of molybdenum and graphite rise up to 1800 0 C and 620 0 C, respectively, in an deposition of 10 MWx10sec. Silicon carbide is not suitable for the magnetic limiter plate. Because the plasma of the JT-60 discharges every 10 min, the average heat flux decreases to 17 w/cm 2 during the each interval. When the magnetic limiter plate has the above heat inflow, a maximum of above 1000 0 C occurs at the edge far from the joint to the thick ring of the vacuum vessel. To reduce heat load of the magnetic limiter plate, an alternating current (2 -- 5Hz) is superposed on the magnetic limiter coil current. The intersection of separatrix line and magnetic limiter plate then moves cyclically more than 10 cm. Concerning temperature distribution of the multi-groove magnetic limiter plate, its dimensions are determined by the limitation in vapor pressure to prevent the impurity inflow. (auth.)
The stopping power and energy straggling of the energetic C and O ions in polyimide
Energy Technology Data Exchange (ETDEWEB)
Mikšová, R., E-mail: miksova@ujf.cas.cz [Nuclear Physics Institute of the Academy of Science of the Czech Republic v.v.i, 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Macková, A. [Nuclear Physics Institute of the Academy of Science of the Czech Republic v.v.i, 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Slepička, P. [Department of Solid State Engineering, Institute of Chemical Technology, 166 28 Prague (Czech Republic)
2016-03-15
The stopping power and energy straggling of {sup 12}C{sup n+} and {sup 16}O{sup n+} heavy ions in the energy range 5.3–8.0 MeV in 8 μm thick polyimide (PI) foil were measured by means of an indirect transmission method using a half-covered a PIPS detector. Ions scattered from thin gold layer, under the scattering angle 150° were detected and the spectrum of ions penetrating the PI foil and without foil was recorded. The values of the experimentally determined stopping powers were compared to the calculated data by SRIM-2013 and MSTAR codes. Measured data were in good agreement with data calculated by SRIM-2013, especially for C ions was observed better agreement than for O ions. The energy straggling was determined and compared to those calculated by using Bohr’s, Bethe–Livingston and Yang models. The measured energy straggling values in the PI foil was corrected for foil roughness and thickness inhomogeneity determined from AFM. Bethe–Livingston predicting formula has been modified to make it appropriate for thicker targets. The energy straggling determined in our experiment was obtained higher than Bohr’s predicted value; the predictions by Yang are in good agreement with our experiment. Bethe–Livingston formulation of the energy straggling shows better agreement with the experimental data after the modified formula implementation which assumes that the thick target was consisted to be composed of n-number of thin layers. Influence of the charge-exchange phenomena to the energy straggling of C and O ions in PI was discussed.
International Nuclear Information System (INIS)
Ishiyama, Shintaro
2004-01-01
Target plate model (35 mm x 25 mm x 100 mm) of divertor device for fusion reactor was fabricated using low activated and light material, Si/xSiC Metal Matrix Composite (MMC) and high strength and thermal conductive SiC. This model has bonding structure of armor tile (25 mm x 25 mm x 10 mmt) of Hot Pressed (HP) and Hot Isostatic Pressed (HIP) Si/SiC (10 wt%)-MMC and substrate (25 mm x 25 mm x 100 mm) of SiC/BeO (1 wt%) with water cooling channel (φ15 mm). Armor tile material, Si/10SiC-MMC shows high thermal conductive and low resistivity with over 200 MPa peak bending strength at high temperature. This material behaves super plasticity over peak temperature corresponding to peak bending strength and low temperature brittleness of this material was improved to degrade DBTT to 673 K by optimization of Hot Press (HP) and Hot Isostatic Press (HIP) conditions. Substrate body material, SiC/1BeO behaves major characteristics of high bending strength over 500 MPa, high density of 3.2 g/cm 3 and high thermal conductivity of 270 W/m·K at room temperature. Target plate model with water cooling by 293 K and 2 MPa pressurized water at 1 m/s was exposed under 5 MW/m 2 x 30 s high heat flux H + ion beam and showed very good cooling performance and no damage was found after this test. (author)
Molecular depth profiling of trehalose using a C{sub 60} cluster ion beam
Energy Technology Data Exchange (ETDEWEB)
Wucher, Andreas [Department of Physics, University of Duisburg-Essen, D-47048 Duisburg (Germany)], E-mail: andreas.wucher@uni-due.de; Cheng Juan; Winograd, Nicholas [Department of Chemistry, Pennsylvania State University, University Park, PA 16802 (United States)
2008-12-15
Molecular depth profiling of organic overlayers was performed using a mass selected fullerene ion beam in conjunction with time-of-flight (TOF-SIMS) mass spectrometry. The characteristics of depth profiles acquired on a 300-nm trehalose film on Si were studied as a function of the impact kinetic energy and charge state of the C{sub 60} projectile ions. We find that the achieved depth resolution depends only weakly upon energy.
Energy Technology Data Exchange (ETDEWEB)
Marinkovic, N [Boris Kidric Institute of nuclear sciences, Vinca, Belgrade (Yugoslavia)
1978-07-01
For the need of in core fuel management and prediction of fuel cycle costs as well as operating of a nuclear power plant behaviour of main physical parameters and refueling scheme during approach to equilibrium operation are indispensable. An estimation of a refueling scheme during forst six years of exploitation for a commercially proven PWR reactor of WWER-440 type is shown in this paper. (author)
Phase zone plates as condensers for the Gottingen scanning x-ray microscope
International Nuclear Information System (INIS)
Hilkenbach, R.; Thieme
1987-01-01
With the Gottingen scanning x-ray microscope the synchrotron source is image by x-ray optics into a monochromatic small scan spot, through which a specimen can be moved. Hereby one part of the optics, the condenser zone plate and a pinhole, works as a linear monochromator in the wavelength region of λ = 2.36 nm to λ = 4.5 nm. The efficiency of such a condenser should be as high as possible to minimize the loss of radiation. Phase zone plates have a four times higher efficiency in the first order of diffraction than amplitude zone plates. Two condenser zone plates, KZP4 and KZP5, have been constructed so that they are well suited for the use in the scanning microscope. These zone plates have been made holographically by superposing two wavefronts of laser light in an specific designed optical arrangement and exposing the zone plate structure into a photoresist. Using reactive ion etching (RIE) the structure has been transformed into Germanium. The thickness of the zone plate has been chosen to show at λ = 2.36 nm a phase effect. The efficiency has been measured at the Berliner Elektronenspeircherring Gesellschaft fur Synchrotronstrahlung m.b.H., Berlin
Behavior of PET implanted by Ti, Ag, Si and C ion using MEVVA implantation
International Nuclear Information System (INIS)
Wu Yuguang; Zhang Tonghe; Zhang Yanwen; Zhang Huixing; Zhang Xiaoji; Zhou Gu
2001-01-01
Polyethylene terephthalane (PET) has been modified with Ti, Ag, Si and C ions from a metal vapor arc source (MEVVA). Ti, Ag, Si and C ions were implanted with acceleration voltage 40 kV to fluences ranging from 1x10 16 to 2x10 17 cm -2 . The surface of implanted PET darkened with increasing ion dose, when the metal ion dose was greater than 1x10 17 cm -2 the color changed to metallic bright. The surface resistance decreases by 5-6 orders of magnitude with increasing dose. The resistivity is stable after long-term storage. The depth of Ti- and Ag-implanted layer is approximately 150 and 80 nm measured by Rutherford backscattering (RBS), respectively. TEM photos revealed the presence of Ti and Ag nano-meter particles on the surface resulting from the high-dose implantation. Ti and Ag ion implantations improved conductivity and wear resistance significantly. The phase and structural changes were obtained by X-ray diffraction (XRD). It can be seen that nano-meter particles of Ti precipitation, TiO 2 and Ti-carbides have been formed in implanted layer. Nano-hardness of implanted PET has been measured by a nano-indenter. The results show that the surface hardness, modulus and wear resistance could be increased
Electron string ion sources for carbon ion cancer therapy accelerators
Energy Technology Data Exchange (ETDEWEB)
Boytsov, A. Yu.; Donets, D. E.; Donets, E. D.; Donets, E. E.; Ponkin, D. O.; Ramzdorf, A. Yu.; Salnikov, V. V.; Shutov, V. B. [Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Katagiri, K.; Noda, K. [National Institute of Radiological Science, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)
2015-08-15
The type of the Electron String Ion Sources (ESIS) is considered to be the appropriate one to produce pulsed C{sup 4+} and C{sup 6+} ion beams for cancer therapy accelerators. In fact, the new test ESIS Krion-6T already now provides more than 10{sup 10} C{sup 4+} ions per pulse and about 5 × 10{sup 9} C{sup 6+} ions per pulse. Such ion sources could be suitable to apply at synchrotrons. It has also been found that Krion-6T can provide more than 10{sup 11} C{sup 6+} ions per second at the 100 Hz repetition rate, and the repetition rate can be increased at the same or larger ion output per second. This makes ESIS applicable at cyclotrons as well. ESIS can be also a suitable type of ion source to produce the {sup 11}C radioactive ion beams. A specialized cryogenic cell was experimentally tested at the Krion-2M ESIS for pulse injection of gaseous species into the electron string. It has been shown in experiments with stable methane that the total conversion efficiency of methane molecules to C{sup 4+} ions reached 5%÷10%. For cancer therapy with simultaneous irradiation and precise dose control (positron emission tomography) by means of {sup 11}C, transporting to the tumor with the primary accelerated {sup 11}C{sup 4+} beam, this efficiency is preliminarily considered to be large enough to produce the {sup 11}C{sup 4+} beam from radioactive methane and to inject this beam into synchrotrons.
Energy Technology Data Exchange (ETDEWEB)
Alfonso, A., E-mail: aalz@dtu.dk [Section of Materials and Surface Engineering, Department of Mechanical Engineering, Technical University of Denmark, 2800 Lyngby (Denmark); Sino-Danish Center for Education and Research, Denmark and China (Denmark); Juul Jensen, D. [Danish-Chinese Center for Nanometals, Section of Materials Science and Advanced Characterization, Department of Wind Energy, Technical University of Denmark, Risø Campus, 4000 Roskilde (Denmark); Sino-Danish Center for Education and Research, Denmark and China (Denmark); Luo, G.-N. [Fusion Reactor Materials Science and Technology Division, Institute of Plasma Physics, Chinese Academy of Sciences, 230031 Hefei, Anhui (China); Sino-Danish Center for Education and Research, Denmark and China (Denmark); Pantleon, W. [Section of Materials and Surface Engineering, Department of Mechanical Engineering, Technical University of Denmark, 2800 Lyngby (Denmark); Association EURATOM-DTU (Denmark); Sino-Danish Center for Education and Research, Denmark and China (Denmark)
2015-10-15
Highlights: • Annealing kinetics of highly-deformed tungsten up to 190 h between 1100 °C and 1250 °C. • Loss of mechanical strength characterized by Vickers hardness measurements. • Two distinct stages of recovery and recrystallization identified and described by established models. • Activation energy of recrystallization lower than after moderate deformation of tungsten. • Comparable to activation energy of grain boundary diffusion due to abundance of low angle boundaries. - Abstract: Pure tungsten is considered as armor material for the most critical parts of fusion reactors (i.e. the divertor and the first wall), among other reasons due to its high melting point (3422 °C) and recrystallization temperature. The thermal stability of a pure tungsten plate warm-rolled to a high plastic strain by 90% thickness reduction was investigated by isothermal annealing for up to 190 h in the temperature range between 1100 °C and 1250 °C. Vickers hardness testing allowed tracking the changes in mechanical properties caused by recovery and recrystallization. The hardness evolution could be rationalized in terms of a logarithmic recovery kinetics and a Johnson–Mehl–Avrami–Kolmogorov recrystallization kinetics accounting for an incubation time of recrystallization. The observed time spans for recrystallization and the corresponding recrystallization activation energy for this highly deformed plate suggest that large plastic deformations (e.g. applied during shaping) are only suitable to produce tungsten components to be used at relatively low temperatures (up to 900 °C for a 2 years lifespan). Higher operation temperatures will lead to fast degradation of the microstructure during operation.
International Nuclear Information System (INIS)
Alfonso, A.; Juul Jensen, D.; Luo, G.-N.; Pantleon, W.
2015-01-01
Highlights: • Annealing kinetics of highly-deformed tungsten up to 190 h between 1100 °C and 1250 °C. • Loss of mechanical strength characterized by Vickers hardness measurements. • Two distinct stages of recovery and recrystallization identified and described by established models. • Activation energy of recrystallization lower than after moderate deformation of tungsten. • Comparable to activation energy of grain boundary diffusion due to abundance of low angle boundaries. - Abstract: Pure tungsten is considered as armor material for the most critical parts of fusion reactors (i.e. the divertor and the first wall), among other reasons due to its high melting point (3422 °C) and recrystallization temperature. The thermal stability of a pure tungsten plate warm-rolled to a high plastic strain by 90% thickness reduction was investigated by isothermal annealing for up to 190 h in the temperature range between 1100 °C and 1250 °C. Vickers hardness testing allowed tracking the changes in mechanical properties caused by recovery and recrystallization. The hardness evolution could be rationalized in terms of a logarithmic recovery kinetics and a Johnson–Mehl–Avrami–Kolmogorov recrystallization kinetics accounting for an incubation time of recrystallization. The observed time spans for recrystallization and the corresponding recrystallization activation energy for this highly deformed plate suggest that large plastic deformations (e.g. applied during shaping) are only suitable to produce tungsten components to be used at relatively low temperatures (up to 900 °C for a 2 years lifespan). Higher operation temperatures will lead to fast degradation of the microstructure during operation.
Hydrodynamics of a flexible plate between pitching rigid plates
Kim, Junyoung; Kim, Daegyoum
2017-11-01
The dynamics of a flexible plate have been studied as a model problem in swimming and flying of animals and fluid-structure interaction of plants and flags. Motivated by fish schooling and an array of sea grasses, we investigate the dynamics of a flexible plate closely placed between two pitching rigid plates. In most studies on passive deformation of the flexible plate, the plate is immersed in a uniform flow or a wavy flow. However, in this study, the flexible plate experiences periodic deformation by the oscillatory flow generated by the prescribed pitching motion of the rigid plates. In our model, the pitching axes of the rigid plates and the clamping position of the flexible plate are aligned on the same line. The flexible plate shows various responses depending on length and pitching frequency of rigid plates, thickness of a flexible plate, and free-stream velocity. To find the effect of each variable on the response of the flexible plate, amplitude of a trailing edge and modal contribution of a flapping motion are compared, and flow structure around the flexible plate is examined.
Swift heavy ion irradiation effects in SiC measured by positrons
Energy Technology Data Exchange (ETDEWEB)
Liszkay, L.; Kajcsos, Zs.; Szilagyi, E. [KFKI Research Inst. for Nuclear and Particle Physics, Budapest (Hungary); Havancsak, K. [Dept. for Solid State Physics, Eoetvoes Univ., Budapest (Hungary); Barthe, M.F.; Desgardin, P.; Henry, L. [CNRS Centre d' Etudes et de Recherches par Irradiation, Orleans (France); Battistig, G. [Research Inst. for Technical Physics and Materials Science, Budapest (Hungary); Skuratov, V.A. [Joint Inst. of Nuclear Research, Moscow (Russian Federation). Bogoliubov Lab. of Theoretical Physics
2001-07-01
N-type 6H SiC single crystals irradiated with swift (246 MeV) Kr ions at room temperature (the implantation depth being 21 {mu}m) were investigated by conventional positron lifetime and Doppler-broadening measurements as well as with the application of a slow positron beam. The fluence dependence of the irradiation-induced defects was studied in the 1 x 10{sup 10} - 1 x 10{sup 14} ion cm{sup -2} range. In the fluence and depth range studied, no sign of amorphization (or creation of large voids) was seen in the Kr irradiated crystals. The positron annihilation results were compared with atomic displacement calculations by TRIM. A simple model was used to describe the trapping effect and determine the relationship between the atomic displacement densities and the positron trapping. The 225 ps lifetime of the open-volume defects created suggests that the V{sub Si}-V{sub C} divacancy is the dominant trapping site in the implanted zone. (orig.)
DEFF Research Database (Denmark)
Zhang, X.D.; He, W.; Yue, Yuanzheng
2012-01-01
specific surface area (203 m2 g-1). The microsphere is composed of densely aggregated nanoparticles and interconnected nanopores. The open mesoporous structure allows lithium ions easily to penetrate into the spheres, while a thorough coating of the biocarbon network on the surface of the LiFePO4...... nanoparticles facilitates lithium ion and electron diffusion. The MP-LFP/C-NC-MS have high discharge capacity of about 158.5 mA h g−1 at the current density of 0.1 C, discharge capacity of 122 mA h g−1 at 10 C, and high capacity retention rate. Therefore the mesoporous microspheres are an ideal type of cathode......-active materials for making high-power Li-ion batteries....
Nanodosimetry in a 12C ion beam using Monte Carlo simulations
International Nuclear Information System (INIS)
Hultqvist, M.; Lillhoek, J.-E.; Lindborg, L.; Gudowska, I.; Nikjoo, H.
2010-01-01
The dose-mean lineal energy, y-bar D , has been calculated in water for irradiation with 12 C ions with initial energies 290 MeV/u. The y-bar D was evaluated from the energy distributions of carbon and secondary boron ions, and from their energy-dependent y-bar D -values. The energy distributions were obtained from simulations with the Monte Carlo code SHIELD-HIT07 and the energy-dependent y-bar D -values were obtained from ion-track simulations with PITS99 coupled with the electron transport code KURBUC. The ratio of the y-bar D -value determined in the vicinity of the Bragg peak to that calculated in a reference 60 Co γ beam was compared with the corresponding ratio of α-values from the linear-quadratic model used in fractionated radiotherapy, showing a good correlation for an object size of around 10 nm.
28 CFR 54.440 - Health and insurance benefits and services.
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Health and insurance benefits and... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 54.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
44 CFR 19.440 - Health and insurance benefits and services.
2010-10-01
... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Health and insurance benefits... Education Programs or Activities Prohibited § 19.440 Health and insurance benefits and services. Subject to § 19.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or...
22 CFR 146.440 - Health and insurance benefits and services.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
International Nuclear Information System (INIS)
Dini, J.W.; Johnson, H.R.; Jones, A.
1979-03-01
Zircaloy-2 is a difficult alloy to coat with an adherent electroplate because it easily forms a tenacious oxide film in air and aqueous solutions. Procedures reported in the literature and those developed at SLL for surmounting this problem were investigated. The best results were obtained when specimens were first etched in either an ammonium bifluoride/sulfuric acid or an ammonium bifluoride solution, plated, and then heated at 700 0 C for 1 hour in a constrained condition. Machining threads in the Zircaloy-2 for the purpose of providing sites for mechanical interlocking of the plating also proved satisfactory
Enhanced Freshwater Production Using Finned-Plate Air Gap Membrane Distillation (AGMD
Directory of Open Access Journals (Sweden)
Perves Bappy Mohammad Jabed
2017-01-01
Full Text Available Air Gap membrane distillation (AGMD, a special type of energy efficient membrane distillation process, is a technology for producing freshwater from waste water. Having some benefits over other traditional processes, this method has been able to draw attention of researchers working in the field of freshwater production technologies. In this study, a basic AGMD system with flat coolant plate has been modified using a specially designed channelled coolant plate of portable size to observe its effect over the production rate and performance of the system. Attempt has been made to increase the amount of distillate flux by using the “fin effect” of the channelled coolant plate. A finned plate have been used instead of a flat coolant plate and experiments were conducted to compare the effect. Coolant temperature and feed temperature of the system have been varied from 10°C to 25°C and 40°C to 70°C respectively. Comparing the data, around 50% to 58% distillate enhancement has been observed for channelled coolant plate. Also, it was seen that the enhancement was higher for higher feed temperatures and coolant temperatures. With these findings, a better performing AGMD module has been introduced to mitigate the scarcity of freshwater.
TEM study of damage recovery in SiC by swift Xe ion irradiation
International Nuclear Information System (INIS)
Skuratov, V.A.; O’Connell, J.; Sohatsky, A.S.; Neethling, J.
2014-01-01
The microstructure of 4H–SiC samples subsequently irradiated with low energy He (10 keV), Ti (220 keV) and high energy (167 MeV) Xe ions has been studied using cross-sectional transmission electron microscopy. It was found that xenon ions with fluences above 10 13 cm −2 restore crystallinity in a heavily damaged partially amorphous zone. No, or negligible damage recovery is observed in fully amorphized layers of silicon carbide
Advanced ion beam calorimetry for the test facility ELISE
International Nuclear Information System (INIS)
Nocentini, R.; Fantz, U.; Franzen, P.; Fröschle, M.; Heinemann, B.; Riedl, R.; Ruf, B.; Wünderlich, D.; Bonomo, F.; Pimazzoni, A.; Pasqualotto, R.
2015-01-01
The negative ion source test facility ELISE (Extraction from a Large Ion Source Experiment) is in operation since beginning of 2013 at the Max-Planck-Institut für Plasmaphysik (IPP) in Garching bei München. The large radio frequency driven ion source of ELISE is about 1×1 m 2 in size (1/2 the ITER source) and can produce a plasma for up to 1 h. Negative ions can be extracted and accelerated by an ITER-like extraction system made of 3 grids with an area of 0.1 m 2 , for 10 s every 3 minutes. A total accelerating voltage of up to 60 kV is available, i.e. a maximum ion beam power of about 1.2 MW can be produced. ELISE is equipped with several beam diagnostic tools for the evaluation of the beam characteristics. In order to evaluate the beam properties with a high level of detail, a sophisticated diagnostic calorimeter has been installed in the test facility at the end of 2013, starting operation in January 2014. The diagnostic calorimeter is split into 4 copper plates with separate water calorimetry for each of the plates. Each calorimeter plate is made of 15×15 copper blocks, which act as many separate inertial calorimeters and are attached to a copper plate with an embedded cooling circuit. The block geometry and the connection with the cooling plate are optimized to accurately measure the time-averaged power of the 10 s ion beam. The surface of the blocks is covered with a black coating that allows infrared (IR) thermography which provides a 2D profile of the beam power density. In order to calibrate the IR thermography, 48 thermocouples are installed in as many blocks, arranged in two vertical and two horizontal rows. The paper describes the beam calorimetry in ELISE, including the methods used for the IR thermography, the water calorimetry and the analytical methods for beam profile evaluation. It is shown how the maximum beam inhomogeneity amounts to 13% in average. The beam divergence derived by IR thermography ranges between 1° and 4° and
Development of a new WWER-440 fuel design
International Nuclear Information System (INIS)
Coucil, D.; Totev, T.
1998-01-01
In March 1996 British Nuclear Fuel Limited signed a contract with Imatran Voima and Paks Nuclear Power Plant to design, develop, license and supply 5 Lead Test Assemblies to the WWER-440 reactor at Loviisa in Finland. In June 1998 the manufacture of these 5 assemblies (4 fixed assemblies and 1 follower assembly) was completed. The fuel is expected to be loaded into Loviisa Unit 2 reactor during the shutdown scheduled for September of this year. (Authors)
Absolute charge-changing cross sections for fast helium ions-C sub 6 sub 0 collisions
Nose, K; Shiraishi, K; Keizaki, T; Itoh, A
2003-01-01
Absolute charge-changing cross sections for fast helium ions passing through a C sub 6 sub 0 gas target have been measured. The measurements were carried out for incident projectile energies at 1.0MeV and 1.5MeV. The measured cross sections are compared with calculated values from Bohr-Lindhard model and Bohr model. In addition, we have obtained equilibrium charge state fractions and average equilibrium charge of helium ions passing through C sub 6 sub 0 , by using the measured cross sections.
45 CFR 618.440 - Health and insurance benefits and services.
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Health and insurance benefits and services. 618....440 Health and insurance benefits and services. Subject to § 618.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its students, a recipient...
6 CFR 17.440 - Health and insurance benefits and services.
2010-01-01
... 6 Domestic Security 1 2010-01-01 2010-01-01 false Health and insurance benefits and services. 17... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 17.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
40 CFR 5.440 - Health and insurance benefits and services.
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Health and insurance benefits and... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 5.440 Health and insurance benefits and services. Subject to § 5.235(d), in providing a medical, hospital, accident, or life insurance...
38 CFR 23.440 - Health and insurance benefits and services.
2010-07-01
... Prohibited § 23.440 Health and insurance benefits and services. Subject to § 23.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its students, a... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Health and insurance...
36 CFR 1211.440 - Health and insurance benefits and services.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Health and insurance benefits... Activities Prohibited § 1211.440 Health and insurance benefits and services. Subject to § 1211.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its...
22 CFR 229.440 - Health and insurance benefits and services.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 229... on the Basis of Sex in Education Programs or Activities Prohibited § 229.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
14 CFR 1253.440 - Health and insurance benefits and services.
2010-01-01
... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Health and insurance benefits and services... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 1253.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
24 CFR 3.440 - Health and insurance benefits and services.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Health and insurance benefits and... Activities Prohibited § 3.440 Health and insurance benefits and services. Subject to § 3.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its...
31 CFR 28.440 - Health and insurance benefits and services.
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Health and insurance benefits and... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 28.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
32 CFR 196.440 - Health and insurance benefits and services.
2010-07-01
... 32 National Defense 2 2010-07-01 2010-07-01 false Health and insurance benefits and services. 196... Activities Prohibited § 196.440 Health and insurance benefits and services. Subject to § 196.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its...
13 CFR 113.440 - Health and insurance benefits and services.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Health and insurance benefits and....440 Health and insurance benefits and services. Subject to § 113.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its students, a recipient...
45 CFR 2555.440 - Health and insurance benefits and services.
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Health and insurance benefits and services. 2555... Activities Prohibited § 2555.440 Health and insurance benefits and services. Subject to § 2555.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its...
43 CFR 41.440 - Health and insurance benefits and services.
2010-10-01
... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Health and insurance benefits and services... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 41.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
International Nuclear Information System (INIS)
Terashima, Keiichi; Koda, Hiroyuki; Takeuchi, Eiichi.
1995-01-01
In order to concretely examine the application of surface reforming by ion implantation, nitrogen ion implantation was applied to the thermally refined steels S45C and SCM440 and the carburized steel SCM415, which are high versatile steels for mechanical structures, and their friction and wear characteristics were examined. The results are summarized as follows. In the surface-reformed material, in which nitrogen was implanted for the purpose of improving the seizure durability of the carburized steel, the load-frictional coefficient curve in lubricated sliding friction was similar to that of the material without implantation, but it was recognized that the load at which seizure occurred reached 2000 kgf or more, and as the amount of implantation was more, the material withstood higher load. In the lubricated sliding friction using a pin-ring type wear testing machine of the thermally refined steels and those to which implantation was applied, it was recognized that the specific wear amount was less in the implanted steels than in those without implantation. The results of the analysis of the implanted surface layers and the friction surfaces are reported. (K.I.)
Relative ion yields in mammalian cell components using C60 SIMS
Keskin, Selda; Piwowar, Alan; Hue, Jonathan; Shen, Kan; Winograd, Nicholas
2013-01-01
Time of flight secondary ion mass spectrometry has been used to better understand the influence of molecular environment on the relative ion yields of membrane lipid molecules found in high abundance in a model mammalian cell line, RAW264.7. Control lipid mixtures were prepared to simulate lipid–lipid interactions in the inner and outer leaflet of cell membranes. Compared with its pure film, the molecular ion yields of 1,2-dioleoyl-sn-glycero-3-phosphocholine and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine are suppressed when mixed with 2-dipalmitoyl-sn-glycero-3-phosphocholine. In the mixture, proton competition between 1,2-dioleoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine, and 2-dipalmitoyl-sn-glycero-3-phosphocholine led to lower ionization efficiency. The possible mechanism for ion suppression was also investigated with 1H and 13C nuclear magnetic resonance spectroscopy. The formation of a hydroxyl bond in lipid mixtures confirms the mechanism involving proton exchange with the surrounding environment. Similar effects were observed for lipid mixtures mimicking the composition of the inner leaflet of cell membranes. The secondary molecular ion yield of 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine was observed to be enhanced in the presence of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine. PMID:25140069
Electrochemical Performance of Iron Diphosphide/Carbon Tube Nanohybrids in Lithium-ion Batteries
International Nuclear Information System (INIS)
Jiang, Jun; Wang, Wenliang; Wang, Chunde; Zhang, Li; Tang, Kaibin; Zuo, Jian; Yang, Qing
2015-01-01
Graphical abstract: Display Omitted -- Highlights: • Dehydrogenated FeP 2 /C nanohybrids were fabricated via a facile annealing process. • The nanohybrids as anode in LIB show excellent cycling stability and rate capability. • C-hybrid promotes buffering volume change and increasing electroconductibility. • The process can be applied for the fabrication of many more TMPs and nanohybrids. -- Abstract: Phosphorous-rich phase iron diphosphide/carbon tube (FeP 2 /C) nanohybrids, which are synthesized via a pyrolysis process and composed of heterostructures of orthorhombic FeP 2 with conical carbon tubes, have been identified as a new anode in lithium-ion batteries. After an annealing treatment to eliminate the excessive hydrogen elements in the carbon tubes, the FeP 2 /C nanohybrids display good reversible capacity, long cycle life, and excellent rate capability. Specifically, the annealed hybrids exhibit a discharge capacity of 602 mA h g −1 on the second cycle and a discharge capacity of 435 mA h g −1 after 100 cycles at 0.1C (0.137 A g −1 ). Meanwhile, these annealed hybrids exhibit excellent rate capability, such as a reversible capability of 510 mA h g −1 , 440 mA h g −1 , 380 mA h g −1 , 330 mA h g −1 and 240 mA h g −1 at 0.25C, 0.5C, 1C, 2.5C and 5C, respectively
Electron backstream to the source plasma region in an ion source
International Nuclear Information System (INIS)
Ohara, Y.; Akiba, M.; Arakawa, Y.; Okumura, Y.; Sakuraba, J.
1980-01-01
The flux of backstream electrons to the source plasma region increases significantly with the acceleration voltage of an ion beam, so that the back plate in the arc chamber should be broken for quasi-dc operation. The flux of backstream electrons is estimated at the acceleration voltage of 50--100 kV for a proton beam with the aid of ion beam simulation code. The power flux of backstream electrons is up to about 7% of the total beam output at the acceleration voltage of 75 kV. It is pointed out that the conventional ion sources such as the duoPIGatron or the bucket source which use a magnetic field for source plasma production are not suitable for quasi-dc and high-energy ion sources, because the surface heat flux of the back plate is increased by the focusing of backstream electrons and the removal of it is quite difficult. A new ion source which has an electron beam dump in the arc chamber is proposed
WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor
International Nuclear Information System (INIS)
Josek, R.; Hudec, F.; Rypar, V.
2006-01-01
One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements
WWER 440 integrity assessment with respect to PTS events
International Nuclear Information System (INIS)
Hrazsky, M.; Mikua, M.; Hermansky, P.
1997-01-01
The present state of art in WWER 440 RPV integrity assessment with respect to PTS events utilized in Slovakia is reviewed briefly in this paper. Recent results of some PTS's (very severe) analyses, shortly described in our paper, have confirmed the necessity of elaboration of new more sophisticated procedures again. Such methodology should be based on prepared IAEA Guidance. (author). 13 refs, 1 fig
WWER 440 integrity assessment with respect to PTS events
Energy Technology Data Exchange (ETDEWEB)
Hrazsky, M; Mikua, M; Hermansky, P [Nuclear Power Plant Research Inst. Trnava Inc., Trnava (Slovakia)
1997-09-01
The present state of art in WWER 440 RPV integrity assessment with respect to PTS events utilized in Slovakia is reviewed briefly in this paper. Recent results of some PTS`s (very severe) analyses, shortly described in our paper, have confirmed the necessity of elaboration of new more sophisticated procedures again. Such methodology should be based on prepared IAEA Guidance. (author). 13 refs, 1 fig.
Evaluation of stabilization techniques for ion implant processing
Ross, Matthew F.; Wong, Selmer S.; Minter, Jason P.; Marlowe, Trey; Narcy, Mark E.; Livesay, William R.
1999-06-01
With the integration of high current ion implant processing into volume CMOS manufacturing, the need for photoresist stabilization to achieve a stable ion implant process is critical. This study compares electron beam stabilization, a non-thermal process, with more traditional thermal stabilization techniques such as hot plate baking and vacuum oven processing. The electron beam processing is carried out in a flood exposure system with no active heating of the wafer. These stabilization techniques are applied to typical ion implant processes that might be found in a CMOS production process flow. The stabilization processes are applied to a 1.1 micrometers thick PFI-38A i-line photoresist film prior to ion implant processing. Post stabilization CD variation is detailed with respect to wall slope and feature integrity. SEM photographs detail the effects of the stabilization technique on photoresist features. The thermal stability of the photoresist is shown for different levels of stabilization and post stabilization thermal cycling. Thermal flow stability of the photoresist is detailed via SEM photographs. A significant improvement in thermal stability is achieved with the electron beam process, such that photoresist features are stable to temperatures in excess of 200 degrees C. Ion implant processing parameters are evaluated and compared for the different stabilization methods. Ion implant system end-station chamber pressure is detailed as a function of ion implant process and stabilization condition. The ion implant process conditions are detailed for varying factors such as ion current, energy, and total dose. A reduction in the ion implant systems end-station chamber pressure is achieved with the electron beam stabilization process over the other techniques considered. This reduction in end-station chamber pressure is shown to provide a reduction in total process time for a given ion implant dose. Improvements in the ion implant process are detailed across
Interactions of relativistic heavy ions in thick heavy element targets and some unresolved problems
International Nuclear Information System (INIS)
Brandt, R.; Ditlov, V.A.; Pozharova, E.A.; Smirnitskij, V.A.
2005-01-01
Interactions of relativistic heavy ions with total energies above 30 GeV in thick Cu and Pb targets (≥2 cm) have been studied with various techniques. Radiochemical irradiation experiments using thick Cu targets, both in a compact form or as diluted '2π-Cu targets' have been carried out with several relativistic heavy ions, such as 44 GeV 12 C (JINR, Dubna) and 72 GeV 40 Ar (LBL, Berkeley, USA). Neutron measuring experiments using thick targets irradiated with various relativistic heavy ions up to 44 GeV 12 C have been performed at JINR. In addition, the number of 'black prongs' in nuclear interactions (due to protons with energies less than 30 MeV and emitted from the target-like interaction partner at rest) produced with 72 GeV 22 Ne ions in nuclear emulsion plates has been measured in the first nuclear interaction of the primary 22 Ne ion and in the following second nuclear interaction of the secondary heavy (Z>1) ion. Some essential results have been obtained. 1) Spallation products produced by relativistic secondary fragments in interactions ([44 GeV 12 C or 72 GeV 40 Ar]+Cu) within thick copper yield less products close to the target and much more products far away from the target as compared to primary beam interactions. This applies also to secondary particles emitted into large angles (Θ>10deg). 2) The neutron production of 44 GeV 12 C within thick Cu and Pb targets is beyond the estimated yield as based on experiments with 12 GeV 12 C. These rather independent experimental results cannot be understood with well-accepted nuclear reaction models. They appear to present unresolved problems
Twenty years of operation of WWER 440/230 units in Jaslovske Bohunice
International Nuclear Information System (INIS)
Tomek, J.
1998-01-01
It is twenty years this year since the first unit WWER 440 of Slovak Nuclear Power Plant Jaslovske Bohunice was commissioned. There are four units WWER 440 in operation Jaslovske Bohunice site. First two units of older soviet PWR design V-230 (also known as V-1) and other two units of newer V-213 type (also known as V-2). The goal of this presentation is to summarize and evaluate the operation of Unit 1 and 2 for this period of time and mainly to describe what has been done and what is planned to be done to increase the nuclear safety and operational reliability of both units. The operating organization and regulatory authority assume that an internationally acceptable level of safety will be reached by accomplishing of the upgrading program.(author)
A study on the welding characteristics of Mn-Ni-Mo type A302-C steel plate for pressure vessel
International Nuclear Information System (INIS)
Yoon, Byoung Hyun; Chang, Woong Seong; Kweon, Young Gak
2003-01-01
In order to develop ASTM A302 grade C type steel plate with excellent weldability, several steels with different chemistry have been manufactured and evaluated their mechanical properties and weldability. Trial A302-C steels have revealed tensile strength in the range of 61-67kg/mm 2 and elongation in the range of 27∼32%, depending on chemical compositions within the ASTM specification range. In case of impact toughness, trial steels showed in the range of 58-70J at 0 .deg. C. From the weldability test, the minimum preheat temperature was found to be about 150 .deg. C, and automatic welding condition satisfied the requirements of both ASTM specification and users
Energy dependence of sputtering yields of Be, Be-C and Be-W films by Be{sup +}-ions
Energy Technology Data Exchange (ETDEWEB)
Korshunov, S.N.; Guseva, M.I.; Gureev, V.M.; Neumoin, V.E.; Stoljarova, V.G. [Russian Research Center Kurchatov Inst., Moscow (Russian Federation)
1998-01-01
The energy dependence measurements of Be, Be-C and Be-W deposited layer sputtering yields by Be{sup +}-ions were performed. The ion energy was varied in the range (0.3-5.0) keV. The temperature in the process of irradiation was sustained at the level of 670 K. The mixed layers were prepared by simultaneous sputtering of pair targets, Be and C, Be and W, and Be-targets with Ar{sup +}- and Be{sup +}-ions and codeposition of the sputtered atoms on silicon collectors The codeposited layer thickness was changed in the range of (500-1000) nm. The content of oxigen in the Be, Be-C, Be-W deposited layers did not exceed 20 at.%. The mixed layer sputtering yields were compared with the experimental and calculated data, obtained for the self-sputtering yields of beryllium and carbon. It was found that the sputtering yields of the Be-C and Be deposited layers by Be{sup +}-ions in the energy range (0.3-5.0) keV are within the range between the corresponding self-sputtering yields for Be and C. The sputtering yields for the mixture Be-W are close to the corresponding self-sputtering yields of beryllium. (author)
International Nuclear Information System (INIS)
Katchadjian, P.; Desimone, C.; Ziobrowski, C.; Garcia, A.
2002-01-01
For the inspection of plate type fuel elements to be used in Research Nuclear Reactors it was applied an immersion pulse-echo ultrasonic technique. For that reason an automated movement system was implemented according to the axes X, Y and Z that allows to automate the test and to show the results obtained in format of C-Scan, facilitating the immediate identification of possible defects and making repetitive the inspection. In this work problems found during the laboratory tests and factors that difficult the inspection are commented. Also the results of C-Scans over UMo fuel elements with pattern defects are shown. Finally, the main characteristics of the transducer with the one the better results were obtained are detailed. (author)
International Nuclear Information System (INIS)
Salah, Numan; Alharbi, Najlaa D.; Habib, Sami S.; Lochab, S.P.
2015-01-01
Carbon ions beam is recently recognized as an ideal cancer treatment modality, because of its excellent local tumor control. These ions have a high relative biological effectiveness resulting from high linear energy transfer (LET) and their sharp Bragg peak. However, the dose of those energetic ions needs to be measured with great precision using a proper dosimeter. Aluminum Oxide (Al 2 O 3 ) is a highly luminescent phosphor widely used for radiation dosimetry using thermoluminesence (TL) technique. In this work nanoparticles of this material activated by different elements like Eu, Tb, Dy, Cu and Ag were evaluated for their TL response to gamma rays irradiation. Tb doped sample is found to be the most sensitive sample, which could be selected for exposure to 85 MeV C 6+ ion beam in the fluence range 10 9 –10 13 ions/cm 2 . The obtained result shows that C ion beam irradiated sample has a simple glow curve structure with a prominent glow peak at around 230 °C. This glow curve has a dosimetric peak better than those induced by gamma rays. This glow peak exhibits a linear response in the range 10 9 –10 11 ions/cm 2 , corresponding to the equivalent absorbed doses 0.285–28.5 kGy. The absorbed doses, penetration depths and main energy loss were calculated using TRIM code based on the Monte Carlo simulation. The wide linear response of Al 2 O 3 :Tb nanoparticles along with the low fading makes this low cost nanomaterial a good candidate for C ion beam dosimetry. - Highlights: • Nanoparticles of Al 2 O 3 doped with Eu, Tb, Dy, Cu and Ag were synthesised. • They were evaluated for their TL response to gamma rays and C ion beam irradiation. • Tb doped sample is the most sensitive sample to gamma rays. • Al 2 O 3 :Tb was exposed to 85 MeV C 6+ ion beam in the fluence range 10 9 -10 13 ions/cm 2 . • The glow peak induced by C ions has a linear response in the range 10 9 -10 11 ions/cm 2
Selected safety aspects of containments for nuclear power plants with WWER-440 reactors
International Nuclear Information System (INIS)
Jankowski, M.W.; Kulig, M.J.; Strupczewski, A.; Balabanov, E.D.
1996-01-01
Considerable attention has been and continues to be focused on the design and operational features that prevent the release of radioactive materials to the environment for a spectrum of accidents for the two classes of WWER-440 reactors: the older 230 model and the more recently designed 213 models. This paper, based on published and unpublished information, aims to clarify the perceptions of the Russian WWER-440 models 230 and 213 nuclear power plant containment system designs and their relevance to selected aspects of accident mitigation. It should be noted that these are unclearly and often negatively perceived, primarily because of a lack of reliable information and a poorly assembled experimental database. Conflicting statements have been made regarding the nature and the features of the plant's containment system. The paper presents a brief outline of the design of both WWER-440 models with respect to their confinement functions. Selected safety-related aspects of the accident localization systems are discussed, and the recognized shortcomings and safety merits are pointed out. The older 230 units experience high leak rates and are designed to withstand medium-size pipe breaks. The possible implications for safety are pointed out in the paper. The on going studies that concentrate on improving the system are highlighted. (orig.)
TEM study of damage recovery in SiC by swift Xe ion irradiation
Energy Technology Data Exchange (ETDEWEB)
Skuratov, V.A., E-mail: skuratov@jinr.ru [Joint Institute for Nuclear Research, Dubna (Russian Federation); O’Connell, J. [Centre for HRTEM, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa); Sohatsky, A.S. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Neethling, J. [Centre for HRTEM, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa)
2014-05-01
The microstructure of 4H–SiC samples subsequently irradiated with low energy He (10 keV), Ti (220 keV) and high energy (167 MeV) Xe ions has been studied using cross-sectional transmission electron microscopy. It was found that xenon ions with fluences above 10{sup 13} cm{sup −2} restore crystallinity in a heavily damaged partially amorphous zone. No, or negligible damage recovery is observed in fully amorphized layers of silicon carbide.
Growth of nanocomposite films from accelerated C60 ions
International Nuclear Information System (INIS)
Pukha, V E; Zubarev, E N; Drozdov, A N; Pugachov, A T; Jeong, S H; Nam, S C
2012-01-01
A beam of accelerated C 60 ions is used to deposit superhard (∼50 GPa) carbon films that exhibit high index plasticity (∼0.13-0.14) and high conductivity (up to 3000 S m -1 ). Transmission electron microscopy, Raman spectroscopy and x-ray photoelectron spectroscopy are subsequently used to study the microstructure and bond character of the deposited films. The films consist of textured graphite nanocrystals and diamond-like amorphous carbon (DLC). The graphene plane of the nanocrystals is aligned perpendicular to the film surface. It is shown that sp 2 bonds dominate in the films. The percentage of sp 3 bonds depends on the ion energy and the substrate temperature, and does not exceed 40%. The obtained results suggest that a new nanocomposite material consisting of oriented graphite nanocrystals reinforced by a DLC matrix is synthesized. A simple model is proposed to correlate the excellent mechanical properties with the observed structure. (paper)
Ion implantation damage annealing in 4H-SiC monitored by scanning spreading resistance microscopy
International Nuclear Information System (INIS)
Suchodolskis, A.; Hallen, A.; Linnarsson, M.K.; Osterman, J.; Karlsson, U.O.
2006-01-01
To obtain a better understanding of the damage annealing process and dopant defect incorporation and activation we have implanted epitaxially grown 4H-SiC layers with high doses of Al + ions. Cross-sections of the samples are investigated by scanning spreading resistance microscopy (SSRM) using a commercial atomic force microscopy (AFM). The defects caused by the implanted ions compensate for the doping and decrease the charge carrier mobility. This causes the resistivity to increase in the as-implanted regions. The calculated profile of implanted ions is in good agreement with the measured ones and shows a skewed Gaussian shape. Implanted samples are annealed up to 400 deg. C. Despite these low annealing temperatures we observe a clear improvement of the sample conductivity in the as-implanted region
10 CFR 440.21 - Weatherization materials standards and energy audit procedures.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Weatherization materials standards and energy audit... FOR LOW-INCOME PERSONS § 440.21 Weatherization materials standards and energy audit procedures. (a...) of this section describes the performance and quality standards for renewable energy systems...