WorldWideScience

Sample records for invivo screening method

  1. Integrated metabolomic analysis of the nano-sized copper particle-induced hepatotoxicity and nephrotoxicity in rats: A rapid invivo screening method for nanotoxicity

    International Nuclear Information System (INIS)

    Lei Ronghui; Wu Chunqi; Yang Baohua; Ma Huazhai; Shi Chang; Wang Quanjun; Wang Qingxiu; Yuan Ye; Liao Mingyang

    2008-01-01

    nano-copper. The data generated from the current study completely supports the fact that an integrated metabolomic approach is promising for the development of a rapid invivo screening method for nanotoxicity

  2. Phytochemical Screening and In-vivo Antipyretic Activity of the ...

    African Journals Online (AJOL)

    Purpose: To investigate the antipyretic activity of the methanol extract of Bombax malabaricum leaves (MEBM) in rats. Methods: Baker's yeast was used to induce fever in Wistar rats which were divided into four groups. The animal groups were thereafter administered MEBM (200 mg/kg), MEBM (400 mg/kg), paracetamol ...

  3. Screening for Hypoglycemic Activity on the Leaf Extracts of Nine Medicinal Plants: In-Vivo Evaluation

    Directory of Open Access Journals (Sweden)

    Aditya Arya

    2012-01-01

    Full Text Available The traditional use of certain plants by the tribal community in central India involves using the young leaves for several ailments, including hyperglycaemia; this study was performed to evaluate the effects of the leaf extracts from 9 such plants in the management of diabetes. Initially, hypoglycemic screening was performed on normal rats whose blood glucose levels were measured before and after oral or intraperitoneal (i.p. administration of the extracts at different periods. The plants were screened at doses of 250 mg/kg i.p. or 500 mg/kg orally. Of these, only Centratherum anthelminticum (Asteraceae, Cissus quadrangularis (Vitaceae, and Woodfordia fruticosa Kurz (Lythraceae significantly reduced postprandial blood glucose levels in normal glycemic rats (P < 0.001, with slight reductions effected by Sida acuta Burm F. (P = 0.002 and Parthenium hysterophorus L. (P = 0.017. The extracts that reduced postprandial blood glucose levels both orally and i.p. in the hypoglycemic screening tests were evaluated for glucose challenge in glucose tolerance tests with i.p and oral administration in overnight-fasted normal rats. The results of these tests potentiate the screening data in the management of diabetes mellitus, which requires further studies on the plants that yielded positive results to determine the active compounds in the different plant parts that are responsible for the activity.

  4. Allergic sensitization: screening methods

    DEFF Research Database (Denmark)

    Ladics, Gregory S.; Fry, Jeremy; Goodman, Richard

    2014-01-01

    potential of a novel protein. However, they would be extremely useful in the discovery and research phases of understanding the mechanisms of food allergy development, and may prove fruitful to provide information regarding potential allergenicity risk assessment of future products on a case by case basis......Experimental in silico, in vitro, and rodent models for screening and predicting protein sensitizing potential are discussed, including whether there is evidence of new sensitizations and allergies since the introduction of genetically modified crops in 1996, the importance of linear versus...... conformational epitopes, and protein families that become allergens. Some common challenges for predicting protein sensitization are addressed: (a) exposure routes; (b) frequency and dose of exposure; (c) dose-response relationships; (d) role of digestion, food processing, and the food matrix; (e) role...

  5. Methods for Screening Live Cells.

    Science.gov (United States)

    Gordeev, A A; Chetverin, A B

    2018-01-01

    Cell screening or, in other words, identification of cells with certain properties is now increasingly used in scientific and medical research, e.g., in diagnostics, drug testing, and production of cell clones with desired characteristics. In this review, we discuss existing methods of cell screening and their classification according to the cell presentation format. We describe the principles of the one-dimensional and two-dimensional formats and compare the main advantages and drawbacks of these formats. The first part describes the methods based on the 2D-format of cell presentation, when cells are immobilized in the same plane by various techniques. The second part describes the methods of the 1D-screening, when cells are aligned in a line in a stream of fluid and scanned one-by-one while passing through a detector. The final part of the review describes the method of high-performance cell analysis based on the merged gel technique. This technique combines the advantages of both 1D and 2D formats and, according to the authors, might become an effective alternative to many modern methods of cell screening.

  6. In-vivo Examples of Flow Patterns With The Fast Vector Velocity Ultrasound Method

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Lindskov; Udesen, Jesper; Gran, Fredrik

    2009-01-01

    Purpose: Conventional ultrasound methods for acquiring color flow images of the blood motion are limited by a relatively low frame rate and are restricted to only giving velocity estimates along the ultrasound beam direction. To circumvent these limitations, the Plane Wave Excitation (PWE) method...... has been proposed. Material and Methods: The PWE method can estimate the 2D vector velocity of the blood with a high frame rate. Vector velocity estimates are acquired by using the following approach: The ultrasound is not focused during the ultrasound transmission, and a full speckle image...... of the blood can be acquired for each pulse emission. The pulse is a 13 bit Barker code transmitted simultaneously from each transducer element. The 2D vector velocity of the blood is found using 2D speckle tracking between segments in consecutive speckle images. Implemented on the experimental scanner RASMUS...

  7. SU-E-T-438: Commissioning of An In-Vivo Quality Assurance Method Using the Electronic Portal Imaging Device

    Energy Technology Data Exchange (ETDEWEB)

    Morin, O; Held, M; Pouliot, J [UC San Francisco, San Francisco, CA (United States)

    2014-06-01

    Purpose: Patient specific pre-treatment quality assurance (QA) using arrays of detectors or film have been the standard approach to assure the correct treatment is delivered to the patient. This QA approach is expensive, labor intensive and does not guarantee or document that all remaining fractions were treated properly. The purpose of this abstract is to commission and evaluate the performance of a commercially available in-vivo QA software using the electronic portal imaging device (EPID) to record the daily treatments. Methods: The platform EPIgray V2.0.2 (Dosisoft), which machine model compares ratios of TMR with EPID signal to predict dose was commissioned for an Artiste (Siemens Oncology Care Systems) and a Truebeam (Varian medical systems) linear accelerator following the given instructions. The systems were then tested on three different phantoms (homogeneous stack of solid water, anthropomorphic head and pelvis) and on a library of patient cases. Simple and complex fields were delivered at different exposures and for different gantry angles. The effects of the table attenuation and the EPID sagging were evaluated. Gamma analysis of the measured dose was compared to the predicted dose for complex clinical IMRT cases. Results: Commissioning of the EPIgray system for two photon energies took 8 hours. The difference between the dose planned and the dose measured with EPIgray was better than 3% for all phantom scenarios tested. Preliminary results on patients demonstrate an accuracy of 5% is achievable in high dose regions for both 3DCRT and IMRT. Large discrepancies (>5%) were observed due to metallic structures or air cavities and in low dose areas. Flat panel sagging was visible and accounted for in the EPIgray model. Conclusion: The accuracy achieved by EPIgray is sufficient to document the safe delivery of complex IMRT treatments. Future work will evaluate EPIgray for VMAT and high dose rate deliveries. This work is supported by Dosisoft, Cachan, France.

  8. Screening of rhizospheric actinomycetes for various in-vitro and in-vivo plant growth promoting (PGP traits and for agroactive compounds

    Directory of Open Access Journals (Sweden)

    Sumaira Anwar

    2016-08-01

    Full Text Available In this study 98 rhizospheric actinomycetes were isolated from different wheat and tomato fields, Punjab, Pakistan. The isolates were characterized morphologically, biochemically and genetically and were subjected to a comprehensive in vitro screening for various plant growth promoting (PGP traits. About 30% of the isolates screened were found to be the promising plant growth promoting rhizobacteria (PGPRs, which exhibited maximum genetic similarity (up to 98-99% with different species of the genus Streptomyces by using16S rRNA gene sequencing. The most active indole acetic acid (IAA producer Streptomyces nobilis WA-3, Streptomyces Kunmingenesis WC-3 and Streptomyces enissocaesilis TA-3 produce 79.5, 79.23 and 69.26 µg/ml IAA respectively at 500µg/ml L-tryptophan. The highest concentration of soluble phosphate was produced by Streptomyces sp. WA-1 (72.13 mg/100ml and S. djakartensis TB-4 (70.36 mg/100ml. All rhizobacterial isolates were positive for siderophore, ammonia and hydrogen cyanide production. Strain S. mutabilis WD-3 showed highest concentration of ACC-deaminase (1.9 mmol /l. For in-vivo screening, seed germination and plant growth experiment were conducted by inoculating wheat (Triticum aestivum seeds with the six selected isolates. Significant increases in shoot length was observed with S. nobilis WA-3 (65 %, increased root length was recorded in case of S. nobilis WA-3 (81 % as compared to water treated control plants. Maximum increases in plant fresh weight were recorded with S. nobilis WA-3 (84 %, increased plant dry weight was recorded in case of S. nobilis WA-3 (85 % as compared to water treated control plants. In case of number of leaves, significant increase was recorded with S. nobilis WA-3 (27 % and significant increase in case of number of roots were recorded in case of strain S. nobilis WA-3 (30 % as compared to control plants. Over all the study revealed that these rhizospheric plant growth promoting (PGP Streptomyces

  9. Screening of Rhizospheric Actinomycetes for Various In-vitro and In-vivo Plant Growth Promoting (PGP) Traits and for Agroactive Compounds

    Science.gov (United States)

    Anwar, Sumaira; Ali, Basharat; Sajid, Imran

    2016-01-01

    In this study 98 rhizospheric actinomycetes were isolated from different wheat and tomato fields, Punjab, Pakistan. The isolates were characterized morphologically, biochemically, and genetically and were subjected to a comprehensive in vitro screening for various plant growth promoting (PGP) traits. About 30% of the isolates screened were found to be the promising PGP rhizobacteria (PGPRs), which exhibited maximum genetic similarity (up to 98–99%) with different species of the genus Streptomyces by using16S rRNA gene sequencing. The most active indole acetic acid (IAA) producer Streptomyces nobilis WA-3, Streptomyces Kunmingenesis WC-3, and Streptomyces enissocaesilis TA-3 produce 79.5, 79.23, and 69.26 μg/ml IAA respectively at 500 μg/ml L-tryptophan. The highest concentration of soluble phosphate was produced by Streptomyces sp. WA-1 (72.13 mg/100 ml) and S. djakartensis TB-4 (70.36 mg/100 ml). All rhizobacterial isolates were positive for siderophore, ammonia, and hydrogen cyanide production. Strain S. mutabilis WD-3 showed highest concentration of ACC-deaminase (1.9 mmol /l). For in-vivo screening, seed germination, and plant growth experiment were conducted by inoculating wheat (Triticum aestivum) seeds with the six selected isolates. Significant increases in shoot length was observed with S. nobilis WA-3 (65%), increased root length was recorded in case of S. nobilis WA-3 (81%) as compared to water treated control plants. Maximum increases in plant fresh weight were recorded with S. nobilis WA-3 (84%), increased plant dry weight was recorded in case of S. nobilis WA-3 (85%) as compared to water treated control plants. In case of number of leaves, significant increase was recorded with S. nobilis WA-3 (27%) and significant increase in case of number of roots were recorded in case of strain S. nobilis WA-3 (30%) as compared to control plants. Over all the study revealed that these rhizospheric PGP Streptomyces are good candidates to be developed as

  10. Clinical results of an EPID-based in-vivo dosimetry method for pelvic cancers treated by intensity-modulated radiation therapy.

    Science.gov (United States)

    Camilleri, J; Mazurier, J; Franck, D; Dudouet, P; Latorzeff, I; Franceries, X

    2014-09-01

    The purpose of our work was to investigate the feasibility of using an EPID-based in-vivo dosimetry method initially designed for conformal fields on pelvic dynamic IMRT fields. The method enables a point dose delivered to the patient to be calculated from the transit signal acquired with an electronic portal imaging device (EPID). After defining a set of correction factors allowing EPID pixel values to be converted into absolute doses, several tests on homogeneous water-equivalent phantoms were performed to estimate the validity of the method in reference conditions. The effects of different treatment parameters, such as delivered dose, field size dependence and patient thickness were also studied. The model was first evaluated on a group of 53 patients treated by 3D conformal radiotherapy (3DCRT) and then on 92 patients treated by IMRT, both for pelvic cancers. For each measurement, the dose was reconstructed at the isocenter (DREC) and compared with the dose calculated by our treatment planning system (DTPS). Excellent agreement was found between DREC and DTPS for both techniques. For 3DCRT treatments, the mean deviation between DREC and DTPS for the 211 in-vivo dose verifications was equal to -1.0  ±  2.2% (1SD). Concerning IMRT treatments, the averaged deviation for the 418 fields verified was equal to -0.3 ± 2.6% (1SD) proving that the method is able to reconstruct a dose for dynamic IMRT pelvic fields. Based on these results, tolerance criteria and action levels were established before its implementation in clinical routine. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  11. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  12. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  13. LANL seismic screening method for existing buildings

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O. [and others

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method.

  14. SU-F-T-218: Validation of An In-Vivo Proton Range Verification Method for Reducing the Risk of Permanent Alopecia in the Treatment of Pediatric Medulloblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Lucconi, G [Department of Medical Physics, S. Orsola-Malpighi University Hospital, Bologna (Italy); Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States); Bentefour, E; Janssens, G [Advanced Technology Group, Ion Beam Applications (IBA), Louvain la Neuve (Belgium); Deepak, S [Department of Physics, Central University of Karnataka, Karnataka 585367 (India); Weaver, K; Moteabbed, M; Lu, H-M [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States)

    2016-06-15

    Purpose: The clinical commissioning of a workflow for pre-treatment range verification/adjustment for the head treatment of pediatric medulloblastoma patients, including dose monitoring during treatment. Methods: An array of Si-diodes (DIODES Incorporated) is placed on the patient skin on the opposite side to the beam entrance. A “scout” SOBP beam, with a longer beam range to cover the diodes in its plateau, is delivered; the measured signal is analyzed and the extracted water equivalent path lengths (WEPL) are compared to the expected values, revealing if a range correction is needed. Diodes stay in place during treatment to measure dose. The workflow was tested in solid water and head phantoms and validated against independent WEPL measurements. Both measured WEPL and skin doses were compared to computed values from the TPS (XiO); a Markus chamber was used for reference dose measurements. Results: The WEPL accuracy of the method was verified by comparing it with the dose extinction method. It resulted, for both solid water and head phantom, in the sub-millimeter range, with a deviation less than 1% to the value extracted from the TPS. The accuracy of dose measurements in the fall-off part of the dose profile was validated against the Markus chamber. The entire range verification workflow was successfully tested for the mock-treatment of head phantom with the standard delivery of 90 cGy per field per fraction. The WEPL measurement revealed no need for range correction. The dose measurements agreed to better than 4% with the prescription dose. The robustness of the method and workflow, including detector array, hardware set and software functions, was successfully stress-tested with multiple repetitions. Conclusion: The performance of the in-vivo range verification system and related workflow meet the clinical requirements in terms of the needed WEPL accuracy for pretreatment range verification with acceptable dose to the patient.

  15. A NEW METHOD FOR IN-VIVO QUANTIFICATION OF CHANGES IN INITIAL ENAMEL CARIES WITH LASER FLUORESCENCE

    NARCIS (Netherlands)

    DEJONG, EDJ; SUNDSTROM, F; WESTERLING, H; TRANAEUS, S; TENBOSCH, JJ; ANGMARMANSSON, B

    1995-01-01

    A new method for the in vivo assessment of changes in initial enamel caries lesions was developed and tested. A CCD camera equipped with a high-pass filter (lambda > 520 nm) collects the fluorescence image of carious teeth, illuminated intraorally with diffuse laser light (lambda = 488 nm).

  16. In-vivo dosimetry in external radiotherapy with amorphous silicon Portal Imaging Devices: from method to clinical validation

    International Nuclear Information System (INIS)

    Boissard, Philippe

    2012-01-01

    In vivo dose verification is used to prevent major deviations between the prescribed dose and the dose really delivered to the patient. This quality control was, nationally and internationally, widely recommended by scientific organizations. In France, its implementation and its use are now regulated. To do this, small detectors are fixed on the patient skin at the beginning of the treatment. However, the treatment delay is increased and not all treatment techniques could be assessed, such as IMRT plans (Intensity Modulated Radiation Therapy). In this context, Transit dosimetry performed with Electronic Portal Imaging Devices (EPIDs) appears as an interesting alternative for in vivo dose verification. During the treatment session, a transit dose is measured with the EPID, in two dimensions, and the dose in the patient is estimated from back projection of the portal dose. This work presents a quick and simple alternative method for verification of dose delivered to the patient using photon beams. Verifications in cases of complexes patient shapes and Intensity Modulated Radiation Therapy (IMRT) have been improved by using a Clarkson-Cunningham's integration method. 46 phantom test cases were designed to assess the accuracy of the method for 4, 6, 10 and 20 MV photon beams. For some points of interest the dose reconstructed by the method is compared to the dose measured with an ionization chamber. An additional in vivo uncertainty due to day to day deviations is defined and investigated. In the same time, a clinical study was driven during three years. In vivo dosimetry was performed for 494 patients treated for various tumors sites. Most of the patients were treated for a prostate cancer using IMRT. The in vivo dose is here compared to the dose calculated by the Treatment Planning System, TPS. The results of these two ways of validations are within the accepted tolerance of classical in vivo dosimetry. From the phantom study, we have estimated that the standard

  17. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  18. The in-vivo monitoring method for traumatic brain injury of mouse based on near-infrared light intensity

    Science.gov (United States)

    Li, Weitao; Wang, Xuena; Qian, Zhiyu; Xie, Jieru; Liu, Xing

    2012-02-01

    A system based on near-infrared light intensity was used to monitor mouse model of traumatic brain injury (TBI) noninvasively. The measurement system was controlled by microcontroller. Light from a 760/850nm dual-wavelength light emitting diode was coupled to a 0.6-mm-diameter optical fiber. The collection fibers were coupled to optoelectronic detectors, which were placed in the different distance from the source fiber. The system consisted of a constant current bias, a circuit lock-in amplifier (including band pass filter, lock-in amplifier, and low pass filter), a PCI 6240 data acquisition card and a multi-core-processor computer. The modified Lambert Beer law was used to calculate the concentration of ΔHbO2 and ΔHb. The sensitivity matrix was defined to evaluate the region of effective detection of optical probe. Five groups of TBI mouse models were built by Feeney's free-falling method. The data measured by system show after TBI the concentration of ΔHbO2 decreased and that of ΔHb increased. It can be concluded that the system can be used to monitor the changes of TBI of mouse non-invasively.

  19. Diagnostic performance of screening methods for urinary ...

    African Journals Online (AJOL)

    Screening for urinary schistosomiasis has been conducted using various indirect diagnostic tests such as interview technique for unqualified haematuria, terminal haematuria and dysuria, visual examination of urine specimen for macrohaematuria, chemical reagent strip technique for microhaematuria and proteinuria, and.

  20. In-vivo examples of synthetic aperture vector flow imaging

    DEFF Research Database (Denmark)

    Oddershede, Niels; Hansen, Kristoffer Lindskov; Nielsen, Michael Bachmann

    2007-01-01

    are processed, and movies of full vector flow images are generated. This paper presents still frames from different time instances of these movies. The movie from the femoral data tracks the accelerating velocity in the femoral artery during systole and a backwards flow at the end of the systole. A complex flow...... would be needed. Synthetic aperture vector flow imaging could potentially provide this. The purpose of this paper is to test the synthetic aperture vector flow imaging method on challenging in-vivo data. Two synthetic aperture in-vivo data sets are acquired using a commercial linear array transducer...

  1. Methods for Similarity-based Virtual Screening

    Directory of Open Access Journals (Sweden)

    Thomas Greve Kristensen

    2013-02-01

    Full Text Available Developing new medical drugs is expensive. Among the first steps is a screening process, in which molecules in existing chemical libraries are tested for activity against a given target. This requires a lot of resources and manpower. Therefore it has become common to perform a virtual screening, where computers are used for predicting the activity of very large libraries of molecules, to identify the most promising leads for further laboratory experiments. Since computer simulations generally require fewer resources than physical experimentation this can lower the cost of medical and biological research significantly. In this paper we review practically fast algorithms for screening databases of molecules in order to find molecules that are sufficiently similar to a query molecule.

  2. METHODS FOR SIMILARITY-BASED VIRTUAL SCREENING

    Directory of Open Access Journals (Sweden)

    Thomas G. Kristensen

    2013-02-01

    Full Text Available Developing new medical drugs is expensive. Among the first steps is a screening process, in which molecules in existing chemical libraries are tested for activity against a given target. This requires a lot of resources and manpower. Therefore it has become common to perform a virtual screening, where computers are used for predicting the activity of very large libraries of molecules, to identify the most promising leads for further laboratory experiments. Since computer simulations generally require fewer resources than physical experimentation this can lower the cost of medical and biological research significantly. In this paper we review practically fast algorithms for screening databases of molecules in order to find molecules that are sufficiently similar to a query molecule.

  3. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  4. Effect of micro-environment modification and polymer type on the in-vitro dissolution behavior and in-vivo performance of amorphous solid dispersions.

    Science.gov (United States)

    Sun, Weiwei; Pan, Baoliang

    2017-06-15

    This study investigates the effects of micro-environment modification and polymer type on the in-vitro dissolution behavior and in-vivo performance of micro-environment pH modifying solid dispersions (pH M -SD) for the poorly water-soluble model drug Toltrazuril (TOL). Various pH M -SDs were prepared using Ca(OH) 2 as a pH-modifier in hydrophilic polymers, including polyethylene glycol 6000 (PEG6000), polyvinylpyrrolidone k30 (PVPk30) and hydroxypropyl methylcellulose (HPMC). Based on the results of physicochemical characterizations and in-vitro dissolution testing, the representative ternary (Ca(OH) 2 :TOL:PEG6000/HPMC/PVPk30=1:8:24, w/w/w) and binary (TOL:PVPk30=1:3, w/w) solid dispersions were selected and optimized to perform in-vivo pharmacokinetic study. The micro-environment pH modification improved the in-vitro water-solubility and in-vivo bioavailability of parent drug TOL. Furthermore, the addition of alkalizers not only enhanced the release and absorption of prototype drug, but also promoted the generation of active metabolites, including toltrazuril sulfoxide (TOLSO) and toltrazuril sulfone (TOLSO 2 ). The in-vitro dissolution profiles and in-vivo absorption, distribution and metabolism behaviors of the pH M -SDs varied with polymer type. Moreover, in-vivo bioavailability of three active pharmaceutical ingredients increased with an increase in in-vitro dissolution rates of the drug from the pH M -SDs prepared with various polymers. Therefore, a non-sink in-vitro dissolution method can be used to predict the in-vivo performance of pH M -SDs formulated with various polymers with trend consistency. In-vitro and in-vivo screening procedures revealed that the pH M -SD composed of Ca(OH) 2 , TOL and PVPk30 at a weight ratio of 1:8:24, of which the safety was adequately proved via histopathological examination, may be a promising candidate for providing better clinical outcomes. Copyright © 2017. Published by Elsevier B.V.

  5. Queensland Lung Cancer Screening Study: rationale, design and methods.

    Science.gov (United States)

    Marshall, H M; Bowman, R V; Crossin, J; Lau, M A; Slaughter, R E; Passmore, L H; McCaul, E M; Courtney, D A; Windsor, M N; Yang, I A; Smith, I R; Keir, B J; Hayes, T J; Redmond, S J; Zimmerman, P V; Fong, K M

    2013-02-01

    Lung cancer is the leading cause of cancer-related mortality in Australia. Screening using low-dose computed tomography (LDCT) can reduce lung cancer mortality. The feasibility of screening in Australia is unknown. This paper describes the rationale, design and methods of the Queensland Lung Cancer Screening Study. The aim of the study is to describe the methodology for a feasibility study of lung cancer screening by LDCT in Australia. The Queensland Lung Cancer Screening Study is an ongoing, prospective observational study of screening by LDCT at a single tertiary institution. Healthy volunteers at high risk of lung cancer (age 60-74 years; smoking history ≥30 pack years, current or quit within 15 years; forced expiratory volume in 1s ≥50% predicted) are recruited from the general public through newspaper advertisement and press release. Participants receive a LDCT scan of the chest at baseline, year 1 and year 2 using a multidetector helical computed tomography scanner and are followed up for a total of 5 years. Feasibility of screening will be assessed by cancer detection rates, lung nodule prevalence, optimal management strategies for lung nodules, economic costs, healthcare utilisation and participant quality of life. Studying LDCT screening in the Australian setting will help us understand how differences in populations, background diseases and healthcare structures modulate screening effectiveness. This information, together with results from overseas randomised studies, will inform and facilitate local policymaking. © 2012 The Authors; Internal Medicine Journal © 2012 Royal Australasian College of Physicians.

  6. Comparison of domestic violence screening methods: a pilot study.

    Science.gov (United States)

    Furbee, P M; Sikora, R; Williams, J M; Derk, S J

    1998-04-01

    Previous studies have indicated a number of barriers to screening for domestic violence (DV) in an emergency department setting. These barriers result in inconsistencies which determine who is screened as well as the content and quality of the information obtained, and if uncontrolled they are likely to affect measurements of DV incidence in ED populations. The objectives of this project were to design a screening tool that circumvented these barriers and sources of error; to assess whether such an alternative method of screening for DV was acceptable to our patients; and to determine whether the alternative and traditional methods of screening for DV would yield comparable results. Our hypotheses were that the alternative screening tool would be acceptable to our patients and that no significant differences would be found between the two methods. The study took place in a rural, university-affiliated ED with approximately 36,000 annual patient visits. The study population consisted of 186 women older than 18 years of age who were treated by one designated physician. Approximately half of these subjects were screened for DV in a face-to-face interview. The other half listened to a tape-recorded questionnaire and recorded their responses on a coded answer sheet. There were 175 completed screenings. The average age of all respondents was 34 years, and 90 (51%) indicated a cumulative lifetime experience of DV of some sort. Overall, 3% of the respondents indicated they were in the ED for injuries received as a result of DV. No significant differences were found between the two methods of screening for DV on any measurement, including refusals. No problems hearing the tape or understanding the instructions were reported. These results indicate that the alternative method of employing a recorded questionnaire was no less effective than the best efforts of a designated and conscientious physician. As a means of quickly assessing the prevalence of DV in an ED setting, we

  7. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... the municipality of Copenhagen in 1991, in the county of Fyn in 1993 and in the municipality of Frederiksberg in 1994, although reduced mortality in randomised controlled trials does not necessarily mean that screening also works in routine health care. In the rest of Denmark mammography screening was introdueed...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  8. Thermography is not a feasible method for breast cancer screening.

    Science.gov (United States)

    Brkljacić, Boris; Miletić, Damir; Sardanelli, Francesco

    2013-06-01

    Breast cancer is a common malignancy causing high mortality in women especially in developed countries. Due to the contribution of mammographic screening and improvements in therapy, the mortality rate from breast cancer has decreased considerably. An imaging-based early detection of breast cancer improves the treatment outcome. Mammography is generally established not only as diagnostic but also as screening tool, while breast ultrasound plays a major role in the diagnostic setting in distinguishing solid lesions from cysts and in guiding tissue sampling. Several indications are established for contrast-enhanced magnetic resonance imaging. Thermography was not validated as a screening tool and the only study performed long ago for evaluating this technology in the screening setting demonstrated very poor results. The conclusion that thermography might be feasible for screening cannot be derived from studies with small sample size, unclear selection of patients, and in which mammography and thermography were not blindly compared as screening modalities. Thermography can not be used to aspirate, biopsy or localize lesions preoperatively since no method so far was described to accurately transpose the thermographic location of the lesion to the mammogram or ultrasound and to surgical specimen. Thermography cannot be proclaimed as a screening method, without any evidence whatsoever.

  9. Screened precession method for area detectors.

    Science.gov (United States)

    Edwards, S L; Nielsen, C; Xuong, N H

    1988-04-01

    A method is presented in which the features of a Buerger-type mechanical precession camera can be simulated using an electronic area detector and a three-circle automated goniostat. The resulting display as viewed on a video monitor is very much like a conventional precession photograph. The detector is stationary which causes a distortion that is negligible for precession angles less than 10 degrees. The virtue of this new method is that a precession image may be collected very fast and the intensities of the reflections when displayed are already digitized. The usefulness of these features is presented through two familiar tasks: the determination of a new protein crystal space group and the evaluation of a heavy-atom derivative.

  10. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  11. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  12. A new method for the calculation of Sommerfeld screening ...

    Indian Academy of Sciences (India)

    A new method for the calculation of Sommerfeld screening parameter 1 in x-ray spectra. U D Misra S Chaturvedi. Research Articles ... earlier by Gokhale and Misra. The method brings out the constancy of 1(23)-1(1) in a natural way and may thus be regarded as providing theoretical explanation of the Hertz law.

  13. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  14. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  15. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    INTRODUCTION: Denmark has had an organized screening programme for cervical cancer since the 1960s. In spite of this, almost 150 Danish women die from the disease each year. There are currently two different methods for preparation of cervical samples: conventional Papanicolaou smear and liquid......-based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...

  16. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  17. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-26

    Apr 26, 2012 ... antibacterial agents by avoiding pure cultures as the first stage to increase screening efficiency. MATERIALS AND METHODS. Preparing mixed culture plates. Soil samples were collected from different locations covered with plant litter in the south of China, and all of these locations are common places, so ...

  18. A direct and sensitive method for screening fructooligosaccharides ...

    African Journals Online (AJOL)

    A direct and sensitive method for screening fructooligosaccharides-digesting microorganisms useful in food and health science. ... Short-chain fructooligosaccharides (FOS) stimulate selectively the growth and activity of microorganisms in the colon providing positive health effects and well-being in humans and animals.

  19. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  20. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  1. [Methods to increase participation in cancer screening programmes].

    Science.gov (United States)

    Giorgi Rossi, Paolo; Camilloni, Laura; Cogo, Carla; Federici, Antonio; Ferroni, Eliana; Furnari, Giacomo; Giordano, Livia; Grazzini, Grazia; Iossa, Anna; Jimenez, Beatriz; Palazzi, Mauro; Palazzo, Fabio; Spadea, Teresa; Senore, Carlo; Borgia, Piero; Guasticchi, Gabriella

    2012-01-01

    to synthesize scientific evidences about methods to increase cervical, breast and colorectal cancer screening participation. a multidisciplinary working group has been set up to define the scope of the report and to conduct the evaluation. The scope and the final evaluation have been submitted to a stakeholder committee, including the Ministry of Health, the National Screening Observatory, regional screening program coordinators, scientific societies, and Lega Italiana Lotta ai Tumori, for comments and integrations. A systematic review of the principal biomedical and social literature databases was conducted to identify experimental and observational studies, updating the existing review by Jepson and coll. (Health Technol Assess. 2000;4(14):i-vii, 1-133). 5900 have been identified, 900 relevant for the topic.Among those, 148 reported quantitative information on intervention efficacy, other 90 came from the previous review. Organised screening programmes, based on invitation letter or on GP involvement,were consistently effective in increasing participation compared to spontaneous screening. Interventions are classified according to their target: individual, community, test simplification, health operators, health service organization. The report presents meta-analyses on efficacy, analyses of cost-effectiveness, impact on organisation and social inequality, and ethical and legal issues, of all the intervention reported in the literature. there are several interventions consistently effective in any context, some of them have minimal impact on costs and health service resources.

  2. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  3. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  4. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  6. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  7. MOSFET dosimetry: temperature effects in-vivo

    International Nuclear Information System (INIS)

    Yu, P.K.N.; Cheung, T.; Butson, M.J.; Cancer Services, Wollongong, NSW

    2004-01-01

    Full text: This note investigates temperature effects on dosimetry using a Metal Oxide Semiconductor Field Effect Transistor (MOSFET) for radiotherapy x-ray treatment. This was performed by analysing the dose response and threshold voltage outputs for MOSFET dosimeters as a function of ambient temperature. Results have shown the clinical semiconductor dosimetry system (CSDS) MOSFET provides stable dose measurements with temperatures varying from 15 deg C up to 40 deg C. Thus standard irradiations performed at room temperature can be directly compared to in-vivo dose assessments performed at near body temperature without a temperature correction function. The MOSFET dosimeter threshold voltage varies with temperature and this level is dependant on the dose history of the MOSFET dosimeter. However the variation can be accounted for in the measurement method. For accurate dosimetry the detector should be placed for approximately 60 seconds on a patient to allow thermal equilibrium before measurements are taken with the final reading performed whilst still attached to the patient or conversely left for approximately 120 seconds after removal from the patient if initial readout was measured at room temperature to allow temperature equilibrium to be established. Copyright (2004) Australasian College of Physical Scientists and Engineers in Medicine

  8. Development, evaluation, and in-vivo validation of two non-invasive methods for quantitation of activity and dosimetry of monoclonal antibodies in humans

    International Nuclear Information System (INIS)

    Hammond, N.D.; Moldofsky, P.J.; Exten, R.E.; Gatenby, R.A.; Broder, G.J.

    1985-01-01

    The authors have applied both a conjugate view imaging method and a first pass study for quantitation of absolute I-131 activity in lesions and normal tissue of patients with colon carcinoma in order to study biological clearance of the I-131 F(ab)'/sub 2/ fragments of mouse monoclonal antibody and the resultant dosimetry. Both methods require a transmission scan for determining patient attenuation and measurement of patient lesion or organ size in the region of interest. The conjugate view method is analyzed for both SPECT and planar imaging. The percent error of both methods relates to lesion size and absolute activity when compared to actual well-counter assayed samples of malignant and normal tissue obtained from CT-guided needle biopsies or surgical specimens. Dosimetric evaluation was based on determination of activity, clearance from computer-generated time-activity curves and lesion or organ volumes from volumetric CT scan data. The dose to the thyroid gland was calculated for one population receiving Lugol's solution 3 days prior and for the other who received Lugol's at the time of administration. Data showed no significant difference in absorbed thyroid dose. Lastly, the absolute uptake of I-131, lesion to background ratios, and the dosimetry data were compared for three different monoclonal antibody fragments

  9. METHOD FOR SIMULTANEOUS 90SR AND 137CS IN-VIVO MEASUREMENTS OF SMALL ANIMALS AND OTHER ENVIRONMENTAL MEDIA DEVELOPED FOR THE CONDITIONS OF THE CHERNOBYL EXCLUSION ZONE

    Energy Technology Data Exchange (ETDEWEB)

    Farfan, E.; Jannik, T.

    2011-10-01

    To perform in vivo simultaneous measurements of the {sup 90}Sr and {sup 137}Cs content in the bodies of animals living in the Chernobyl Exclusion Zone (ChEZ), an appropriate method and equipment were developed and installed in a mobile gamma beta spectrometry laboratory. This technique was designed for animals of relatively small sizes (up to 50 g). The {sup 90}Sr content is measured by a beta spectrometer with a 0.1 mm thick scintillation plastic detector. The spectrum processing takes into account the fact that the measured object is 'thick-layered' and contains a comparable quantity of {sup 137}Cs, which is a characteristic condition of the ChEZ. The {sup 137}Cs content is measured by a NaI scintillation detector that is part of the combined gamma beta spectrometry system. For environmental research performed in the ChEZ, the advantages of this method and equipment (rapid measurements, capability to measure live animals directly in their habitat, and the capability of simultaneous {sup 90}Sr and {sup 137}Cs measurements) far outweigh the existing limitations (considerations must be made for background radiation and the animal size, skeletal shape and body mass). The accuracy of these in vivo measurements is shown to be consistent with standard spectrometric and radiochemical methods. Apart from the in vivo measurements, the proposed methodology, after a very simple upgrade that is also described in the article, works even more accurately with samples of other media, such as soil and plants.

  10. Examples of in-vivo blood vector velocity estimation

    DEFF Research Database (Denmark)

    Udesen, Jesper; Nielsen, Michael Bachmann; Nielsen, Kristian R.

    2007-01-01

    In this paper examples of in-vivo blood vector velocity images of the carotid artery are presented. The transverse oscillation (TO) method for blood vector velocity estimation has been used to estimate the vector velocities and the method is first evaluated in a circulating flowrig where...... person. In case 3) the estimated vector velocities are compared with numerical simulations. Qualitatively the same flow pattern can be seen in both simulations and in the vector velocity images. Furthermore a vortex is identified in the carotid sinus at the deceleration phase after the peak systole...

  11. Potential screening and early diagnosis method for cancer: Tongue diagnosis

    Science.gov (United States)

    HAN, SHUWEN; YANG, XI; QI, QUAN; PAN, YUEFEN; CHEN, YONGCHAO; SHEN, JUNJUN; LIAO, HAIHONG; JI, ZHAONING

    2016-01-01

    Tongue diagnosis, as a unique method of traditional Chinese medicine (TCM), was used to discriminate physiological functions and pathological conditions by observing the changes of the tongue and tongue coating. The aims of the present study were to explore a potential screening and early diagnosis method of cancer through evaluating the differences of the images of tongue and tongue coating and the microbiome on the tongue coating. The DS01-B tongue diagnostic information acquisition system was used to photograph and analyze the tongue and tongue coating. The next-generation sequencing technology was used to determine the V2-V4 hypervariable regions of 16S rDNA to investigate the microbiome on the tongue coating. Bioinformatics and statistical methods were used to analyze the microbial community structure and diversity. Comparing with the healthy people, the number of mirror-like tongue, thick tongue coating and the moisture of tongue were increased in cancers. The dominant color of the tongue in the healthy people was reddish while it was purple in the cancers. The relative abundance of Neisseria, Haemophilus, Fusobacterium and Porphyromonas in the healthy people were higher than that in the cancers. We also found 6 kinds of special microorganisms at species level in cancers. The study suggested that tongue diagnosis may provide potential screening and early diagnosis method for cancer. PMID:27035407

  12. A Quantum-Based Similarity Method in Virtual Screening

    Directory of Open Access Journals (Sweden)

    Mohammed Mumtaz Al-Dabbagh

    2015-10-01

    Full Text Available One of the most widely-used techniques for ligand-based virtual screening is similarity searching. This study adopted the concepts of quantum mechanics to present as state-of-the-art similarity method of molecules inspired from quantum theory. The representation of molecular compounds in mathematical quantum space plays a vital role in the development of quantum-based similarity approach. One of the key concepts of quantum theory is the use of complex numbers. Hence, this study proposed three various techniques to embed and to re-represent the molecular compounds to correspond with complex numbers format. The quantum-based similarity method that developed in this study depending on complex pure Hilbert space of molecules called Standard Quantum-Based (SQB. The recall of retrieved active molecules were at top 1% and top 5%, and significant test is used to evaluate our proposed methods. The MDL drug data report (MDDR, maximum unbiased validation (MUV and Directory of Useful Decoys (DUD data sets were used for experiments and were represented by 2D fingerprints. Simulated virtual screening experiment show that the effectiveness of SQB method was significantly increased due to the role of representational power of molecular compounds in complex numbers forms compared to Tanimoto benchmark similarity measure.

  13. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  14. Method for rapid screening of pesticide mineralization in soil.

    Science.gov (United States)

    Rasmussen, Jim; Jensen, Pia Haugaard; Holm, Peter E; Jacobsen, Ole Stig

    2004-05-01

    A method has been developed for the analysis of (14)CO(2) evolution from the mineralization of (14)C-labelled organic compounds in soil samples. The new method is less space demanding and substantially cuts down laborious manual work compared to the traditional incubation bottle method used. Furthermore, the use of scintillation cocktail is largely reduced with the new method. In the new method, (14)CO(2) is trapped in filter paper held in the lid of a 20 ml glass vial by surface tension. The trapping solution used is Ca(OH)(2), which fixates CO(2) in the filter paper and the analysis of trapped (14)CO(2) is done using the Cyclone trade mark Storage Phosphor system. The lids are placed in a 32 well holder and exposed to a phosphor screen prior to scanning in a Cyclone trade mark scanner. The new filter method has been tested and compared to results obtained using the traditional method. The results show good agreement but due to a smaller capacity for CO(2) with the filter method compared to the traditional method, the interval between sampling has to be shorter using the filter method when the CO(2) development is high. The detection limits for the filter method is higher compared to the traditional method. With the filter method, the level of radioactivity has to exceed 300 dpm before detection is possible, while the same limit for the traditional method is around 30 dpm. On the other hand, the gas trapping faster and the efficiency is higher with the filter method.

  15. Validation of screening method for determination of methyltestosterone in fish

    Directory of Open Access Journals (Sweden)

    Stojkovski Velimir

    2013-07-01

    Full Text Available Anabolic androgenic steroids are synthetic derivatives of testosterone, which is the primary male sex hormone. These anabolic agents are used to increase the weight gain, to improve the food efficiency, storing proteins and to decrease fatness. However, depending on the use of anabolic agent in animal feed, anabolic residues that may occur in meat and meat products present risks to human health. The aim of this study was the validation of screening ELISA method for determination of methyltestoterone anabolic steroid in fish. The validation process was carried out according to Commission Decision 2002/657/EC criteria. The detection limit for methyltestosterone was 140.95 ng/kg and the detection capability was 564.43 ng/kg. The overall recoveries and the coefficients of variation (CV were in the range of 82.4%-97.4% and 1.5%-6.9%, respectively, a working range between 50 to 4050 ng/kg, and the regression equation of the final inhibition curve was: y= -0,1741x + 1,5082, R2 = 0.9927. Because of the good recovery and precision, and satisfactory detection capability, this method is applicable in official control laboratories as a rapid screening method for determination of methyltestosterone in fish.

  16. In-vivo synthetic aperture flow imaging in medical ultrasound

    DEFF Research Database (Denmark)

    Nikolov, Svetoslav; Jensen, Jørgen Arendt

    2003-01-01

    A new method for acquiring flow images using synthetic aperture techniques in medical ultrasound is presented. The new approach makes it possible to have a continuous acquisition of flow data throughout the whole image simultaneously, and this can significantly improve blood velocity estimation.......2% and a mean relative bias of 3.4% using 24 pulse emissions at a flow angle of 45 degrees. The 24 emissions can be used for making a full-color flow map image. An in-vivo image of How in the carotid artery for a 29-year-old male also is presented. The full image is acquired using 24 emissions....

  17. Automatic Segmentation of Vessels in In-Vivo Ultrasound Scans

    DEFF Research Database (Denmark)

    Tamimi-Sarnikowski, Philip; Brink-Kjær, Andreas; Moshavegh, Ramin

    2017-01-01

    was evaluated empirically and applied to a dataset of in-vivo 1770 images recorded from 8 healthy subjects. The segmentation results were compared to manual delineation performed by two experienced users. The results showed a sensitivity and specificity of 90.41 ± 11.2 % and 97.93 ± 5.7 % (mean ± standard......Ultrasound has become highly popular to monitor atherosclerosis, by scanning the carotid artery. The screening involves measuring the thickness of the vessel wall and diameter of the lumen. An automatic segmentation of the vessel lumen, can enable the determination of lumen diameter. This paper...... presents a fully automatic segmentation algorithm, for robustly segmenting the vessel lumen in longitudinal B-mode ultrasound images. The automatic segmentation is performed using a combination of B-mode and power Doppler images. The proposed algorithm includes a series of preprocessing steps, and performs...

  18. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  19. A Method for Universal Screening of Elementary School Students: Development of the Social Challenges Screening Questionnaire

    Science.gov (United States)

    Smith, Christopher J.; Pollard, Elena; Stein, Alexander J.; Ober-Reynolds, Sharman; Kirwan, Janet; Malligo, Amanda; Matthews, Nicole L.; Openden, Daniel; Melmed, Raun D.

    2015-01-01

    Schools regularly screen students for hearing and vision impairments because they present impediments to academic progress. For the same reason, schools should consider adding a universal screening for social challenges, which may also impede the learning process. This study reports on the development of the Social Challenges Screening…

  20. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  1. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Thermography--a feasible method for screening breast cancer?

    Science.gov (United States)

    Kolarić, Darko; Herceg, Zeljko; Nola, Iskra Alexandra; Ramljak, Vesna; Kulis, Tomislav; Holjevac, Jadranka Katancić; Deutsch, Judith A; Antonini, Svetlana

    2013-06-01

    Potential use of thermography for more effective detection of breast carcinoma was evaluated on 26 patients scheduled for breast carcinoma surgery. Ultrasonographic scan, mammography and thermography were performed at the University Hospital for Tumors. Thermographic imaging was performed using a new generation of digital thermal cameras with high sensitivity and resolution (ThermoTracer TH7102WL, NEC). Five images for each patient were recorded: front, right semi-oblique, right oblique, left- semi oblique and left oblique. While mammography detected 31 changes in 26 patients, thermography was more sensitive and detected 6 more changes in the same patients. All 37 changes were subjected to the cytological analysis and it was found that 16 of samples were malignant, 8 were suspected malignant and 11 were benign with atypia or proliferation while only 2 samples had benign findings. The pathohistological method (PHD) recorded 75.75% malignant changes within the total number of samples. Statistical analysis of the data has shown a probability of a correct mammographic finding in 85% of the cases (sensitivity of 85%, specificity of 84%) and a probability of a correct thermographic finding in 92% of the cases (sensitivity of 100%, specificity of 79%). As breast cancer remains the most prevalent cancer in women and thermography exhibited superior sensitivity, we believe that thermography should immediately find its place in the screening programs for early detection of breast carcinoma, in order to reduce the sufferings from this devastating disease.

  3. In-vivo imaging of retinal nerve fiber layer vasculature: imaging – histology comparison

    Directory of Open Access Journals (Sweden)

    Libby Richard T

    2009-08-01

    Full Text Available Abstract Background Although it has been suggested that alterations of nerve fiber layer vasculature may be involved in the etiology of eye diseases, including glaucoma, it has not been possible to examine this vasculature in-vivo. This report describes a novel imaging method, fluorescence adaptive optics (FAO scanning laser ophthalmoscopy (SLO, that makes possible for the first time in-vivo imaging of this vasculature in the living macaque, comparing in-vivo and ex-vivo imaging of this vascular bed. Methods We injected sodium fluorescein intravenously in two macaque monkeys while imaging the retina with an FAO-SLO. An argon laser provided the 488 nm excitation source for fluorescence imaging. Reflectance images, obtained simultaneously with near infrared light, permitted precise surface registration of individual frames of the fluorescence imaging. In-vivo imaging was then compared to ex-vivo confocal microscopy of the same tissue. Results Superficial focus (innermost retina at all depths within the NFL revealed a vasculature with extremely long capillaries, thin walls, little variation in caliber and parallel-linked structure oriented parallel to the NFL axons, typical of the radial peripapillary capillaries (RPCs. However, at a deeper focus beneath the NFL, (toward outer retina the polygonal pattern typical of the ganglion cell layer (inner and outer retinal vasculature was seen. These distinguishing patterns were also seen on histological examination of the same retinas. Furthermore, the thickness of the RPC beds and the caliber of individual RPCs determined by imaging closely matched that measured in histological sections. Conclusion This robust method demonstrates in-vivo, high-resolution, confocal imaging of the vasculature through the full thickness of the NFL in the living macaque, in precise agreement with histology. FAO provides a new tool to examine possible primary or secondary role of the nerve fiber layer vasculature in retinal

  4. The effects of surface processing on in-vivo corrosion of Nitinol stents in a porcine model.

    Science.gov (United States)

    Sullivan, Stacey J L; Madamba, Daniel; Sivan, Shiril; Miyashiro, Katie; Dreher, Maureen L; Trépanier, Christine; Nagaraja, Srinidhi

    2017-10-15

    A major limitation with current assessments of corrosion in metallic medical devices is the lack of correlation between in-vitro and in-vivo corrosion performance. Therefore, the objective of this study was to elucidate the relationship between pitting corrosion measured by breakdown potentials (E b ) in ASTM F2129 testing and corrosion resistance in-vivo. Four groups of Nitinol stents were manufactured using different processing methods to create unique surface properties. The stents were implanted into iliac arteries of minipigs for six months and explanted for corrosion analysis. Scanning electron microscopy and energy dispersive X-ray spectrometry analyses indicated that stents with a thick complex thermal oxide (420nm) and high corrosion resistance in-vitro (E b =975±94mV) were free from detectable corrosion in-vivo and exhibited no changes in Ni/Ti ratio when compared to non-implanted controls. This result was also found in mechanically polished stents with a thin native oxide (4nm; E b =767±226mV). In contrast, stents with a moderately thick thermal oxide (130nm) and low corrosion resistance in-vitro (E b =111±63mV) possessed corrosion with associated surface microcracks in-vivo. In addition, Ni/Ti ratios in corroded regions were significantly lower compared to non-corroded adjacent areas on explanted stents. When stents were minimally processed (i.e. retained native tube oxide from the drawing process), a thick thermal oxide was present (399nm) with low in-vitro corrosion resistance (E b =68±29mV) resulting in extensive in-vivo pitting. These findings demonstrate that functional corrosion testing combined with a detailed understanding of the surface characteristics of a Nitinol medical device can provide insight into in-vivo corrosion resistance. Nitinol is a commonly used material in the medical device industry. However, correlations between surface processing of nitinol and in-vivo corrosion has yet to be established. Elucidating the link between in-vivo

  5. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  6. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  7. Pb-210-in-vivo measurements in the human skeleton

    International Nuclear Information System (INIS)

    Scheler, R.; Dettmann, K.

    1998-01-01

    A suitable method for the retrospective estimation of the exposure to short-lived radon progeny is the in-vivo measurement of the decay product Pb-210. The deposited Pb-210 is estimated at the skull by measurements with a low-energy Ge-detector-array. Because the decision limit resp. minimal detectable activity of 24 Bq resp. 48 Bq the quantitative assessment of cumulated exposure is possible for long-time exposure at levels of the equilibrium equivalent radon-concentration above 500 Bqm -3 . It seems that the average value of Pb-210-activity in the skeleton of individuals living in regions with increased radon-concentration exceeds the mean value of 15 Bq. A correlation with the exposure may be possible. (orig.) [de

  8. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  9. Phytochemical Screening and In-vivo Antipyretic Activity of the ...

    African Journals Online (AJOL)

    Erah

    and timber, including its use for the production of match-sticks. [3]. The leaves are used traditionally in inflammation and cutaneous trouble [3,4]. Its leaf extract exhibits significant antifungal activities against ringworm infection while the bark gum contains catechutannic acid [5]. Dar et al [6] isolated antioxidant and analgesic ...

  10. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  11. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    Since high-throughput screening (HTS) that selects antibacterial agents according to targets in vitro rather than whole-cell have not proven effective in the discovery of new antibiotics; new approaches for discovering the next generation of antibiotics are urgently needed. Filamentous fungi are an important source for many ...

  12. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  13. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  14. In-vivo analysis of ankle joint movement for patient-specific kinematic characterization.

    Science.gov (United States)

    Ferraresi, Carlo; De Benedictis, Carlo; Franco, Walter; Maffiodo, Daniela; Leardini, Alberto

    2017-09-01

    In this article, a method for the experimental in-vivo characterization of the ankle kinematics is proposed. The method is meant to improve personalization of various ankle joint treatments, such as surgical decision-making or design and application of an orthosis, possibly to increase their effectiveness. This characterization in fact would make the treatments more compatible with the specific patient's joint physiological conditions. This article describes the experimental procedure and the analytical method adopted, based on the instantaneous and mean helical axis theories. The results obtained in this experimental analysis reveal that more accurate techniques are necessary for a robust in-vivo assessment of the tibio-talar axis of rotation.

  15. A random plasma glucose method for screening for gestational diabetes.

    Science.gov (United States)

    Maheshwari, J R; Mataliya, M V

    1989-01-01

    Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG). RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated with RPG level. Thirty-six cases of gestational diabetes were picked up. The pick up rate is significantly higher as compared to that which would have been detected utilising conventional screening criteria.

  16. A random plasma glucose method for screening for gestational diabetes.

    Directory of Open Access Journals (Sweden)

    Maheshwari J

    1989-01-01

    Full Text Available Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG. RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated with RPG level. Thirty-six cases of gestational diabetes were picked up. The pick up rate is significantly higher as compared to that which would have been detected utilising conventional screening criteria.

  17. A random plasma glucose method for screening for gestational diabetes.

    OpenAIRE

    Maheshwari J; Mataliya M

    1989-01-01

    Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG). RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated wi...

  18. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  19. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  20. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  1. Application Of Active Screen Method For Ion Nitriding Efficiency Improvement

    Directory of Open Access Journals (Sweden)

    Ogórek M.

    2015-06-01

    Full Text Available Paper presents the research of austenitic steel AISI 304 after ion nitriding at 400°C and at t =4h, for the two different variants of samples distribution in the working plasma reactive chamber tube. In order to assess the effectiveness of ion nitriding variants emission spectroscopy – GDOES, surface hardness tests, microstructure research (LM of nitrided layers were made. It has been found that the use of active screens increases the surface layer thickness and depth of nitrogen diffusion into austenitic steel 304.

  2. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  3. A new microbial screening method for the detection of antimicrobial residues in slaughter animals: The Nouws antibiotic test (NAT-screening)

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Oostra-van Dijk, S.; Schouten, J.; Rapallini, M.; Egmond, van H.J.

    2008-01-01

    An improved microbial method for the screening of antimicrobial residues in slaughter animals has been developed. The Nouws antibiotic test (NAT-screening) is based on the analysis of renal pelvis fluid and comprises five test plates enabling group specific identification. The NAT-screening combines

  4. A comparison of protein kinases inhibitor screening methods using both enzymatic activity and binding affinity determination

    DEFF Research Database (Denmark)

    Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan

    2014-01-01

    Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening...

  5. Nouws antibiotics test: Validation of a post-screening method for antibiotic residues in kidney

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Oostra-van Dijk, S.; Schouten, J.; Rapallini, M.; Kortenhoeven, L.; Egmond, van H.J.

    2009-01-01

    Anticipating the rise in ‘suspect’ samples caused by the introduction of a more sensitive screening test for the presence of antibiotic residues in slaughter animals, an additional microbial post-screening method was developed. The test comprises four antibiotic group specific test plates, optimized

  6. Terbium-sensitized luminescence screening method for fluoroquinolones in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods commonly used for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay was developed...

  7. Machine learning improves the precision and robustness of high-content screens: using nonlinear multiparametric methods to analyze screening results.

    Science.gov (United States)

    Horvath, Peter; Wild, Thomas; Kutay, Ulrike; Csucs, Gabor

    2011-10-01

    Imaging-based high-content screens often rely on single cell-based evaluation of phenotypes in large data sets of microscopic images. Traditionally, these screens are analyzed by extracting a few image-related parameters and use their ratios (linear single or multiparametric separation) to classify the cells into various phenotypic classes. In this study, the authors show how machine learning-based classification of individual cells outperforms those classical ratio-based techniques. Using fluorescent intensity and morphological and texture features, they evaluated how the performance of data analysis increases with increasing feature numbers. Their findings are based on a case study involving an siRNA screen monitoring nucleoplasmic and nucleolar accumulation of a fluorescently tagged reporter protein. For the analysis, they developed a complete analysis workflow incorporating image segmentation, feature extraction, cell classification, hit detection, and visualization of the results. For the classification task, the authors have established a new graphical framework, the Advanced Cell Classifier, which provides a very accurate high-content screen analysis with minimal user interaction, offering access to a variety of advanced machine learning methods.

  8. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  9. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  10. High-throughput bubble screening method for combinatorial discovery of electrocatalysts for water splitting.

    Science.gov (United States)

    Xiang, Chengxiang; Suram, Santosh K; Haber, Joel A; Guevarra, Dan W; Soedarmadji, Ed; Jin, Jian; Gregoire, John M

    2014-02-10

    Combinatorial synthesis and screening for discovery of electrocatalysts has received increasing attention, particularly for energy-related technologies. High-throughput discovery strategies typically employ a fast, reliable initial screening technique that is able to identify active catalyst composition regions. Traditional electrochemical characterization via current-voltage measurements is inherently throughput-limited, as such measurements are most readily performed by serial screening. Parallel screening methods can yield much higher throughput and generally require the use of an indirect measurement of catalytic activity. In a water-splitting reaction, the change of local pH or the presence of oxygen and hydrogen in the solution can be utilized for parallel screening of active electrocatalysts. Previously reported techniques for measuring these signals typically function in a narrow pH range and are not suitable for both strong acidic and basic environments. A simple approach to screen the electrocatalytic activities by imaging the oxygen and hydrogen bubbles produced by the oxygen evolution reaction (OER) and hydrogen evolution reaction (HER) is reported here. A custom built electrochemical cell was employed to record the bubble evolution during the screening, where the testing materials were subject to desired electrochemical potentials. The transient of the bubble intensity obtained from the screening was quantitatively analyzed to yield a bubble figure of merit (FOM) that represents the reaction rate. Active catalysts in a pseudoternary material library, (Ni-Fe-Co)Ox, which contains 231 unique compositions, were identified in less than one minute using the bubble screening method. An independent, serial screening method on the same material library exhibited excellent agreement with the parallel bubble screening. This general approach is highly parallel and is independent of solution pH.

  11. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  12. Flow method and apparatus for screening chemicals using micro x-ray fluorescence

    Science.gov (United States)

    Warner, Benjamin P [Los Alamos, NM; Havrilla, George J [Los Alamos, NM; Miller, Thomasin C [Bartlesville, OK; Lewis, Cris [Los Alamos, NM; Mahan, Cynthia A [Los Alamos, NM; Wells, Cyndi A [Los Alamos, NM

    2009-04-14

    Method and apparatus for screening chemicals using micro x-ray fluorescence. A method for screening a mixture of potential pharmaceutical chemicals for binding to at least one target binder involves flow-separating a solution of chemicals and target binders into separated components, exposing them to an x-ray excitation beam, detecting x-ray fluorescence signals from the components, and determining from the signals whether or not a binding event between a chemical and target binder has occurred.

  13. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    genomic locus, but limits the detection of its correct genomic integration by standard PCR methods. Genomic Long Range PCR (LR-PCR), using primers adjacent to the homology arms, has been used as an alternative to radioactive-based Southern blot screenings. However, LR-PCRs are often difficult and render...... many false positive and false negative results. Here, we propose an alternative screening method based on the detection of a genetic modification at the mRNA level, which we successfully optimized in two mouse models. This screening method consists of a reverse-transcription PCR (RT-PCR) using primers...... that match exons flanking the targeting construct. The detection of the expected modification in this PCR product confirms the integration at the correct genomic location and shows that the mutant mRNA is expressed. This is a simple and sensitive strategy to screen locus-specific recombination of targeting...

  14. Chemical Safety Alert: Identifying Chemical Reactivity Hazards Preliminary Screening Method

    Science.gov (United States)

    Introduces small-to-medium-sized facilities to a method developed by Center for Chemical Process Safety (CCPS), based on a series of twelve yes-or-no questions to help determine hazards in warehousing, repackaging, blending, mixing, and processing.

  15. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  16. Comparing Vertical and Horizontal Screening Methods for Pharmacy Resident Candidates Before Interviews

    Directory of Open Access Journals (Sweden)

    Michael J. Peeters

    2015-01-01

    Full Text Available Purpose: Prior studies have examined autobiographical screening methods among medical student applicants, and demonstrated halo bias with single-rater scoring; though others have questioned its practical significance. Comparing with traditional vertical screening method, we evaluated a horizontal method for initial screening of Post-Graduate Year-1 (PGY-1 pharmacy practice resident candidate applications prior to interviews. Methods: Our screening rubric for PGY-1 pharmacy residency candidates consisted of eight criteria, each scored using a 5-point Likert scale. During the 2014 residency recruitment season, two single-evaluators (A&B scored all eight criteria and their scores were summed into total application scores (vertical method. Meanwhile two other evaluators (C&D each evaluated only two criteria for all applications. The four combined-evaluators (A-D scores, on two criteria each, were summed together into total application scores (horizontal method. For statistical comparison of single-evaluator and combined-evaluators, inter-component reliabilities were analyzed for each evaluator, while inter-rater consistency was also examined. For practical significance, actual selection differences were reviewed. Results:Forty-six applications were evaluated to determine 24 invitations for on-site interviews. Inter-component reliability differed among evaluatorA, evaluatorB, combined-evaluators A-D (Cronbach’s alpha of 0.74, 0.73, 0.58, respectively; lower better. Among raters, inter-rater consistency was excellent (0.86 by intraclass correlation, p Conclusion: Halo bias was seen with the single-evaluators (vertical method; two interview invitations were negatively impacted. For pharmacy resident screening, a horizontal screening method appears to be rigorous in promoting fairness for applicants. As pharmacy residency applications continue to grow, a fair and time-efficient method of screening seems imperative.   Type: Original Research

  17. Evaluation of radiochromic films EBT3 for in-vivo dosimetry in radiotherapy treatments with photons

    International Nuclear Information System (INIS)

    Galvan de la C, O. O.; Rivera M, T.; Garcia G, O. A.; Larraga G, J. M.

    2015-10-01

    Full text: In-vivo dosimetry is a challenge in radiotherapy due to the measures are carried out in reference conditions outside; there is no balance of charged particle and beam consists of photons own and contamination electrons. Detectors that are useful for such measures should be sufficiently small and thin so they do not disturb the beam and do not alter the dose on target. In this paper the radiochromic films Gafchromic model EBT3 are evaluated as potential detectors for in-vivo dosimetry; measurements were carried out in solid water phantom on the surface, with films of dimensions 3 x 3 cm 2 . Irradiations were performed with a linear accelerator Novalis of 6 MV. Comparison between dose values found with a diode type Sfd detector (IBA dosimetry, Germany) and a diamond detector CVD (PTW-Freiburg) for 2 different sized of field (5 x 5 cm 2 and 10 x 10 cm 2 ) on the surface of a water phantom scanning was realized. The total spreading factor (Tsf) measured on surface was of 0.831 ± 4.6%; which is greater 12.9% than Tsf measured at a depth of maximum dose. This difference may be due to the contribution of scattered electrons to the beam exit. The measures must be corroborated with Monte Carlo simulations, which they will be validated on surface by the Abdel-Rahman [et al.] method; this mechanism will determine if the films are useful detectors for in-vivo dosimetry clinically. (Author)

  18. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  19. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  20. Copper Sulphate Densitometry as a Screening Method for Anaemia ...

    African Journals Online (AJOL)

    to identify those pregnant mothers with severe anemia. The cyanmethaemoglobin. (HiCN) method was performed as recommended by the ICSH (16). Corning. 252 colorimeter was used to read the absorbance and its linearitv was ..... closed glass or plastic containers. As it is shown in Table 3 the comparison bin tile copper ...

  1. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  2. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  3. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  4. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  5. Screening methods for assessing damage to natural resources following the Exxon Valdez oil spill

    International Nuclear Information System (INIS)

    Krahn, M.M.; Ylitalo, G.M.; Buzitis, J.; Krone, C.A.; Stein, J.E.; Chan, S.L.; Varanasi, U.

    1993-01-01

    Evaluating the extent of the damage to natural resources after a major oil spill, such as the Exxon Valdez spill in Prince William Sound, Alaska, requires the analysis of thousands of samples of sediment and biota. Therefore, the use of rapid, low-cost analytical methods-generally known as screening methods-to estimate concentrations of petroleum-related aromatic compounds in samples is vitally important to the production of timely information in an emergency response. These screening procedures can rapidly process large numbers of samples to yield semiquantitative estimates of contaminant and allow ranking of samples by degree of contamination. Thus, the most contaminated samples can be located rapidly by screening, and detailed analyses; for example, gas chromatography/ mass spectrometry, (GC/MS) can be focused on selected samples to confirm the presence of contaminants. Screening methods were developed for sediments, bile, and tissue. Petroleum-related aromatics are screened for in sediments using size-exclusion HPLC. Aromatic metabolites are screened for in bile and tissue of fish by reversed-phase HPLC with fluorescence detection

  6. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening...

  7. Pharmacy Diabetes Screening Trial: protocol for a pragmatic cluster-randomised controlled trial to compare three screening methods for undiagnosed type 2 diabetes in Australian community pharmacy

    OpenAIRE

    Krass, Ines; Carter, Rob; Mitchell, Bernadette; Mohebbi, Mohammadreza; Shih, Sophy T F; Trinder, Peta; Versace, Vincent L; Wilson, Frances; Namara, Kevin Mc

    2017-01-01

    Introduction With the rising prevalence of type 2 diabetes in Australia, screening and earlier diagnosis is needed to provide opportunities to intervene with evidence-based lifestyle and treatment options to reduce the individual, social and economic impact of the disease. The objectives of the Pharmacy Diabetes Screening Trial are to compare the clinical effectiveness and cost-effectiveness of three screening models for type 2 diabetes in a previously undiagnosed population. Methods and anal...

  8. Primary Care Screening Methods and Outcomes for Asylum Seekers in New York City.

    Science.gov (United States)

    Bertelsen, Nathan S; Selden, Elizabeth; Krass, Polina; Keatley, Eva S; Keller, Allen

    2018-02-01

    Effective screening in primary care among asylum-seekers in the US is critical as this population grows. This study aimed to evaluate disease prevalence and screening methods in this high-risk group. Two hundred ten new clients from 51 countries, plus Tibet, who were accepted into a program for asylum seekers from 2012 to 2014 were included. Screening rates and outcomes for infectious, non-communicable, and mental illnesses were evaluated. Screening rates were highest for PTSD, depression, hepatitis B, and latent tuberculosis. Seventy-one percent of clients screened positive for depression and 55 % for PTSD, followed by latent tuberculosis (41 %), hypertension (10 %), hepatitis B (9.4 %), and HIV (0.8 %). Overall screening rates were high. Point of care testing was more effective than testing that required a repeat visit. A large psychiatric and infectious disease burden was identified. These findings can inform future primary care screening efforts for asylum seekers in the US.

  9. Hazard Screening Methods for Nanomaterials: A Comparative Study

    Directory of Open Access Journals (Sweden)

    Barry Sheehan

    2018-02-01

    Full Text Available Hazard identification is the key step in risk assessment and management of manufactured nanomaterials (NM. However, the rapid commercialisation of nano-enabled products continues to out-pace the development of a prudent risk management mechanism that is widely accepted by the scientific community and enforced by regulators. However, a growing body of academic literature is developing promising quantitative methods. Two approaches have gained significant currency. Bayesian networks (BN are a probabilistic, machine learning approach while the weight of evidence (WoE statistical framework is based on expert elicitation. This comparative study investigates the efficacy of quantitative WoE and Bayesian methodologies in ranking the potential hazard of metal and metal-oxide NMs—TiO2, Ag, and ZnO. This research finds that hazard ranking is consistent for both risk assessment approaches. The BN and WoE models both utilize physico-chemical, toxicological, and study type data to infer the hazard potential. The BN exhibits more stability when the models are perturbed with new data. The BN has the significant advantage of self-learning with new data; however, this assumes all input data is equally valid. This research finds that a combination of WoE that would rank input data along with the BN is the optimal hazard assessment framework.

  10. Fingerprints: A simple method for Screening Hemophilic Patients.

    Science.gov (United States)

    Jamalian, M; Mesri, M; Vishteh, H R K; Solhi, H; Salehpour, R

    2014-08-01

    The present study aims to compare hemophilic patients' fingerprint types with the normal people to help diagnose the disease, particularly new occurrences of the disease. This case-control study was conducted in 2012. Sixty two patients with hemophilia type A and 62 normal healthy people were selected. The type of fingerprint was determined by a forensic specialist who was kept unaware of the participants' group. Using advanced Henry method, the main types of fingerprints were classified as arch, loop, whorl, as well as other types. In the control group, loop type (65%) and in the case group the whorl type (34%) were the most frequent fingerprint type (p fingerprint in each finger between two groups. In addition, the average number of whorl type in the patients with mild disease was significantly higher and the average number of arch and other types of fingerprints was significantly lower than patients with moderate or severe disease. The findings of the present study indicated that not only are the fingerprints of normal and hemophilic people different, but also a difference was observed between hemophilic patients with the mild factor level and patients with moderate or severe one.

  11. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  12. Recommendations for Developing Alternative Test Methods for Screening and Prioritization of Chemicals for Developmental Neurotoxicity

    Science.gov (United States)

    Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternative methods to current animal testing protocols and gUidelines. An immediate goal is to develop test methods that are capable of screening large numbers of chemic...

  13. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    renormalization of a 2D material embedded in an arbitrary vdWH. The method evaluates the change in the GW self-energy of the 2D material from the change in the screened Coulomb interaction. The latter is obtained using the quantum-electrostatic heterostructure (QEH) model. We benchmark the GΔW method against full...

  14. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  15. Anthropometric methods for obesity screening in schoolchildren: the Ouro Preto Study.

    Science.gov (United States)

    Cándido, A P C; Alosta, J P S; Oliveira, C T; Freitas, R N; Freitas, S N; Machado-Coelho, G L L

    2012-01-01

    Childhood obesity is increasing dramatically in last decades. To evaluate the usefulness of body mass index (BMI), skinfold thickness (ST), waist circumference (WC), and foot-to-foot bioelectrical impedance (BIA-FF) for screening for obesity in mixed-race population, using the tetrapolar bioelectrical impedance (BIA-T) technique as reference method. A cross-sectional-based population study was performed in the city of Ouro Preto, Brazil, in 2006. Schoolchildren aged 6-15 years (n = 788) was randomly selected according to age and sex stratified by the proportion of students in each schools of the city. Nonparametric receiver operating characteristic (ROC) analysis was used to define the sensitivity and specificity for each method studied using the tetrapolar method as reference. The BMI and the BIA-FF were the most suitable for adiposity screening in pre-pubertal and pubertal stages because they present a better balance between sensitivity and specificity, and smaller misclassification. For post-pubertal boys, the BF-ST-D was the best body fat assessment method. The results suggest that BIA-FF and BMI are choice methods for obesity screening in mixed population and that the method choice for body fat screening must be done according to sexual maturity of boys and girls. The present study demonstrates the need to perform studies in wider mixed-race population to determine anthropometric parameters and to examine the predictive ability of methods and cut-offs here elucidated in the development of obesity.

  16. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  17. In-vivo precision - a crucial factor in bone densitometry. First results from the clinical practice

    International Nuclear Information System (INIS)

    Slavchev, A.

    2008-01-01

    The good densitometric practice should include assessment of the measurement accuracy and precision as a warranty for the timely recognition and assessment of the disease and particularly important for the monitoring and assessment of its development as well as for the choice of the adequate therapy. First results from a large-scale study of the performance of DXA densitometers under operation throughout the country prove that one of the main characteristics - precision has prevalent importance for the clinical practice than the other one - accuracy, namely in diagnostics and therapy particularly the long term monitoring of the patients. The quality control especially in its part of radiation protection measurements exhibits high specificity concerning both operator and patient. The procedure of determining of the in-vivo precision error and the least significant change, respectively, and the screening as well are interconnected with a higher degree of radiation exposure for the operator staff. The in-vivo precision (errors) obtained from the clinical practice in the most of the osteoporosis centres is inferior to the values recommended by the ISCD and by this represent a warranty for a high degree of objectivity and reducing the subjective and stochastic factors in diagnostics and following-up of osteoporosis. (author)

  18. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  19. Performance evaluation of sound screening Method for estimating sound Risk in small Workshops of Hamadan city

    Directory of Open Access Journals (Sweden)

    Rostam Golmohammadi

    2016-03-01

    Full Text Available Introduction: noise pollution has a negative effect on physiological parameters, efficiency and auditory system. The aim of this study was to evaluate the performance of a sound screening method for estimating sound risk in small workshops of Hamadan city. Methods: This cross-sectional study was conducted in 22 plants with more than 20 workers. Noise screening was done using a screening form. Next, noise level was measured at all the plants by SL 4001 sound level meter and regular grid method. Data were analyzed using Pearson’s test and linear regression by SPSS version 16 software. Results: The mean (SD scores of sound pressure level and screening form were 80.12 dB (7.277 and 60.50 (8.964 in the 22 understudy plants, respectively. The average measured workshop area and volume were 1448 and 10300, respectively. Pearson’s test revealed a significant relationship between the results of the two methods, (P > 0.046. Also the percentage of workers at risk (greater than 85 dB was 32.29 and the percentage of workers within safe limit (less than 85 dB was 63.3. While the largest percentage of workers in the caution zone (82 dB was 67.04. conclusions: A correlation was shown between the results of the two methods. The use of this method to identify workshops with the possibility of noise pollution is effective.

  20. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    assess all potential post-stroke visual impairments. The current tools screen for only a number of potential stroke-related impairments, which means many visual defects may be missed. The sensitivity of those which screen for all impairments is significantly lowered when patients are unable to report their visual symptoms. Future research is required to develop a tool capable of assessing stroke patients which encompasses all potential visual deficits and can also be easily performed by both the patients and administered by health care professionals in order to ensure all stroke survivors with visual impairment are accurately identified and managed. Implications for Rehabilitation Over 65% of stroke survivors will suffer from a visual impairment, whereas 45% of stroke units do not assess vision. Visual impairment significantly reduces the quality of life, such as being unable to return to work, driving and depression. This review outlines the available screening methods to accurately identify stroke survivors with visual impairments. Identifying visual impairment after stroke can aid general rehabilitation and thus, improve the quality of life for these patients.

  1. Breast cancer screening: evidence of benefit depends on the method used

    Science.gov (United States)

    2012-01-01

    In this article, we discuss the most common epidemiological methods used for evaluating the ability of mammography screening to decrease the risk of breast cancer death in general populations (effectiveness). Case-control studies usually find substantial effectiveness. However when breast cancer mortality decreases for reasons unrelated to screening, the case-control design may attribute to screening mortality reductions due to other causes. Studies based on incidence-based mortality have obtained contrasted results compatible with modest to considerable effectiveness, probably because of differences in study design and statistical analysis. In areas where screening has been widespread for a long time, the incidence of advanced breast cancer should be decreasing, which in turn would translate into reduced mortality. However, no or modest declines in the incidence of advanced breast cancer has been observed in these areas. Breast cancer mortality should decrease more rapidly in areas with early introduction of screening than in areas with late introduction of screening. Nonetheless, no difference in breast mortality trends has been observed between areas with early or late screening start. When effectiveness is assessed using incidence-based mortality studies, or the monitoring of advanced cancer incidence, or trends in mortality, the ecological bias is an inherent limitation that is not easy to control. Minimization of this bias requires data over long periods of time, careful selection of populations being compared and availability of data on major confounding factors. If case-control studies seem apparently more adequate for evaluating screening effectiveness, this design has its own limitations and results must be viewed with caution. See related Opinion article: http://www.biomedcentral.com/1741-7015/10/106 and Commentary http://www.biomedcentral.com/1741-7015/10/164 PMID:23234249

  2. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    Ionic liquids (ILs) have attracted considerable attention in both the academic and industrial communities for absorbing and separating gases. However, a data-rich and well-structured systematic database has not yet been established, and screening for highly efficient ILs meeting various requireme......Ionic liquids (ILs) have attracted considerable attention in both the academic and industrial communities for absorbing and separating gases. However, a data-rich and well-structured systematic database has not yet been established, and screening for highly efficient ILs meeting various...... requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  3. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  4. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  5. Non-invasive Estimation of Pressure Changes using 2-D Vector Velocity Ultrasound: An Experimental Study with In-Vivo Examples

    DEFF Research Database (Denmark)

    Olesen, Jacob Bjerring; Villagómez Hoyos, Carlos Armando; Møller, Niclas Dechau

    2018-01-01

    A non-invasive method for estimating intravascular pressure changes using 2-D vector velocity is presented. The method was first validated on computational fluid dynamics (CFD) data, and with catheter measurements on phantoms. Hereafter, the method was tested in-vivo at the carotid bifurcation...

  6. Tumor characteristics and detection method in the MRISC screening program for the early detection of hereditary breast cancer

    NARCIS (Netherlands)

    Kriege, M.; Brekelmans, C. T. M.; Peterse, H.; Obdeijn, I. M.; Boetes, C.; Zonderland, H. M.; Muller, S. H.; Kok, T.; Manoliu, R. A.; Besnard, A. P. E.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; Bartels, C. C. M.; Meijer, S.; Oosterwijk, J. C.; Hoogerbrugge, N.; Tollenaar, R. A. E. M.; de Koning, H. J.; Rutgers, E. J. T.; Klijn, J. G. M.

    In the MRISC study, women with an inherited risk for breast cancer were screened by a 6-month clinical breast examination (CBE) and yearly MRI and mammography. We found that the MRISC screening scheme could facilitate early breast cancer diagnosis and that MRI was a more sensitive screening method

  7. [The Body Dysmorphic Disorder in Plastic Surgery - A Systematic Review of Screening Methods].

    Science.gov (United States)

    Houschyar, K S; Philipps, H M; Duscher, D; Rein, S; Weissenberg, K; Nietzschmann, I; Maan, Z N; Pyles, M N; Siemers, F

    2017-12-01

    The body dysmorphic disorder (BDD) is considered to be a sub-form of somatoform disorders. BDD can express itself in a delirious experience, an excessive evaluation and employment of the external appearance, in particular the face. Preliminary results suggest that individuals with BDD do not benefit from plastic surgery, so that aesthetic surgery often results in aggravation of their symptoms. Thus, the identification of signs for a BDD is crucial, whether a patient should be operated plastically-aesthetically. This overview explains the often difficult diagnostics of the BDD by summarizing the current literature on its screening. Systematic overview METHODS: An electronic search was conducted in the German and English-language literature in order to identify all screening instruments for the BDD. The specific development and validation processes are assessed whether the screening instruments have a positive predictive value for the BDD. Six different screening instruments were identified for the BDD. Only two of these were evaluated in a cosmetic setting: the "Body Dysmorphic Disorder Questionnaire Dermatology Version" (BDDQ-DV) and the "Dysmorphic Concern Questionnaire" (DCQ). The influence on the subjective results after a plastic-aesthetic procedure was measured only for the DCQ. The limited availability of validated screening instruments for BDD in plastic surgery is markedly in contrast to the supposedly high prevalence of the disease of 2.4 %. Among the currently used screening tools, the BDDQ-DV and the DCQ appear to be most suitable. Further research efforts are needed to establish better screening methods for the BDD in the plastic surgical patient population and to examine the effects of BDD on treatment results. Georg Thieme Verlag KG Stuttgart · New York.

  8. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  9. Function-specific virual screening for GPCR ligands using a combined scoring method.

    NARCIS (Netherlands)

    Kooistra, A.J.; Vischer, H.F.; McNaught-Flores, D.; Leurs, R.; de Esch, I.J.P.; de Graaf, C.

    2016-01-01

    The ability of scoring functions to correctly select and rank docking poses of small molecules in protein binding sites is highly target dependent, which presents a challenge for structure-based drug discovery. Here we describe a virtual screening method that combines an energy-based docking scoring

  10. Fast screening method for detection of acyl-HSL-degrading soil isolates

    NARCIS (Netherlands)

    Jafra, S.; Wolf, van der J.M.

    2004-01-01

    A reliable method was developed for screening of bacteria isolates capable of degrading acyl-HSLs, the signal molecules in quorum-sensing-mediated processes of many Proteobacteria. The microtiter assay was based on the use of a GFP-marked Escherichia coli strain, which fluoresces upon the presence

  11. Comparison of three microbial screening methods for antibiotics using routine monitoring samples

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Rapallini, M.; Oostra, S.; Elferink, J.W.A.

    2009-01-01

    Monitoring large numbers of slaughter animals for the presence of antimicrobial residues is preferably carried out using microbiological screening methods, because of their high cost-effectiveness. An evaluation of the Nouws antibiotic test (NAT) was performed on routine monitoring samples and the

  12. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  13. Overdiagnosis associated with breast cancer screening: A simulation study to compare lead-time adjustment methods.

    Science.gov (United States)

    Seigneurin, A; Labarère, J; Duffy, S W; Colonna, M

    2015-12-01

    Estimating overdiagnosis associated with breast cancer screening may use annual incidence rates of cancer. We simulated populations invited to screening programmes to assess two lead-time adjustment methods. Overdiagnosis estimates were computed using the compensatory drop method, which considered the decrease in incidence of cancers among older age groups no longer offered screening, and the method based on the decrease in incidence of late-stage cancers. The true value of overdiagnosis was 0% in all the data sets simulated. The compensatory drop method yielded an overdiagnosis estimate of -0.1% (95% credibility interval -0.5% to 0.5%) when participation rates among the population and risk of cancers were constant. However, if participation rates increased with calendar year as well as risk of cancer with birth cohorts, the overdiagnosis estimated was 11.0% (10.5-11.6%). Using the method based on the incidence of early- and late-stage cancers, overdiagnosis estimates were 8.9% (8.5-9.3%) and 17.6% (17.4-17.9%) when participation rates and risks of cancer were constant or increased with time, respectively. Adjustment for lead time based on the compensatory drop method is accurate only when participation rates and risks of cancer remain constant, whereas the adjustment method based on the incidence of early- and late-stage cancers results in overestimating overdiagnosis regardless of stability of participation rates and breast cancer risk. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Directory of Open Access Journals (Sweden)

    Eviatar Ephraim

    2009-02-01

    Full Text Available Abstract Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007 and EMBASE (1975–2007. Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles, the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia.

  15. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  16. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  17. Optimal Screening Methods to Detect Cardiac Disorders in Athletes: An Evidence-Based Review.

    Science.gov (United States)

    Winkelmann, Zachary K; Crossway, Ashley K

    2017-12-01

    Reference/Citation:  Harmon KG, Zigman M, Drezner JA. The effectiveness of screening history, physical exam, and ECG to detect potentially lethal cardiac disorders in athletes: a systematic review/meta-analysis. J Electrocardiol. 2015;48(3):329-338.   Which screening method should be considered best practice to detect potentially lethal cardiac disorders during the preparticipation physical examination (PE) of athletes?   The authors completed a comprehensive literature search of MEDLINE, CINAHL, Cochrane Library, Embase, Physiotherapy Evidence Database (PEDro), and SPORTDiscus from January 1996 to November 2014. The following key words were used individually and in combination: ECG, athlete, screening, pre-participation, history, and physical. A manual review of reference lists and key journals was performed to identify additional studies. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed for this review.   Studies selected for this analysis involved (1) outcomes of cardiovascular screening in athletes using the history, PE, and electrocardiogram (ECG); (2) history questions and PE based on the American Heart Association recommendations and guidelines; and (3) ECGs interpreted following modern standards. The exclusion criteria were (1) articles not in English, (2) conference abstracts, and (3) clinical commentary articles. Study quality was assessed on a 7-point scale for risk of bias; a score of 7 indicated the highest quality. Articles with potential bias were excluded.   Data included number and sex of participants, number of true- and false-positives and negatives, type of ECG criteria used, number of cardiac abnormalities, and specific cardiac conditions. The sensitivity, specificity, false-positive rate, and positive predictive value of each screening tool were calculated and summarized using a bivariate random-effects meta-analysis model.   Fifteen articles reporting on 47 137 athletes

  18. Development of a high throughput screening method to test flavour-forming capabilities of anaerobic micro-organisms.

    NARCIS (Netherlands)

    Smit, B.A.; Engels, W.J.M.; Hylckama Vlieg, van J.E.T.; Wouters, J.T.M.; Smit, G.

    2004-01-01

    Aim: Development of a fast, automated and reliable screening method for screening of large collections of bacterial strains with minimal handling time. Methods and Results: The method is based on the injection of a small headspace sample (100 µl) from culture vials (2 ml) in 96-well format directly

  19. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    OpenAIRE

    Cristina Portalés; Sergio Casas; Inmaculada Coma; Marcos Fernández

    2017-01-01

    The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, w...

  20. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    OpenAIRE

    Portalés Ricart, Cristina; Casas Yrurzum, Sergio; Coma Tatay, Inmaculada; Fernández Marín, Marcos

    2017-01-01

    The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, w...

  1. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  2. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  3. A comparison of screening methods in two early phase oral leukoplakia clinical trials.

    Science.gov (United States)

    Rosas, R R; Cole, K A; Darrah, L; Rohrer, M D; Rhodus, N L; Ondrey, F G

    2012-10-01

    Clinical trial accrual for oral dysplasia is difficult in the United States and elsewhere. Patients with dysplastic oral leukoplakia progress to frank invasive carcinoma at a rate of 5-37% over 5 years. We compared two clinical trial screening efforts to hopefully devise better accrual strategies to these types of clinical trials. For the first trial, we identified 244 patients with dysplastic oral leukoplakia in our university database and a media campaign. Patients were notified and screened by examination and biopsy. For the second clinical trial, we established a preneoplastic lesions clinic and teaching and communications network with regional oral healthcare professionals. Only one of 244 patients accrued to the first clinical trial through an organized screening effort based on database/medical records review. The second clinical trial accrued 16/30 screened patients through redirected efforts in teaching, communications, and a preneoplastic lesions clinic. We conclude that significant difficulties resulted from medical record/database review of leukoplakia patients as a screening method for leukoplakia clinical trial entry. We feel that persistent direct contact and education of healthcare professionals who are likely to examine leukoplakia patients improved accrual to the second clinical trial. © 2012 John Wiley & Sons A/S.

  4. A high throughput method and culture medium for rapid screening of phosphate accumulating microorganisms.

    Science.gov (United States)

    Chaudhry, Vasvi; Nautiyal, Chandra Shekhar

    2011-09-01

    A novel PA Medium (PAM) for efficient screening of phosphate-accumulating organisms (PAOs) was developed taking Serratia marcescens NBRI1213 as model organism. The defined National Botanical Research Institute's growth medium (NBRI) supplemented with 0.1% maltose, designed for quantitative estimation of phosphate accumulation was designated as PAM. Our work suggested usage of PAM for efficient qualitative screening and as a microbiological medium for preferential selection of PAOs on Petri-plates. For qualitative screening of PAOs, Toluidine blue-O dye (TBO) was supplemented in PAM, designated as PAM-TBO. Qualitative analysis of phosphate accumulated by various groups correlated well with grouping based upon quantitative analysis of PAOs, effect of carbon, nitrogen, salts, and phosphate accumulation-defective transposon mutants. For significantly increasing sample throughput, efficiency of screening PAOs was further enhanced by adaptation of PAM-TBO assay to microtiter plate based method. It is envisaged that usage of this medium will be salutary for quick screening of PAOs from environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  6. Improving the Image Quality of Synthetic Transmit Aperture Ultrasound Images - Achieving Real-Time In-Vivo Imaging

    DEFF Research Database (Denmark)

    Gammelmark, Kim

    Synthetic transmit aperture (STA) imaging has the potential to increase the image quality of medical ultrasound images beyond the levels obtained by conventional imaging techniques (linear, phased, and convex array imaging). Currently, however, in-vivo applications of STA imaging is limited by a ......-vivo imaging, and that the obtained image quality is highly competitive with the techniques applied in current medical ultrasound scanners. Hereby, the goals of the PhD have been successfully achieved......., these issues need to solved. The goal of this PhD study has been to find methods that can be used to overcome the above mentioned limitations, and hereby improve the image quality of STA imaging to a clinically desirable level, enabling real-time in-vivo STA imaging. The thesis investigates a new method...

  7. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  8. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  9. 3D in-vivo optical skin imaging for topographical quantitative assessment of non-ablative laser technology.

    Science.gov (United States)

    Friedman, Paul M; Skover, Greg R; Payonk, Greg; Kauvar, Arielle N B; Geronemus, Roy G

    2002-03-01

    A new method for treating facial rhytides and acne scars with nonablative laser and light source techniques has recently been introduced. Given the inherent limitations of photographic and clinical evaluation to assess subtle changes in rhytides and surface topography, a new noninvasive objective assessment is required to accurately assess the outcomes of these procedures. The purpose of this study was to measure and objectively quantify facial skin using a novel, noninvasive, In-vivo method for assessing three-dimensional topography. This device was used to quantify the efficacy of five treatment sessions with the 1064 nm QS Nd:YAG laser for rhytides and acne scarring, for up to six months following laser treatment. Two subjects undergoing facial rejuvenation procedures were analyzed before and after therapy using a 30-mm, three-dimensional microtopography imaging system (PRIMOS, GFM, Teltow, Germany). The imaging system projects light on to a specific surface of the skin using a Digital Micromirror Device (DMD Texas Instruments, Irving, TX) and records the image with a CCD camera. Skin Surface microtopography is reconstructed using temporal phase shift algorithms to generate three-dimensional images. Measurements were taken at baseline, at various times during the treatment protocol, and then at three and six-month follow-up visits. Silicone skin replicas (FLEXICO, Herts, England) were also made before and after the laser treatment protocol for comparison to In-vivo acquisition. Skin roughness decreased by 11% from baseline after three treatment sessions in the wrinkles subject, while a 26% improvement of skin roughness was recorded by 3D In-vivo assessment six months following the fifth treatment session. The subject with acne scarring demonstrated a 33% decrease in roughness analysis after three treatment sessions by 3D In-vivo assessment. A 61% improvement in surface topography was recorded 3-months following the fifth treatment session, which was maintained

  10. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  11. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  12. In-vivo dosimetry for conformal arc therapy using several MOSFET in stereotactic radiosurgery computed by an inverse model

    OpenAIRE

    Sors Aurélie; Cassol Emmanuelle; Masquère Mathieu; Latorzeff Igor; Duthil Pierre; Chauveau Nicolas; Lotterie Jean-Albert; Sabatier Jean; Redon Alain; Berry Isabelle; Franceries Xavier

    2016-01-01

    In-vivo dosimetry is still a challenge in stereotactic radiosurgery since most of treatments are delivered using rotational technique with small fields. A realistic and practical solution for these treatments delivered in conformal radiotherapy is proposed to control the absorbed dose at isocentre, using multiple surface MOSFET measurements over an arc. On the one hand, a forward method was developed to optimize the location of the detectors at the patient surface, taking into account arc len...

  13. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  14. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  15. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  16. Method for detecting, screening and/or monitoring a cancer in an individual

    DEFF Research Database (Denmark)

    2003-01-01

    The invention relates to a method for screening and/or detecting and/or monitoring a cancer in an individual, said method comprising determining a first parameter represented by the concentration of TIMP-1 in at least one excreta, e.g. saliva, from the individual. The invention provides a method...... that without the need to use a blood sample is suitable for facilitating the early diagnosis of a cancer, monitoring the recurrence of a cancer, and/or monitoring the status of a cancer or the effect of cancer treatment in an individual....

  17. Method for detecting, screening and/or montoring a cancer in individual

    DEFF Research Database (Denmark)

    2005-01-01

    The invention relates to a method for screening and/or detecting and/or monitoring a cancer in an individual, said method comprising determining a first parameter represented by the concentration of TIMP-1 in at least one excreta, e.g. saliva, from the individual. The invention provides a method...... that without the need to use a blood sample is suitable for facilitating the early diagnosis of a cancer, monitoring the recurrence of a cancer, and/or monitoring the status of a cancer or the effect of cancer treatment in an individual....

  18. Modeling of high-frequency wave propagation in the heterogenous Earth using screen method

    Science.gov (United States)

    Ding, Y.; Zheng, Y.

    2017-12-01

    High-frequency (1Hz) wave propagation modeling in the heterogenous Earth is difficult due to computation cost. We have developed one alternative method to do high-frequency wave propagation locally in the Earth. First, we divide the heterogeneous Earth model into two parts: the background gradient velocity model, and the velocity perturbation. Then we trace rays from the source to the Earth surface and make screens perpendicular to the rays. We propagate the wavefield in each screen by Kirchhoff surface integral and account for the velocity perturbations with a phase shift. Recursively, the algorithm will propagate the wavefield locally from the source to the surface. The result is compared with that from the finite difference method.

  19. A tree based method for the rapid screening of chemical fingerprints

    DEFF Research Database (Denmark)

    Kristensen, Thomas Greve; Nielsen, Jesper; Pedersen, Christian Nørgaard Storm

    2009-01-01

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules...... with fingerprints similar to a query fingerprint. In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases......: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds...

  20. Screening methods for linear-scaling short-range hybrid calculations on CPU and GPU architectures.

    Science.gov (United States)

    Beuerle, Matthias; Kussmann, Jörg; Ochsenfeld, Christian

    2017-04-14

    We present screening schemes that allow for efficient, linear-scaling short-range exchange calculations employing Gaussian basis sets for both CPU and GPU architectures. They are based on the LinK [C. Ochsenfeld et al., J. Chem. Phys. 109, 1663 (1998)] and PreLinK [J. Kussmann and C. Ochsenfeld, J. Chem. Phys. 138, 134114 (2013)] methods, but account for the decay introduced by the attenuated Coulomb operator in short-range hybrid density functionals. Furthermore, we discuss the implementation of short-range electron repulsion integrals on GPUs. The introduction of our screening methods allows for speedups of up to a factor 7.8 as compared to the underlying linear-scaling algorithm, while retaining full numerical control over the accuracy. With the increasing number of short-range hybrid functionals, our new schemes will allow for significant computational savings on CPU and GPU architectures.

  1. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  2. A new method for the screening of solid-phase combinatorial libraries for affinity chromatography.

    Science.gov (United States)

    Roque, A Cecília A; Taipa, M Angela; Lowe, Christopher R

    2004-01-01

    A new methodology for the rapid assessment of affinity ligands synthesized by combinatorial solid-phase chemistry is reported. This screening strategy utilizes the target protein conjugated to FITC, and represents an almost universal technique for the preliminary screening of solid-phase combinatorial libraries. The assessment of a triazine-scaffolded solid-phase combinatorial library of ligands, designed to bind to human IgG, was performed with FITC-human IgG, and the results compared with those obtained by conventional affinity chromatographic screening assays. The effect of different molar conjugation ratios of FITC-IgG (F/P) was evaluated. Independently of the F/P ratio, no false negative results were observed, although lower F/P ratios diminished non-specific interactions and the number of false positives. The nature of the substituents on the triazine scaffold was not related to the number of false positive IgG-binding ligands. The reproducibility of the FITC technique, using FITC-human IgG conjugates with low F/P ratio (F/P=2), was also evaluated. The FITC-based technique proved to be efficient and accurate in the identification of strongly binding ligands (binding >50% of loaded protein, by standard affinity chromatographic assays), and is envisaged as a versatile and cost-effective method to screen other systems, and evaluate several binding/elution conditions at small-scale, prior to scale-up to standard affinity chromatography. Copyright 2004 John Wiley & Sons, Ltd.

  3. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  4. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  5. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  6. SU-E-T-435: Development and Commissioning of a Complete System for In-Vivo Dosimetry and Range Verification in Proton Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Samuel, D [Universite catholique de Louvain, Louvain-la-neuve, BW (Belgium); Testa, M; Park, Y [Massachusetts General Hospital, Boston, MA (United States); Schneider, R; Moteabbed, M [General Hospital, Boston, MA (United States); Janssens, G; Prieels, D [Ion Beam Applications, Louvain-la-neuve, Brabant Wallon (Belgium); Orban de Xivry, J [Universite catholique de Louvain, Louvain-la-neuve, BW (Belgium); Lu, H [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States); Bentefour, E

    2014-06-01

    Purpose: In-vivo dose and beam range verification in proton therapy could play significant roles in proton treatment validation and improvements. Invivo beam range verification, in particular, could enable new treatment techniques one of which, for example, could be the use of anterior fields for prostate treatment instead of opposed lateral fields as in current practice. We have developed and commissioned an integrated system with hardware, software and workflow protocols, to provide a complete solution, simultaneously for both in-vivo dosimetry and range verification for proton therapy. Methods: The system uses a matrix of diodes, up to 12 in total, but separable into three groups for flexibility in application. A special amplifier was developed to capture extremely small signals from very low proton beam current. The software was developed within iMagX, a general platform for image processing in radiation therapy applications. The range determination exploits the inherent relationship between the internal range modulation clock of the proton therapy system and the radiological depth at the point of measurement. The commissioning of the system, for in-vivo dosimetry and for range verification was separately conducted using anthropomorphic phantom. EBT films and TLDs were used for dose comparisons and range scan of the beam distal fall-off was used as ground truth for range verification. Results: For in-vivo dose measurement, the results were in agreement with TLD and EBT films and were within 3% from treatment planning calculations. For range verification, a precision of 0.5mm is achieved in homogeneous phantoms, and a precision of 2mm for anthropomorphic pelvic phantom, except at points with significant range mixing. Conclusion: We completed the commissioning of our system for in-vivo dosimetry and range verification in proton therapy. The results suggest that the system is ready for clinical trials on patient.

  7. SU-E-T-435: Development and Commissioning of a Complete System for In-Vivo Dosimetry and Range Verification in Proton Therapy

    International Nuclear Information System (INIS)

    Samuel, D; Testa, M; Park, Y; Schneider, R; Moteabbed, M; Janssens, G; Prieels, D; Orban de Xivry, J; Lu, H; Bentefour, E

    2014-01-01

    Purpose: In-vivo dose and beam range verification in proton therapy could play significant roles in proton treatment validation and improvements. Invivo beam range verification, in particular, could enable new treatment techniques one of which, for example, could be the use of anterior fields for prostate treatment instead of opposed lateral fields as in current practice. We have developed and commissioned an integrated system with hardware, software and workflow protocols, to provide a complete solution, simultaneously for both in-vivo dosimetry and range verification for proton therapy. Methods: The system uses a matrix of diodes, up to 12 in total, but separable into three groups for flexibility in application. A special amplifier was developed to capture extremely small signals from very low proton beam current. The software was developed within iMagX, a general platform for image processing in radiation therapy applications. The range determination exploits the inherent relationship between the internal range modulation clock of the proton therapy system and the radiological depth at the point of measurement. The commissioning of the system, for in-vivo dosimetry and for range verification was separately conducted using anthropomorphic phantom. EBT films and TLDs were used for dose comparisons and range scan of the beam distal fall-off was used as ground truth for range verification. Results: For in-vivo dose measurement, the results were in agreement with TLD and EBT films and were within 3% from treatment planning calculations. For range verification, a precision of 0.5mm is achieved in homogeneous phantoms, and a precision of 2mm for anthropomorphic pelvic phantom, except at points with significant range mixing. Conclusion: We completed the commissioning of our system for in-vivo dosimetry and range verification in proton therapy. The results suggest that the system is ready for clinical trials on patient

  8. A time-scale sensitometric method for evaluating screen - film systems

    International Nuclear Information System (INIS)

    Goes, E.G.; Pela, C.A.; Ghilardi, N.T.

    1997-01-01

    An x-ray sensitometer is used to measure the characteristic curve of radiographic films exposed with fluorescent intensifying screens. The series of relative exposures, necessary to cover the full density range of the film, can be obtained by either time-scale or intensity-scale sensitometric methods. We have developed a convenient method of exposing film-screen systems for time-scale sensitometry. In this method, during exposure the x-ray kilovoltage, tube current and x-ray intensity remain constant and a geometric series of exposures of the film is modulated by varying the exposure time. This time variation can be obtained when a lead disc with different sector openings is rotated in front of the film system by a stepping motor. The conditions normally used are 70 kVp x-rays, 3.5 mm Al total filtration at the tube, and 2.4 m focal spot-film distance. This exposure latitude gives a complete characteristic curve of film-screen systems. (author)

  9. A time-scale sensitometric method for evaluating screen - film systems

    Energy Technology Data Exchange (ETDEWEB)

    Goes, E.G.; Pela, C.A.; Ghilardi, N.T. [CIDRA - Centro de Instrumentacao, Dosimetria e Radioprotecao, DFM - FFCLRP - USP, Av. Bandeirantes, 3900-14040 901 Ribeirao Preto, SP (Brazil)

    1997-10-01

    An x-ray sensitometer is used to measure the characteristic curve of radiographic films exposed with fluorescent intensifying screens. The series of relative exposures, necessary to cover the full density range of the film, can be obtained by either time-scale or intensity-scale sensitometric methods. We have developed a convenient method of exposing film-screen systems for time-scale sensitometry. In this method, during exposure the x-ray kilovoltage, tube current and x-ray intensity remain constant and a geometric series of exposures of the film is modulated by varying the exposure time. This time variation can be obtained when a lead disc with different sector openings is rotated in front of the film system by a stepping motor. The conditions normally used are 70 kVp x-rays, 3.5 mm Al total filtration at the tube, and 2.4 m focal spot-film distance. This exposure latitude gives a complete characteristic curve of film-screen systems. (author)

  10. Development of a whole-cell-based screening method for a carotenoid assay using aerial microalgae.

    Science.gov (United States)

    Aburai, Nobuhiro; Kazama, Hiroaki; Tsuruoka, Atsushi; Goto, Mizuki; Abe, Katsuya

    2018-02-20

    Non-destructive approaches based on the application of optical spectroscopy are important for monitoring carotenoid accumulation in a whole cell cultured under various conditions. A simple and rapid assay utilizing aerial microalgae helps to identify stress conditions that can efficiently enhance the carotenogenesis in photosynthetic organisms. The spectra of cell suspensions were characterized in the aerial microalga Coelastrella sp. KGU-Y002, which are unicellular and undifferentiated. Total carotenoid contents could be successfully estimated on the basis of the absorbance values of the cell suspensions and calibration data analyzed by HPLC (high-performance liquid chromatography). A novel screening method, the so-called "whole-cell-based screening method" for carotenoid assays (WCA), was developed based on this procedure. It was possible to investigate the effects of various stresses on carotenoid accumulation in the aerial microalga by adapting this bioassay to a 96-well microtiter plate. When bioactive compounds were screened from our library of plant extracts using this method, an active compound was identified from the plant extract. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Evaluation of detection methods for screening meat and poultry products for the presence of foodborne pathogens.

    Science.gov (United States)

    Bohaychuk, Valerie M; Gensler, Gary E; King, Robin K; Wu, John T; McMullen, Lynn M

    2005-12-01

    Rapid and molecular technologies such as enzyme-linked immunosorbent assay (ELISA), PCR, and lateral flow immunoprecipitation can reduce the time and labor involved in screening food products for the presence of pathogens. These technologies were compared with conventional culture methodology for the detection of Salmonella, Campylobacter, Listeria, and Escherichia coli O157:H7 inoculated in raw and processed meat and poultry products. Recommended protocols were modified so that the same enrichment broths used in the culture methods were also used in the ELISA, PCR, and lateral flow immunoprecipitation assays. The percent agreement between the rapid technologies and culture methods ranged from 80 to 100% depending on the pathogen detected and the method used. ELISA, PCR, and lateral flow immunoprecipitation all performed well, with no statistical difference, compared with the culture method for the detection of E. coli O157:H7. ELISA performed better for the detection of Salmonella, with sensitivity and specificity rates of 100%. PCR performed better for the detection of Campylobacter jejuni, with 100% agreement to the culture method. PCR was highly sensitive for the detection of all the foodborne pathogens tested except Listeria monocytogenes. Although the lateral flow immunoprecipitation tests were statistically different from the culture methods for Salmonella and Listeria because of false-positive results, the tests did not produce any false negatives, indicating that this method would be suitable for screening meat and poultry products for these pathogens.

  12. Estimation of in-vivo pulses in medical ultrasound

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt

    1994-01-01

    and the three-dimensional, attenuated ultrasound field for a concave transducer. Pulses are estimated from in-vivo liver data showing good resemblance to a pulse measured as the response from a planar reflector and then properly attenuated. The main application for the algorithm is to function......An algorithm for the estimation of one-dimensional in-vivo ultrasound pulses is derived. The routine estimates a set of ARMA parameters describing the pulse and uses data from a number of adjacent rf lines. Using multiple lines results in a decrease in variance on the estimated parameters...... and significantly reduces the risk of terminating the algorithm at a local minimum. Examples from use on synthetic data confirms the reduction in variance and increased chance of successful minimization termination. Simulations are also reported indicating the relation between the one-dimensional pulse...

  13. Applications of nuclear technologies for in-vivo elemental analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cohn, S.H.; Ellis, K.J.; Vartsky, D.; Wielopolski, L.

    1982-01-01

    Measurement facilities developed, to date, include a unique whole-body-counter, (WBC); a total-body neutron-activation facility (TBNAA); and a partial-body activation facility (PBNAA). A variation of the prompt-gamma neutron-activation technique for measuring total-body nitrogen was developed to study body composition of cancer patients and the effect of nutritional regimens on the composition. These new techniques provide data in numerous clinical studies not previously amenable to investigation. The development and perfection of these techniques provide unique applications of radiation and radioisotopes to the early diagnosis of certain diseases and the evaluation of therapeutic programs. The PBNAA technique has been developed and calibrated for in-vivo measurement of metals. Development has gone forward on prompt-gamma neutron activation for the measurement of cadmium, x-ray fluorescence (XRF) for measurement of iron. Other techniques are being investigated for in-vivo measurement of metals such as silicon and beryllium.

  14. Applications of nuclear technologies for in-vivo elemental analysis

    International Nuclear Information System (INIS)

    Cohn, S.H.; Ellis, K.J.; Vartsky, D.; Wielopolski, L.

    1982-01-01

    Measurement facilities developed, to date, include a unique whole-body-counter, (WBC); a total-body neutron-activation facility (TBNAA); and a partial-body activation facility (PBNAA). A variation of the prompt-gamma neutron-activation technique for measuring total-body nitrogen was developed to study body composition of cancer patients and the effect of nutritional regimens on the composition. These new techniques provide data in numerous clinical studies not previously amenable to investigation. The development and perfection of these techniques provide unique applications of radiation and radioisotopes to the early diagnosis of certain diseases and the evaluation of therapeutic programs. The PBNAA technique has been developed and calibrated for in-vivo measurement of metals. Development has gone forward on prompt-gamma neutron activation for the measurement of cadmium, x-ray fluorescence (XRF) for measurement of iron. Other techniques are being investigated for in-vivo measurement of metals such as silicon and beryllium

  15. Bio-Mechatronics: From Insects to In-Vivo Mechatronics

    OpenAIRE

    Vaidyanathan, Ravi

    2013-01-01

    The Department of Automatic Control & Systems Engineering is pleased to announce the following seminar: Bio-Mechatronics: From Insects to In-Vivo Mechatronics Dr Ravi Vaidyanathan Department of Mechanical Engineering Imperial College Wednesday, 25th September 2013 at 14:00, LT02, Sir Henry Stephenson Building Mechatronics is the synergistic combination of precision engineering, electronic control, and systems thinking in the design of products and manufacturing processes. Bio-Mechatron...

  16. High-Solids Enzymatic Saccharification Screening Method for Lignocellulosic Biomass (Poster)

    Energy Technology Data Exchange (ETDEWEB)

    Roche, C. M.; Stickel, J. J.

    2009-05-01

    The ability to screen new biomass pretreatments and advanced enzyme systems at process-relevant conditions is key to developing economically viable lignocellulosic ethanol. While much research is being invested in developing pretreatment technologies and enzyme systems that will more efficiently convert cellulosic biomass to sugars, the current standard reactor vessel, a shake flask, that is used for screening enzymatic saccharification of cellulosic biomass is inadequate at high-solids conditions. Shake flasks do not provide adequate mixing at high solids conditions. In this work, a roller bottle reactor was identified as a small-scale high-solids saccharification reaction vessel, and a method was developed for use in screening both pretreated biomass and enzyme systems at process-relevant conditions. This new method addresses mixing issues observed in high-solids saccharifications. In addition, yield calculations from sugar concentrations on a mass basis were used to account for the two-phase nature of the saccharification slurry, which eliminates discontinuities in comparing high-solids to low-solids saccharifications that occur when using concentrations on a volume basis. The roller bottle reactors out-performed the shake flasks by 5% for an initial insoluble solids loading of 15% and 140% for an initial soluble solids loading of 30%. The reactor system and method was compared at bench and floor scales and determined to be scalable for initial insoluble solids loading in the range of 15% to 30%. Pretreatment and enzyme screening results indicate that mid severity pretreated biomass is more digestible than the low and high severity biomass and GC220 is a superior enzyme to Spezyme CP.

  17. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  18. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...... predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher...

  20. Function-specific virtual screening for GPCR ligands using a combined scoring method.

    Science.gov (United States)

    Kooistra, Albert J; Vischer, Henry F; McNaught-Flores, Daniel; Leurs, Rob; de Esch, Iwan J P; de Graaf, Chris

    2016-06-24

    The ability of scoring functions to correctly select and rank docking poses of small molecules in protein binding sites is highly target dependent, which presents a challenge for structure-based drug discovery. Here we describe a virtual screening method that combines an energy-based docking scoring function with a molecular interaction fingerprint (IFP) to identify new ligands based on G protein-coupled receptor (GPCR) crystal structures. The consensus scoring method is prospectively evaluated by: 1) the discovery of chemically novel, fragment-like, high affinity histamine H1 receptor (H1R) antagonists/inverse agonists, 2) the selective structure-based identification of ß2-adrenoceptor (ß2R) agonists, and 3) the experimental validation and comparison of the combined and individual scoring approaches. Systematic retrospective virtual screening simulations allowed the definition of scoring cut-offs for the identification of H1R and ß2R ligands and the selection of an optimal ß-adrenoceptor crystal structure for the discrimination between ß2R agonists and antagonists. The consensus approach resulted in the experimental validation of 53% of the ß2R and 73% of the H1R virtual screening hits with up to nanomolar affinities and potencies. The selective identification of ß2R agonists shows the possibilities of structure-based prediction of GPCR ligand function by integrating protein-ligand binding mode information.

  1. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  2. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  3. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  4. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  5. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products. PMID:26257724

  6. A non-contact time-domain scanning brain imaging system: first in-vivo results

    Science.gov (United States)

    Mazurenka, M.; Di Sieno, L.; Boso, G.; Contini, D.; Pifferi, A.; Dalla Mora, A.; Tosi, A.; Wabnitz, H.; Macdonald, R.

    2013-06-01

    We present results of first in-vivo tests of an optical non-contact scanning imaging system, intended to study oxidative metabolism related processes in biological tissue by means of time-resolved near-infrared spectroscopy. Our method is a novel realization of the short source-detector separation approach and based on a fast-gated single-photon avalanche diode to detect late photons only. The scanning system is built in quasi-confocal configuration and utilizes polarizationsensitive detection. It scans an area of 4×4 cm2, recording images with 32×32 pixels, thus creating a high density of source-detector pairs. To test the system we performed a range of in vivo measurements of hemodynamic changes in several types of biological tissues, i.e. skin (Valsalva maneuver), muscle (venous and arterial occlusions) and brain (motor and cognitive tasks). Task-related changes in hemoglobin concentrations were clearly detected in skin and muscle. The brain activation shows weaker, but yet detectable changes. These changes were localized in pixels near the motor cortex area (C3). However, it was found that even very short hair substantially impairs the measurement. Thus the applicability of the scanner is limited to hairless parts of body. The results of our first in-vivo tests prove the feasibility of non-contact scanning imaging as a first step towards development of a prototype for biological tissue imaging for various medical applications.

  7. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  8. Development of colorimetric field screening methods for munitions compounds in soil

    Science.gov (United States)

    Jenkins, Thomas F.; Walsh, Marianne E.; Schumacher, Patricia W.; Thorne, Philip G.

    1995-10-01

    Simple colorimetric tests have been developed to screen for the presence of TNT, TNB, DNT, DNB, tetryl, RDX, HMX, nitroglycerine (NG), PETN, nitrocellulose (NC), nitroguanidine (NQ), picric acid and ammonium picrate in soil. Soils are extracted by manual shaking with acetone. For the nitroaromatics, the extracts are reacted with potassium hydroxide and sodium sulfite to form their colored Janowsky complexes. For RDX, HMX, NG, PETN, NC and NQ, extracts are passed through an anion exchange resin to remove nitrate, and then acidified with acetic acid; the nitramines and nitrate esters are reduced with zinc to form nitrous acid. The nitrous acid is detected by the Griess reaction using a Hach Nitriver 3 powder pillow, which produces a highly colored azo dye. Detection of these analytes can be obtained visually and concentrations estimated from absorbance measurements at 540 nm for TNT, TNB and tetryl, 570 nm for DNTs and DNB, and at 510 nm for RDX, HMX, NG, PETN, NC and NQ. For picric acid/ammonium picrate, the acetone extract is passed through a basic ion-exchange column that retains picrate ion. The column is rinsed with methanol to elute interferences, and the picrate is desorbed with acetone containing several drops of sulfuric acid. The extract is diluted with deionized water, and the concentration of picrate is obtained from the absorbance at 400 nm. Detection limits are about 1 (mu) g/g for all analytes except NG, NC and NQ, which are slightly higher. Results from field screening at a number of sites have been correlated with laboratory analyses for TNT and RDX. The results indicate that the field screening methods do not suffer from false negatives and the rate of false positives is low. Concentration estimates from field screening compared favorably with results from the standard laboratory methods.

  9. A screening method of oil-soluble synthetic dyes in chilli products based on multi-wavelength chromatographic fingerprints comparison.

    Science.gov (United States)

    Zhu, Yonghong; Wu, Yanlei; Zhou, Chunjie; Zhao, Bo; Yun, Wen; Huang, Siyu; Tao, Peng; Tu, Dawei; Chen, Shiqi

    2016-02-01

    A multi-wavelength HPLC fingerprint comparison method was proposed for the screening of oil-soluble synthetic dyes in chilli products. The screening was based on the fingerprint differences of normal unadulterated chilli sample with tested chilli samples. The samples were extracted with acetone and fingerprinted by HPLC under four visible light wavelengths (450 nm, 490 nm, 520 nm, and 620 nm). It was found that the fingerprints of different chilli product samples had a relatively fixed number of peaks and stable retention time. When 16 kinds of known synthetic dyes were used as model analytes to assess the screening efficiency, 14 of them could be screened using fingerprint comparison method, with LOD of 0.40-2.41 mg/kg. The new screening method was simple and had the possibility of finding existence of the adulterated dyes which could not be identified using known standard analytes as control. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Developmental neurotoxicity testing: recommendations for developing alternative methods for the screening and prioritization of chemicals.

    Science.gov (United States)

    Crofton, Kevin M; Mundy, William R; Lein, Pamela J; Bal-Price, Anna; Coecke, Sandra; Seiler, Andrea E M; Knaut, Holger; Buzanska, Leonora; Goldberg, Alan

    2011-01-01

    Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternative methods to current animal testing protocols and guidelines. An immediate goal is to develop test methods that are capable of screening large numbers of chemicals. This document provides recommendations for developing alternative DNT approaches that will generate the type of data required for evaluating and comparing predictive capacity and efficiency across test methods and laboratories. These recommendations were originally drafted to stimulate and focus discussions of alternative testing methods and models for DNT at the TestSmart DNT II meeting (http://caat.jhsph.edu/programs/workshops/dnt2.html) and this document reflects critical feedback from all stakeholders that participated in this meeting. The intent of this document is to serve as a catalyst for engaging the research community in the development of DNT alternatives and it is expected that these recommendations will continue to evolve with the science.

  11. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  12. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  13. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  14. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  15. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  16. Fast Spectral Velocity Estimation Using Adaptive Techniques: In-Vivo Results

    DEFF Research Database (Denmark)

    Gran, Fredrik; Jakobsson, Andreas; Udesen, Jesper

    2007-01-01

    spectral Capon (BPC) method is based on a standard minimum variance technique adapted to account for both averaging over slowtime and depth. The Blood Amplitude and Phase Estimation technique (BAPES) is based on finding a set of matched filters (one for each velocity component of interest) and filtering......Adaptive spectral estimation techniques are known to provide good spectral resolution and contrast even when the observation window(OW) is very sbort. In this paper two adaptive techniques are tested and compared to the averaged perlodogram (Welch) for blood velocity estimation. The Blood Power...... the blood process over slow-time and averaging over depth to find the power spectral density estimate. In this paper, the two adaptive methods are explained, and performance Is assessed in controlled steady How experiments and in-vivo measurements. The three methods were tested on a circulating How rig...

  17. Fast high-throughput screening of temoporfin-loaded liposomal formulations prepared by ethanol injection method.

    Science.gov (United States)

    Yang, Kewei; Delaney, Joseph T; Schubert, Ulrich S; Fahr, Alfred

    2012-03-01

    A new strategy for fast, convenient high-throughput screening of liposomal formulations was developed, utilizing the automation of the so-called ethanol-injection method. This strategy was illustrated by the preparation and screening of the liposomal formulation library of a potent second-generation photosensitizer, temoporfin. Numerous liposomal formulations were efficiently prepared using a pipetting robot, followed by automated size characterization, using a dynamic light scattering plate reader. Incorporation efficiency of temoporfin and zeta potential were also detected in selected cases. To optimize the formulation, different parameters were investigated, including lipid types, lipid concentration in injected ethanol, ratio of ethanol to aqueous solution, ratio of drug to lipid, and the addition of functional phospholipid. Step-by-step small liposomes were prepared with high incorporation efficiency. At last, an optimized formulation was obtained for each lipid in the following condition: 36.4 mg·mL(-1) lipid, 13.1 mg·mL(-1) mPEG(2000)-DSPE, and 1:4 ethanol:buffer ratio. These liposomes were unilamellar spheres, with a diameter of approximately 50 nm, and were very stable for over 20 weeks. The results illustrate this approach to be promising for fast high-throughput screening of liposomal formulations.

  18. SCREENING METHOD OF THE DYSPLASIA OF THE CONNECTIVE TISSUE IN ADOLESCENTS

    Directory of Open Access Journals (Sweden)

    G. Y. Kalaeva

    2016-01-01

    Full Text Available ABSTRACT Aim of the study is to develop the diagnostic checklist based on the incidence and significance analysis of the external features of the dysplasia of the connective tissue (DCT for its screening and assessment of its prevalence in the adolescents’ population.Materials and methods.110 adolescents (aged from 10 to 14 years were examined, 81 of them had the dysplasia of the connective tissue (the first group. The second group was presented by 29 adolescents without DCT. The presence and degree of manifestation of DCT were established according to the criterions of Kadurina T. I., Gorbunova V.N. (2009, Т. Milkovska–Dimitrova (1987. There were the physical, laboratory and instrumental examination. Statistical processing of the results was carried out using Statistica 6.0 program and IBM SPSS Statistics 20.0. The diagnostic efficiency of the developed checklist was appreciated by means of the receiver operating characteristic curve (ROC curve. Results. The frequent occurrence of the DCT’s external features in adolescents was identified. The diagnostic checklist was developed. It was consisted of 12 items with illustrations, allowing readily identification of the dysplastic phenotype presence with diagnostic sensitivity 81.5% and specificity 79.3%. This checklist can be recommended as for the population studies, as for screening about DCT in adolescents during the primary outpatient pediatrician attendance. In the positive result of the screening it is necessary the further checkup to detect the organ changes and diagnosis updating. 

  19. A newborn screening method for cerebrotendinous xanthomatosis using bile alcohol glucuronides and metabolite ratios.

    Science.gov (United States)

    Vaz, Frédéric M; Bootsma, Albert H; Kulik, Willem; Verrips, Aad; Wevers, Ron A; Schielen, Peter C; DeBarber, Andrea E; Huidekoper, Hidde H

    2017-05-01

    Cerebrotendinous xanthomatosis (CTX) is a treatable neurodegenerative metabolic disorder of bile acid synthesis in which symptoms can be prevented if treatment with chenodeoxycholic acid supplementation is initiated early in life, making CTX an excellent candidate for newborn screening. We developed a new dried blood spot (DBS) screening assay for this disorder on the basis of different ratios between the accumulating cholestanetetrol glucuronide (tetrol) and specific bile acids/bile acid intermediates, without the need for derivatization. A quarter-inch DBS punch was extracted with methanol, internal standards were added, and after concentration the extract was injected into the tandem mass spectrometer using a 2 min flow injection analysis for which specific transitions were measured for cholestanetetrol glucuronide, taurochenodeoxycholic acid (t-CDCA), and taurotrihydroxycholestanoic acid (t-THCA). A proof-of-principle experiment was performed using 217 Guthrie cards from healthy term/preterm newborns, CTX patients, and Zellweger patients. Using two calculated biomarkers, tetrol:t-CDCA and t-THCA:tetrol, this straightforward method achieved an excellent separation between DBSs of CTX patients and those of controls, Zellweger patients, and newborns with cholestasis. The results of this small pilot study indicate that the tetrol:t-CDCA ratio is an excellent derived biomarker for CTX that has the potential to be used in neonatal screening programs. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  20. In-vivo and ex-vivo assessment of the accuracy of the computer-aided volumetry of porcine kidney in CT images

    International Nuclear Information System (INIS)

    Cai, W.; Harris, G.; Holalkere, N.; Sahani, D.; Yoshida, H.

    2007-01-01

    Measurement of kidney volume by computed tomography (CT), called renal volumetry, is indispensable for diagnosis and treatment of kidney-related diseases. Computer-aided volumetry (CAV) of kidney relies on an efficient and accurate segmentation method of the kidney. The purpose of this study is to assess the accuracy of our CAV of kidney scheme using dynamic-threshold (DT) level set method, based on in-vivo and ex-vivo reference standards. Eight Yorkshire breed anesthetized pigs were scanned on a 64-slice multi-detector CT scanner (Sensation 64, Siemens) after an injection of iodinated (300 mgl/ml) contrast agent through an IV cannula. The kidneys of the pigs were then surgically resected and scanned on CT in the same manner. Both in-vivo and ex-vivo CT images were subjected to our volumetry scheme. The resulting volumes of the kidneys were compared with the in-vivo and ex-vivo reference standards: the former was established by manual contouring of the kidneys on the CT images by an experienced radiologist, and the latter was established as the water displacement volume of the resected kidney. Our CAV of kidney scheme demonstrated accurate in-vivo and ex-vivo measurement of kidney volume, despite a large difference between the two reference standards. (orig.)

  1. In-vivo and ex-vivo assessment of the accuracy of the computer-aided volumetry of porcine kidney in CT images

    Energy Technology Data Exchange (ETDEWEB)

    Cai, W.; Harris, G.; Holalkere, N.; Sahani, D.; Yoshida, H. [Massachusetts General Hospital and Harvard Medical School (United States)

    2007-06-15

    Measurement of kidney volume by computed tomography (CT), called renal volumetry, is indispensable for diagnosis and treatment of kidney-related diseases. Computer-aided volumetry (CAV) of kidney relies on an efficient and accurate segmentation method of the kidney. The purpose of this study is to assess the accuracy of our CAV of kidney scheme using dynamic-threshold (DT) level set method, based on in-vivo and ex-vivo reference standards. Eight Yorkshire breed anesthetized pigs were scanned on a 64-slice multi-detector CT scanner (Sensation 64, Siemens) after an injection of iodinated (300 mgl/ml) contrast agent through an IV cannula. The kidneys of the pigs were then surgically resected and scanned on CT in the same manner. Both in-vivo and ex-vivo CT images were subjected to our volumetry scheme. The resulting volumes of the kidneys were compared with the in-vivo and ex-vivo reference standards: the former was established by manual contouring of the kidneys on the CT images by an experienced radiologist, and the latter was established as the water displacement volume of the resected kidney. Our CAV of kidney scheme demonstrated accurate in-vivo and ex-vivo measurement of kidney volume, despite a large difference between the two reference standards. (orig.)

  2. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  3. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  4. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  5. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  6. A graphical screening method for assessing stream water quality using specific conductivity and alkalinity data.

    Science.gov (United States)

    Kney, Arthur D; Brandes, David

    2007-03-01

    In areas of varying geology, it is difficult to infer water quality from specific conductance or electrical conductivity (EC) data without an understanding of the expected range of EC values based on local bedrock composition. This paper describes a user-friendly graphical screening method that addresses this issue by plotting the EC against concurrent alkalinity data, which correlates well with the presence of carbonate bedrock under natural conditions, and thus serves as an index of bedrock type. The upper limit of EC vs. alkalinity expected in a stream is determined using regional groundwater quality data, based on the assumption that stream chemistry reflects groundwater under baseflow conditions. Stream samples with EC/alkalinity values that consistently plot above this limit are considered impacted by anthropogenic sources. The effect of dilution and runoff on the EC vs. alkalinity plot of stream samples is considered using a simple baseflow/storm runoff-mixing model. The graphical method's utility as a screening tool is demonstrated by application to stream chemistry data from watersheds of southeastern Pennsylvania and northwestern New Jersey in several distinct geologic settings; however the method is general and widely applicable to watersheds in humid temperate regions. Its use is intended for watershed stewards of both professional and nonprofessional qualification.

  7. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  8. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  9. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  10. Optical sensing method for screening disease in melon seeds by using optical coherence tomography.

    Science.gov (United States)

    Lee, Changho; Lee, Seung-Yeol; Kim, Jeong-Yeon; Jung, Hee-Young; Kim, Jeehyun

    2011-01-01

    We report a noble optical sensing method to diagnose seed abnormalities using optical coherence tomography (OCT). Melon seeds infected with Cucumber green mottle mosaic virus (CGMMV) were scanned by OCT. The cross-sectional sensed area of the abnormal seeds showed an additional subsurface layer under the surface which is not found in normal seeds. The presence of CGMMV in the sample was examined by a blind test (n = 140) and compared by the reverse transcription-polymerase chain reaction. The abnormal layers (n = 40) were quantitatively investigated using A-scan sensing analysis and statistical method. By utilizing 3D OCT image reconstruction, we confirmed the distinctive layers on the whole seeds. These results show that OCT with the proposed data processing method can systemically pick up morphological modification induced by viral infection in seeds, and, furthermore, OCT can play an important role in automatic screening of viral infections in seeds.

  11. Microbial screening for quinolones residues in cow milk by bio-optical method.

    Science.gov (United States)

    Appicciafuoco, Brunella; Dragone, Roberto; Frazzoli, Chiara; Bolzoni, Giuseppe; Mantovani, Alberto; Ferrini, Anna Maria

    2015-03-15

    The use of antibiotics on lactating cows should be monitored for the possible risk of milk contamination with residues. Accordingly, Maximum Residue Levels (MRLs) are established by the European Commission to guarantee consumers safety. As pointed out by Dec 2002/657/EC, screening is the first step in the strategy for antibiotic residue control, thus playing a key role in the whole control procedure. However, current routine screening methods applied in milk chain still fail to detect residues of quinolones at concentrations of interest. This paper reports the findings of a new bio-optical method for the screening of quinolones residues in bovine milk, based on E. coli ATCC 11303 growth inhibition. The effect of blank and spiked cow milk samples (aliquots equivalents to 0.8%, v/v) is evaluated in Mueller Hinton Broth (MHb) and MHb enriched with MgSO4 2% (MHb-Mg) inoculated with the test strain at the concentration of 10(4)CFU/mL. The presence of quinolones inhibits the cellular growth in MHb, while this effect is neutralized in MHb-Mg allowing both detection and presumptive identification of quinolones. Growth of the test strain is monitored at 37 °C in a Bioscreen C automated system, and Optical Density (OD) at 600 nm is recorded every 10 min after shaking for 10s. Growth curves (OD vs. time) of E. coli ATCC 11303 are assessed in milk samples, with and without quinolones, and their differences in terms of ΔOD (ΔOD600nm=ODMHb-Mg-ODMHb) are calculated. The presence of quinolones is detected by the cellular growth inhibition (OD vs time, none increase in the value OD) and presumptively identified through the increase of the slope of ΔOD600nm curve (ΔOD vs. time), after about 3h of incubation. The detection limit for ciprofloxacin and enrofloxacin is at the level of MRL, for marbofloxacin is at 2-fold the MRL whereas for danofloxacin is at 4-fold the MRL. Although the sensitivity of the method could be further improved and the procedure automated, it is a

  12. Powered by DFT: Screening methods that accelerate materials development for hydrogen in metals applications.

    Science.gov (United States)

    Nicholson, Kelly M; Chandrasekhar, Nita; Sholl, David S

    2014-11-18

    CONSPECTUS: Not only is hydrogen critical for current chemical and refining processes, it is also projected to be an important energy carrier for future green energy systems such as fuel cell vehicles. Scientists have examined light metal hydrides for this purpose, which need to have both good thermodynamic properties and fast charging/discharging kinetics. The properties of hydrogen in metals are also important in the development of membranes for hydrogen purification. In this Account, we highlight our recent work aimed at the large scale screening of metal-based systems with either favorable hydrogen capacities and thermodynamics for hydrogen storage in metal hydrides for use in onboard fuel cell vehicles or promising hydrogen permeabilities relative to pure Pd for hydrogen separation from high temperature mixed gas streams using dense metal membranes. Previously, chemists have found that the metal hydrides need to hit a stability sweet spot: if the compound is too stable, it will not release enough hydrogen under low temperatures; if the compound is too unstable, the reaction may not be reversible under practical conditions. Fortunately, we can use DFT-based methods to assess this stability via prediction of thermodynamic properties, equilibrium reaction pathways, and phase diagrams for candidate metal hydride systems with reasonable accuracy using only proposed crystal structures and compositions as inputs. We have efficiently screened millions of mixtures of pure metals, metal hydrides, and alloys to identify promising reaction schemes via the grand canonical linear programming method. Pure Pd and Pd-based membranes have ideal hydrogen selectivities over other gases but suffer shortcomings such as sensitivity to sulfur poisoning and hydrogen embrittlement. Using a combination of detailed DFT, Monte Carlo techniques, and simplified models, we are able to accurately predict hydrogen permeabilities of metal membranes and screen large libraries of candidate alloys

  13. In-vivo studies of new vector velocity and adaptive spectral estimators in medical ultrasound

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Lindskov

    Wave Excitation. Furthermore two different adaptive spectral estimators have been investigated: Blood spectral Power Capon method (BPC) and Blood Amplitude and Phase Estimation method (BAPES). The novel techniques investigated in this thesis are developed to circumvent some of the main limitations...... estimate blood velocities angle independently with a high frame rate. Complex vessel geometries in the cardiovascular system were explored in-vivo on four volunteers using the technique. Flow patterns previously visualized with magnetic resonance angiography and predicted by models of computational fluid...... dynamics, were shown for the first time with ultrasound. Additionally, new information on complex flow patterns in bifurcations and around venous valves was discovered. BPC and BAPES are adaptive spectral estimators which can produce spectrograms with a high temporal resolution. Spectrograms obtained in...

  14. Hydroxamate-based colorimetric method for direct screening of transglutaminase-producing bacteria.

    Science.gov (United States)

    Bourneow, Chaiwut; Benjakul, Soottawat; H-Kittikun, Aran

    2012-05-01

    Microbial transglutaminase (MTGase) is a commercial enzyme that has been applied to many protein containing foods to improve their textural property. The screening of MTGase-producing microorganisms from various sources might lead to the discovery of a new MTGase with different characteristics. This report demonstrates the use of a direct detection method for MTGase-producing bacteria grown on an agar plate by filter paper disc (FPD) assay. The principle of the assay is the formation of a red burgundy color by the hydroxamate-ferric complex. The color developed intensity was linearly correlated by the concentration of hydroxamic acid in the range of 0.1-0.8 μM and was visually scored at 4 levels: 0, 1, 2 and 3. Streptoverticillium mobaraense DSM 40847, a positive MTGase-producer, was chosen for the verification and improving of the proposed method. The colonies grown on the nutrient agar plate at 37°C for 24 h were covered with FPDs and 30 μl of substrates (CBZ-Gln-Gly and hydroxylamine). After incubation, 10 μl of the ferric-TCA-HCl solution was placed on the FPD. The optimal time taken to catalyze the formation of CBZ-Gln-Gly-hydroxamic acid by the MTGase and the time taken for the hydroxamate-ferric complex to form color were 180 and 60 min, respectively. Using this assay, 30 of 189 colonies isolated from wastewater and floating-floc samples showed MTGase-positive colonies which were well correlated to the quantitative screening of MTGase activity (R(2) = 0.9758). The results revealed that the FPD assay could be used for the qualitative screening of MTGase-producing bacteria.

  15. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  16. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  17. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  18. Research on testing instrument and method for correction of the uniformity of image intensifier fluorescence screen brightness

    Science.gov (United States)

    Qiu, YaFeng; Chang, BenKang; Qian, YunSheng; Fu, RongGuo

    2011-09-01

    To test the parameters of image intensifier screen is the precondition for researching and developing the third generation image intensifier. The picture of brightness uniformity of tested fluorescence screen shows bright in middle and dark at edge. It is not so direct to evaluate the performance of fluorescence screen. We analyze the energy and density distribution of the electrons, After correction, the image in computer is very uniform. So the uniformity of fluorescence screen brightness can be judged directly. It also shows the correction method is reasonable and close to ideal image. When the uniformity of image intensifier fluorescence screen brightness is corrected, the testing instrument is developed. In a vacuum environment of better than 1×10-4Pa, area source electron gun emits electrons. Going through the electric field to be accelerated, the high speed electrons bombard the screen and the screen luminize. By using testing equipment such as imaging luminance meter, fast storage photometer, optical power meter, current meter and photosensitive detectors, the screen brightness, the uniformity, light-emitting efficiency and afterglow can be tested respectively. System performance are explained. Testing method is established; Test results are given.

  19. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  20. Development of Efficient Screening Method for Resistance of Cabbage to Fusarium oxysporum f. sp. conglutinans

    Directory of Open Access Journals (Sweden)

    Song-Yi Baik

    2011-04-01

    Full Text Available This study was conducted to establish the efficient screening method for resistant cabbage to Fusarium wilt caused by Fusarium oxysporum f. sp. conglutinans. The resistance degrees of nine commercial cabbage cultivars to the disease were evaluated. Among them, five cultivars (YR-honam, Ogane, Greenhot, Redmat, and Ccoccoma showing different resistance to the fungus were selected. Then development of Fusarium wilt of the cultivars according to several conditions including root wounding, dipping period of roots in spore suspension, inoculum concentration, and incubation temperature to develop the disease was investigated. Highly resistant cultivars such as ``YR-honam`` and ``Ogane`` hardly showed change of resistance to the disease by root wounding, dipping period, and inoculum concentration, while disease severity of Fusarium wilt on the cultivars was changed with incubation temperatures (20℃, 25℃ and 30℃. When the cabbage cultivars were incubated at 25℃, they represented the most difference of resistance and susceptibility to Fusarium wilt. From above results, we suggest that an efficient screening method for resistant cabbage to F. oxysporum f. sp. conglutinans is to dip the non-cut roots of 14-day-old seedlings in spore suspension of 1×107 conidia/ml for 0.5 hr and to transplant the seedlings to plastic pots with a fertilized soil, and then to cultivate the plants in a growth chamber at 25℃ for 3 weeks to develop Fusarium wilt.

  1. Dioxins in beef samples from Mexico using a low resolution GC/MS screening method.

    Science.gov (United States)

    Naccha, Lidia; Alanis, Guadalupe; Torres, Anabel; Abad, Esteban; Ábalos, Manuela; Rivera, Josep; Heyer, Lorenzo; Morales, Alberto; Waksman, Noemí

    2010-01-01

    Dioxins in beef were quantified by high resolution gas chromatography coupled to low-resolution mass spectrometry (GC/LRMS). The analyses were performed according to the minimum requirements described in the USEPA 1613 method with some minor modifications. Levels found in the samples were in the range 1.02-8.04 pg WHO-TEQ PCDDs/PCDFs g(-1) fat. For comparison purposes, the maximum level allowed by the European Union is 3 pg WHO-TEQ PCDDs/PCDFs g(-1) fat, and some of these samples surpassed the above-mentioned limit and can be considered as contaminated food. The results confirm that a preliminary screening of dioxins in beef can be performed by GC/LRMS. As far as we know, this is the first report of dioxins in beef in Mexico. After the appropriated tests, the applied methodology could be considered as an alternative screening method for the analysis of PCDD/Fs in other food products.

  2. Agreement between visual inspection with acetic acid and Papanicolaou's smear as screening methods for cervical cancer.

    Science.gov (United States)

    Naz, Uzma; Hanif, Sadia

    2014-04-01

    To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaou's (Pap) smear as screening methods for cervical cancer. A cross-sectional study. Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaou's smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings.

  3. An alternative method for screening lactic acid bacteria for the production of exopolysaccharides with rapid confirmation

    Directory of Open Access Journals (Sweden)

    Elinalva Maciel Paulo

    2012-12-01

    Full Text Available The accumulation of exopolysaccharides (EPS produced by microorganisms occurs in the presence of excess substrate and limiting conditions of elements that are essential to growth, such as nitrogen, phosphorus, sulfur, and magnesium. The presence of EPS produced by bacterial cells contributes to slime colonies formation in solid medium and increased viscosity in liquid medium. This paper proposes an alternative method for screening EPS-producing lactic acid bacteria using solid medium-containing discs of filter paper that are saturated with active cultures. The screening was carried out under different culture conditions varying the type of sugar, pH, and temperature. EPS production was visualized by the presence of mucoid colonies on the discs, which was confirmed by the formation of a precipitate when part of this colony was mixed with absolute alcohol. The established conditions for obtaining a high number of isolates producing EPS were 10% sucrose, pH 7.5 and 28 ºC. This method proved to be effective and economical because several strains could be tested on the same plate, with immediate confirmation.

  4. Acanthamoeba castellanii: A new high-throughput method for drug screening in vitro.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Padrón, José M; Valladares, Basilio; Elsheikha, Hany M

    2016-12-01

    Despite significant public health impact, there is no specific antiprotozoal therapy for prevention and treatment of Acanthamoeba castellanii infection. There is a need for new and efficient anti-Acanthamoeba drugs that are less toxic and can reduce treatment duration and frequency of administration. In this context a new, rapid and sensitive assay is required for high-throughput activity testing and screening of new therapeutic compounds. A colorimetric assay based on sulforhodamine B (SRB) staining has been developed for anti-Acanthamoeba drug susceptibility testing and adapted to a 96-well microtiter plate format. Under these conditions chlorhexidine was tested to validate the assay using two clinical strains of A. castellanii (Neff strain, T4 genotype [IC 50 4.68±0.6μM] and T3 genotype [IC 50 5.69±0.9μM]). These results were in good agreement with those obtained by the conventional Alamar Blue assay, OCR cytotoxicity assay and manual cell counting method. Our new assay offers an inexpensive and reliable method, which complements current assays by enhancing high-throughput anti-Acanthamoeba drug screening capabilities. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  6. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  7. In-Vivo High Dynamic Range Vector Flow Imaging

    DEFF Research Database (Denmark)

    Villagómez Hoyos, Carlos Armando; Stuart, Matthias Bo; Jensen, Jørgen Arendt

    2015-01-01

    Current vector flow systems are limited in their detectable range of blood flow velocities. Previous work on phantoms has shown that the velocity range can be extended using synthetic aperture directional beamforming combined with an adaptive multi-lag approach. This paper presents a first invivo...... example with a high dynamic velocity range. Velocities with an order of magnitude apart are detected on the femoral artery of a 41 years old healthy individual. Three distinct heart cycles are captured during a 3 secs acquisition. The estimated vector velocities are compared against each other within...

  8. Real time monitoring in-vivo micro-environment through the wound heal mechanism

    Science.gov (United States)

    Yan, Jack

    2013-02-01

    One of the In-vivo system's challenge is real time display the sensing information. Usually Ultrasound, CT, MRI, PET are used to get the internal information, this thesis proposed another approach to address the display challenge. Special nano-particles are in-taken or injected to living subject (usually into blood circulation) to sense and collect psychological information when the active particles pass through the tissues of interest. Using the wound healing mechanism, these activated particles (Information collected) can be drifted out to the wound area and adhibited close to the skin, then skin can show different color if the activated particles are concentrated enough in the specific area to create a skin screen. The skin screen can display the blood status, internal organ's temperature, pressure depending the nano-particles' function and their pathway. This approach can also be used to display in-body video if the particles are sensitive and selective enough. In the future, the skin screen can be bio-computer's monitor. The wound healing in an animal model normally divides in four phase: Hemostasis, Inflammation, Proliferation and Maturation. Hemostasis phase is to form a stable clot sealing the damaged vessel. Inflammation phase causes the blood vessels to become leaky releasing plasma and PMN's (polymorphonucleocytes) into the surrounding tissue and provide the first line of defense against infection. Proliferation phase involves replacement of dermal tissues and sometimes subdermal tissues in deeper wounds as well as contraction of the wound. Maturation phase remodels the dermal tissues mainly by fibroblast to produce greater tensile strength. The skin screen wound will be carefully controlled to be triggered at dermis layer.

  9. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  10. Implementing a method of screening one-well hydraulic barrier design alternatives.

    Science.gov (United States)

    Rubin, Hillel; Shoemaker, Christine A; Köngeter, Jürgen

    2009-01-01

    This article provides details of applying the method developed by the authors (Rubin et al. 2008b) for screening one-well hydraulic barrier design alternatives. The present article with its supporting information (manual and electronic spreadsheets with a case history example) provides the reader complete details and examples of solving the set of nonlinear equations developed by Rubin et al. (2008b). It allows proper use of the analytical solutions and also depicting the various charts given by Rubin et al. (2008b). The final outputs of the calculations are the required position and the discharge of the pumping well. If the contaminant source is nonaqueous phase liquid (NAPL) entrapped within the aquifer, then the method provides an estimate of the aquifer remediation progress (which is a by-product) due to operating the hydraulic barrier.

  11. A novel thin-layer chromatography method to screen 1,3-propanediol producers.

    Science.gov (United States)

    Anand, Pinki; Saxena, Rajendra Kumar

    2012-11-01

    To date, there is no established protocol for the screening of 1,3-propanediol producers. The proposed method has a wide applicability to harness the commercial potential of microorganisms which produce 1,3-propanediol as the end product. Glycerol fermentation broth of 50 bacteria spotted on thin-layer chromatography plates and run by appropriate solvent systems followed by colour development using vanillin reagent gave different coloured spots with most of the compounds present in the fermentation broth. The appearance of a purple-coloured spot of 1,3-propanediol with a retention factor (R(f)) of 0.62 forms the basis for the selection of 1,3-propanediol producers. Apart from being a rapid detection system the proposed method is pH independent and its authenticity was reconfirmed by HPLC.

  12. Screening Methods for Identification of the Target Group Autism Spectrum For Special Education Teachers and Psychologists

    Directory of Open Access Journals (Sweden)

    Sorokin A. B.,

    2016-10-01

    Full Text Available We present three screening instruments which can be used by special education teachers and psychologists for assessment of children who may belong to the intervention target group “autism spectrum”. Two of these instruments (Social Communication Questionnaire and Checklist for Autism Spectrum Disorders are parent/caregiver questionnaires and one (Autism Mental Status Exam is a short observation schedule. All three methods were used with 132 children with conditions associated with autism spectrum, other developmental conditions, as well as typically developing children. Correlation coefficient values ranged from 0.7 to 0.82 for the pairwise comparison of the three overall scores. They provide evidence for significant convergent validity of the methods. The article discusses the strong sides of every instrument that professionals may find useful when choosing instruments for their diagnostic toolbox.

  13. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  14. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  15. Preliminary In-Vivo Evaluation of Convex Array Synthetic Aperture Imaging

    DEFF Research Database (Denmark)

    Pedersen, Morten Høgholm; Gammelmark, Kim; Jensen, Jørgen Arendt

    2004-01-01

    Synthetic transmit aperture (STA) imaging has previously been investigated and compared to traditional imaging techniques in simulations and phantom studies. However, a full in-vivo study evaluating its clinical potential has yet to be conducted. This paper presents a preliminary in-vivo study of...

  16. Current trends in virtual high throughput screening using ligand-based and structure-based methods.

    Science.gov (United States)

    Sukumar, Nagamani; Das, Sourav

    2011-12-01

    High throughput in silico methods have offered the tantalizing potential to drastically accelerate the drug discovery process. Yet despite significant efforts expended by academia, national labs and industry over the years, many of these methods have not lived up to their initial promise of reducing the time and costs associated with the drug discovery enterprise, a process that can typically take over a decade and cost hundreds of millions of dollars from conception to final approval and marketing of a drug. Nevertheless structure-based modeling has become a mainstay of computational biology and medicinal chemistry, helping to leverage our knowledge of the biological target and the chemistry of protein-ligand interactions. While ligand-based methods utilize the chemistry of molecules that are known to bind to the biological target, structure-based drug design methods rely on knowledge of the three-dimensional structure of the target, as obtained through crystallographic, spectroscopic or bioinformatics techniques. Here we review recent developments in the methodology and applications of structure-based and ligand-based methods and target-based chemogenomics in Virtual High Throughput Screening (VHTS), highlighting some case studies of recent applications, as well as current research in further development of these methods. The limitations of these approaches will also be discussed, to give the reader an indication of what might be expected in years to come.

  17. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  18. In-vivo Centrifugation of Drosophila Embryos

    Science.gov (United States)

    Tran, Susan L.; Welte, Michael A.

    2010-01-01

    A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species. PMID:20613707

  19. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  20. In-vivo evaluation of an in situ polymer precipitation delivery system for a novel natriuretic peptide.

    Directory of Open Access Journals (Sweden)

    Soo Ghim Lim

    Full Text Available This study reports on the release of a novel natriuretic peptide, CD-NP, from an in situ polymer precipitation delivery system. Following extensive screening of in-vitro release profiles, an in-vivo evaluation of the efficacy of the delivery system was carried out in Wistar rats. Gel injection was performed subcutaneously on the back of the rats. A secondary messenger, cyclic Guanosine 3'5' Monophosphate (cGMP, was tested for verification of CD-NP bioactivity, in addition to direct measurements of CD-NP levels in plasma and urine using a radio-immuno assay. Plasma evaluation showed an elevated level of CD-NP over 3 weeks' duration. Unexpectedly, plasma cGMP level followed a decreasing trend over the same duration despite high CD-NP level. Loss of drug bioactivity was ruled out as a high level of CD-NP and cGMP excretion was observed in the treatment group as compared to baseline readings. This unexpected low-plasma cGMP levels and high-urinary cGMP excretion suggest that there might be other compensatory responses to regulation of the CDNP bioactivity as a result of the high drug dosing. The results stress the importance of assessing the overall bioactivity of released drug (in-vivo concurrently in addition to measuring its concentrations, to determine the correct release profile.

  1. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  2. Human in-vivo brain magnetic resonance current density imaging (MRCDI)

    DEFF Research Database (Denmark)

    Göksu, Cihan; Hanson, Lars G.; Siebner, Hartwig R

    2017-01-01

    Magnetic resonance current density imaging (MRCDI) and MR electrical impedance tomography (MREIT) are two emerging modalities, which combine weak time-varying currents injected via surface electrodes with magnetic resonance imaging (MRI) to acquire information about the current flow and ohmic...... is modulated by these shifts, allowing to determine ΔBz,c for the reconstruction of the current flow and ohmic conductivity. Here, we demonstrate reliable ΔBz,c measurements in-vivo in the human brain based on multi-echo spin echo (MESE) and steady-state free precession free induction decay (SSFP......-FID measurements, we demonstrate a strong influence of magnetic stray fields on the ΔBz,c images, caused by non-ideal paths of the electrode cables, and validate a correction method. Finally, we perform measurements with two different current injection profiles in five subjects. We demonstrate reliable recordings...

  3. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  4. An Improved Method for P2X7R Antagonist Screening.

    Science.gov (United States)

    Soares-Bezerra, Rômulo José; Ferreira, Natiele Carla da Silva; Alberto, Anael Viana Pinto; Bonavita, André Gustavo; Fidalgo-Neto, Antônio Augusto; Calheiros, Andrea Surrage; Frutuoso, Valber da Silva; Alves, Luiz Anastacio

    2015-01-01

    ATP physiologically activates the P2X7 receptor (P2X7R), a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites), this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS) method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG) and oxidized ATP (OATP). The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively) [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  5. An end-point method based on graphene oxide for RNase H analysis and inhibitors screening.

    Science.gov (United States)

    Zhao, Chuan; Fan, Jialong; Peng, Lan; Zhao, Lijian; Tong, Chunyi; Wang, Wei; Liu, Bin

    2017-04-15

    As a highly conserved damage repair protein, RNase H can hydrolysis DNA-RNA heteroduplex endonucleolytically and cleave RNA-DNA junctions as well. In this study, we have developed an accurate and sensitive RNase H assay based on fluorophore-labeled chimeric substrate hydrolysis and the differential affinity of graphene oxide on RNA strand with different length. This end-point measurement method can detect RNase H in a range of 0.01 to 1 units /mL with a detection limit of 5.0×10 -3 units/ mL under optimal conditions. We demonstrate the utility of the assay by screening antibiotics, resulting in the identification of gentamycin, streptomycin and kanamycin as inhibitors with IC 50 of 60±5µM, 70±8µM and 300±20µM, respectively. Furthermore, the assay was reliably used to detect RNase H in complicated biosamples and found that RNase H activity in tumor cells was inhibited by gentamycin and streptomycin sulfate in a concentration-dependent manner. The average level of RNase H in serums of HBV infection group was similar to that of control group. In summary, the assay provides an alternative tool for biochemical analysis for this enzyme and indicates the feasibility of high throughput screening inhibitors of RNase H in vitro and in vivo. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Development of Screening Method for an Frail Elderly by Measurement Quantitative Lower Limb Muscular Strength

    Science.gov (United States)

    Yamashita, Kazuhiko; Iwakami, Yumi; Imaizumi, Kazuya; Sato, Mitsuru; Nakajima, Sawako; Ino, Shuichi; Kawasumi, Masashi; Ifukube, Tohru

    Falling is one of the most serious problems for the elderly. The aim of this study was to develop a screening method for identifying factors that increase the risk of falling among the elderly, particularly with regard to lower limb muscular strength. Subjects were 48 elderly volunteers, including 25 classed as healthy and 23 classed as frail. All subjects underwent measurement of lower limb muscular strength via toe gap force and measurement of muscle strength of the hip joint adductor via knee gap force. In the frail group, toe gap force of the right foot was 20% lower than that in the healthy group; toe gap force of the left foot in the frail group was 23% lower than that in the healthy group, while knee gap force was 20% lower. Furthermore, we found that combining left toe gap force and knee gap force gave the highest odds ratio (6.05) with 82.6% sensitivity and 56.0% specificity when the toe gap force was 24 N and the knee gap force was 100 N. Thus, lower limb muscular strength can be used for simple and efficient screening, and approaches to prevent falls can be based on quantitative data such as lower limb muscular strength.

  7. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Simplified methods for screening cowpea cultivars for manganese leaf-tissue tolerance. [Vigna unguiculata

    Energy Technology Data Exchange (ETDEWEB)

    Wissemeier, A.H.; Horst, W.J. (Univ. of Hannover (West Germany))

    In cowpea (Vigna unguiculata (L.) Walp.) dark brown speckles on old leaves are typical symptoms of Mn toxicity and indicate Mn sensitivity of leaf tissue. Induction and subsequent quantification of brown Mn speckles in leaf tissues were used to screen cowpea cultivars for Mn leaf-tissue tolerance using three different techniques: (i) leaf cuttings cultured for 22 days in solution culture with 20 {mu}M MnSO{sub 4}, (ii) leaf rings mounted on leaves of intact plants and filled with 500 {mu}M MnSO{sub 4} for 5 days, and (iii) leaf disks floated for 3 days on 500 {mu}M MnSO{sub 4}. Density of brown speckles differed considerably among the six cultivars tested, and was not related to the Mn concentrations of the leaf tissues. There were close relationships between genotypic Mn-toxicity symptom expression and depression of dry matter production of the cultivars at high Mn supply in a long-term sand culture experiment. The floating leaf-disk method is particularly suited for screening large numbers of cowpea cultivars for Mn leaf-tissue tolerance because it requires only 3 days. The ranking of the cultivars for Mn tolerance was highly correlated to Mn tolerance of intact plants.

  9. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  10. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  11. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  12. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  13. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  14. Real Time Deconvolution of In-Vivo Ultrasound Images

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt

    2013-01-01

    based model for the ultrasound pulse and can include a depth varying pulse and spatially varying signal-to-noise ration. An autoregressive moving average (ARMA) model of orders 8 and 9 is used for the pulse, and the ARMA parameters are determined as a function of depth using a minimum variance algorithm...... resolution has been determined from the in-vivo liver image using the auto-covariance function. From the envelope of the estimated pulse the axial resolution at Full-Width-Half-Max is 0.581 mm corresponding to 1.13 l at 3 MHz. The algorithm increases the resolution to 0.116 mm or 0.227 l corresponding...... to a factor of 5.1. The basic pulse can be estimated in roughly 0.176 seconds on a single CPU core on an Intel i5 CPU running at 1.8 GHz. An in-vivo image consisting of 100 lines of 1600 samples can be processed in roughly 0.1 seconds making it possible to perform real-time deconvolution on ultrasound data...

  15. Cardiac In-vivo Measurements Using Synthetic Transmit Aperture Ultrasound

    DEFF Research Database (Denmark)

    Andresen, Henrik; Nikolov, Svetoslav; Hassager, Christian

    2006-01-01

    in each scan sequence is equal to the number of transducer elements. A pulse repetition frequency of 4500 Hz was used, allowing a frame rate of 78 and 39 frames/s for the 64 and 128 element transducer. As the heart walls move with a speed of up to 80 mm/s, a movement of the tissue of several wavelengths...... presented in this paper show a cross-section of the ventricle and atrium, where the walls of the ventricles and the atrioventricular valves are visible. The dynamic of the beating heart is visible during the recorded sequences. Distortions are seen in the images created by the full scan sequence, which......, effectively achieving dynamic transmit and receive focusing. The purpose of this paper is to acquire in-vivo cardiac images using STA to investigate image quality and the effect of tissue motion. For the in-vivo experiments, a 3 MHz and a 3.5 MHz transducers were used with 64 and 128 elements, respectively...

  16. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  17. A Mixed Methods Review of Education and Patient Navigation Interventions to Increase Breast and Cervical Cancer Screening for Rural Women.

    Science.gov (United States)

    Falk, Derek

    2018-02-07

    Reviews have assessed studies of breast and cervical cancer screening access and utilization for rural women, but none analyze interventions to increase screening rates. A mixed methods literature search identified studies of breast and/or cervical cancer prevention education and patient navigation interventions for rural women. Rural areas need greater implementation and evaluation of screening interventions as these services address the challenges of delivering patient-centered cancer care to un-/underserved communities. The lack of intervention studies on breast and cervical cancer education and patient navigation programs compared to urban studies highlights the need for validation of these programs among diverse, rural populations.

  18. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  19. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  20. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust.

    Science.gov (United States)

    Rosati, Jacky A; Bern, Amy M; Willis, Robert D; Blanchard, Fredrick T; Conner, Teri L; Kahn, Henry D; Friedman, David

    2008-02-15

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation.

  1. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  2. Fluorometric method for inorganic pyrophosphatase activity detection and inhibitor screening based on click chemistry.

    Science.gov (United States)

    Xu, Kefeng; Chen, Zhonghui; Zhou, Ling; Zheng, Ou; Wu, Xiaoping; Guo, Longhua; Qiu, Bin; Lin, Zhenyu; Chen, Guonan

    2015-01-06

    A fluorometric method for pyrophosphatase (PPase) activity detection was developed based on click chemistry. Cu(II) can coordinate with pyrophosphate (PPi), the addition of pyrophosphatase (PPase) into the above system can destroy the coordinate compound because PPase catalyzes the hydrolysis of PPi into inorganic phosphate and produces free Cu(II), and free Cu(II) can be reduced by sodium ascorbate (SA) to form Cu(I), which in turn initiates the ligating reaction between nonfluorescent 3-azidocoumarins and terminal alkynes to produce a highly fluorescent triazole complex, based on which, a simple and sensitive turn on fluorometric method for PPase can be developed. The fluorescence intensity of the system has a linear relationship with the logarithm of the PPase concentration in the range of 0.5 and 10 mU with a detection limit down to 0.2 mU (S/N = 3). This method is cost-effective and convenient without any labels or complicated operations. The proposed system was applied to screen the potential PPase inhibitor with high efficiency. The proposed method can be applied to diagnosis of PPase-related diseases.

  3. DNA-electrophoresis of single cells - a method to screen for irradiated foodstuffs

    International Nuclear Information System (INIS)

    Leffke, A.; Helle, N.; Boegl, K.W.; Schreiber, G.A.

    1993-01-01

    Microelectrophoresis of single cells can be used to detect γ-irradiation over a wide dose range and for a variety of products. It is a simple and rapid test for DNA damages and can be used for screening. The method was tested on cell suspensions of bone marrow and muscle cells from frozen chicken legs, chicken heart, turkey liver, beef and pork irradiated with doses up to 3 kGy. Cell suspensions were prepared by incubation of tissues in EDTA-SDS-buffer at pH 8. Single cell electrophoresis was performed in 0.75% agarose gel. DNA was visualised by silver staining. In unirradiated samples no or only a small amount of DNA penetrated the cell membranes. Cells of irradiated samples appeared like a ''comet'' due to to migration of DNA-fragments out of cell. (orig.)

  4. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  5. A new screening method for flunitrazepam in vodka and tequila by fluorescence spectroscopy.

    Science.gov (United States)

    Leesakul, Nararak; Pongampai, Sirintip; Kanatharana, Proespichaya; Sudkeaw, Pravit; Tantirungrotechai, Yuthana; Buranachai, Chittanon

    2013-01-01

    A new screening method for flunitrazepam in colourless alcoholic beverages based on a spectroscopic technique is proposed. Absorption and steady-state fluorescence of flunitrazepam and its protonated form with various acids were investigated. The redshift of the wavelength of maximum absorption was distinctively observed in protonated flunitrazepam. An emissive fluorescence at 472 nm was detected in colourless spirits (vodka and tequila) at room temperature. 2-M perchloric acid was the most appropriated proton source. By using electron ionization mass spectrometry and time-dependent density functional theory calculations, the possible structure of protonated flunitrazepam was identified to be 2-nitro-N-methylacridone, an acridone derivative as opposed to 2-methylamino-5-nitro-2'-fluorobenzophenone, a benzophenone derivative. Copyright © 2012 John Wiley & Sons, Ltd.

  6. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  7. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  8. In-Vivo Imaging of Cell Migration Using Contrast Enhanced MRI and SVM Based Post-Processing.

    Directory of Open Access Journals (Sweden)

    Christian Weis

    Full Text Available The migration of cells within a living organism can be observed with magnetic resonance imaging (MRI in combination with iron oxide nanoparticles as an intracellular contrast agent. This method, however, suffers from low sensitivity and specificty. Here, we developed a quantitative non-invasive in-vivo cell localization method using contrast enhanced multiparametric MRI and support vector machines (SVM based post-processing. Imaging phantoms consisting of agarose with compartments containing different concentrations of cancer cells labeled with iron oxide nanoparticles were used to train and evaluate the SVM for cell localization. From the magnitude and phase data acquired with a series of T2*-weighted gradient-echo scans at different echo-times, we extracted features that are characteristic for the presence of superparamagnetic nanoparticles, in particular hyper- and hypointensities, relaxation rates, short-range phase perturbations, and perturbation dynamics. High detection quality was achieved by SVM analysis of the multiparametric feature-space. The in-vivo applicability was validated in animal studies. The SVM detected the presence of iron oxide nanoparticles in the imaging phantoms with high specificity and sensitivity with a detection limit of 30 labeled cells per mm3, corresponding to 19 μM of iron oxide. As proof-of-concept, we applied the method to follow the migration of labeled cancer cells injected in rats. The combination of iron oxide labeled cells, multiparametric MRI and a SVM based post processing provides high spatial resolution, specificity, and sensitivity, and is therefore suitable for non-invasive in-vivo cell detection and cell migration studies over prolonged time periods.

  9. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  10. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  11. Ion mobility spectrometry (IMS) field screening methods and analysis of explosives in contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Avolio, J.; DeBono, R.; Radwanski, P. [Barringer Instruments Inc., New Providence, NJ (United States)

    1995-12-31

    The rapid on-site and lab analysis of soil samples contaminated with DNT, TNT, and RDX is explored with IMS detection and various sample preparation methods. Field screening for explosives is presently time consuming and generates considerable amounts of additional chemical wastes. The field method is also limited in the number of different explosives that can be analyzed. The use of a Barringer Instruments IONSCAN IMS system, which is comprised of a thermal desorption sample introduction system directly plumbed to the IMS reaction region and drift tube assembly permits novel methods of sample prep and sample introduction to be employed. Direct sampling, sample salvation, and sample extraction are all investigated and reported. Benefits of utilizing an IONSCAN in the analysis of soil samples is the ability to simultaneously analyze up to 18 analytes in each sample in 4.8 seconds! Therefore it is feasible to analyze for degradation products as well as the target parent explosive compounds. 10 PPM or better limits of detection are achieved with this methodology and an IONSCAN for DNT, TNT, and RDX. Based on these preliminary results this work is being continued in both the lab and on-site with soil and water samples.

  12. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  13. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  14. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  15. Heteroduplex analysis: a useful screening method for glycogen storage disease type Ia.

    Science.gov (United States)

    Narita, T; Tsuruta, Y; Chiba, K

    1998-04-01

    Glycogen storage disease type Ia (GSDIa), also known as von Gierke disease, is the most common and severe disease of glycogenoses and is caused by a deficiency of glucose-6-phosphatase (G6Pase) and transmitted by an autosomal recessive trait. The encoding gene of G6Pase is composed of only five exons and each exon is short. With heteroduplex analysis (HDA) method, we analyzed the genomic DNA from a patient diagnosed with GSDIa and from her parents. Exons II and IV of the patient showed heteroduplex bands. The mother had a heteroduplex band of exon II, and the father had a heteroduplex band of exon IV. In a mini-slab electrophoresis, exons II and IV of the patient did not show clear heteroduplex bands, but they appeared broader than the others, which made us suspect that they were heteroduplex bands. HDA is an easy and simple method and can verify mutant homozygous DNA fragments by adding wild-type DNA. We think that HDA may be a very useful screening method for the detection of novel genomic mutation in GSDIa in large-scale and mini-slab electrophoresis.

  16. An in-vivo dosimetry procedure for Elekta step and shoot IMRT.

    Science.gov (United States)

    Cilla, S; Azario, L; Greco, F; Fidanzio, A; Porcelli, A; Grusio, M; Macchia, G; Morganti, A G; Meluccio, D; Piermattei, A

    2014-06-01

    The aim of this work was to extend an in-vivo dosimetry (IVD) method, previously developed by the authors for 3D-conformal radiotherapy, to step and shoot IMRT treatments for pelvic tumors delivered by Elekta linacs. The algorithm is based on correlation functions to convert EPID transit signals into in-vivo dose values at the isocenter point, Diso. The EPID images were obtained by the so-called "IMRT Dosimetric Weighting" mode as a superposition of many segment fields. This way each integral dosimetric image could be acquired in about 10 s after the end of beam delivery and could be processed while delivering the successive IMRT beams. A specific algorithm for Diso reconstruction especially featured for step and shoot IMRT was implemented using a fluence inhomogeneity index, FI, introduced to describe the degree of beam modulation with respect to open beams. A γ-analysis of 2D-EPID images obtained day to day, resulted rapid enough to verify the plan delivery reproducibility. Fifty clinical IMRT beams, planned for patients undergoing radiotherapy of pelvic tumors, were used to irradiate a homogeneous phantom. For each beam the agreement between the reconstructed dose, Diso, and the TPS computed dose, Diso,TPS, was well within 5%, while the mean ratio R = Diso/Diso,TPS resulted for 250 tests equal to 1.006 ± 0.036. The same beams were checked in vivo, i.e. during patient treatment delivery, obtaining 500 tests whose average R ratio resulted equal to 1.011 ± 0.042. The γ-analysis of the EPID images with 5% 3 mm criteria supplied 85% of the tests with pass rates γ(mean) ≤ 0.5 and P(γFisica Medica. Published by Elsevier Ltd. All rights reserved.

  17. In-vivo oxidized albumin- a pro-inflammatory agent in hypoalbuminemia.

    Directory of Open Access Journals (Sweden)

    Faiga Magzal

    Full Text Available Hypoalbuminemia of Hemodialysis (HD patients is an independent cardiovascular risk factor, however, there is no mechanistic explanation between hypoalbuminemia and vascular injury. In the event of oxidative stress and inflammation to which HD patients are exposed, albumin is oxidized and undetected by common laboratory methods, rendering an apparent hypoalbuminemia. We wanted to show that these circulating modified oxidized albumin molecules cause direct vascular damage, mediating inflammation. Once these in-vivo albumin modifications were reduced in- vitro, the apparent hypoalbuminemia concomitantly with its inflammatory effects, were eliminated. Albumin modification profiles from 14 healthy controls (HC and 14 HD patients were obtained by mass spectrometry (MS analyses before and after reduction in- vitro, using redox agent 1,4 dithiothreitol (DTT. Their inflammatory effects were explored by exposing human umbilical endothelial cells (HUVEC to all these forms of albumin. Albumin separated from hypoalbuminemic HD patients increased endothelial mRNA expression of cytokines and adhesion molecules, and augmented secretion of IL-6. This endothelial inflammatory state was almost fully reverted by exposing HUVEC to the in-vitro reduced HD albumin. MS profile of albumin modifications peaks was similar between HD and HC, but the intensities of the various peaks were significantly different. Abolishing the reversible oxidative modifications by DTT prevented endothelial injury and increased albumin levels. The irreversible modifications such as glycation and sulfonation show low intensities in HD albumin profiles and are nearly unobserved in HC. We showed, for the first time, a mechanistic link between hypoalbuminemia and the pro-inflammatory properties of in-vivo oxidized albumin, initiating vascular injury.

  18. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  19. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  20. The Stroop Smartphone App is A Short and Valid Method to Screen for Minimal Hepatic Encephalopathy

    Science.gov (United States)

    Bajaj, Jasmohan S; Thacker, Leroy R; Heuman, Douglas M; Fuchs, Michael; Sterling, Richard K; Sanyal, Arun J; Puri, Puneet; Siddiqui, Mohammad S; Stravitz, Richard T; Bouneva, Iliana; Luketic, Velimir; Noble, Nicole; White, Melanie B; Monteith, Pamela; Unser, Ariel; Wade, James B

    2013-01-01

    Minimal hepatic encephalopathy(MHE) detection is difficult due to the unavailability of short screening tools. Therefore MHE patients can remain undiagnosed and untreated. Aim To use a Stroop smartphone application(EncephalApp_Stroop) to screen for MHE. Methods The App and standard psychometric tests(SPT; 2/4 abnormal is MHE, gold standard), psychometric hepatic encephalopathy score(PHES) and Inhibitory control(ICT) tests were administered to cirrhotics [with/without prior-overt HE(OHE)] and age-matched controls from two centers; a subset underwent re-testing. A separate validation cohort was also recruited. Stroop has “off”state with neutral stimuli and “on”state with incongruent stimuli. Outcomes: time to complete five correct runs, number of trials needed in On(Ontime) and Off(Offtime) states. Stroop results were compared between controls and cirrhotics with/without OHE, and those with/without MHE(using SPT,ICT,PHES). ROC analysis was performed to diagnose MHE in cirrhotics with/without prior OHE. Results 125 cirrhotics (43 prior OHE) and 134 controls were included in the original cohort. App times were correlated with MELD (Offtime:r=0.57,Ontime:r=0.61,pStroop performance was also significantly impaired in those with MHE compared to no-MHE according to SPT,ICT and PHES (all p274.9 seconds(OnTime+OffTime) had an AUC=0.89 in all patients and 0.84 in patients without prior OHE for MHE diagnosis using SPT as the gold standard. The validation cohort showed 78% sensitivity and 90% specificity with the >274.9 seconds OnTime+OffTime cut-off. App result patterns were similar between the centers. Test-retest reliability in controls and those without prior OHE was good; a learning effect on Ontime in cirrhotics without prior OHE was seen. In conclusion, the Stroop smartphone app is a short, valid and reliable tool for screening of MHE. PMID:23389962

  1. Mass screening for celiac disease from the perspective of newly diagnosed adolescents and their parents: A mixed-method study

    Directory of Open Access Journals (Sweden)

    Rosén Anna

    2011-10-01

    Full Text Available Abstract Background Mass screening for celiac disease (CD as a public health intervention is controversial. Prior to implementation, acceptability to the targeted population should be addressed. We aimed at exploring adolescents' and parents' experiences of having the adolescents' CD detected through mass screening, and their attitudes towards possible future mass screening. Methods All adolescents (n = 145 with screening-detected CD found in a Swedish school-based screening study, and their parents, were invited to this study about one year after diagnosis. In all, 14 focus group discussions were conducted with 31 adolescents and 43 parents. Written narrative was completed by 91 adolescents (63% and 105 parents (72%, and questionnaires returned by 114 parents (79%. Data were analyzed using qualitative content analysis. In addition, narratives and questionnaire data allowed for quantified measures. Results Adolescents and parents described how they agreed to participate "for the good of others," without considering consequences for themselves. However, since the screening also introduced a potential risk of having the disease, the invitation was regarded as "an offer hard to resist." For the majority, receiving the diagnosis was described as "a bolt of lightning," but for some it provided an explanation for previous health problems, and "suddenly everything made sense." Looking back at the screening, the predominant attitude was "feeling grateful for being made aware," but some adolescents and parents also expressed "ambivalent feelings about personal benefits." Among parents, 92% supported future CD screening. The most common opinion among both adolescents and parents was that future CD mass screening should be "a right for everyone" and should be offered as early as possible. However, some argued that it should be "only for sufferers" with symptoms, whereas others were "questioning the benefits" of CD mass screening. Conclusions Although the

  2. Identification of imprinted genes using a novel screening method based on asynchronous DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Kawame, H.; Hansen, R.S.; Gartler, S.M. [Univ. of Washington, Seattle, WA (United States)

    1994-09-01

    Genomic imprinting refers to the process of epigenetic change that occurs during germ cell development that results in either maternal- or paternal-specific gene expression. Identification of imprinted genes is of primary importance to the understanding of imprinting mechanisms and the role of specific imprinted genes in human disease. Recently, it has been established that chromosomal regions known to contain imprinted genes replicate asynchronously. We propose a novel screening method to identify imprinted genes based on replication asynchrony as a marker for imprinted domains. Dividing human cells were pulse-labeled with BrdU and separated into different fractions of S-phase by flow cytometry. A library of late-replicating inter-Alu sequences should be enriched in gene-associated sequences that replicate early on one chromosome and late on the other homologue. Clones were analyzed for replication timing by hybridization to inter-Alu replication profiles. Candidates for replication asynchrony exhibited broad or biphasic replication timing, and these were analyzed for chromosomal location by hybridizations to inter-Alu products from a hybrid mapping panel. Initial screening of 123 clones resulted in 3 asynchronously-replicating clones that localized to single chromosomes. Chromosome 17 and chromosome 19 candidates might be located in regions thought to be imprinted by synteny with mouse chromosomes. A chromosome 15 clone was further characterized because of its possible localization to the Prader-Willi/Angelman locus. This sequence was localized outside the region deleted in Prader-Willi patients, and was found to be expressed in human cell lines. Replication asynchrony for this sequence appears to be polymorphic because cells derived from some individuals indicated synchronous replication. This appears to be the first example of a polymorphism in replication asynchrony.

  3. aSi EPIDs for the in-vivo dosimetry of static and dynamic beams

    Science.gov (United States)

    Piermattei, A.; Cilla, S.; Azario, L.; Greco, F.; Russo, M.; Grusio, M.; Orlandini, L.; Fidanzio, A.

    2015-10-01

    Portal imaging by amorphous silicon (aSi) photodiode is currently the most applied technology for in-vivo dosimetry (IVD) of static and dynamic radiotherapy beams. The strategy, adopted in this work to perform the IVD procedure by aSi EPID, is based on: in patient reconstruction of the isocenter dose and day to day comparison between 2D-portal images to verify the reproducibility of treatment delivery. About 20.000 tests have been carried out in this last 3 years in 8 radiotherapy centers using the SOFTDISO program. The IVD results show that: (i) the procedure can be implemented for linacs of different manufacturer, (ii) the IVD analysis can be obtained on a computer screen, in quasi real time (about 2 min after the treatment delivery) and (iii) once the causes of the discrepancies were eliminated, all the global IVD tests for single patient were within the acceptance criteria defined by: ±5% for the isocenter dose, and PγFisica Nucleare (INFN) and Università Cattolica del S.Cuore (UCSC).

  4. Utilization of breast cancer screening methods in a developing nation: results from a nationally representative sample of Malaysian households.

    Science.gov (United States)

    Dunn, Richard A; Tan, Andrew K G

    2011-01-01

    As is the case in many developing nations, previous studies of breast cancer screening behavior in Malaysia have used relatively small samples that are not nationally representative, thereby limiting the generalizability of results. Therefore, this study uses nationally representative data from the Malaysia Non-Communicable Disease Surveillance-1 to investigate the role of socio-economic status on breast cancer screening behavior in Malaysia, particularly differences in screening behaviour between ethnic groups. The decisions of 816 women above age 40 in Malaysia to screen for breast cancer using mammography, clinical breast exams (CBE), and breast self-exams (BSE) are modeled using logistic regression. Results indicate that after adjusting for differences in age, education, household income, marital status, and residential location, Malay women are less likely than Chinese and Indian women to utilize mammography, but more likely to perform BSE. Education level and urban residence are positively associated with utilization of each method, but these relationships vary across ethnicity. Higher education levels are strongly related to using each screening method among Chinese women, but have no statistically significant relationship to screening among Malays. © 2011 Wiley Periodicals, Inc.

  5. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  6. NMR-based screening method for transglutaminases: rapid analysis of their substrate specificities and reaction rates.

    Science.gov (United States)

    Shimba, Nobuhisa; Yokoyama, Kei-ichi; Suzuki, Ei-ichiro

    2002-03-13

    Incorporation of inter- or intramolecular covalent cross-links into food proteins with microbial transglutaminase (MTG) improves the physical and textural properties of many food proteins such as tofu, boiled fish paste, and sausage. Other transglutaminases (TGases) are expected to be used in the same way, and also to extend the scope of industrial applications to materials, drugs, and so on. The TGases have great diversity, not only in amino acid sequence and size, but also in their substrate specificities and catalytic activities, and therefore, it is quite difficult to estimate their reactivity. We have developed an NMR-based method using the enzymatic labeling technique (ELT) for simultaneous analysis of the substrate specificities and reaction rates of TGases. It is quite useful for comparing the existing TGases and for screening new TGases or TGases variants. This method has shown that MTG is superior for industrial use because of its lower substrate specificity compared with those of guinea pig liver transglutaminase (GTG) and red sea bream liver transglutaminase (FTG). We have also found that an MTG variant lacking an N-terminal aspartic acid residue has higher activity than that of the native enzyme.

  7. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  8. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  9. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  10. Combined use of Clauss and prothrombin time-derived methods for determining fibrinogen concentrations: Screening for congenital dysfibrinogenemia.

    Science.gov (United States)

    Xiang, Liqun; Luo, Meiling; Yan, Jie; Liao, Lin; Zhou, Weijie; Deng, Xuelian; Deng, Donghong; Cheng, Peng; Lin, Faquan

    2017-09-18

    In this study, the significance of fibrinogen concentration assessed by a combination of Clauss and prothrombin time (PT)-derived methods for screening for congenital dysfibrinogenemia were investigated, and the screening efficiency of fibrinogen PT-derived/Clauss ratio on congenital dysfibrinogenemia was analyzed. We compared fibrinogen concentrations determined by the Clauss, PT-derived, and enzyme-linked immunosorbent assay (ELISA) methods in 73 patients with congenital dysfibrinogenemia and 81 normal controls. Receiver operating characteristic (ROC) curves were utilized to evaluate the efficacy of fibrinogen PT-derived/Clauss ratio in screening for congenital dysfibrinogenemia. Fibrinogen concentrations determined by the Clauss method were dramatically lower than by the PT-derived method and ELISA, and correlated poorly with the latter two methods in patients with congenital dysfibrinogenemia. Fibrinogen concentrations in normal controls were slightly lower according to the Clauss method than to the PT-derived method and ELISA; however, each method yielded results within the normal range and the correlation was good. The area under the ROC curve of fibrinogen PT-derived/Clauss ratio for diagnosis of congenital dysfibrinogenemia was 1 with a standard error of 0, 95% confidence interval of 0.976-1.00, and optimal critical diagnosis point of 1.43. When fibrinogen PT-derived/Clauss ratio was >1.43, the sensitivity and specificity for diagnosis of congenital dysfibrinogenemia were both 100%. The combined use of Clauss and PT-derived methods for determining fibrinogen concentrations improves the efficiency of screening for congenital dysfibrinogenemia, as the fibrinogen PT-derived/Clauss ratio has high sensitivity and specificity in diagnosis of congenital dysfibrinogenemia. This ratio could serve an important screening tool for this disease. © 2017 Wiley Periodicals, Inc.

  11. High-throughput siRNA screening as a method of perturbation of biological systems and identification of targeted pathways coupled with compound screening.

    Science.gov (United States)

    Kiefer, Jeff; Yin, Hongwei H; Que, Qiang Q; Mousses, Spyro

    2009-01-01

    High-throughput RNA interference (HT-RNAi) is a powerful research tool for parallel, 'genome-wide', targeted knockdown of specific gene products. Such perturbation of gene product expression allows for the systematic query of gene function. The phenotypic results can be monitored by assaying for specific alterations in molecular and cellular endpoints, such as promoter activation, cell proliferation and survival. RNAi profiling may also be coupled with drug screening to identify molecular correlates of drug response. As with other genomic-scale data, methods of data analysis are required to handle the unique aspects of data normalization and statistical processing. In addition, novel techniques or knowledge-mining strategies are required to extract useful biological information from HT-RNAi data. Knowledge-mining strategies involve the novel application of bioinformatic tools and expert curation to provide biological context to genomic-scale data such as that generated from HT-RNAi data. Pathway-based tools, whether text-mining based or manually curated, serve an essential role in knowledge mining. These tools can be applied during all steps of HT-RNAi screen experiments including pre-screen knowledge gathering, assay development and hit confirmation and validation. Most importantly, pathway tools allow the interrogation of HT-RNAi data to identify and prioritize pathway-based biological information as a result of specific loss of gene function.

  12. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  13. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  14. In-vivo dosimetric study of carcinoma of uterine cervix with FBX solution in external beam therapy

    International Nuclear Information System (INIS)

    Srinivas, Challapalli; Shenoy, K. Kamalaksh; Dinesh, M.; Savitha, K.S.; Kasturi, Dinesh Pai; Supe, S.S.; Nagesha, Y.N.

    1999-01-01

    To ensure accurate dose delivery to target site in external beam therapy and brachytherapy, various authors have conducted tests to assess the process of manual dose calculations. In vivo dosimetric measurement is one of these methods to verify these calculations. In this study, an attempt has been made to compare the manually calculated dose to dose estimated using a chemical dosimeter (FBX) solution (in-vivo method, using polypropylene vials), on 12 patients of carcinoma of uterine cervix in external beam therapy. Dose measured by FBX vial varies in the range of ± 2 to 6.75%, as compared with manual calculations. These variations seen may be attributed to the location of the vial position in the vagina, with reference to the beam axis (may not be horizontal), off axis position, manual calculation variations and reproducibility of the FBX system etc. FBX dosimetry offers itself as an in-vivo method to estimate the dose delivered to the target site in external beam therapy. (author)

  15. In-vivo quantification of primary microRNA processing by Drosha with a luciferase based system

    International Nuclear Information System (INIS)

    Allegra, Danilo; Mertens, Daniel

    2011-01-01

    Research highlights: → Posttranscriptional regulation of miRNA processing is difficult to quantify. → Our in-vivo processing assay can quantify Drosha cleavage in live cells. → It is based on luciferase reporters fused with pri-miRNAs. → The assay validates the processing defect caused by a mutation in pri-16-1. → It is a sensitive method to quantify pri-miRNA cleavage by Drosha in live cells. -- Abstract: The RNAse III Drosha is responsible for the first step of microRNA maturation, the cleavage of primary miRNA to produce the precursor miRNA. Processing by Drosha is finely regulated and influences the amount of mature microRNA in a cell. We describe in the present work a method to quantify Drosha processing activity in-vivo, which is applicable to any microRNA. With respect to other methods for measuring Drosha activity, our system is faster and scalable, can be used with any cellular system and does not require cell sorting or use of radioactive isotopes. This system is useful to study regulation of Drosha activity in physiological and pathological conditions.

  16. A Novel Screening Method to Identify Late-Stage Dementia Patients for Palliative Care Research and Practice.

    Science.gov (United States)

    Ernecoff, Natalie C; Wessell, Kathryn L; Gabriel, Stacey; Carey, Timothy S; Hanson, Laura C

    2017-12-27

    Investigators need novel methods for timely identification of patients with serious illness to test or implement new palliative care models. The study's aim was to develop an electronic health record (EHR) phenotype to identify patients with late-stage dementia for a clinical trial of palliative care consultation. We developed a computerized method to identify patients with dementia on hospital admission. Within a data warehouse derived from the hospital's EHR, we used search terms of age, admission date, and ICD-9 and ICD-10 diagnosis codes to create an EHR dementia phenotype, followed by brief medical record review to confirm late-stage dementia. We calculated positive predictive value, false discovery rate, and false negative rate of this novel screening method. The EHR phenotype screening method had a positive predictive value of 76.3% for dementia patients and 24.5% for late-stage dementia patients; a false discovery rate of 23.7% for dementia patients and 75.5% for late-stage dementia patients compared to physician assessment. The sensitivity of this screening method was 59.7% to identify hospitalized patients with dementia. Daily screening-including confirmatory chart reviews-averaged 20 minutes and was more feasible, efficient, and more complete than manual screening. A novel method using an EHR phenotype plus brief medical record review is effective to identify hospitalized patients with late-stage dementia. In health care systems with similar clinical data warehouses, this method may be applied to serious illness populations to improve enrollment in clinical trials of palliative care or to facilitate access to palliative care services. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  17. IN SEARCH OF A FAST SCREENING METHOD FOR DETECTING THE MALINGERING OF COGNITIVE IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Amada Ampudia

    2012-07-01

    Full Text Available Forensic settings demand expedient and conclusive forensic psychological assessment. The aim of this study was to design a simple and fast, but reliable psychometric instrument for detecting the malingering of cognitive impairment. In a quasi-experimental design, 156 individuals were divided into three groups: a normal group with no cognitive impairment; a Mild Cognitive Impairment (MCI group; and a group of informed malingerers with no MCI who feigned cognitive impairment. Receiver Operating Curve (ROC analysis of the Test of Memory Malingering (TOMM, and of several subtests of the Wechsler Memory Scale (WMS-III revealed that the WMS-III was as reliable and accurate as the TOMM in discriminating malingerers from the honest. The results revealed that the diagnostic accuracy, sensitivity and specificity of the WMS-III Auditory Recognition Delayed of Verbal Paired Associates subtest was similar to the TOMM in discriminating malingering from genuine memory impairment. In conclusion, the WMS-III Recognition of Verbal Paired Associates subtest and the TOMM provide a fast, valid and reliable screening method for detecting the malingering of cognitive impairment.

  18. Retinal vascular fractals in Behçet's Disease: A screening method?

    Science.gov (United States)

    Norouzpour, Amir; Mehdizadeh, Alireza

    2015-01-01

    The branching pattern of retinal vessels may be affected in Behçet's Disease (BD). Fractal analysis can be used as a new method to quantify the changes of the vascular branching pattern. In this study, we examined, for the first time, the relationship between retinal fractal dimension (D f) and retinal vascular changes seen in patients with BD. We conducted a retrospective study of 10 new cases of BD with clinically ocular involvement. Color fundus images taken from both eyes of the participants have been analyzed, and D f of the whole retinal vasculature was quantified using a novel computer-based program. The resultant D f was compared with that of healthy individuals. The mean D f, calculated from 20 fundus images of cases with BD, was 1.59 ± 0.064. It was lower than that of healthy participants (1.65 ± 0.060) significantly (P = 0.013). Retinal fractal analysis of cases with BD has been performed for the first time, and the results showed that early retinal vascular changes seen in new cases of BD are associated with lower retinal D f. Retinal fractal analysis in BD can be practically utilized as a potential tool for screening of retinal involvement, evaluating the prognosis and the response to treatment.

  19. Genealogical tree study as screening method in the Lynch syndrome prior to genetic test.

    Science.gov (United States)

    Delgado-Plasencia, Luciano; Medina-Arana, Vicente; Barrios Del Pino, Ysamar; Fernández-Peralta, Antonia; González-Aguilera, Juan J

    2010-08-01

    Despite genetic advances in the study of Lynch syndrome (LS), difficulties remain in the diagnosis of the syndrome. The aim of this study was to assess the usefulness of a detailed genealogical tree as a screening method to identify Tenerife island families with a high probability of LS. We elaborated complete genealogical trees of the families. According to the degree of fulfillment of the Amsterdam Criteria II, the genealogical trees were classified as high or low probability of LS. Additionally, we analyzed the level of tumor microsatellite instability (MSI+) and identified a mutation in exon 13 of the MSH2 gene by single-strand conformation polymorphism, sequencing, and PCR-RFLP. According the genealogical trees, we found 10 families with high probability of LS and 30 families with low probability of LS. The families with high probability of LS showed high MSI+ in all cases. Conversely, families with low probability were MSS (microsatellite stable). In 5 of the 10 families with high probability, we discovered a T-->G mutation in position 688 of exon 13 of MSH2, which appeared in all the family members with the tumor, except 1 patient with a retinoblastoma. Our results indicate that genealogical tree is a highly effective tool for classifying families with a high probability of Lynch Syndrome prior to genetic test.

  20. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  1. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Science.gov (United States)

    Sahin, Levent; Bozkurt, Murat; Sahin, Hilal; Gürel, Aykut; Yumru, Ayse Ender

    2014-10-01

    To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD) aneuploidy screening (AS) is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss. Copyright © 2014. Published by Elsevier Taiwan.

  2. A novel method for screening of potential probiotics for high adhesion capability.

    Science.gov (United States)

    Wang, Xin; Wu, Qinglong; Deng, Kan; Wei, Qiang; Hu, Ping; He, Jingjing; Liu, Huan; Zheng, Yong; Wei, Hua; Shah, Nagendra P; Chen, Tingtao

    2015-07-01

    To screen for potential probiotics with high adhesion capability, a chemostat model-based cultured human feces and denaturing gradient gel electrophoresis methods were applied, and the adhesion capability of the isolates was evaluated in vitro and in vivo. Lactobacillus plantarum (HM218749), Lactobacillus reuteri (EU547310), and Enterococcus faecalis (HM218543) were isolated from the slime on the chemostat wall, as these organisms could grow better at 37°C in an anaerobic environment and could resist harsh conditions (pH 1.5 and 0.30% bile salt). Lactobacillus plantarum, L. reuteri, and E. faecalis could adhere to HT-29 cells and reduce the adhesion of Shigella dysenteriae 2457, Staphylococcus aureus Cowan1, Enterobacter sakazakii 45401, and Escherichia coli 44102 to HT-29 cells. Moreover, the animal experiment showed that L. plantarum could adhere to mice intestine, increasing the number of lactobacilli and decreasing the number of enterococci. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Directory of Open Access Journals (Sweden)

    Levent Sahin

    2014-10-01

    Full Text Available To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD aneuploidy screening (AS is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss.

  4. Alternative global goodness metrics and sensitivity analysis: heuristics to check the robustness of conclusions from studies comparing virtual screening methods.

    Science.gov (United States)

    Sheridan, Robert P

    2008-02-01

    We introduce two ways of testing the robustness of conclusions from studies comparing virtual screening methods: alternative "global goodness" metrics and sensitivity analysis. While the robustness tests cannot eliminate all biases in virtual screening comparisons, they are useful as a "reality check" for any given study. To illustrate this, we apply them to a set of enrichments published in McGaughey et al. (J. Chem. Inf. Model. 2007, 47, 1504-1519) where 11 target protein/ligand combinations are tested on 2D and 3D similarity methods, plus docking. The major conclusions in that paper, for instance, that ligand-based methods are better than docking methods, hold up. However, some minor conclusions, such as Glide being the best docking method, do not.

  5. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  6. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia

    Science.gov (United States)

    Gubern, Carme; Hurtado, Olivia; Rodríguez, Rocío; Morales, Jesús R; Romera, Víctor G; Moro, María A; Lizasoain, Ignacio; Serena, Joaquín; Mallolas, Judith

    2009-01-01

    Background Studies of gene expression in experimental cerebral ischaemia models can contribute to understanding the pathophysiology of brain ischaemia and to identifying prognostic markers and potential therapeutic targets. The normalization of relative qRT-PCR data using a suitable reference gene is a crucial prerequisite for obtaining reliable conclusions. No validated housekeeping genes have been reported for the relative quantification of the mRNA expression profile activated in in-vitro ischaemic conditions, whereas for the in-vivo model different reference genes have been used. The present study aims to determine the expression stability of ten housekeeping genes (Gapdh, β2m, Hprt, Ppia, Rpl13a, Oaz1, 18S rRNA, Gusb, Ywhaz and Sdha) to establish their suitability as control genes for in-vitro and in-vivo cerebral ischaemia models. Results The expression stability of the candidate reference genes was evaluated using the 2-ΔC'T method and ANOVA followed by Dunnett's test. For the in-vitro model using primary cultures of rat astrocytes, all genes analysed except for Rpl13a and Sdha were found to have significantly different levels of mRNA expression. These different levels were also found in the case of the in-vivo model of pMCAO in rats except for Hprt, Sdha and Ywhaz mRNA, where the expression did not vary. Sdha and Ywhaz were identified by geNorm and NormFinder as the two most stable genes. Conclusion We have validated endogenous control genes for qRT-PCR analysis of gene expression in in-vitro and in-vivo cerebral ischaemia models. For normalization purposes, Rpl13a and Sdha are found to be the most suitable genes for the in-vitro model and Sdha and Ywhaz for the in-vivo model. Genes previously used as housekeeping genes for the in-vivo model in the literature were not validated as good control genes in the present study, showing the need for careful evaluation for each new experimental setup. PMID:19531214

  7. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia

    Directory of Open Access Journals (Sweden)

    Serena Joaquín

    2009-06-01

    Full Text Available Abstract Background Studies of gene expression in experimental cerebral ischaemia models can contribute to understanding the pathophysiology of brain ischaemia and to identifying prognostic markers and potential therapeutic targets. The normalization of relative qRT-PCR data using a suitable reference gene is a crucial prerequisite for obtaining reliable conclusions. No validated housekeeping genes have been reported for the relative quantification of the mRNA expression profile activated in in-vitro ischaemic conditions, whereas for the in-vivo model different reference genes have been used. The present study aims to determine the expression stability of ten housekeeping genes (Gapdh, β2m, Hprt, Ppia, Rpl13a, Oaz1, 18S rRNA, Gusb, Ywhaz and Sdha to establish their suitability as control genes for in-vitro and in-vivo cerebral ischaemia models. Results The expression stability of the candidate reference genes was evaluated using the 2-ΔC'T method and ANOVA followed by Dunnett's test. For the in-vitro model using primary cultures of rat astrocytes, all genes analysed except for Rpl13a and Sdha were found to have significantly different levels of mRNA expression. These different levels were also found in the case of the in-vivo model of pMCAO in rats except for Hprt, Sdha and Ywhaz mRNA, where the expression did not vary. Sdha and Ywhaz were identified by geNorm and NormFinder as the two most stable genes. Conclusion We have validated endogenous control genes for qRT-PCR analysis of gene expression in in-vitro and in-vivo cerebral ischaemia models. For normalization purposes, Rpl13a and Sdha are found to be the most suitable genes for the in-vitro model and Sdha and Ywhaz for the in-vivo model. Genes previously used as housekeeping genes for the in-vivo model in the literature were not validated as good control genes in the present study, showing the need for careful evaluation for each new experimental setup.

  8. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  9. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  10. A streamlined risk screening method for managing reutilization of abandoned factories in Taiwan

    Directory of Open Access Journals (Sweden)

    I-Chun Chen

    2017-05-01

    Full Text Available An integrated management strategy that considers the competing relationships between land values and associated risks in the process of land-use conversion is needed to assess and manage the reutilization of brownfields. However, the often large number of individual brownfields renders it difficult to conduct a completed risk assessment for all sites, and a streamlined risk screening method would facilitate prioritization of the redevelopment of those factories. This methodology takes into account the spatial heterogeneity of contaminated lands and produces risk mapping that compiles complex risk-related information. Using abandoned factories in Taiwan as a case study, the method considers 40 points (50% accumulated probability as the threshold of acceptable risk. Emergency risk should be over 90% of accumulated probability. For the sustainability of brownfield reutilization in Taiwan, this research uses a risk matrix to identify the low, middle, and high risk for brownfield reutilization. It can indicate zones with a high risk level or low economic incentive as areas of concern for future decision making. In Taiwan, high-risk sites with high incentive account for only 21.3% of the sites. In contrast, the sites with the lowest incentive and low risk account for 57.6% of the sites. To avoid failure in the brownfield market, three strategies are suggested: (1 flexible land management with urban planning is a feasible option for protecting the receptor's health; (2 the government could provide the tool or brownfield funds to reduce the uncertainty of investment risk; and (3 risk monitoring and management can reduce the possible pitfalls associated with brownfield reutilization.

  11. Electrostatic Dust Cloth: A Passive Screening Method to Assess Occupational Exposure to Organic Dust in Bakeries

    Directory of Open Access Journals (Sweden)

    Carla Viegas

    2018-02-01

    Full Text Available Organic dust is widespread in the environment including occupational settings, such as bakeries. Recently, a new collection device—the electrostatic dust cloth (EDC—has been described for the assessment of occupational exposures. The aim of this study was to investigate the suitability of EDC for identifying the distribution patterns and exposure concentrations of particulate matter and microbial contaminants such as fungi and bacteria in bakeries. Twelve bakeries were selected, and dust was allowed to settle for 13 to 16 days on EDCs (a total of 33 samples. Particle counts and size distribution (0.3 µm, 0.5 µm, 1 µm, 2.5 µm, 5 µm and 10 µm were measured with direct-reading equipment. Higher EDC mass was significantly correlated (p values < 0.05 with higher fungal load on dichloran glycerol (DG18 and with particle size distribution in the 0.3 µm, 0.5 µm, 1.0 µm and 10.0 µm range. Fungal levels on malt extract agar (MEA ranged from 0 to 2886 CFU/m2 EDC in the warehouse setting, 0 to 500 CFU/m2 EDC in the production setting, and 0 to 3135 CFU/m2 EDC in the store. Penicillium sp. (42.56% was the most frequent fungi. Total bacterial load ranged from 0 to 18,859 CFU/m2 EDC in the warehouse, 0 to 71,656 CFU/m2 EDC in production, and 0 to 21,746 CFU/m2 EDC in the store. EDC assessment provided a longer-term integrated sample of organic dust, useful for identifying critical worksites in which particulate matter and bio-burden exposures are elevated. These findings suggest that EDC can be applied as a screening method for particulate matter-exposure assessment and as a complementary method to quantify exposures in occupational environments.

  12. LC-ESI/MS/MS method for rapid screening and confirmation of 44 exogenous anabolic steroids in human urine.

    Science.gov (United States)

    Jeon, Byoung Wook; Yoo, Hye Hyun; Jeong, Eun Sook; Kim, Ho Jun; Jin, Changbae; Kim, Dong Hyun; Lee, Jaeick

    2011-09-01

    A sensitive and rapid method based on liquid chromatography-triple-quadrupole tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI) has been developed and validated for the screening and confirmation of 44 exogenous anabolic steroids (29 parent steroids and 15 metabolites) in human urine. The method involves an enzymatic hydrolysis, liquid-liquid extraction, and detection by LC-MS/MS. A triple-quadrupole mass spectrometer was operated in positive ESI mode with selected reaction monitoring (SRM) mode for the screening and product ion scan mode for the confirmation. The protonated molecular ions were used as precursor ions for the SRM analysis and product ion scan. The intraday and interday precisions of the target analytes at concentrations of the minimum required performance levels for the screening were 2-14% and 2-15%, respectively. The limits of detection for the screening and confirmation method were 0.1-10 ng/mL and 0.2-10 ng/mL, respectively, for 44 steroids. This method was successfully applied to analysis of urine samples from suspected anabolic steroid abusers.

  13. Screening for hearing and visual loss among elderly with questionnaires and tests : which method is the most convincing for action?

    NARCIS (Netherlands)

    Eekhof, JAH; De Bock, GH; Schaapveld, K; Springer, MP

    2000-01-01

    Objective - To examine the extent to which self-report and performance-based measures identify the same people, and also whether one of these methods any more than the other induces the general practitioner (GP) to offer a patient help? Design - Comparison of tests and questionnaire in a screening

  14. [Performance of different methods of estimating risk screening for chromosomal anomalies].

    Science.gov (United States)

    Avătăjitei, Maria-Cristina; Moscalu, Mihaela; Martiniuc, Violeta; Onofriescu, M

    2012-01-01

    In the last 10 years, several studies have been carried out on additional ultrasound markers in the first trimester of pregnancy in order to improve detection rate of fetal numerical chromosome abnormalities (aneuploidy) and to reduce the rate of false-positive diagnosis. The purpose of this study was to evaluate the performance of various recommendations for which amniocentesis was performed followed by FISH testing in the diagnosis of aneuploidy. These evaluations were conducted in order to determine whether ultrasound aspects are associated with fetal aneuploidy and to estimate the risk level of individual markers using probability estimation analysis. The study has been carried out at the Clinical Hospital of Obstetrics and Gynecology "CuzaVodă" Iaşi, at the Laboratory of cytogenetic--prenatal diagnosis, during January 2004-December 2011, on a target group of 1406 pregnant women. As part of this study, 1411 amniocentesis were performed. increased efficiency of screening for fetal aneuploidy in the first trimester of pregnancy is obtained through combined method (maternal age over 35 years, increased nuchal translucency and the presence of double test risk) which has 100% detection rate and a rate false-positive result of 0%. The efficiency of this method is provided also by the relatively high risk (RR = 17.2) and its specificity (Sp = 100%). Making the assessment following the study false positive rate, it appears that a good method of risk assessment for aneuploidy is the combined evaluation of increased nuchal translucency (NT) with maternal age over 35 years (specificity 99.5%, a detection rate of 40% false positive rate of 0.45% and a relative risk of 7.09 for the presence of aneuploidy). The achievement of a correct prenatal diagnosis and the increase of the method efficiency, requires a correct selection of cases with aneuploidy risk assessment, based on the results of ultrasound and biochemical (double test risk) investigations correlated with

  15. A PiggyBac-based recessive screening method to identify pluripotency regulators.

    Directory of Open Access Journals (Sweden)

    Ge Guo

    2011-04-01

    Full Text Available Phenotype driven genetic screens allow unbiased exploration of the genome to discover new biological regulators. Bloom syndrome gene (Blm deficient embryonic stem (ES cells provide an opportunity for recessive screening due to frequent loss of heterozygosity. We describe a strategy for isolating regulators of mammalian pluripotency based on conversion to homozygosity of PiggyBac gene trap insertions combined with stringent selection for differentiation resistance. From a screen of 2000 mutants we obtained a disruptive integration in the Tcf3 gene. Homozygous Tcf3 mutants showed impaired differentiation and enhanced self-renewal. This phenotype was reverted in a dosage sensitive manner by excision of one or both copies of the gene trap. These results provide new evidence confirming that Tcf3 is a potent negative regulator of pluripotency and validate a forward screening methodology to identify modulators of pluripotent stem cell biology.

  16. A newborn screening method for cerebrotendinous xanthomatosis using bile alcohol glucuronides and metabolite ratios

    NARCIS (Netherlands)

    Vaz, Frédéric M.; Bootsma, Albert H.; Kulik, Willem; Verrips, Aad; Wevers, Ron A.; Schielen, Peter C.; DeBarber, Andrea E.; Huidekoper, Hidde H.

    2017-01-01

    Cerebrotendinous xanthomatosis (CTX) is a treatable neurodegenerative metabolic disorder of bile acid synthesis in which symptoms can be prevented if treatment with chenodeoxycholic acid supplementation is initiated early in life, making CTX an excellent candidate for newborn screening. We developed

  17. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman M.

    2016-11-23

    Drug discovery is a process that takes many years and hundreds of millions of dollars to reveal a confident conclusion about a specific treatment. Part of this sophisticated process is based on preliminary investigations to suggest a set of chemical compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training prediction models. Yet, the difficulties imposed by big expansion in data and its dimensionality are inevitable. In this thesis, I address the main challenges that come when data mining techniques are used for virtual screening. In order to achieve an efficient virtual screening using data mining, I start by addressing the problem of feature selection and provide analysis of best ways to describe a chemical compound for an enhanced screening performance. High-throughput screening (HTS) assays data used for virtual screening are characterized by a great class imbalance. To handle this problem of class imbalance, I suggest using a novel algorithm called DRAMOTE to narrow down promising candidate chemicals aimed at interaction with specific molecular targets before they are experimentally evaluated. Existing works are mostly proposed for small-scale virtual screening based on making use of few thousands of interactions. Thus, I propose enabling large-scale (or big) virtual screening through learning millions of interaction while exploiting any relevant dependency for a better accuracy. A novel solution called DRABAL that incorporates structure learning of a Bayesian Network as a step to model dependency between the HTS assays, is showed to achieve significant improvements over existing state-of-the-art approaches.

  18. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  19. A method of simultaneous no-screen X-ray film taking with direct twofold magnification of hands and feet

    International Nuclear Information System (INIS)

    Zajgner, J.; Szymanska-Prach, H.

    1978-01-01

    The authors propose an original method of X-ray examination of hands and feet which makes possible simultaneous radiography without screen and direct twofold magnified film taking. The method is not connected with the necessity of exposing the patient to an additional dose of X-rays. It has been tried in 20 patients with suspected rheumatoid arthritis. It requires an X-ray tube with 0.3 x 0.3 mm microfocus. (author)

  20. Performance evaluation of structure based and ligand based virtual screening methods on ten selected anti-cancer targets.

    Science.gov (United States)

    Ramasamy, Thilagavathi; Selvam, Chelliah

    2015-10-15

    Virtual screening has become an important tool in drug discovery process. Structure based and ligand based approaches are generally used in virtual screening process. To date, several benchmark sets for evaluating the performance of the virtual screening tool are available. In this study, our aim is to compare the performance of both structure based and ligand based virtual screening methods. Ten anti-cancer targets and their corresponding benchmark sets from 'Demanding Evaluation Kits for Objective In silico Screening' (DEKOIS) library were selected. X-ray crystal structures of protein-ligand complexes were selected based on their resolution. Openeye tools such as FRED, vROCS were used and the results were carefully analyzed. At EF1%, vROCS produced better results but at EF5% and EF10%, both FRED and ROCS produced almost similar results. It was noticed that the enrichment factor values were decreased while going from EF1% to EF5% and EF10% in many cases. Published by Elsevier Ltd.

  1. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  2. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    Energy Technology Data Exchange (ETDEWEB)

    Liaparinos, P. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece); Kandarakis, I.; Cavouras, D. [Department of Medical Instruments Technology, Technological Educational Institution of Athens, Ag. Spyridonos Street, Aigaleo, 12210 Athens (Greece); Kalivas, N. [Greek Atomic Energy Commission, 15310 Athens (Greece); Delis, H. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece); Panayiotakis, G. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece)], E-mail: panayiot@upatras.gr

    2007-09-21

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd{sub 2}O{sub 2}S:Tb phosphor material with packing density of 70% and grain size of 7 {mu}m and (c) phosphor thickness ranging between 30 and 70 mg/cm{sup 2}. The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm{sup 2} phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems.

  3. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    Science.gov (United States)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-09-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2O 2S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2. The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems.

  4. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-07-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts.

  5. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-01-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2 O 2 S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2 . The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems

  6. Development of a method for efficient cost-effective screening of Aspergillus niger mutants having increased production of glucoamylase.

    Science.gov (United States)

    Zhu, Xudong; Arman, Bessembayev; Chu, Ju; Wang, Yonghong; Zhuang, Yingping

    2017-05-01

    To develop an efficient cost-effective screening process to improve production of glucoamylase in Aspergillus niger. The cultivation of A. niger was achieved with well-dispersed morphology in 48-deep-well microtiter plates, which increased the throughput of the samples compared to traditional flask cultivation. There was a close negative correlation between glucoamylase and its pH of the fermentation broth. A novel high-throughput analysis method using Methyl Orange was developed. When compared to the conventional analysis method using 4-nitrophenyl α-D-glucopyranoside as substrate, a correlation coefficient of 0.96 by statistical analysis was obtained. Using this novel screening method, we acquired a strain with an activity of 2.2 × 10 3  U ml -1 , a 70% higher yield of glucoamylase than its parent strain.

  7. Comparing 3 values clarification methods for colorectal cancer screening decision-making: a randomized trial in the US and Australia.

    Science.gov (United States)

    Brenner, Alison; Howard, Kirsten; Lewis, Carmen; Sheridan, Stacey; Crutchfield, Trisha; Hawley, Sarah; Reuland, Dan; Kistler, Christine; Pignone, Michael

    2014-03-01

    To compare the effects of three methods of values clarification (VCM): balance sheet; rating and ranking; and a discrete choice experiment (DCE) on decision-making about colorectal cancer (CRC) screening among adults in the US and Australia. Using online panels managed by a survey research organization in the US and Australia, we recruited adults ages 50-75 at average risk for CRC for an online survey. Those eligible were randomized to one of the three VCM tasks. CRC screening options were described in terms of five key attributes: reduction in risk of CRC incidence and mortality; nature of the screening test; screening frequency; complications from screening; and chance of requiring a colonoscopy (as initial or follow-up testing). Main outcomes included self-reported most important attribute and unlabeled screening test preference by VCM and by country, assessed after the VCM. A total of 920 participants were enrolled; 51 % were Australian; mean age was 59.0; 87.0 % were white; 34.2 % had a 4-year college degree; 42.8 % had household incomes less than $45,000 USD per year; 44.9 % were up to date with CRC screening. Most important attribute differed across VCM groups: the rating and ranking group was more likely to choose risk reduction as most important attribute (69.8 %) than the balance sheet group (54.7 %) or DCE (49.3 %), p important attribute did not vary by country (p = 0.236). The fecal occult blood test (FOBT)-like test was the most frequently preferred test overall (55.9 %). Unlabeled test choice did not differ meaningfully by VCM. Australians were more likely to prefer the FOBT (AU 66.2 % vs. US 45.1 %, OR 2.4, 95 % CI 1.8, 3.1). Few participants favored no screening (US: 9.2 %, AU: 6.2 %). Screening test attribute importance varied by VCM, but not by country. FOBT was more commonly preferred by Australians than by Americans, but test preferences were heterogeneous in both countries.

  8. An efficient screening method for the isolation of heterotrophic bacteria influencing growth of diatoms under photoautotrophic conditions.

    Science.gov (United States)

    Zecher, Karsten; Jagmann, Nina; Seemann, Philipp; Philipp, Bodo

    2015-12-01

    Interactions between photoautotrophic diatoms and heterotrophic bacteria are important for the biogeochemical C-cycle in the oceans. Additionally, biofilms formed by diatoms and bacteria are the initiating step of biofouling processes, which causes high costs in shipping. Despite this ecological and economical importance, the knowledge about biochemical and molecular mechanisms underlying these interkingdom interactions is relatively small. For analyzing these mechanisms, laboratory model systems are required. In this study, an efficient screening method for isolating bacteria influencing photoautotrophic diatom growth was established. First, diatom cultures of Phaeodactylum tricornutum and Thalassiosira pseudonana were made axenic by applying β-lactam antibiotics. Second, a non-invasive method for measuring growth of multiple parallel diatom cultures by chlorophyll fluorescence was established. This method allowed semi-quantitative chlorophyll determination of cultures with up to 3 μg (chlorophyll) ml(-1). Axenic diatom cultures were then used for enriching bacteria and led to the isolation of 24 strains influencing growth of both diatom strains in various ways. For example, Rheinheimera sp. strain Tn16 inhibited growth of T. pseudonana, while it stimulated growth and cell aggregation of P. tricornutum. Thus, this screening method is appropriate for isolating heterotrophic bacteria showing different interactions with different diatom species ranging from synergistic to antagonistic. In consecutive applications, this method will be useful to screen for bacterial mutants with altered phenotypes regarding the influence on diatom growth. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Magnetic Nanoparticles in-vivo Detection of Transplant Rejection

    Science.gov (United States)

    Flynn, E. R.; Bryant, H. C.; Larson, R. S.; Sergatskov, D. A.

    2006-03-01

    Superparamagnetic nanoparticles are being used to develop methodology for the in-vivo detection and imaging of immune system attacks on transplanted organs. The signature for impending rejection of a transplant is enhanced presence of T-cells. Magnetic nanoparticles coated with specific antibodies (CD-2 and CD-3) will target and attach to these T-cells. Approximately 3 .10^5 nanoparticles can attach to each cell. When a pulsed external magnetic field is applied to the decorated cells for a fraction of a second, magnetic moments of the nanoparticles aligned with the field. After the pulse is switched off, the net magnetic moment decays over several seconds by the Nèel mechanism. The resulting magnetic remanence field (typically 10-11 T) is measured using a multi-channel SQUID array. We present the data from live T-cells placed in realistic kidney phantom. The detection sensitivity was ˜2.10^3 T-cells - a small fraction of the number actually invading the rejected transplant. The 7-channel SQUID array allows us to image the cell clusters with a few millimeters resolution.

  10. In-vivo von Mises strains during Invisalign treatment.

    Science.gov (United States)

    Vardimon, Alexander D; Robbins, Daniel; Brosh, Tamar

    2010-10-01

    The Invisalign (Align Technology, Santa Clara, Calif) force delivery system has not been investigated. Since forces are related to the strains developed on the aligner surface, the behavior of the maxillary incisor and premolar von Mises strains (IVM, PVM) were studied during biweekly wear of an aligner. Maxillary aligners (n = 61) were examined from 3 patients requiring maxillary incisor retraction and stationary anchored premolars. Two series of maxillary aligners were manufactured. Series 1 was worn by the patient, and series 2 served for in-vivo measurements with 2 strain gauge rosettes bonded to each aligner on the vestibular sides of the incisor and the premolar. Measurements were taken at days 1, 2, 9, and 15. All aligners demonstrated a peak IVM strain at day 1 (PIVM). Each aligner should be worn close to 24 hours in the first 2 days, with the time subsequently reduced (remaining 12 days). Final aligners should be thicker or worn for longer period (eg, 3 weeks). In spite of the inherent anchorage property of the aligner, attachment reinforcement should be considered in demanding anchorage requirements. Copyright © 2010 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  11. Oscillometric blood pressure measurement: a simple method in screening for peripheral arterial disease

    DEFF Research Database (Denmark)

    Mehlsen, Jesper; Wiinberg, Niels; Bruce, Christopher

    2008-01-01

    Blood pressure at the ankle level is a reliable indicator of peripheral arterial disease (PAD) and the ankle brachial index (ABI) is a useful non-invasive screening tool for the early detection of atherosclerosis. In the first part of the study, systolic blood pressures obtained by oscillometry...... and plethysmography were compared in 80 subjects referred for possible vascular disease. In the second part of the study, 31 general practitioners enrolled 1258 consecutive patients aged more than 60 years. ABI was estimated by oscillometry. Patients with an ABI lower than 0.9 were referred to the local hospital...... of PAD was sufficiently high in subjects over the age of 60 years to warrant screening. The ankle brachial index based on measurements with an oscillometric device was shown reliable in the exclusion of PAD, thereby fulfilling an important criterion for the use in screening....

  12. Screening method to assess the risk of explosive spalling on fire exposed concrete

    DEFF Research Database (Denmark)

    Sørensen, Lars Schiøtt

    2003-01-01

    At the Technical University of Denmark (BYG.DTU)a new test set-up is under development to screen various concretes to assess their risk of explosive spalling. The test exposes a standard cylinder to compressive ring stresses together with rapid heating of the cylinder end.......At the Technical University of Denmark (BYG.DTU)a new test set-up is under development to screen various concretes to assess their risk of explosive spalling. The test exposes a standard cylinder to compressive ring stresses together with rapid heating of the cylinder end....

  13. Best practices: implementation of a glucose screening program based on diffusion of innovation theory methods.

    Science.gov (United States)

    Nicol, Ginger E; Morrato, Elaine H; Johnson, Mark C; Campagna, Elizabeth; Yingling, Michael D; Pham, Victor; Newcomer, John W

    2011-01-01

    There is public health interest in the identification and treatment of modifiable cardiometabolic risk factors among patients treated with antipsychotic medications. However, best-practice screening recommendations endorsed by multiple medical organizations have not translated into real-world clinical practice. Quality improvement strategies may help to address the gap between policy and implementation. This column describes the successful implementation of a best-practice glucose screening program in a large network of community mental health centers that was based on Six Sigma and diffusion of innovation theory.

  14. Monte Carlo simulation of in-vivo measurement of lung contamination; Simulacion Monte Carlo de medida in-vivo de contaminacion en pulmon

    Energy Technology Data Exchange (ETDEWEB)

    Moraleda, M.; Gomez-Ros, J. M.; Lopez, M. A.; Navarro, J. F.; Broggio, D.

    2011-07-01

    This paper describes the technique used to simulate in-vivo measurement of lung contaminated with enriched uranium using an anthropomorphic phantom of thorax. This work was carried out as part of an international intercomparison between different institutions within collaborative actions EURADOS promoted.

  15. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  16. Estimation of Pap-test coverage in an area with an organised screening program: challenges for survey methods

    Directory of Open Access Journals (Sweden)

    Raggi Patrizio

    2006-03-01

    Full Text Available Abstract Background The cytological screening programme of Viterbo has completed the second round of invitations to the entire target population (age 25–64. From a public health perspective, it is important to know the Pap-test coverage rate and the use of opportunistic screening. The most commonly used study design is the survey, but the validity of self-reports and the assumptions made about non respondents are often questioned. Methods From the target population, 940 women were sampled, and responded to a telephone interview about Pap-test utilisation. The answers were compared with the screening program registry; comparing the dates of Pap-tests reported by both sources. Sensitivity analyses were performed for coverage over a 36-month period, according to various assumptions regarding non respondents. Results The response rate was 68%. The coverage over 36 months was 86.4% if we assume that non respondents had the same coverage as respondents, 66% if we assume they were not covered at all, and 74.6% if we adjust for screening compliance in the non respondents. The sensitivity and specificity of the question, "have you ever had a Pap test with the screening programme" were 84.5% and 82.2% respectively. The test dates reported in the interview tended to be more recent than those reported in the registry, but 68% were within 12 months of each other. Conclusion Surveys are useful tools to understand the effectiveness of a screening programme and women's self-report was sufficiently reliable in our setting, but the coverage estimates were strongly influenced by the assumptions we made regarding non respondents.

  17. An analysis of normalization methods for Drosophila RNAi genomic screens and development of a robust validation scheme

    Science.gov (United States)

    Wiles, Amy M.; Ravi, Dashnamoorthy; Bhavani, Selvaraj; Bishop, Alexander J.R.

    2010-01-01

    Genome-wide RNAi screening is a powerful, yet relatively immature technology that allows investigation into the role of individual genes in a process of choice. Most RNAi screens identify a large number of genes with a continuous gradient in the assessed phenotype. Screeners must then decide whether to examine just those genes with the most robust phenotype or to examine the full gradient of genes that cause an effect and how to identify the candidate genes to be validated. We have used RNAi in Drosophila cells to examine viability in a 384-well plate format and compare two screens, untreated control and treatment. We compare multiple normalization methods, which take advantage of different features within the data, including quantile normalization, background subtraction, scaling, cellHTS2 1, and interquartile range measurement. Considering the false-positive potential that arises from RNAi technology, a robust validation method was designed for the purpose of gene selection for future investigations. In a retrospective analysis, we describe the use of validation data to evaluate each normalization method. While no normalization method worked ideally, we found that a combination of two methods, background subtraction followed by quantile normalization and cellHTS2, at different thresholds, captures the most dependable and diverse candidate genes. Thresholds are suggested depending on whether a few candidate genes are desired or a more extensive systems level analysis is sought. In summary, our normalization approaches and experimental design to perform validation experiments are likely to apply to those high-throughput screening systems attempting to identify genes for systems level analysis. PMID:18753689

  18. New methods for the screening of antioxidants in three Sideritis species

    NARCIS (Netherlands)

    Koleva, I.

    2007-01-01

    This thesis describes the rapid and robust evaluation of antioxidant activity of complex mixtures such as plant extracts. The study was directed to establish the best screening and isolation procedures for components with antioxidative properties to ensure the development of an “algorithm” for

  19. A limited review of over diagnosis methods and long-term effects in breast cancer screening

    Directory of Open Access Journals (Sweden)

    Dongfeng Wu

    2011-09-01

    Full Text Available Breast cancer screening programs have been effective in detecting tumors prior to symptoms. Recently, there has been concern over the issue of over-diagnosis, that is, diagnosis of a breast cancer that does not manifest prior to death. Estimates for over-diagnosis vary, ranging from 7 to 52%. This variability may be due partially to issues associated with bias and/or incorrect inferences associated with the lack of probability modeling. A critical issue is how to evaluate the long-term effects due to continued screening. Participants in a periodic screening program can be classified into four mutually exclusive groups depending on whether individuals are diagnosed and whether their symptoms appear prior to death: True-earlydetection; No-early-detection; Over-diagnosis; and Not-sonecessary. All initially superficially healthy people will eventually fall into one of these four categories. This manuscript reviews the major methodologies associated with the over-diagnosis and long-term effects of breast cancer screening.

  20. A high-throughput screening method for determining the substrate scope of nitrilases.

    Science.gov (United States)

    Black, Gary W; Brown, Nicola L; Perry, Justin J B; Randall, P David; Turnbull, Graeme; Zhang, Meng

    2015-02-14

    Nitrile compounds are intermediates in the synthesis of pharmaceuticals such as atorvastatin. We have developed a chromogenic reagent to screen for nitrilase activity as an alternative to Nessler's reagent. It produces a semi-quantifiable blue colour and hydrolysis of 38 nitrile substrates by 23 nitrilases as cell-free extracts has been shown.

  1. Wastewater screening method for evaluating applicability of zero-valent iron to industrial wastewater

    International Nuclear Information System (INIS)

    Lee, J.W.; Cha, D.K.; Oh, Y.K.; Ko, K.B.; Jin, S.H.

    2010-01-01

    This study presents a screening protocol to evaluate the applicability of the ZVI pretreatment to various industrial wastewaters of which major constituents are not identified. The screening protocol consisted of a sequential analysis of UV-vis spectrophotometry, high-performance liquid chromatograph (HPLC), and bioassay. The UV-vis and HPLC analyses represented the potential reductive transformation of unknown constituents in wastewater by the ZVI. The UV-vis and HPLC results were quantified using principal component analysis (PCA) and Euclidian distance (ED). The short-term bioassay was used to assess the increased biodegradability of wastewater constituents after ZVI treatment. The screening protocol was applied to seven different types of real industrial wastewaters. After identifying one wastewater as the best candidate for the ZVI treatment, the benefit of ZVI pretreatment was verified through continuous operation of an integrated iron-sequencing batch reactor (SBR) resulting in the increased organic removal efficiency compared to the control. The iron pretreatment was suggested as an economical option to modify some costly physico-chemical processes in the existing wastewater treatment facility. The screening protocol could be used as a robust strategy to estimate the applicability of ZVI pretreatment to a certain wastewater with unknown composition.

  2. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  3. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-01-01

    Digital PCR has developed rapidly since it was first reported in the 1990s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products. PMID:26239916

  4. Method of simulated screen sensitometry for asymmetric, low crossover medical x-ray films.

    Science.gov (United States)

    Dickerson, R E; Haus, A G; Baker, C W

    1994-04-01

    Recognition of the importance of performing simulated screen-light sensitometry of medical x-ray films for the purpose of processor quality control has increased over the past several years. As a result there is a greater need to provide new techniques for performing simulated screen-light sensitometry. Medical films with reduced intensifying screen-light crossover intended to achieve reduced blur and higher spatial resolution pose particular problems in doing simulated screen-light sensitometry if care is not taken to choose a proper simulated light sensitometer with the capability of simultaneous double-sided exposures. Misleading and incorrect sensitometric data can be obtained for film contrast evaluation if a single side exposure is used. Asymmetric, near-zero crossover films pose even greater problems as proper orientation of the film and proper degree of light output asymmetry need be achieved in order to obtain correct sensitometry. The films used in this study were three double emulsion films varying in crossover from 3% to 24%. Of the two very-low-crossover films, one had symmetric emulsion layers while the second featured emulsion layers which were asymmetric in terms of contrast and speed. Sensitometric data show several curve shapes with significant distortions, depending on orientation, for the asymmetric, low-crossover film when exposed using a single-sided exposure. Only by using a double-sided exposure and an appropriate neutral density filter to simulate the degree of screen-light asymmetry in this system could one achieve a characteristic curve comparable to that achieved by inverse square sensitometry.

  5. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Validation of nutritional risk index method against patient-generated subjective global assessment in screening malnutrition in colorectal cancer patients.

    Science.gov (United States)

    Faramarzi, Elnaz; Mahdavi, Reza; Mohammad-Zadeh, Mohammad; Nasirimotlagh, Behnam

    2013-10-01

    To validate malnutrition screening tool of nutrition risk index (NRI) against patient-generated subjective global assessment (PG-SGA) as a gold standard tool in colorectal cancer patients before radiotherapy. Nutritional status of 52 volunteer colorectal cancer patients with a mean age of 54.1±16.8 years who referred to radiotherapy center were assessed by PG-SGA (gold standard method) and NRI. Serum albumin levels of patients were determined by colorimetric method. A contingency table was used to determine the sensitivity, specificity, and predictive value of the NRI in screening patients at risk of malnutrition, in comparison with the PG-SGA in patients before radiotherapy. The findings of PG-SGA and NRI showed that 52% and 45% of patients in our study were moderately or severely malnourished respectively. The NRI had a sensitivity of 66% and a specificity of 60% against PG-SGA. The positive predictive value was 64% and the negative predicative value was 62%. The agreement between NRI and PG-SGA was statistically insignificant (kappa =0.267; P>0.05). The findings of present study showed that the prevalence of malnutrition was high in patients with colorectal cancer. Moreover, NRI method had low sensitivity and specificity in assessing nutritional status of patients with cancer. It seems that the combination of anthropometric, laboratory parameters and a subjective scoring system may be helpful tools in screening of malnutrition in cancer patients.

  7. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  8. Fluorophore Absorption Size Exclusion Chromatography (FA-SEC): An Alternative Method for High-Throughput Detergent Screening of Membrane Proteins.

    Science.gov (United States)

    Lin, Sung-Yao; Sun, Xing-Han; Hsiao, Yu-Hsuan; Chang, Shao-En; Li, Guan-Syun; Hu, Nien-Jen

    2016-01-01

    Membrane proteins play key roles in many fundamental functions in cells including ATP synthesis, ion and molecule transporter, cell signalling and enzymatic reactions, accounting for ~30% genes of whole genomes. However, the hydrophobic nature of membrane proteins frequently hampers the progress of structure determination. Detergent screening is the critical step in obtaining stable detergent-solubilized membrane proteins and well-diffracting protein crystals. Fluorescence Detection Size Exclusion Chromatography (FSEC) has been developed to monitor the extraction efficiency and monodispersity of membrane proteins in detergent micelles. By tracing the FSEC profiles of GFP-fused membrane proteins, this method significantly enhances the throughput of detergent screening. However, current methods to acquire FSEC profiles require either an in-line fluorescence detector with the SEC equipment or an off-line spectrofluorometer microplate reader. Here, we introduce an alternative method detecting the absorption of GFP (FA-SEC) at 485 nm, thus making this methodology possible on conventional SEC equipment through the in-line absorbance spectrometer. The results demonstrate that absorption is in great correlation with fluorescence of GFP. The comparably weaker absorption signal can be improved by using a longer path-length flow cell. The FA-SEC profiles were congruent with the ones plotted by FSEC, suggesting FA-SEC could be a comparable and economical setup for detergent screening of membrane proteins.

  9. Fluorophore Absorption Size Exclusion Chromatography (FA-SEC: An Alternative Method for High-Throughput Detergent Screening of Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Sung-Yao Lin

    Full Text Available Membrane proteins play key roles in many fundamental functions in cells including ATP synthesis, ion and molecule transporter, cell signalling and enzymatic reactions, accounting for ~30% genes of whole genomes. However, the hydrophobic nature of membrane proteins frequently hampers the progress of structure determination. Detergent screening is the critical step in obtaining stable detergent-solubilized membrane proteins and well-diffracting protein crystals. Fluorescence Detection Size Exclusion Chromatography (FSEC has been developed to monitor the extraction efficiency and monodispersity of membrane proteins in detergent micelles. By tracing the FSEC profiles of GFP-fused membrane proteins, this method significantly enhances the throughput of detergent screening. However, current methods to acquire FSEC profiles require either an in-line fluorescence detector with the SEC equipment or an off-line spectrofluorometer microplate reader. Here, we introduce an alternative method detecting the absorption of GFP (FA-SEC at 485 nm, thus making this methodology possible on conventional SEC equipment through the in-line absorbance spectrometer. The results demonstrate that absorption is in great correlation with fluorescence of GFP. The comparably weaker absorption signal can be improved by using a longer path-length flow cell. The FA-SEC profiles were congruent with the ones plotted by FSEC, suggesting FA-SEC could be a comparable and economical setup for detergent screening of membrane proteins.

  10. In-vivo dynamic characterization of microneedle skin penetration using optical coherence tomography

    Science.gov (United States)

    Enfield, Joey; O'Connell, Marie-Louise; Lawlor, Kate; Jonathan, Enock; O'Mahony, Conor; Leahy, Martin

    2010-07-01

    The use of microneedles as a method of circumventing the barrier properties of the stratum corneum is receiving much attention. Although skin disruption technologies and subsequent transdermal diffusion rates are being extensively studied, no accurate data on depth and closure kinetics of microneedle-induced skin pores are available, primarily due to the cumbersome techniques currently required for skin analysis. We report on the first use of optical coherence tomography technology to image microneedle penetration in real time and in vivo. We show that optical coherence tomography (OCT) can be used to painlessly measure stratum corneum and epidermis thickness, as well as microneedle penetration depth after microneedle insertion. Since OCT is a real-time, in-vivo, nondestructive technique, we also analyze skin healing characteristics and present quantitative data on micropore closure rate. Two locations (the volar forearm and dorsal aspect of the fingertip) have been assessed as suitable candidates for microneedle administration. The results illustrate the applicability of OCT analysis as a tool for microneedle-related skin characterization.

  11. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  12. Fast Blood Vector Velocity Imaging using ultrasound: In-vivo examples of complex blood flow in the vascular system

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Lindskov; Udesen, Jesper; Gran, Fredrik

    2008-01-01

    Conventional ultrasound methods for acquiring color flow images of the blood motion are restricted by a relatively low frame rate and angle dependent velocity estimates. The Plane Wave Excitation (PWE) method has been proposed to solve these limitations. The frame rate can be increased, and the 2-D...... vector velocity of the blood motion can be estimated. The transmitted pulse is not focused, and a full speckle image of the blood can be acquired for each emission. A 13 bit Barker code is transmitted simultaneously from each transducer element. The 2-D vector velocity of the blood is found using 2-D...... speckle tracking between segments in consecutive speckle images. The flow patterns of six bifurcations and two veins were investigated in-vivo. It was shown: 1) that a stable vortex in the carotid bulb was present opposed to other examined bifurcations, 2) that retrograde flow was present...

  13. Multiparameter telemetry as a sensitive screening method to detect vaccine reactogenicity in mice.

    Directory of Open Access Journals (Sweden)

    Margarete Arras

    Full Text Available Refined vaccines and adjuvants are urgently needed to advance immunization against global infectious challenges such as HIV, hepatitis C, tuberculosis and malaria. Large-scale screening efforts are ongoing to identify adjuvants with improved efficacy profiles. Reactogenicity often represents a major hurdle to the clinical use of new substances. Yet, irrespective of its importance, this parameter has remained difficult to screen for, owing to a lack of sensitive small animal models with a capacity for high throughput testing. Here we report that continuous telemetric measurements of heart rate, heart rate variability, body core temperature and locomotor activity in laboratory mice readily unmasked systemic side-effects of vaccination, which went undetected by conventional observational assessment and clinical scoring. Even minor aberrations in homeostasis were readily detected, ranging from sympathetic activation over transient pyrogenic effects to reduced physical activity and apathy. Results in real-time combined with the potential of scalability and partial automation in the industrial context suggest multiparameter telemetry in laboratory mice as a first-line screen for vaccine reactogenicity. This may accelerate vaccine discovery in general and may further the success of vaccines in combating infectious disease and cancer.

  14. Comparative study between Pap smear and visual inspection using acetic acid as a method of cervical cancer screening.

    Science.gov (United States)

    Begum, S A; Rashid, M H; Nessa, A; Aziz, M A; Zakaria, S M; Roy, J S

    2012-01-01

    This prospective study was done for the comparison of visual inspection using acetic acid (VIA) and Pap smear as a method of cervical cancer screening. This study was also done to determine the proportion of women screened positive with VIA and proportion of women screened positive with Pap smear. Another aim was to compare the sensitivity and specificity of VIA and Pap smear. A total of 300 women attended to the outpatient gynecologic clinic and cervical cancer screening programme at Bangabandhu Sheikh Mujib Medical University (BSMMU) were included. On VIA, 23 out of 300 women screened had aceto-white lesions. On Pap smear, 14 out of the 300 women had ASCUS or worse lesions. Of the 300 enrolled women, 11 were positive on both VIA and cytology; 12 were positive on VIA only; and 3 were positive on cytology only. Those women (n=26) who showed positive test result with either VIA or Pap smear or both tests were further subjected to colposcopy directed biopsy. Histology was taken as gold standard to compare the performance of VIA and cytology (Pap's smear). Histological diagnosis of CIN/cancer was made in 18 Positive cases out of the total 26 patients who underwent biopsy. Pap smear picked up 10 out of the 18 biopsy-proven cases whereas VIA could identify 17 out of the 18 CIN/carcinoma cervices. VIA was more sensitive (94.44%) than pap smear (55.55%), which was statistically significant. However, the specificity of VIA was slightly lower (97.87%) than that of cytology (98.58%). The PPV of VIA was 73.91% versus 71.42 % for Pap smear.

  15. Radioimmunoassay of alpha-foetoprotein in the eluate of dried blood. A method for antenatal screening of neural tube defects

    International Nuclear Information System (INIS)

    Travert, G.; Herlicoviez, M.; Laroche, D.

    1979-01-01

    A radioimmunoassay for alpha-foetoprotein (AFP) in dried blood spots is reported. The main technical characteristics (reproducibility, sensitivity, recovery of exogenous AFP added and AFP stability in dried blood) are evaluated. They indicate that this method is feasible and well adapted to AFP measurement during pregnancy. AFP determination in maternal serum allows early detection of at least 80% of neural tube defects. The use of dried blood spots as samples for AFP assay makes our method a possible mass screening test for these malformations, which occur with an incidence of 12 for 10,000 [fr

  16. Gastric Cancer Screening by Combined Assay for Serum Anti-Helicobacter pylori IgG Antibody and Serum Pepsinogen Levels--The ABC Method.

    Science.gov (United States)

    Yamaguchi, Yasuharu; Nagata, Yasuhiko; Hiratsuka, Ryuuta; Kawase, Yoshihiko; Tominaga, Tatsurou; Takeuchi, Shunji; Sakagami, Shinya; Ishida, Shusei

    2016-01-01

    Helicobacter pylori (Hp) infection and gastric atrophy are both risk factors for gastric cancer. Recently it has been found that X-ray examination for gastric cancer screening does not have much effect on the detection rate for gastric cancer in Japan. A candidate for a new mass screening for gastric cancer, the ABC method, using the combination assay of Hp and serum pepsinogen, was useful for identifying the development of gastric cancer in high-risk and low-risk populations. People with higher cancer risk are recommended to receive endoscopy. The ABC method was carried out as a gastric cancer mass-screening on the initiative of Nishitokyo Medical Association in Nishitokyo city from 2011. This paper reviewed the present status of gastric cancer screening using the ABC method, including the latest results of our ongoing screening. We report results for 36,627 individuals from 2011 to 2013. Among them, 16,965 received blood examination for the ABC method. Of those, 8,083 planned to undergo endoscopic examination according to stratification of the risk for the development of gastric cancer. In fact, a total of 2,911 individuals underwent endoscopic examination. Gastric cancer was detected in 65 patients, including 52 (80%) diagnosed with early gastric cancer. The ABC method was not organized screening but opportunistic screening. X-ray examination was the organized screening that was ongoing during the same period. Detection cost for 1 gastric cancer case using the ABC method was cheaper than the conventional X-ray screening method (¥1,267,452 vs. ¥2,807,763). Although further large epidemiological studies are required, the ABC method might be positioned as an effective mass screening for gastric cancer. © 2016 S. Karger AG, Basel.

  17. The Canadian National Calibration Reference Center for Bioassay and in-vivo Monitoring: A program summary

    International Nuclear Information System (INIS)

    Kramer, G.H.; Zamora, M.L.

    1994-01-01

    The Canadian National Calibration Reference Center for Bioassay and in-vivo Monitoring is part of the Radiation Protection Bureau, Department of Health. The Reference Center operates a variety of different intercomparison programs that are designed to confirm that workplace monitoring results are accurate and provide the necessary external verification required by the Canadian regulators. The programs administered by the Reference Center currently include urinalysis intercomparisons for tritium, natural uranium, and 14 C, and in-vivo programs for whole-body, thorax, and thyroid monitoring. The benefits of the intercomparison programs to the participants are discussed by example. Future programs that are planned include dual spiked urine sample which contain both tritium and 14 C and the in-vivo measurement of 99m Tc. 18 refs., 1 fig., 2 tabs

  18. DETECTION OF MICROVASCULAR COMPLICATIONS OF TYPE 2 DIABETES BY EZSCAN AND ITS COMPARISON WITH STANDARD SCREENING METHODS

    Directory of Open Access Journals (Sweden)

    Sarita Bajaj

    2016-08-01

    Full Text Available BACKGROUND EZSCAN is a new, noninvasive technique to detect sudomotor dysfunction and thus neuropathy in diabetes patients at an early stage. It further predicts chances of development of other microvascular complications. In this study, we evaluated EZSCAN for detection of microvascular complications in Type 2 diabetes patients and compared accuracy of EZSCAN with standard screening methods. MATERIALS AND METHODS 104 known diabetes patients, 56 males and 48 females, were studied. All cases underwent the EZSCAN test, Nerve Conduction Study (NCS test, Vibration perception threshold test (VPT, Monofilament test, Fundus examination and Urine micral test. The results of EZSCAN were compared with standard screening methods. The data has been analysed and assessed by applying appropriate statistical tests within different groups. RESULTS Mean age of the subjects was 53.5 ± 11.4 years. For detection of diabetic neuropathy, sensitivity and specificity of EZSCAN was found to be 77.0 % and 95.3%, respectively. Odd’s ratio (OR was 68.82 with p < 0.0001. AUC in ROC curve was 0.930. Sensitivity and specificity of EZSCAN for detection of nephropathy were 67.1% and 94.1%, respectively. OR = 32.69 with p < 0.0001. AUC was 0.926. Sensitivity of EZSCAN for detection of retinopathy was 90% while specificity is 70.3%. OR = 21.27; p< 0.0001. AUC came out to be 0.920. CONCLUSION Results of EZSCAN test compared significantly to the standard screening methods for the detection of microvascular complications of diabetes and can be used as a simple, noninvasive and quick method to detect microvascular complications of diabetes.

  19. TU-G-BRD-08: In-Vivo EPID Dosimetry: Quantifying the Detectability of Four Classes of Errors

    Energy Technology Data Exchange (ETDEWEB)

    Ford, E; Phillips, M; Bojechko, C [University of Washington, Seattle, WA (United States)

    2015-06-15

    Purpose: EPID dosimetry is an emerging method for treatment verification and QA. Given that the in-vivo EPID technique is in clinical use at some centers, we investigate the sensitivity and specificity for detecting different classes of errors. We assess the impact of these errors using dose volume histogram endpoints. Though data exist for EPID dosimetry performed pre-treatment, this is the first study quantifying its effectiveness when used during patient treatment (in-vivo). Methods: We analyzed 17 patients; EPID images of the exit dose were acquired and used to reconstruct the planar dose at isocenter. This dose was compared to the TPS dose using a 3%/3mm gamma criteria. To simulate errors, modifications were made to treatment plans using four possible classes of error: 1) patient misalignment, 2) changes in patient body habitus, 3) machine output changes and 4) MLC misalignments. Each error was applied with varying magnitudes. To assess the detectability of the error, the area under a ROC curve (AUC) was analyzed. The AUC was compared to changes in D99 of the PTV introduced by the simulated error. Results: For systematic changes in the MLC leaves, changes in the machine output and patient habitus, the AUC varied from 0.78–0.97 scaling with the magnitude of the error. The optimal gamma threshold as determined by the ROC curve varied between 84–92%. There was little diagnostic power in detecting random MLC leaf errors and patient shifts (AUC 0.52–0.74). Some errors with weak detectability had large changes in D99. Conclusion: These data demonstrate the ability of EPID-based in-vivo dosimetry in detecting variations in patient habitus and errors related to machine parameters such as systematic MLC misalignments and machine output changes. There was no correlation found between the detectability of the error using the gamma pass rate, ROC analysis and the impact on the dose volume histogram. Funded by grant R18HS022244 from AHRQ.

  20. Microfilter paper method for 17α-hydroxyprogesterone radioimmunoassay: its application for rapid screening for congenital adrenal hyperplasia

    International Nuclear Information System (INIS)

    Pang, S.; Hotchkiss, J.; Drash, A.L.; Levine, L.S.; New, M.I.

    1977-01-01

    A new micromethod for measuring a steroid in blood collected on filter paper has been developed. The method is easy and rapid and has the specificity, accuracy and precision of RIA in whole plasma. Less than 20 μl of blood is required, and, therefore, samples may be obtained with heel prick. This method has been applied to the determination of 17α-hydroxyprogesterone (17α-OH-P) for screening patients with congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency. There was excellent correlation (r = .94) between the values of 17α-OH-P obtained by microfilter paper method and those from plasma samples of cord (40 +- 13 ng/ml) and neonatal blood (<3.6 ng/ml) in normal infants. In six neonates at risk for CAH the diagnosis was made utilizing the microfilter paper method. 17α-OH-P concentrations were highly elevated in both filter paper eluates of whole blood (67 to 360 ng/ml of plasma) and simultaneously obtained plasma concentration (74 to 395 ng/ml) in affected infants. The concentrations of 17α-OH-P remained unchanged in dried filter paper blood when stored at room temperature for up to 21 days. Thus, filter paper with dried blood may be sent for steroid assay by mail. The ease with which samples may be transported and the minute amount of sample necessary make this method a promising screening test for CAH

  1. A combined enrichment/polymerase chain reaction based method for the routine screening of Streptococcus agalactiae in pregnant women

    Directory of Open Access Journals (Sweden)

    F.M. Munari

    2012-03-01

    Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.

  2. A precise theoretical method for high- throughput screening of novel organic electrode materials for Li-ion batteries

    Directory of Open Access Journals (Sweden)

    Wanwan Zhang

    2017-09-01

    Full Text Available Organic electrode materials have gained significant attention due to their flexibility, lightweight characteristics, abundant resources in nature, and low CO2 emission. It's urgently needed for setting up an accurate high-throughput screening theoretical scheme that could find out possible candidates of electrode materials. Currently, the error between the theoretical potentials calculated by the PBE-D2 (DFT-D2, dispersion-corrected density functional theory method and the experimental values is larger than 12%. Thus, it's essential to finding a more accurate method. In the present work, hybrid functionals and vdW correction methods are applied to investigate six reported organic electrode materials for Li-ion batteries. The results show that the hybrid functional combined with the D2 dispersion corrected method, i.e., HSE06-D2 (Heyd, Scuseria, and Ernzerhof, dispersion-corrected, is able to predict the potential of the organic material precisely with an average error of approximately 5%. This method occupies much hardware resources and being very time consuming, but it could be applied as the final ultrafine step in the high-throughput screening program.

  3. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    Science.gov (United States)

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  4. Philadelphia Telemedicine Glaucoma Detection and Follow-up Study: Methods and Screening Results.

    Science.gov (United States)

    Hark, Lisa A; Katz, L Jay; Myers, Jonathan S; Waisbourd, Michael; Johnson, Deiana; Pizzi, Laura T; Leiby, Benjamin E; Fudemberg, Scott J; Mantravadi, Anand V; Henderer, Jeffrey D; Zhan, Tingting; Molineaux, Jeanne; Doyle, Vance; Divers, Meskerem; Burns, Christine; Murchison, Ann P; Reber, Shae; Resende, Arthur; Bui, Thien Dan V; Lee, Jane; Crews, John E; Saaddine, Jinan B; Lee, Paul P; Pasquale, Louis R; Haller, Julia A

    2017-09-01

    To describe methodology and screening results from the Philadelphia Telemedicine Glaucoma Detection and Follow-up Study. Screening program results for a prospective randomized clinical trial. Individuals were recruited who were African-American, Hispanic/Latino, or Asian over age 40 years; white individuals over age 65 years; and any ethnicity over age 40 years with a family history of glaucoma or diabetes. Primary care offices and Federally Qualified Health Centers were used for telemedicine (Visit 1). Two posterior fundus photographs and 1 anterior segment photograph were captured per eye in each participant, using a nonmydriatic, autofocus, hand-held fundus camera (Volk Optical, Mentor, Ohio, USA). Medical and ocular history, family history of glaucoma, visual acuity, and intraocular pressure measurements using the ICare rebound tonometer (ICare, Helsinki, Finland) were obtained. Images were read remotely by a trained retina reader and a glaucoma specialist. From April 1, 2015, to February 6, 2017, 906 individuals consented and attended Visit 1. Of these, 553 participants were female (61.0%) and 550 were African-American (60.7%), with a mean age of 58.7 years. A total of 532 (58.7%) participants had diabetes, and 616 (68%) had a history of hypertension. During Visit 1, 356 (39.3%) participants were graded with a normal image. Using image data from the worse eye, 333 (36.8%) were abnormal and 155 (17.1%) were unreadable. A total of 258 (28.5%) had a suspicious nerve, 62 (6.8%) had ocular hypertension, 102 (11.3%) had diabetic retinopathy, and 68 (7.5%) had other retinal abnormalities. An integrated telemedicine screening intervention in primary care offices and Federally Qualified Health Centers detected high rate of suspicious optic nerves, ocular hypertension, and retinal pathology. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Cost comparison of laboratory methods and four field screening technologies for uranium-contaminated soil

    International Nuclear Information System (INIS)

    Douthat, D.M.; Armstrong, A.Q.

    1994-01-01

    To address the problem of characterizing uranium-contaminated surface soil at federal facilities, the Department of Energy has the development of four uranium field screening technologies, under the direction of the Uranium-in-Soils Integrated Demonstration (USID) Program. These four technologies include: a long-range alpha detector a beta scintillation detector, an in situ gamma detector, and a mobile laser ablation-inductively coupled plasma/atomic emission spectrometry (LA-ICP/AES) laboratory. As part of the performance assessment for these field screening technologies, cost estimates for the development and operation of each technology were created. A cost study was conducted to compare three of the USID field screening technologies to the use of traditional field surveying equipment to adequately characterize surface soils of a one-acre site. The results indicate that the use of traditional equipment costs more than the in situ gamma detector, but less than the beta scintillation detector and LRAD. The use of traditional field surveying equipment results in cost savings of 4% and 34% over the use of the beta scintillation and LRAD technologies, respectively. A study of single-point surface soil sampling and laboratory analysis costs was also conducted. Operational costs of the mobile LA-ICP/AES laboratory were compared with operational costs of traditional sampling and analysis, which consists of collecting soil samples and conducting analysis in a radiochemical laboratory. The cost study indicates that the use of the mobile LA-ICP/AES laboratory results in cost savings of 23% and 40% over traditional field sampling and laboratory analysis conducted by characterization groups at two DOE facilities

  6. Development of cell death-based method for the selectivity screening of caspase-1 inhibitors

    DEFF Research Database (Denmark)

    Chopra, Puneet; Gupta, Shashank; Dastidar, Sunanda G

    2009-01-01

    be used for the selectivity screening of multiple caspases in a biologically relevant context in a single assay. In this study, we have developed an assay in which DNA fragmentation, a hallmark of apoptosis, of Jurkat cell line was examined post induction with etoposide in the presence or absence...... belonging to caspase-1 family (1, 4 and 5) are not present in the Jurkat cells or might not be involved in the etoposide-induced DNA fragmentation. Since the inhibition of caspases 3, 8 and 9 is accompanied by the down regulation of the activity of a cascade of caspases (caspases 2, 6, 7, 9 and 10...

  7. Screening of various botanical extracts for antioxidant activity using DPPH free radical method.

    Science.gov (United States)

    Waqas, Muhammad Khurram; Saqib, Najam-Us; Rashid, Saeed-Ur; Shah, Pervaiz Akhtar; Akhtar, Naveed; Murtaza, Ghulam

    2013-01-01

    Aiming at the exploration of herbal use by society, crude extracts of the seeds of some commonly used medicinal plants (Vitis vinifera, Tamarindus indica and Glycin max) were screened for their free radical scavenging properties using ascorbic acid as standard antioxidant. Free radical scavenging activity was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical. The overall antioxidant activity of grape seeds (Vitis vinifera) was the strongest, followed in descending order by soybean (Glycin max) and tamarind (Tamarindus indica). The seeds extract of Vitis vinifera, Glycin max and Tamarindus indica showed 85.61%, 83.45% and 79.26%, DPPH scavenging activity respectively.

  8. Two-Screen Method for Determining Electron Beam Energy and Deflection from Laser Wakefield Acceleration

    Energy Technology Data Exchange (ETDEWEB)

    Pollock, B B; Ross, J S; Tynan, G R; Divol, L; Glenzer, S H; Leurent, V; Palastro, J P; Ralph, J E; Froula, D H; Clayton, C E; Marsh, K A; Pak, A E; Wang, T L; Joshi, C

    2009-04-24

    Laser Wakefield Acceleration (LWFA) experiments have been performed at the Jupiter Laser Facility, Lawrence Livermore National Laboratory. In order to unambiguously determine the output electron beam energy and deflection angle at the plasma exit, we have implemented a two-screen electron spectrometer. This system is comprised of a dipole magnet followed by two image plates. By measuring the electron beam deviation from the laser axis on each plate, both the energy and deflection angle at the plasma exit are determined through the relativistic equation of motion.

  9. In-vivo diffusing-wave-spectroscopy measurements of the ocular fundus

    Science.gov (United States)

    Rovati, L.; Cattini, S.; Zambelli, N.; Viola, F.; Staurenghi, G.

    2007-04-01

    We present what is to our knowledge the first observation of a diffusing-wave-spectroscopy signal recorded in-vivo on the ocular fundus. A modified ophthalmic microscope was developed which can acquire diffusing-wave-spectroscopy signal from the eye fundus. The diffusing-wave-spectroscopy signal was recorded in-vivo on a rabbit eye during transpupillary thermotherapy. Experimental results show the ability of the system to detect motion of the scattering sites in the ocular fundus layers during laser thermal heating.

  10. A rapid ELISA-based method for screening Bordetella pertussis strain production of antigens included in current acellular pertussis vaccines.

    Science.gov (United States)

    Barkoff, Alex-Mikael; Guiso, Nicole; Guillot, Sophie; Xing, Dorothy; Markey, Kevin; Berbers, Guy; Mertsola, Jussi; He, Qiushui

    2014-06-01

    Despite extensive vaccinations, there have been pertussis epidemics in many countries including the Netherlands, the UK, Australia and the USA. During these epidemics Bordetella pertussis strains not producing the vaccine antigen pertactin (Prn) are emerging and increasing in numbers. However, methods for confirming PRN production of B. pertussis isolates are combined PCR or PCR-based sequencing tests and western blotting. Furthermore, data about production of pertussis toxin (PT) and filamentous hemagglutinin (FHA) of these isolates are scarce. Fimbriae (Fim) production is usually determined by agglutination and reported as serotype. In this study we developed an easy, accurate and rapid method for screening PT and FHA production. Methods for Prn and Fim production have been published earlier. We analyzed altogether 109 B. pertussis strains, including 103 Finnish B. pertussis strains collected during 2006-2013, international strain Tohama I, French strains FR3496 (PT-negative), FR3693 (Prn-negative) and FR4624 (FHA-negative) and Fim-serotype reference strains S1 (producing only Fim2) and S3 (producing only Fim3). An indirect ELISA with whole bacterial cells as coating antigen was developed and used for rapid screening of the B. pertussis strains. Production of different antigens (PT, FHA, Prn, Fim2 and Fim3) was detected with specific monoclonal antibodies (mAbs). From the 103 Finnish B. pertussis strains tested, all were positive for PT, FHA and Fim. Four were found negative for Prn, and they were isolated during 2011-2013. The newly developed method proved to be useful and simple for rapid screening of different antigen production of B. pertussis isolates. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. A rapid screening-level method to optimize location of infiltration ponds.

    Science.gov (United States)

    Fennemore, G G; Davis, A; Goss, L; Warrick, A W

    2001-01-01

    A rapid-screening technique was developed to identify lithologies that best disperse artificial recharge via surface infiltration and minimize effects on ground water chemistry. The technique prospectively evaluates basin infiltration rates and water chemistry influences by integrating geotechnical, hydraulic, and water quality data with column test data and numerical modeling. The technique was validated using field data collected from surface infiltration basins designed to recharge ground water pumped from the Pipeline pit gold mine in Nevada. Observed recharge rates at these infiltration sites correlated most significantly with depth to groundwater, with basins in coarse-grained lithologies performing better (0.45 to 0.85 m/day) than those with fine-grained layers ( 2000 mg/L) than coarse-grained soils (infiltration basins for a variety of lithologies. Sites for infiltration basins can be rapidly screened to include areas with greatest depth to groundwater and in coarsest alluvial sediments, and impact to ground water chemistry can be reliably predicted using computer modeling and column test results.

  12. A Digital PCR-Based Method for Efficient and Highly Specific Screening of Genome Edited Cells.

    Directory of Open Access Journals (Sweden)

    Scott D Findlay

    Full Text Available The rapid adoption of gene editing tools such as CRISPRs and TALENs for research and eventually therapeutics necessitates assays that can rapidly detect and quantitate the desired alterations. Currently, the most commonly used assay employs "mismatch nucleases" T7E1 or "Surveyor" that recognize and cleave heteroduplexed DNA amplicons containing mismatched base-pairs. However, this assay is prone to false positives due to cancer-associated mutations and/or SNPs and requires large amounts of starting material. Here we describe a powerful alternative wherein droplet digital PCR (ddPCR can be used to decipher homozygous from heterozygous mutations with superior levels of both precision and sensitivity. We use this assay to detect knockout inducing alterations to stem cell associated proteins, NODAL and SFRP1, generated using either TALENs or an "all-in-one" CRISPR/Cas plasmid that we have modified for one-step cloning and blue/white screening of transformants. Moreover, we highlight how ddPCR can be used to assess the efficiency of varying TALEN-based strategies. Collectively, this work highlights how ddPCR-based screening can be paired with CRISPR and TALEN technologies to enable sensitive, specific, and streamlined approaches to gene editing and validation.

  13. [Tat-based cell-cell fusion method for screening HIV-1 fusion inhibitors].

    Science.gov (United States)

    Wang, Xiaoli; Yang, Yishu; Shen, Sisi; Wang, Xianliang; Feng, Tian; Hu, Qin; Zeng, Yi

    2018-03-25

    An HIV-1 cell-cell fusion system was developed to screen HIV-1 entry inhibitors that block cell-cell fusion. In this system, the pEGFP-Tat plasmid was constructed and cotransfected into effector cells (HEK-293T) with HIV-1 envelope plasmid. TZM-bl cell, a genetically engineered cell line that expresses CD4, CXCR4, CCR5 as well as Tat-inducible β-galactosidase and luciferase reporter gene, was used as target cell. Thus, the co-culture of target cells and effector cells allows the cell fusion via Env and the activity of the fusion inhibitor can be quantified by measuring the reporter protein expression. The experimental parameters were optimized and 11 anti-HIV-1 agents including CCR5 antagonist maraviroc, reverse transcription inhibitor zidovudine (AZT) and integrase inhibitor raltegravir were tested. The result showed that the system exhibited high specificity and sensitivity. Two of eight tested anti-HIV-1 agents were found to block the cell-cell fusion. The system is suitable for efficient screening of HIV-1 cell-cell fusion inhibitors.

  14. On the Evaluation Overlap Integrals with the Same and Different Screening Parameters Over Slater Type Orbitals via the Fourier-Transform Method

    International Nuclear Information System (INIS)

    Yavuz, M.; Yuekcue, N.; Oeztekin, E.; Yilmaz, H.; Doenduer, S.

    2005-01-01

    In this paper, derivation of analytical expressions for overlap integrals with the same and different screening parameters of Slater type orbitals (STOs) via the Fourier-transform method is presented. Consequently, it is relatively easy to express the Fourier integral representations of the overlap integrals with same and different screening parameters mentioned as finite sums of Gegenbauer, Gaunt, binomial coefficients, and STOs.

  15. Comparing different methods for fast screening of microbiological quality of beach sand aimed at rapid-response remediation.

    Science.gov (United States)

    Testolin, Renan C; Almeida, Tito C M; Polette, Marcus; Branco, Joaquim O; Fischer, Larissa L; Niero, Guilherme; Poyer-Radetski, Gabriel; Silva, Valéria C; Somensi, Cleder A; Corrêa, Albertina X R; Corrêa, Rogério; Rörig, Leonardo R; Itokazu, Ana Gabriela; Férard, Jean-François; Cotelle, Sylvie; Radetski, Claudemir M

    2017-05-15

    There is scientific evidence that beach sands are a significant contributor to the pathogen load to which visitors are exposed. To develop beach quality guidelines all beach zones must be included in microbiological evaluations, but monitoring methods for beach sand quality are relatively longstanding, expensive, laborious and require moderate laboratory infrastructure. This paper aimed to evaluate the microorganism activity in different beach zones applying and comparing a classical method of membrane filtration (MF) with two colorimetric screening methods based on fluorescein (FDA) and tetrazolium (TTC) salt biotransformation to evaluate a new rapid and low-cost method for beach sand microbiological contamination assessments. The colorimetric results can help beach managers to evaluate rapidly and at low cost the microbiological quality of different beach zones in order to decide whether remedial actions need to be adopted to prevent exposure of the public to microbes due to beach sand and/or water contamination. Copyright © 2017. Published by Elsevier Ltd.

  16. Newborn screening for severe combined immunodeficiency using a novel and simplified method to measure T-cell excision circles (TREC).

    Science.gov (United States)

    Tagliaferri, Laura; Kunz, Joachim B; Happich, Margit; Esposito, Susanna; Bruckner, Thomas; Hübschmann, Daniel; Okun, Jürgen G; Hoffmann, Georg F; Schulz, Ansgar; Kappe, Judit; Speckmann, Carsten; Muckenthaler, Martina U; Kulozik, Andreas E

    2017-02-01

    The prognosis of children with severe combined immunodeficiency (SCID) depends on a presymptomatic diagnosis and early treatment before complications occur. We established and tested a simplified, practical and economic newborn screening method based on the quantification of T-cell receptor excision circles (TRECs) on dried blood spots (DBSs) through qPCR. Our method was validated by the analysis of 11 positive controls, which all showed an absence of TRECs, thus yielding a sensitivity of 100%. Further, we analyzed 6034 anonymized newborns of whom 6031 (99,95%) showed a normal TREC qPCR with a median of 600 estimated TREC copies/1.6mm punch. The test showed a recall-rate of 0.05%. We present a highly sensitive, specific and time- and cost-effective method of TREC quantification, which is suitable for SCID newborn screening. In comparison to established methods, our test requires only 25% of the input material, doesn't require DNA purification and significantly reduces time and cost requirement. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Toxic Cyanobacteria in Svalbard: Chemical Diversity of Microcystins Detected Using a Liquid Chromatography Mass Spectrometry Precursor Ion Screening Method

    Directory of Open Access Journals (Sweden)

    Julia Kleinteich

    2018-04-01

    Full Text Available Cyanobacteria synthesize a large variety of secondary metabolites including toxins. Microcystins (MCs with hepato- and neurotoxic potential are well studied in bloom-forming planktonic species of temperate and tropical regions. Cyanobacterial biofilms thriving in the polar regions have recently emerged as a rich source for cyanobacterial secondary metabolites including previously undescribed congeners of microcystin. However, detection and detailed identification of these compounds is difficult due to unusual sample matrices and structural congeners produced. We here report a time-efficient liquid chromatography-mass spectrometry (LC-MS precursor ion screening method that facilitates microcystin detection and identification. We applied this method to detect six different MC congeners in 8 out of 26 microbial mat samples of the Svalbard Archipelago in the Arctic. The congeners, of which [Asp3, ADMAdda5, Dhb7] MC-LR was most abundant, were similar to those reported in other polar habitats. Microcystins were also determined using an Adda-specific enzyme-linked immunosorbent assay (Adda-ELISA. Nostoc sp. was identified as a putative toxin producer using molecular methods that targeted 16S rRNA genes and genes involved in microcystin production. The mcy genes detected showed highest similarities to other Arctic or Antarctic sequences. The LC-MS precursor ion screening method could be useful for microcystin detection in unusual matrices such as benthic biofilms or lichen.

  18. Results of a screening method used in a 12-month stool survey for Escherichia coli O157:H7.

    Science.gov (United States)

    Harris, A A; Kaplan, R L; Goodman, L J; Doyle, M; Landau, W; Segreti, J; Mayer, K; Levin, S

    1985-10-01

    Escherichia coli serotype O157:H7 has been epidemiologically linked to outbreaks of hemorrhagic colitis associated with fast-food restaurants and nursing homes. Sporadic cases now exceed those associated with outbreaks. The incidence of the organism in patients with common diarrhea syndromes and in asymptomatic persons is unknown. Routine serotyping of E. coli isolates is impractical for most clinical microbiology laboratories. We developed a screening plate by utilizing sorbitol fermentation as a biochemical marker to identify organisms for serotyping. A total of 2,552 stool samples were screened. In 106 (4.1%), sorbitol-negative E. coli were identified. Of these, two were serotype O157:H7, and both produced a Vero cell toxin. One patient had hemorrhagic colitis and the other a mild, febrile, self-limited diarrhea with no other bacterial pathogen identified. This plate provides an easy, effective method of screening for sorbitol-negative E. coli, a process facilitating the selection of organisms for serotyping and one that may help clarify this organism's role in human disease.

  19. A gas/liquid chromatographic-mass spectrometric method for the rapid screening of 250 pesticides in aqueous matrices

    Energy Technology Data Exchange (ETDEWEB)

    Chandramouli, B.; Harvan, D.; Brittain, S.; Hass, R. [Eno River Labs, LLC. Durham, NC (United States)

    2004-09-15

    Pesticide residues in food present a potentially serious and significant cause for concern. Many pesticides have been associated with significant health effects to the nervous and endocrine systems and some have been deemed carcinogenic. There are many well-established techniques for pesticide analysis. However, commercial pesticide methods have traditionally only been available for specific pesticide families, such as chlorinated pesticides or herbicides, and at detection limits ranging from 0.05 ppb to 1 ppm in aqueous matrices. Techniques that can quickly screen for the presence/absence of pesticide residues in food matrices are critical in ensuring the safety of food and water. This paper outlines a combined Gas Chromatographic-High Resolution Mass Spectrometric (GC-HRMS) and Liquid Chromatographic Tandem Mass Spectrometric (LC-MS/MS) screening assay for 250 pesticides that was developed for use in water, and soda samples at screening levels ranging from 0.1-5 ppb. The pesticides selected have been identified by the European Union as being of concern and the target of possible legislation. The list encompasses a variety of pesticide classes and compound groupings.

  20. Assessing local capacity to expand rural breast cancer screening and patient navigation: An iterative mixed-method tool.

    Science.gov (United States)

    Inrig, Stephen J; Higashi, Robin T; Tiro, Jasmin A; Argenbright, Keith E; Lee, Simon J Craddock

    2017-04-01

    Despite federal funding for breast cancer screening, fragmented infrastructure and limited organizational capacity hinder access to the full continuum of breast cancer screening and clinical follow-up procedures among rural-residing women. We proposed a regional hub-and-spoke model, partnering with local providers to expand access across North Texas. We describe development and application of an iterative, mixed-method tool to assess county capacity to conduct community outreach and/or patient navigation in a partnership model. Our tool combined publicly-available quantitative data with qualitative assessments during site visits and semi-structured interviews. Application of our tool resulted in shifts in capacity designation in 10 of 17 county partners: 8 implemented local outreach with hub navigation; 9 relied on the hub for both outreach and navigation. Key factors influencing capacity: (1) formal linkages between partner organizations; (2) inter-organizational relationships; (3) existing clinical service protocols; (4) underserved populations. Qualitative data elucidate how our tool captured these capacity changes. Our capacity assessment tool enabled the hub to establish partnerships with county organizations by tailoring support to local capacity and needs. Absent a vertically integrated provider network for preventive services in these rural counties, our tool facilitated a virtually integrated regional network to extend access to breast cancer screening to underserved women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The Stroop smartphone application is a short and valid method to screen for minimal hepatic encephalopathy.

    Science.gov (United States)

    Bajaj, Jasmohan S; Thacker, Leroy R; Heuman, Douglas M; Fuchs, Michael; Sterling, Richard K; Sanyal, Arun J; Puri, Puneet; Siddiqui, Mohammad S; Stravitz, Richard T; Bouneva, Iliana; Luketic, Velimir; Noble, Nicole; White, Melanie B; Monteith, Pamela; Unser, Ariel; Wade, James B

    2013-09-01

    Minimal hepatic encephalopathy (MHE) detection is difficult because of the unavailability of short screening tools. Therefore, MHE patients can remain undiagnosed and untreated. The aim of this study was to use a Stroop smartphone application (app) (EncephalApp_Stroop) to screen for MHE. The app and standard psychometric tests (SPTs; 2 of 4 abnormal is MHE, gold standard), psychometric hepatic encephalopathy score (PHES), and inhibitory control tests (ICTs) were administered to patients with cirrhosis (with or without previous overt hepatic encephalopathy; OHE) and age-matched controls from two centers; a subset underwent retesting. A separate validation cohort was also recruited. Stroop has an "off" state with neutral stimuli and an "on" state with incongruent stimuli. Outcomes included time to complete five correct runs as well as number of trials needed in on (Ontime) and off (Offtime) states. Stroop results were compared between controls and patients with cirrhosis with or without OHE and those with or without MHE (using SPTs, ICTs, and PHES). Receiver operating characteristic analysis was performed to diagnose MHE in patients with cirrhosis with or without previous OHE. One hundred and twenty-five patients with cirrhosis (43 previous OHE) and 134 controls were included in the original cohort. App times were correlated with Model for End-Stage Liver Disease (Offtime: r = 0.57; Ontime: r = 0.61; P Stroop performance was also significantly impaired in those with MHE, compared to those without MHE, according to SPTs, ICTs, and PHES (all P 274.9 seconds (Ontime plus Offtime) had an area under the curve of 0.89 in all patients and 0.84 in patients without previous OHE for MHE diagnosis using SPT as the gold standard. The validation cohort showed 78% sensitivity and 90% specificity with the >274.9-seconds Ontime plus Offtime cutoff. App result patterns were similar between the centers. Test-retest reliability in controls and those without previous OHE was good; a

  2. Effects of skin disinfection method, deviation bag, and bacterial screening on clinical safety of platelet transfusions in the Netherlands.

    Science.gov (United States)

    de Korte, Dirk; Curvers, Joyce; de Kort, Wim L A M; Hoekstra, Tiny; van der Poel, Cees L; Beckers, Erik A M; Marcelis, Jan H

    2006-03-01

    Bacterial contamination of blood products is a great hazard for development of fatal transfusion reactions. Bacterial screening of platelet concentrates (PC) by aerobic and anaerobic culturing (BacT/ALERT, bioMérieux) was introduced in the Netherlands in October 2001. In November 2002, a nationwide, uniform skin cleansing method was introduced with a double-swab disinfection with 70 percent isopropyl alcohol. One location routinely used an integrated diversion bag to collect the first 20 to 30 mL. Over the calendar years 2002 and 2003, in total 113,093 PCs derived from pooled buffy coats were screened. After introduction of the new disinfection method, 0.85 percent were initially positive. This was a small reduction compared to the previous disinfection methods under which 0.95 percent were initially positive. The location with use of the diversion bag showed a significantly lower frequency of bacterial contamination, with 0.50 percent before and 0.37 percent after introduction of 70 percent isopropyl alcohol. In addition 8000 apheresis PCs were also screened, showing 24 initially positive samples (0.30%). The use of the diversion bag and, to a lesser extent, the use of double swabs with 70 percent isopropyl alcohol, led to a reduction of contamination. As expected, predominant contamination with resident skin bacteria was reduced. The combination of diversion bag and new disinfection led to a frequency of initial positive results for pooled five-donor PCs, which is similar to that of single-donor apheresis PCs. Furthermore, the bacterial detection system and associated product recall procedures have been shown to be effective in preventing transfusion of contaminated PCs and/or related red cells, especially for rapidly growing bacteria.

  3. An approximate-reasoning-based method for screening flammable gas tanks

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-03-01

    High-level waste (HLW) produces flammable gases as a result of radiolysis and thermal decomposition of organics. Under certain conditions, these gases can accumulate within the waste for extended periods and then be released quickly into the dome space of the storage tank. As part of the effort to reduce the safety concerns associated with flammable gas in HLW tanks at Hanford, a flammable gas watch list (FGWL) has been established. Inclusion on the FGWL is based on criteria intended to measure the risk associated with the presence of flammable gas. It is important that all high-risk tanks be identified with high confidence so that they may be controlled. Conversely, to minimize operational complexity, the number of tanks on the watchlist should be reduced as near to the true number of flammable risk tanks as the current state of knowledge will support. This report presents an alternative to existing approaches for FGWL screening based on the theory of approximate reasoning (AR) (Zadeh 1976). The AR-based model emulates the inference process used by an expert when asked to make an evaluation. The FGWL model described here was exercised by performing two evaluations. (1) A complete tank evaluation where the entire algorithm is used. This was done for two tanks, U-106 and AW-104. U-106 is a single shell tank with large sludge and saltcake layers. AW-104 is a double shell tank with over one million gallons of supernate. Both of these tanks had failed the screening performed by Hodgson et al. (2) Partial evaluations using a submodule for the predictor likelihood for all of the tanks on the FGWL that had been flagged previously by Whitney (1995).

  4. Screen printing as a holistic manufacturing method for multifunctional microsystems and microreactors

    Science.gov (United States)

    Bejarano, D.; Lozano, P.; Mata, D.; Cito, S.; Constantí, M.; Katakis, I.

    2009-11-01

    Microsystems are commonly manufactured by photolithographic or injection moulding techniques in a variety of realizations and on almost any material. A perennial problem in the manufacturing of microsystems is the difficulty to obtain hybrid devices that incorporate distinct materials with different functionalities. In most of the cases, cumbersome prototyping and high investment needed for manufacturing are additional problems that add to the cost of the final product. Such drawbacks are true not only for lab-on-a-chip but also for certain microreactor applications. Most importantly, in many commercial applications where an intermediate product between full fluidics control and a 'strip' is needed, such restraints prohibit the feasibility of reduction to practice. Screen printing on the other hand is a low cost technique that has been used for years in mass producing two-dimensional low cost reproductions of a mask pattern for circuits and art incorporates prototyping in production and allows the use of an almost limitless variety of materials as 'inks'. In this work it is demonstrated that taking advantage of the deposited ink's three-dimensional nature, screen printing can be used as a versatile and low cost technique for the fabrication of microchannels. Microchannels with dimensions in the order of 100 µm were fabricated that could readily incorporate functionalities through the choice of the materials used to create the microstructure. Variables have been investigated through a factorial experimental design as important process parameters that affect the resolution and print thickness of the resulting microchannels that incorporate electroactive elements. Such studies can lead to the optimization of the process for custom applications.

  5. An approximate-reasoning-based method for screening flammable gas tanks

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-03-01

    High-level waste (HLW) produces flammable gases as a result of radiolysis and thermal decomposition of organics. Under certain conditions, these gases can accumulate within the waste for extended periods and then be released quickly into the dome space of the storage tank. As part of the effort to reduce the safety concerns associated with flammable gas in HLW tanks at Hanford, a flammable gas watch list (FGWL) has been established. Inclusion on the FGWL is based on criteria intended to measure the risk associated with the presence of flammable gas. It is important that all high-risk tanks be identified with high confidence so that they may be controlled. Conversely, to minimize operational complexity, the number of tanks on the watchlist should be reduced as near to the true number of flammable risk tanks as the current state of knowledge will support. This report presents an alternative to existing approaches for FGWL screening based on the theory of approximate reasoning (AR) (Zadeh 1976). The AR-based model emulates the inference process used by an expert when asked to make an evaluation. The FGWL model described here was exercised by performing two evaluations. (1) A complete tank evaluation where the entire algorithm is used. This was done for two tanks, U-106 and AW-104. U-106 is a single shell tank with large sludge and saltcake layers. AW-104 is a double shell tank with over one million gallons of supernate. Both of these tanks had failed the screening performed by Hodgson et al. (2) Partial evaluations using a submodule for the predictor likelihood for all of the tanks on the FGWL that had been flagged previously by Whitney (1995)

  6. FSH to estradiol ratio can be used as screening method for mild cognitive impairment in postmenopausal women.

    Science.gov (United States)

    Hestiantoro, A; Wiwie, M; Shadrina, A; Ibrahim, N; Purba, J S

    2017-12-01

    To determine the role of anthropometric measurement, menopausal symptoms and biochemical marker changes as screening methods for mild cognitive impairment (MCI) in postmenopausal women Methods: A cross-sectional study included 282 postmenopausal women in Jakarta, further classified into two groups, with and without MCI. Some related variables such as age, body mass index (BMI), duration of menopause, vasomotor symptoms, hormone levels such as follicle stimulating hormone (FSH), luteinizing hormone, leptin, estradiol, and cognitive status, were assessed and analyzed. The FSH levels significantly correlated with MCI incidence (p = 0.018), along with the ratio of FSH/estradiol levels (p = 0.029) and ratio of FSH/soluble leptin receptor (p = 0.011), while other variables did not. By multivariate analysis, the ratio of FSH/estradiol was known as the most significant factor with a probability of having MCI in menopausal women of 1.15. Using the ROC curve, the threshold of the ratio FSH/estradiol to predict MCI was 1.94, with sensitivity 66.5% and specificity 46.8%. The ratio of FSH to estradiol (>1.94) can be used as a screening method for the occurrence of MCI in postmenopausal women.

  7. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  8. A screening method for cytochrome P-450 organic peroxidase activity and application to hydrocarbon-degrading bacterial populations

    Energy Technology Data Exchange (ETDEWEB)

    Wyndham, R.C. (Univ. of Toronto, ON (Canada))

    1987-01-01

    A method to detect the expression of hemoproteins with organic hydroperoxide reducing activity was developed to screen bacterial populations isolated from heavy oils and oil sands. The method is based on the activity of cytochrome P-450 as catalyst in the reduction of cumene hydroperoxide by artificial electron donors. There was no cross-reactivity with true catalyst in the reduction of cumene hydroperoxide by artificial electron donors. There was no cross-reactivity with true peroxidases involved in the reduction of hydrogen peroxide. Cross-reactivity with catalase could be eliminated with appropriate inhibitors but did not normally interfere with the detection method. A preliminary screen resulted in the isolation of Acinetobactor calcoaceticus and a range of Gram-positive bacteria with organic peroxidase activity. Carbon monoxide difference spectra of cell-free extracts of the isolates revealed the presence of a hydrocarbon-inducible cytochrome P-450 in Acinetobacter calcoaceticus and in coryneform and actinomycete bacteria. A CO-binding cytochrome of unknown type with a Soret absorption maximum at 424 nm and cumene hydroperoxidase activity was also detected in some strains. 34 refs., 1 fig., 3 tabs.

  9. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    Energy Technology Data Exchange (ETDEWEB)

    Gil Tejedor, A.M. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain); Fernandez Hernando, P. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)]. E-mail: pfhernando@ccia.uned.es; Durand Alegria, J.S. [Departamento de Ciencias Analiticas, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, c/Senda del Rey 9, 28040 Madrid (Spain)

    2007-05-15

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL{sup -1} range, with a detection limit of 4.15 ng mL{sup -1} for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg].

  10. Validation of a 20-h real-time PCR method for screening of Salmonella in poultry faecal samples

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, Flemming; Hoorfar, Jeffrey

    2010-01-01

    (NordVal). The comparative trial was performed against a reference method from the Nordic Committee on Food Analysis (NMKL187, 2007) using 132 artificially and naturally contaminated samples. The limit of detection (LOD50) was found to be 24 and 33 CFU/sample for the PCR and NMKL187 methods......, respectively. The relative accuracy, relative sensitivity and relative specificity were all 100%, when including naturally contaminated samples and samples artificially contaminated with 10-100 CFU/sample. The collaborative trial included six laboratories and valid results were obtained from five of them....... Apart from one of the samples that was artificially contaminated with 1-10 CFU/sample being a false-negative with PCR for one of the laboratories, no false-positive or false-negative results were reported. This test supplies the growing demand for validated diagnostic PCR methods for screening...

  11. A rapid fluorimetric screening method for the 1,4-benzodiazepines: Determination of their metabolite oxazepam in urine

    International Nuclear Information System (INIS)

    Gil Tejedor, A.M.; Fernandez Hernando, P.; Durand Alegria, J.S.

    2007-01-01

    Oxazepam is the major metabolite screened in urine samples for the evidence of the use of benzodiazepine drugs. The methods currently used, however, are laborious and time consuming. This paper proposes an oxazepam detection method based on its hydrolysis and cyclization - a reaction catalysed by cerium (IV) in an ortho-phosphoric acid-containing medium - to form 2-chloro-9(10H)-acridinone, a strongly fluorescent molecule. The variables involved in the hydrolysis and cyclization stages were optimised. Oxazepam was detectable in the 5-900 ng mL -1 range, with a detection limit of 4.15 ng mL -1 for k = 3. The method was successfully used for the determination of oxazepam in urine samples collected at different times after the oral administration of Valium[reg] and Tranxilium[reg

  12. A simple screening method for the determination of 230Th in soil and sediment samples by gamma-spectrometry

    International Nuclear Information System (INIS)

    Lozano, J.C.; Rodriguez, P.B.; Tome, F.V.

    2001-01-01

    A simple and easy to perform method for the determination of 230 Th in soil and sediment samples using gamma-spectrometry is proposed and compared with the more usual procedure using alpha-particle spectrometry. The proposed method involves an efficiency calibration for the specific determination of this radionuclide instead of a complete calibration of the spectra. A single density parameter is introduced to correct the efficiencies obtained from the reference sources. The activities of 230 Th determined by gamma-spectrometry and alpha-particle spectrometry are compared. The minimum detectable activity values obtained are completely adequate for 230 Th determination in soil and sediment samples, in which 230 Th activities are usually fairly high. Thus, this procedure is intended as a very easy way to obtain the activity of this radionuclide in these types of samples, at least as a screening method before carrying out other more laborious procedures. (author)

  13. Incipient Social Groups: An Analysis via In-Vivo Behavioral Tracking.

    Directory of Open Access Journals (Sweden)

    Jamin Halberstadt

    Full Text Available Social psychology is fundamentally the study of individuals in groups, yet there remain basic unanswered questions about group formation, structure, and change. We argue that the problem is methodological. Until recently, there was no way to track who was interacting with whom with anything approximating valid resolution and scale. In the current study we describe a new method that applies recent advances in image-based tracking to study incipient group formation and evolution with experimental precision and control. In this method, which we term "in vivo behavioral tracking," we track individuals' movements with a high definition video camera mounted atop a large field laboratory. We report results of an initial study that quantifies the composition, structure, and size of the incipient groups. We also apply in-vivo spatial tracking to study participants' tendency to cooperate as a function of their embeddedness in those crowds. We find that participants form groups of seven on average, are more likely to approach others of similar attractiveness and (to a lesser extent gender, and that participants' gender and attractiveness are both associated with their proximity to the spatial center of groups (such that women and attractive individuals are more likely than men and unattractive individuals to end up in the center of their groups. Furthermore, participants' proximity to others early in the study predicted the effort they exerted in a subsequent cooperative task, suggesting that submergence in a crowd may predict social loafing. We conclude that in vivo behavioral tracking is a uniquely powerful new tool for answering longstanding, fundamental questions about group dynamics.

  14. Incipient Social Groups: An Analysis via In-Vivo Behavioral Tracking.

    Science.gov (United States)

    Halberstadt, Jamin; Jackson, Joshua Conrad; Bilkey, David; Jong, Jonathan; Whitehouse, Harvey; McNaughton, Craig; Zollmann, Stefanie

    2016-01-01

    Social psychology is fundamentally the study of individuals in groups, yet there remain basic unanswered questions about group formation, structure, and change. We argue that the problem is methodological. Until recently, there was no way to track who was interacting with whom with anything approximating valid resolution and scale. In the current study we describe a new method that applies recent advances in image-based tracking to study incipient group formation and evolution with experimental precision and control. In this method, which we term "in vivo behavioral tracking," we track individuals' movements with a high definition video camera mounted atop a large field laboratory. We report results of an initial study that quantifies the composition, structure, and size of the incipient groups. We also apply in-vivo spatial tracking to study participants' tendency to cooperate as a function of their embeddedness in those crowds. We find that participants form groups of seven on average, are more likely to approach others of similar attractiveness and (to a lesser extent) gender, and that participants' gender and attractiveness are both associated with their proximity to the spatial center of groups (such that women and attractive individuals are more likely than men and unattractive individuals to end up in the center of their groups). Furthermore, participants' proximity to others early in the study predicted the effort they exerted in a subsequent cooperative task, suggesting that submergence in a crowd may predict social loafing. We conclude that in vivo behavioral tracking is a uniquely powerful new tool for answering longstanding, fundamental questions about group dynamics.

  15. In-vivo dosimetry for field sizes down to 6 × 6 mm2 in shaped beam radiosurgery with microMOSFET.

    Science.gov (United States)

    Sors, A; Cassol, E; Latorzeff, I; Duthil, P; Sabatier, J; Lotterie, J A; Redon, A; Berry, I; Franceries, X

    2014-09-01

    The aim of this study is to evaluate microMOSFET as in-vivo dosimeter in 6 MV shaped-beam radiosurgery for field sizes down to 6 × 6 mm2. A homemade build-up cap was developed and its use with microMOSFET was evaluated down to 6 × 6 mm2. The study with the homemade build-up cap was performed considering its influence on field size over-cover occurring at surface, achievement of the overall process of electronic equilibrium, dose deposition along beam axis and dose attenuation. An optimized calibration method has been validated using MOSFET in shaped-beam radiosurgery for field sizes from 98 × 98 down to 18 × 18 mm2. The method was detailed in a previous study and validated in irregular field shapes series measurements performed on a head phantom. The optimized calibration method was applied to microMOSFET equipped with homemade build-up cap down to 6 × 6 mm2. Using the same irregular field shapes, dose measurements were performed on head phantom. MicroMOSFET results were compared to previous MOSFET ones. Additional irregular field shapes down to 8.8 × 8.8 mm2 were studied with microMOSFET. Isocenter dose attenuation due to the homemade build-up cap over the microMOSFET was near 2% irrespective of field size. Our results suggested that microMOSFET equipped with homemade build-up cap is suitable for in-vivo dosimetry in shaped-beam radiosurgery for field sizes down to 6 × 6 mm2 and therefore that the required build-up cap dimensions to perform entrance in-vivo dosimetry in small-fields have to ensure only partial charge particle equilibrium. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  16. Collaborative study of a microbiological screening method (three-plate) for the banned antimicrobial growth promotors tylosin, virginiamycin, spiramycin, zinc bacitracin and avoparcin in animal feed

    NARCIS (Netherlands)

    Pol-Hofstad, I.; Lankveld, van W.D.M.; Tomassen, M.J.H.; Jong, de J.; Egmond, van H.J.

    2008-01-01

    A microbiological screening method (three-plate) for the detection of the antimicrobial growth promoters tylosin, spiramycin, virginiamycin, zinc bacitracin, and avoparcin in animal feed has been developed and validated successfully. A collaborative study involving 18 laboratories receiving 172

  17. Application of Sweat Patch Screening for 16 Drugs and Metabolites Using a Fast and Highly Selective LC-MS/MS Method

    NARCIS (Netherlands)

    Koster, Remco A.; Alffenaar, Jan-Willem C.; Greijdanus, Ben; VanDerNagel, Joanneke E. L.; Uges, Donald R. A.

    Background: To facilitate the monitoring of drug abuse by patients, a method was developed and validated for fast and highly selective screening for amphetamine, methamphetamine, 3,4-methylenedioxymethamphetamine, methylenedioxyamphetamine, methylenedioxyethylamphetamine, methylphenidate, cocaine,

  18. State of the art in the validation of screening methods for the control of antibiotic residues: is there a need for further development?

    Science.gov (United States)

    Gaudin, Valérie

    2017-09-01

    Screening methods are used as a first-line approach to detect the presence of antibiotic residues in food of animal origin. The validation process guarantees that the method is fit-for-purpose, suited to regulatory requirements, and provides evidence of its performance. This article is focused on intra-laboratory validation. The first step in validation is characterisation of performance, and the second step is the validation itself with regard to pre-established criteria. The validation approaches can be absolute (a single method) or relative (comparison of methods), overall (combination of several characteristics in one) or criterion-by-criterion. Various approaches to validation, in the form of regulations, guidelines or standards, are presented and discussed to draw conclusions on their potential application for different residue screening methods, and to determine whether or not they reach the same conclusions. The approach by comparison of methods is not suitable for screening methods for antibiotic residues. The overall approaches, such as probability of detection (POD) and accuracy profile, are increasingly used in other fields of application. They may be of interest for screening methods for antibiotic residues. Finally, the criterion-by-criterion approach (Decision 2002/657/EC and of European guideline for the validation of screening methods), usually applied to the screening methods for antibiotic residues, introduced a major characteristic and an improvement in the validation, i.e. the detection capability (CCβ). In conclusion, screening methods are constantly evolving, thanks to the development of new biosensors or liquid chromatography coupled to tandem-mass spectrometry (LC-MS/MS) methods. There have been clear changes in validation approaches these last 20 years. Continued progress is required and perspectives for future development of guidelines, regulations and standards for validation are presented here.

  19. Evaluation of an array-based method for human papillomavirus detection and genotyping in comparison with conventional methods used in cervical cancer screening.

    Science.gov (United States)

    García-Sierra, Nerea; Martró, Elisa; Castellà, Eva; Llatjós, Mariona; Tarrats, Antoni; Bascuñana, Elisabet; Díaz, Rosana; Carrasco, María; Sirera, Guillem; Matas, Lurdes; Ausina, Vicente

    2009-07-01

    Cervical cancer is the second-most prevalent cancer in young women around the world. Infection with human papillomavirus (HPV), especially high-risk HPV types (HR-HPV), is necessary for the development of this cancer. HPV-DNA detection is increasingly being used in cervical cancer screening programs, together with the Papanicolau smear test. We evaluated the usefulness of introducing this new array-based HPV genotyping method (i.e., Clinical Arrays Papillomavirus Humano) in the cervical cancer screening algorithm in our center. The results obtained using this method were compared to those obtained by the hybrid capture II high-risk HPV DNA test (HC-II) and Papanicolau in a selected group of 408 women. The array-based assay was performed in women that were HC-II positive or presented cytological alterations. Among 246 array-positive patients, 123 (50%) presented infection with >or=2 types, and HR-HPV types were detected in 206 (83.7%), mainly HPV-16 (24.0%). Up to 132 (33.2%) specimens were classified as ASCUS (for atypical squamous cells of undetermined significance), and only 48 (36.4%) of them were HPV-DNA positive by either assay; however, 78.7% of these cases were caused by HR-HPV types. The agreement between both HPV-DNA detection techniques was fairly good (n = 367). Screening with Papanicolau smear and HC-II tests, followed by HPV detection and genotyping, provided an optimal identification of women at risk for the development of cervical cancer. Furthermore, with the identification of specific genotypes, either in single or multiple infections, a better prediction of disease progression was achieved. The array method also made allowed us to determine the possible contribution of the available vaccines in our setting.

  20. Dental implants coated with laser deposited hydroxyapatite films - physical properties and in-vivo study

    Czech Academy of Sciences Publication Activity Database

    Jelínek, Miroslav; Dostálová, T.; Himmlová, L.; Grivas, Ch.; Fotakis, C.

    2002-01-01

    Roč. 374, - (2002), s. 599-604 ISSN 1058-725X Institutional research plan: CEZ:AV0Z1010914 Keywords : laser deposition * thin films * implants * hydroxyapatite * in-vivo tests Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.457, year: 2002

  1. Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

    Science.gov (United States)

    Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

    2016-11-01

    For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  2. A rapid quantification method for the screening indicator for β-thalassemia with near-infrared spectroscopy

    Science.gov (United States)

    Chen, Jiemei; Peng, Lijun; Han, Yun; Yao, Lijun; Zhang, Jing; Pan, Tao

    2018-03-01

    Near-infrared (NIR) spectroscopy combined with chemometrics was applied to rapidly analyse haemoglobin A2 (HbA2) for β-thalassemia screening in human haemolysate samples. The relative content indicator HbA2 was indirectly quantified by simultaneous analysis of two absolute content indicators (Hb and Hb • HbA2). According to the comprehensive prediction effect of the multiple partitioning of calibration and prediction sets, the parameters were optimized to achieve modelling stability, and the preferred models were validated using the samples not involved in modelling. Savitzky-Golay smoothing was firstly used for the spectral pretreatment. The absorbance optimization partial least squares (AO-PLS) was used to eliminate high-absorption wave-bands appropriately. The equidistant combination PLS (EC-PLS) was further used to optimize wavelength models. The selected optimal models were I = 856 nm, N = 16, G = 1 and F = 6 for Hb and I = 988 nm, N = 12, G = 2 and F = 5 for Hb • HbA2. Through independent validation, the root-mean-square errors and correlation coefficients for prediction (RMSEP, RP) were 3.50 g L- 1 and 0.977 for Hb and 0.38 g L- 1 and 0.917 for Hb • HbA2, respectively. The predicted values of relative percentage HbA2 were further calculated, and the calculated RMSEP and RP were 0.31% and 0.965, respectively. The sensitivity and specificity for β-thalassemia both reached 100%. Therefore, the prediction of HbA2 achieved high accuracy for distinguishing β-thalassemia. The local optimal models for single parameter and the optimal equivalent model sets were proposed, providing more models to match possible constraints in practical applications. The NIR analysis method for the screening indicator of β-thalassemia was successfully established. The proposed method was rapid, simple and promising for thalassemia screening in a large population.

  3. TMB-Hunt: An amino acid composition based method to screen proteomes for beta-barrel transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Agnew Alison

    2005-03-01

    Full Text Available Abstract Background Beta-barrel transmembrane (bbtm proteins are a functionally important and diverse group of proteins expressed in the outer membranes of bacteria (both gram negative and acid fast gram positive, mitochondria and chloroplasts. Despite recent publications describing reasonable levels of accuracy for discriminating between bbtm proteins and other proteins, screening of entire genomes remains troublesome as these molecules only constitute a small fraction of the sequences screened. Therefore, novel methods are still required capable of detecting new families of bbtm protein in diverse genomes. Results We present TMB-Hunt, a program that uses a k-Nearest Neighbour (k-NN algorithm to discriminate between bbtm and non-bbtm proteins on the basis of their amino acid composition. By including differentially weighted amino acids, evolutionary information and by calibrating the scoring, an accuracy of 92.5% was achieved, with 91% sensitivity and 93.8% positive predictive value (PPV, using a rigorous cross-validation procedure. A major advantage of this approach is that because it does not rely on beta-strand detection, it does not require resolved structures and thus larger, more representative, training sets could be used. It is therefore believed that this approach will be invaluable in complementing other, physicochemical and homology based methods. This was demonstrated by the correct reassignment of a number of proteins which other predictors failed to classify. We have used the algorithm to screen several genomes and have discussed our findings. Conclusion TMB-Hunt achieves a prediction accuracy level better than other approaches published to date. Results were significantly enhanced by use of evolutionary information and a system for calibrating k-NN scoring. Because the program uses a distinct approach to that of other discriminators and thus suffers different liabilities, we believe it will make a significant contribution to the

  4. CITRUS, cervical cancer screening trial by randomization of HPV testing intervention for upcoming screening: Design, methods and baseline data of 18,471 women.

    Science.gov (United States)

    Morisada, Tohru; Teramoto, Katsuhiro; Takano, Hirokuni; Sakamoto, Ikuko; Nishio, Hiroshi; Iwata, Takashi; Hashi, Akihiko; Katoh, Ryohei; Okamoto, Aikou; Sasaki, Hiroshi; Nakatani, Eiji; Teramukai, Satoshi; Aoki, Daisuke

    2017-10-01

    To assess the efficacy of screening with concurrent liquid-based cytology and human papillomavirus (HPV) testing for primary cervical cancer screening, we initiated a randomized trial entitled CervIcal cancer screening Trial by Randomization of HPV testing intervention for Upcoming Screening (CITRUS). Between June 2013 and March 2015, women aged 30-64 years of age who participated in a regular cervical cancer screening program (every 2 years) were invited to enrollment of our study. After giving their informed consent, 18,402 women were randomly assigned to liquid-based cytology as the control group (n=9145) or to HPV DNA testing with liquid-based cytology as the intervention group (n=9257). We subsequently compared the incidence rate of cervical intraepithelial neoplasia (CIN), the rate of false positive tests and the rate of overdiagnosis, as well as assessing the risks and benefits of receiving screening for women in both groups. The primary outcome of our study was the incidence of cervical intraepithelial neoplasia grade 3 or worse (CIN3+) during the study period of around 6 years. In the control group, 97.9% of women were NILM, and 2.06% ASC-US or worse (ASC-US+). In the intervention group, 87.13% of women were NILM/HPV negative, 0.72% ASC-US/HPV negative, 10.34% NILM/HPV positive, 0.69% ASC-US/HPV positive, 0.90% worse than ASC-US/either HPV. Positive HPV testing was not linearly related to age in our study. Insights from CITRUS will provide future prospects for cervical cancer screening focused on the use of HPV testing in Japan. NCT01895517, UMIN000010843, TRIUC1312. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Application of a PEG precipitation method for solubility screening: A tool for developing high protein concentration formulations

    Science.gov (United States)

    Li, Li; Kantor, Angela; Warne, Nicholas

    2013-01-01

    Previous publications demonstrated that the extrapolated solubility by polyethylene glycol (PEG) precipitation method (Middaugh et al., J Biol Chem 1979; 254:367–370; Juckes, Biochim Biophys Acta 1971; 229:535–546; Foster et al., Biochim Biophys Acta 1973; 317:505; Mahadevan and Hall, AIChE J 1990; 36:1517–1528; Stevenson and Hageman, Pharm Res 1995; 12:1671–1676) has a strong correlation to experimentally measured solubility of proteins. Here, we explored the utility of extrapolated solubility as a method to compare multiple protein drug candidates when nonideality of a highly soluble protein prohibits accurate quantitative solubility prediction. To achieve high efficiency and reduce the amount of protein required, the method is miniaturized to microwell plate format for high-throughput screening application. In this simplified version of the method, comparative solubility of proteins can be obtained without the need of concentration measurement of the supernatant following the precipitation step in the conventional method. The monoclonal antibodies with the lowest apparent solubilities determined by this method are the most difficult to be concentrated, indicating a good correlation between the prediction and empirical observations. This study also shows that the PEG precipitation method gives results for opalescence prediction that favorably compares to experimentally determined opalescence levels at high concentration. This approach may be useful in detecting proteins with potential solubility and opalescence problems prior to the time-consuming and expensive development process of high concentration formulation. PMID:23740802

  6. DEPIVIH 2: Use of three HIV testing methods in French primary care settings - ELISA laboratory screening versus two rapid point-of-care HIV tests.

    Science.gov (United States)

    Papadima, D; Gauthier, R; Prévoteau du Clary, F; Bouée, S; Conort, G; Livrozet, J-M; Taulera, O; Wajsbrot, A; Majerholc, C; Peter, J-M; Aubert, J-P

    2018-03-01

    The primary endpoint was to evaluate the use of HIV testing methods by French primary care providers: Elisa laboratory screening, instant result HIV diagnostic test and rapid result HIV diagnostic test. The secondary endpoints were the population screening rate of unknown HIV status consulting during the study period, reasons for screening and for choosing the specific screening method, the investigators' satisfaction with the rapid diagnostic test (RDT) and problems encountered. National prospective interventional study with French family physicians (FP) from December 2013 to December 2014. FPs enrolled all consenting adults consulting for an HIV screening test during a 6-month period: the choice was an Elisa laboratory test or one of the two RDTs. During the study period, 43 FPs included 981 patients. HIV screening was performed for the first time for 31.6% of patients; 767 (78.2%) Elisa laboratory test prescriptions and 214 (21.8%) RDTs were performed, leading to a screening rate of 1.3%. For 120 (15.7%) of the Elisa laboratory tests, the result was not reported and six RDTs were not valid. Nine patients were diagnosed as HIV-infected (0.9%): five with Elisa laboratory test and four with RDT. Almost 90% of FPs were willing to keep on using RDTs in their daily practice. In general practice, RDTs may be an important additional tool to traditional HIV screening. They could account for one in five tests prescribed in this context. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Screening method for solvent selection used in tar removal by the absorption process.

    Science.gov (United States)

    Masurel, Eve; Authier, Olivier; Castel, Christophe; Roizard, Christine

    2015-01-01

    The aim of this paper is the study of the treatment of flue gas issued from a process of biomass gasification in fluidized bed. The flue gas contains tar which should be selectively removed from the fuel components of interest (e.g. H2, CO and light hydrocarbons) to avoid condensation and deposits in internal combustion engine. The chosen flue gas treatment is the gas-liquid absorption using solvents, which present specific physicochemical properties (e.g. solubility, viscosity, volatility and chemical and thermal stability) in order to optimize the unit on energetic, technico-economic and environmental criteria. The rational choice of the proper solvent is essential for solving the tar issue. The preselection of the solvents is made using a Hansen parameter in order to evaluate the tar solubility and the saturation vapour pressure of the solvent is obtained using Antoine law. Among the nine families of screened solvents (alcohols, amines, ketones, halogenates, ethers, esters, hydrocarbons, sulphured and chlorinates), acids methyl esters arise as solvents of interest. Methyl oleate has then been selected and studied furthermore. Experimental liquid-vapour equilibrium data using bubbling point and absorption cell measurements and theoretical results obtained by the UNIFAC-Dortmund model confirm the high potential of this solvent and the good agreement between experimental and theoretical results.

  8. Materials Screening for the Discovery of New Half-Heuslers: Machine Learning versus ab Initio Methods.

    Science.gov (United States)

    Legrain, Fleur; Carrete, Jesús; van Roekeghem, Ambroise; Madsen, Georg K H; Mingo, Natalio

    2018-01-18

    Machine learning (ML) is increasingly becoming a helpful tool in the search for novel functional compounds. Here we use classification via random forests to predict the stability of half-Heusler (HH) compounds, using only experimentally reported compounds as a training set. Cross-validation yields an excellent agreement between the fraction of compounds classified as stable and the actual fraction of truly stable compounds in the ICSD. The ML model is then employed to screen 71 178 different 1:1:1 compositions, yielding 481 likely stable candidates. The predicted stability of HH compounds from three previous high-throughput ab initio studies is critically analyzed from the perspective of the alternative ML approach. The incomplete consistency among the three separate ab initio studies and between them and the ML predictions suggests that additional factors beyond those considered by ab initio phase stability calculations might be determinant to the stability of the compounds. Such factors can include configurational entropies and quasiharmonic contributions.

  9. Motion - Computerized Tomographic Colography is a Better Method for Screening for Polyps: Arguments Against the Motion

    Directory of Open Access Journals (Sweden)

    Jerome B Simon

    2003-01-01

    Full Text Available Computerized tomographic (CT colography is an exciting technique whereby images of the colonic wall and lumen can be obtained without colonoscopy. It is not as good as conventional colonoscopy, however, because of both inherent and performance limitations. Among the former is the inability to visualize subtle mucosal lesions, such as alterations in colour or pliability. More importantly, CT colography is strictly a diagnostic technique, and does not allow biopsy or removal of polyps. The vigorous bowel preparation required for this procedure can be very unpleasant for the patient, and includes purgatives followed by distension of the colon with air. Unlike with colonoscopy, adherent stool can be difficult to distinguish radiologically from polyps or cancers; as a result, many patients require colonoscopy anyway. The major performance limitations of CT colography are poor sensitivity and specificity compared with conventional colonoscopy. Rectal lesions, flat adenomas and diminutive adenomas are especially difficult to detect, and false-positive results are also common. In addition, the procedure is expensive and less cost effective than colonoscopy. CT colography takes relatively little patient time, but a substantial amount of time is needed for the radiologist to interpret the images. Interobserver variability is high. For all of these reasons, CT colography cannot be recommended as a screening test for colorectal neoplasia.

  10. Bioprospecting of Thermostable Cellulolytic Enzymes through Modeling and Virtual Screening Method

    Directory of Open Access Journals (Sweden)

    R. Navanietha Krishnaraj

    2017-04-01

    Full Text Available Cellulolytic enzymes are promising candidates for the use of cellulose in any bioprocess operations and for the disposal of the cellulosic wastes in an environmentally benign manner. Cellulases from thermophiles have the advantage of hydrolyzing cellulose at wider range of operating conditions unlike the normal enzymes. Herein we report the modeled structures of cellulolytic enzymes (endoglucanase, cellobiohydrolase and ß-glucosidase from a thermophilic bacterium,Clostridium thermocellumand their validation using Root Mean Square Deviation (RMSD and Ramachandran plot analyses. Further, the molecular interactions of the modeled enzyme with cellulose were analyzed using molecular docking technique. The results of molecular docking showed that the endoglucanase, cellobiohydrolase and ß-glucosidase had the binding affinities of -10.7, -9.0 and -10.8 kcal/mol, respectively. A correlation between the binding affinity of the endoglucanase with cellulose and the enzyme activity was also demonstrated. The results showed that the binding affinities of cellulases with cellulose could be used as a tool to assess the hydrolytic activity of cellulases. The results obtained could be used in virtual screening of cellulolytic enzymes based on the molecular interactions with the substrate, and aid in developing systems biology models of thermophiles for industrial biotechnology applications.

  11. A sediment extraction and cleanup method for wide-scope multitarget screening by liquid chromatography-high-resolution mass spectrometry.

    Science.gov (United States)

    Massei, Riccardo; Byers, Harry; Beckers, Liza-Marie; Prothmann, Jens; Brack, Werner; Schulze, Tobias; Krauss, Martin

    2018-01-01

    Previous studies on organic sediment contaminants focused mainly on a limited number of highly hydrophobic micropollutants accessible to gas chromatography using nonpolar, aprotic extraction solvents. The development of liquid chromatography-high-resolution mass spectrometry (LC-HRMS) permits the spectrum of analysis to be expanded to a wider range of more polar and ionic compounds present in sediments and allows target, suspect, and nontarget screening to be conducted with high sensitivity and selectivity. In this study, we propose a comprehensive multitarget extraction and sample preparation method for characterization of sediment pollution covering a broad range of physicochemical properties that is suitable for LC-HRMS screening analysis. We optimized pressurized liquid extraction, cleanup, and sample dilution for a target list of 310 compounds. Finally, the method was tested on sediment samples from a small river and its tributaries. The results show that the combination of 100 °C for ethyl acetate-acetone (50:50, neutral extract) followed by 80 °C for acetone-formic acid (100:1, acidic extract) and methanol-10 mM sodium tetraborate in water (90:10, basic extract) offered the best extraction recoveries for 287 of 310 compounds. At a spiking level of 1 μg mL -1 , we obtained satisfactory cleanup recoveries for the neutral extract-(93 ± 23)%-and for the combined acidic/basic extracts-(42 ± 16)%-after solvent exchange. Among the 69 compounds detected in environmental samples, we successfully quantified several pharmaceuticals and polar pesticides.

  12. Use of 15N dilution method for screening soybean lines with high yield and high nitrogen fixation ability

    International Nuclear Information System (INIS)

    Li Haixian; Li Xinmin; Danso, S.K.A.

    1998-01-01

    15 N dilution method was used for screening soybean lines with high nitrogen fixation ability. Screened lines 1005, 8502, 2096, 943, 1454 and Dongnong-42 have high nitrogen fixation ability with their % Ndfa of about 70%. 1454 and 1555 are both high yield and high nitrogen fixation lines. The ability of nitrogen fixation was not related to the yield, but related to maturing time. The cultivars with different maturing time have different levels of nitrogen fixation ability. The longer the maturing period is, the greater the ability of nitrogen fixation it has. There were ten cultivars or lines used in the test of 1992 and 1994. Although the weather condition were greatly different between the two years the results of seven cultivars or lines were the same, indicating that nitrogen fixation ability of the soybean is stable with years. Using 15 N dilution method to estimate nitrogen fixation ability of soybean is reliable, however, the % Ndfa of lines 8502 and 2096 increased by 19% in 1994, a rainy year, indicating that a change in % Ndfa with a few varieties maybe caused by weather

  13. In-vivo dosimetry - how hard could it be?

    International Nuclear Information System (INIS)

    Tremethick, L.J.

    1996-01-01

    for SSD, Field size, Wedges and Block trays were obtained for the 10 diodes at 6 and 18MV . The accuracy of entrance and exit dose calculation using the correction factors were tested in known geometry phantoms and all showed good agreement (<1%) with expected results. The majority of patient measurements resulted in doses with <5% deviation from the expected. The remainder that exceeded ICRU 50 recommendations were thoroughly investigated for the discrepancy. The project was found to be a useful tool for evaluation of all links in the dosimetry chain, including the accuracy of the treatment set-up. Although this project was extremely time consuming and labour intensive, techniques developed or refined may be of particular relevance in the near future with the introduction of true conformal therapy. Centres will then be faced with the task of validating dosimetry for which data based on watertank measurements using a stationary, rectangular beam, perpendicular to a homogeneous medium will be insufficient. In-vivo dosimetry offers an independent assessment of patient dose during treatment

  14. Screening of various low-grade biomass materials for low temperature gasification: Method development and application

    DEFF Research Database (Denmark)

    Thomsen, Tobias Pape; Ravenni, Giulia; Holm, Jens Kai

    2015-01-01

    method and the subsequent use of the method to identify promising e but currently unproven, low-grade biomass resources for conversion in Pyroneer systems. The technical assessment is conducted by comparing the results from a series of physical-mechanical and thermochemical experiments to a set of proven...

  15. Human in-vivo brain magnetic resonance current density imaging (MRCDI).

    Science.gov (United States)

    Göksu, Cihan; Hanson, Lars G; Siebner, Hartwig R; Ehses, Philipp; Scheffler, Klaus; Thielscher, Axel

    2018-05-01

    Magnetic resonance current density imaging (MRCDI) and MR electrical impedance tomography (MREIT) are two emerging modalities, which combine weak time-varying currents injected via surface electrodes with magnetic resonance imaging (MRI) to acquire information about the current flow and ohmic conductivity distribution at high spatial resolution. The injected current flow creates a magnetic field in the head, and the component of the induced magnetic field ΔB z,c parallel to the main scanner field causes small shifts in the precession frequency of the magnetization. The measured MRI signal is modulated by these shifts, allowing to determine ΔB z,c for the reconstruction of the current flow and ohmic conductivity. Here, we demonstrate reliable ΔB z,c measurements in-vivo in the human brain based on multi-echo spin echo (MESE) and steady-state free precession free induction decay (SSFP-FID) sequences. In a series of experiments, we optimize their robustness for in-vivo measurements while maintaining a good sensitivity to the current-induced fields. We validate both methods by assessing the linearity of the measured ΔB z,c with respect to the current strength. For the more efficient SSFP-FID measurements, we demonstrate a strong influence of magnetic stray fields on the ΔB z,c images, caused by non-ideal paths of the electrode cables, and validate a correction method. Finally, we perform measurements with two different current injection profiles in five subjects. We demonstrate reliable recordings of ΔB z,c fields as weak as 1 nT, caused by currents of 1 mA strength. Comparison of the ΔB z,c measurements with simulated ΔB z,c images based on FEM calculations and individualized head models reveals significant linear correlations in all subjects, but only for the stray field-corrected data. As final step, we reconstruct current density distributions from the measured and simulated ΔB z,c data. Reconstructions from non-corrected ΔB z,c measurements

  16. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  17. Raman spectroscopy as an effective screening method for detecting adulteration of milk with small nitrogen-rich molecules and sucrose.

    Science.gov (United States)

    Nieuwoudt, M K; Holroyd, S E; McGoverin, C M; Simpson, M C; Williams, D E

    2016-04-01

    Adulteration of milk for commercial gain is acknowledged as a serious issue facing the dairy industry. Several analytical techniques can be used to detect adulteration but they often require time-consuming sample preparation, expensive laboratory equipment, and highly skilled personnel. Here we show that Raman spectroscopy provides a simple, selective, and sensitive method for screening milk, specifically for small nitrogen-rich compounds, such as melamine, urea, ammonium sulfate, dicyandiamide, and for sucrose. Univariate and multivariate statistical methods were used to determine limits of detection and quantification from Raman spectra of milk spiked with 50 to 1,000 mg/L of the N-rich compounds and 0.25 to 4% sucrose. Partial least squares (PLS) calibration provided limit of detection minimum thresholds milk for these adulterants. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Shortened screening method for phosphorus fractionation in sediments A complementary approach to the standards, measurements and testing harmonised protocol

    International Nuclear Information System (INIS)

    Pardo, Patricia; Rauret, Gemma; Lopez-Sanchez, Jose Fermin

    2004-01-01

    The SMT protocol, a sediment phosphorus fractionation method harmonised and validated in the frame of the standards, measurements and testing (SMT) programme (European Commission), establishes five fractions of phosphorus according to their extractability. The determination of phosphate extracted is carried out spectrophotometrically. This protocol has been applied to 11 sediments of different origin and characteristics and the phosphorus extracted in each fraction was determined not only by UV-Vis spectrophotometry, but also by inductively coupled plasma-atomic emission spectrometry. The use of these two determination techniques allowed the differentiation between phosphorus that was present in the extracts as soluble reactive phosphorus and as total phosphorus. From the comparison of data obtained with both determination techniques a shortened screening method, for a quick evaluation of the magnitude and importance of the fractions given by the SMT protocol, is proposed and validated using two certified reference materials

  19. pd Scattering Using a Rigorous Coulomb Treatment. Reliability of the Renormalization Method for Screened-Coulomb Potentials

    Science.gov (United States)

    Hiratsuka, Y.; Oryu, S.; Gojuki, S.

    2011-05-01

    Reliability of the screened Coulomb renormalization method, which was proposed in an elegant way by Alt-Sandhas-Zankel-Ziegelmann (ASZZ), is discussed on the basis of "two-potential theory" for the three-body AGS equations with the Coulomb potential. In order to obtain ASZZ's formula, we define the on-shell Møller function, and calculate it by using the Haeringen criterion, i.e. "the half-shell Coulomb amplitude is zero". By these two steps, we can finally obtain the ASZZ formula for a small Coulomb phase shift. Furthermore, the reliability of the Haeringen criterion is thoroughly checked by a numerically rigorous calculation for the Coulomb LS-type equation. We find that the Haeringen criterion can be satisfied only in the higher energy region. We conclude that the ASZZ method can be verified in the case that the on-shell approximation to the Møller function is reasonable, and the Haeringen criterion is reliable.

  20. pd Scattering Using a Rigorous Coulomb Treatment: Reliability of the Renormalization Method for Screened-Coulomb Potentials

    International Nuclear Information System (INIS)

    Hiratsuka, Y.; Oryu, S.; Gojuki, S.

    2011-01-01

    Reliability of the screened Coulomb renormalization method, which was proposed in an elegant way by Alt-Sandhas-Zankel-Ziegelmann (ASZZ), is discussed on the basis of 'two-potential theory' for the three-body AGS equations with the Coulomb potential. In order to obtain ASZZ's formula, we define the on-shell Moller function, and calculate it by using the Haeringen criterion, i. e. 'the half-shell Coulomb amplitude is zero'. By these two steps, we can finally obtain the ASZZ formula for a small Coulomb phase shift. Furthermore, the reliability of the Haeringen criterion is thoroughly checked by a numerically rigorous calculation for the Coulomb LS-type equation. We find that the Haeringen criterion can be satisfied only in the higher energy region. We conclude that the ASZZ method can be verified in the case that the on-shell approximation to the Moller function is reasonable, and the Haeringen criterion is reliable. (author)

  1. Evaluating user preferences for video transfer methods from a mobile device to a TV screen

    DEFF Research Database (Denmark)

    Fleury, Alexandre; Pedersen, Jakob Schou; Larsen, Lars Bo

    2013-01-01

    This article reports on the evaluation of four methods for transferring video content from a mobile device to a fixed television. The methods have been investigated in a Wizard-of-Oz approach through two consecutive studies. The first experiment aimed at collecting general opinions toward...... and investigated in a second experiment. The results indicate that familiarity, convenience and annoyance are strong predictors of the preference level of methods for transferring video content from a mobile to a fixed device. A discussion and potential design guidelines are finally proposed....

  2. In-vivo evaluation of clindamycin release from glyceryl monooleate-alginate microspheres by NIR spectroscopy.

    Science.gov (United States)

    Mohamed, Amir Ibrahim; Ahmed, Osama A A; Amin, Suzan; Elkadi, Omar Anwar; Kassem, Mohamed A

    2015-10-15

    The purpose of this study was to use near-infrared (NIR) transmission spectroscopic technique to determine clindamycin plasma concentration after oral administration of clindamycin loaded GMO-alginate microspheres using rabbits as animal models. Lyophilized clindamycin-plasma standard samples at a concentration range of 0.001-10 μg/ml were prepared and analyzed by NIR and HPLC as a reference method. NIR calibration model was developed with partial least square (PLS) regression analysis. Then, a single dose in-vivo evaluation was carried out and clindamycin-plasma concentration was estimated by NIR. Over 24 h time period, the pharmacokinetic parameters of clindamycin were calculated for the clindamycin loaded GMO-alginate microspheres (F3) and alginate microspheres (F2), and compared with the plain drug (F1). PLS calibration model with 7-principal components (PC), and 8000-9200 cm(-1) spectral range shows a good correlation between HPLC and NIR values with root mean square error of cross validation (RMSECV), root mean square error of prediction (RMSEP), and calibration coefficient (R(2)) values of 0.245, 1.164, and 0.9753, respectively, which suggests that NIR transmission technique can be used for drug-plasma analysis without any extraction procedure. F3 microspheres exhibited controlled and prolonged absorption Tmax of 4.0 vs. 1.0 and 0.5 h; Cmax of 2.37±0.3 vs. 3.81±0.8 and 5.43±0.7 μg/ml for F2 and F1, respectively. These results suggest that the combination of GMO and alginate (1:4 w/w) could be successfully employed for once daily clindamycin microspheres formulation which confirmed by low Cmax and high Tmax values. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. [Evaluation of potential risks of abrasive water jet osteotomy in-vivo].

    Science.gov (United States)

    Kuhlmann, C; Pude, F; Bishup, C; Krömer, S; Kirsch, L; Andreae, A; Wacker, K; Schmolke, S

    2005-10-01

    Since the 80's the water jet scalpel is an established tool in some surgical fields. It is used in particular in visceral surgery for preparation of parenchymatous organs. By the addition of biocompatible abrasives, this technique is able to effectively machine hard biological tissues. Free defined cutting geometries can be realised in a non contact process. Therewith this method has crucial advantages compared to conventional osteotomy techniques and gives new impulses to the development in endoprosthetics and correction osteotomies of hollow bones. In the presented work the new developed abrasive water injection jet (AWIJ) was used the first time for in-vivo osteotomies. Aim of this study was the detection of potential thrombembolic effects and wash in effects of the cutting fluid. Hollow bones of the fore and hind leg of 20 house pigs were treated with the new cutting technique. Intraoperative documentation of relevant vital parameters was performed by a multi monitoring system. Thrombembolic effects during the osteotomy were detected by transthoracic Doppler ultrasonography and transesophagale echocardiography. The hollow bones were prepared in consideration of the vascularisation's protection especially in respect to the venous flow. Thrombembolic effects with temporary haemodynamic respectively respiratory consequences could be detected exclusively by using the so called "3-component jet", which consists of 90 vol % of air. The usage of an abrasive suspension enables the airfree dosing of dry soluable abrasives. Thrombembolic effects could not be monitored in this case. Intramedullary fluid in-wash effects as well as resulting electrolytic disorders could not be proven. For abrasive waterjet osteotomies with 3 component jet a relevant risk of thrombembolic effects could be shown. This knowledge has also to be considered for abdominal and neurosurgical applications in the future. Due to the usage of an abrasive suspension this risk can fully be avoided.

  4. A new screening method to detect proximal dental caries using fluorescence imaging.

    Science.gov (United States)

    Kim, Eun-Soo; Lee, Eun-Song; Kang, Si-Mook; Jung, Eun-Ha; de Josselin de Jong, Elbert; Jung, Hoi-In; Kim, Baek-Il

    2017-12-01

    This study aimed to assess the screening performance of the quantitative light-induced fluorescence (QLF) technology to detect proximal caries using both fluorescence loss and red fluorescence in a clinical situation. Moreover, a new simplified QLF score for the proximal caries (QS-Proximal) is proposed and its validity for detecting proximal caries was evaluated as well. This clinical study included 280 proximal surfaces, which were assessed by visual-tactile and radiographic examinations and scored by each scoring system according to lesion severity. The occlusal QLF images were analysed in two different ways: (1) a quantitative analysis producing fluorescence loss (ΔF) and red fluorescence (ΔR) parameters; and (2) a new QLF scoring index. For both quantitative parameters and QS-Proximal, the sensitivity, specificity, and area under the receiver operating characteristic curve (AUROC) were calculated as a function of the radiographic scoring index at the enamel and dentine caries levels. Both ΔF and ΔR showed excellent AUROC values at the dentine caries level (ΔF=0.860, ΔR=0.902) whereas a relatively lower value was observed at the enamel caries level (ΔF=0.655, ΔR=0.686). The QS-Proximal also showed excellent AUROC ranged from 0.826 to 0.864 for detecting proximal caries at the dentine level. The QS-Proximal, which represents fluorescence changes, showed excellent performance in detecting proximal caries using the radiographic score as the gold standard. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Meta-analysis of two computer-assisted screening methods for diagnosing oral precancer and cancer.

    Science.gov (United States)

    Ye, Xiaojing; Zhang, Jing; Tan, Yaqin; Chen, Guanying; Zhou, Gang

    2015-11-01

    The early diagnosis of oral precancer and cancer is crucial and could have the highest impact on improving survival rates. A meta-analysis was conducted to compare the accuracy between the OralCDx brush biopsy and DNA-image cytometry in diagnosing both conditions. Bibliographic databases were systematically searched for original relevant studies on the early diagnosis of oral precancer and oral cancer. Study characteristics were evaluated to determine the accuracy of the two screening strategies. Thirteen studies (eight of OralCDx brush biopsy and five of DNA-image cytometry) were identified as having reported on 1981 oral mucosa lesions. The meta-analysis found that the area under the summary receiver operating characteristic curves of the OralCDx brush biopsy and DNA-image cytometry were 0.8879 and 0.9885, respectively. The pooled sensitivity, specificity, and diagnostic odds ratio of the OralCDx brush biopsy were 86% (95% CI 81-90), 81% (95% CI 78-85), and 20.36 (95% CI 2.72-152.67), respectively, while these modalities of DNA-image cytometry were 89% (95% CI 83-94), 99% (95% CI 97-100), and 446.08 (95% CI 73.36-2712.43), respectively. Results of a pairwise comparison between each modality demonstrated that specificity, area under the curve (AUC), and Q(∗) index of DNA-image cytometry was significantly higher than that of the OralCDx brush biopsy (Z=2.821, p0.05). In conclusion, the meta-analysis of the published studies indicated that DNA-image cytometry is more accurate than the OralCDx brush biopsy in diagnosing oral precancer and oral cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. [Spirometry as method of screening and intervention in high- risk smokers in primary care].

    Science.gov (United States)

    Clotet, Joan; Real, Jordi; Lorente, Iñigo; Fuentes, Araceli; Paredes, Eugeni; Ciria, Carmen

    2012-06-01

    To show the effectiveness of screening in the detection of new cases of COPD in smokers of high-risk, and to describe the characteristics associated with COPD, as well as determine the predisposition to quit. A cross-sectional and multicentre study. Basic Primary Care Centres representing different rural and urban areas of Lleida. A total of 497 active smokers without COPD from 40 to 70 years selected from the database Primary Care Database (e-CAP). Spirometry was performed on all patients. The spirometry results were reported and brief counselling was given on quitting smoking and the readiness to stop smoking was determined. Age, gender, height, weight, smoking, respiratory symptoms and physical activity. The majority of patients (65.4%) were men, age 51± 7.6 years. They smoked an average of 32 packs/year; 40.4% performed moderate activity and 27.4% referred to some respiratory symptoms. Of the 25% who had an obstructive or mixed pattern, 75.8% of the cases had a moderate level of severity. A decision to quit was made by 38.8%. In the multivariate analysis, gender, age 50 to 59 years and a smoking index>40 were associated with COPD. Moderate or intense physical activity decreased the risk of COPD. To perform spirometry in high-risk smokers, to show the spirometry results and give brief anti-smoking counselling, enables not previously diagnosed cases of COPD to be detected. It also helps to determine the readiness to stop smoking and to establish individualised treatment and follow-up plans. Copyright © 2011 Elsevier España, S.L. All rights reserved.

  7. Comparison of DNA extraction methods from small samples of newborn screening cards suitable for retrospective perinatal viral research.

    Science.gov (United States)

    McMichael, Gai L; Highet, Amanda R; Gibson, Catherine S; Goldwater, Paul N; O'Callaghan, Michael E; Alvino, Emily R; MacLennan, Alastair H

    2011-04-01

    Reliable detection of viral DNA in stored newborn screening cards (NSC) would give important insight into possible silent infection during pregnancy and around birth. We sought a DNA extraction method with sufficient sensitivity to detect low copy numbers of viral DNA from small punch samples of NSC. Blank NSC were spotted with seronegative EDTA-blood and seropositive EBV EDTA-blood. DNA was extracted with commercial and noncommercial DNA extraction methods and quantified on a spectrofluorometer using a PicoGreen dsDNA quantification kit. Serial dilutions of purified viral DNA controls determined the sensitivity of the amplification protocol, and seropositive EBV EDTA-blood amplified by nested PCR (nPCR) validated the DNA extraction methods. There were considerable differences between the commercial and noncommercial DNA extraction methods (P=0.014; P=0.016). Commercial kits compared favorably, but the QIamp DNA micro kit with an added forensic filter step was marginally more sensitive. The mean DNA yield from this method was 3 ng/μl. The limit of detection was 10 viral genome copies in a 50-μl reaction. EBV nPCR detection in neat and 1:10 diluted DNA extracts could be replicated reliably. We conclude that the QIamp Micro DNA extraction method with the added forensic spin-filter step was suitable for retrospective DNA viral assays from NSC.

  8. Validity of screening methods for periodontitis using salivary hemoglobin level and self-report questionnaires in people with disabilities.

    Science.gov (United States)

    Nam, Sun-Hei; Jung, Hoi-In; Kang, Si-Mook; Inaba, Daisuke; Kwon, Ho-Keun; Kim, Baek-Il

    2015-04-01

    The aim of this study is to evaluate the validity of screening methods in predicting periodontitis in people with disabilities using the objective salivary hemoglobin level, a subjective self-report questionnaire, and a combined model of the two methods with demographic characteristics. The participants were 195 patients with disabilities aged >18 years who were examined using the community periodontal index (CPI), salivary hemoglobin level, and answers to 10 self-report questions (n = 192). Multivariable logistic regression and receiver operating characteristic (ROC) curve analysis were performed to evaluate the validity of the methods and the combined model in predicting the prevalence of ≥CPI 3 (probing depth [PD] ≥4 mm) or CPI 4 (PD ≥6 mm). Overall, 75.9% of the study group (148 of 195) were diagnosed with ≥CPI 3, and 38.5% of the study group (75 of 195) were diagnosed with CPI 4. The areas under the ROC curve (AUCs) of the salivary hemoglobin level were 0.578 (sensitivity of 41% and specificity of 77%) and 0.662 (sensitivity of 53% and specificity of 75%) for predicting the prevalence of ≥CPI 3 and CPI 4, respectively. Multivariable modeling incorporating four different questions for predicting ≥CPI 3 or CPI 4 indicated higher AUCs of 0.710 and 0.732, respectively, yielding higher sensitivity (55% for ≥CPI 3 and 69% for CPI 4) than that of salivary hemoglobin level. The most useful prediction models for ≥CPI 3 or CPI 4 were combined models, which yielded AUCs of 0.773 and 0.807, respectively, with sensitivity values of 70% and specificity values >75%. The salivary hemoglobin level, self-report questionnaire, and the combined method demonstrated screening potential that could predict the population prevalence of ≥CPI 3 or CPI 4.

  9. Top Quantile of Environmental Screening Methods, San Joaquin Valley CA, 2013, Occidental College of Los Angeles

    Data.gov (United States)

    U.S. Environmental Protection Agency — This layer combines the Top quantiles of the CES, CEVA, and EJSM layers so that viewers can see the overlap of â??hot spotsâ?? for each method. This layer was...

  10. Imaging of prostate cancer: a platform for 3D co-registration of in-vivo MRI ex-vivo MRI and pathology

    Science.gov (United States)

    Orczyk, Clément; Mikheev, Artem; Rosenkrantz, Andrew; Melamed, Jonathan; Taneja, Samir S.; Rusinek, Henry

    2012-02-01

    Objectives: Multi-parametric MRI is emerging as a promising method for prostate cancer diagnosis. prognosis and treatment planning. However, the localization of in-vivo detected lesions and pathologic sites of cancer remains a significant challenge. To overcome this limitation we have developed and tested a system for co-registration of in-vivo MRI, ex-vivo MRI and histology. Materials and Methods: Three men diagnosed with localized prostate cancer (ages 54-72, PSA levels 5.1-7.7 ng/ml) were prospectively enrolled in this study. All patients underwent 3T multi-parametric MRI that included T2W, DCEMRI, and DWI prior to robotic-assisted prostatectomy. Ex-vivo multi-parametric MRI was performed on fresh prostate specimen. Excised prostates were then sliced at regular intervals and photographed both before and after fixation. Slices were perpendicular to the main axis of the posterior capsule, i.e., along the direction of the rectal wall. Guided by the location of the urethra, 2D digital images were assembled into 3D models. Cancer foci, extra-capsular extensions and zonal margins were delineated by the pathologist and included in 3D histology data. A locally-developed software was applied to register in-vivo, ex-vivo and histology using an over-determined set of anatomical landmarks placed in anterior fibro-muscular stroma, central. transition and peripheral zones. The mean root square distance across corresponding control points was used to assess co-registration error. Results: Two specimens were pT3a and one pT2b (negative margin) at pathology. The software successfully fused invivo MRI. ex-vivo MRI fresh specimen and histology using appropriate (rigid and affine) transformation models with mean square error of 1.59 mm. Coregistration accuracy was confirmed by multi-modality viewing using operator-guided variable transparency. Conclusion: The method enables successful co-registration of pre-operative MRI, ex-vivo MRI and pathology and it provides initial evidence

  11. Prediction of Phase Behavior of Spray-Dried Amorphous Solid Dispersions: Assessment of Thermodynamic Models, Standard Screening Methods and a Novel Atomization Screening Device with Regard to Prediction Accuracy

    Directory of Open Access Journals (Sweden)

    Aymeric Ousset

    2018-03-01

    Full Text Available The evaluation of drug–polymer miscibility in the early phase of drug development is essential to ensure successful amorphous solid dispersion (ASD manufacturing. This work investigates the comparison of thermodynamic models, conventional experimental screening methods (solvent casting, quench cooling, and a novel atomization screening device based on their ability to predict drug–polymer miscibility, solid state properties (Tg value and width, and adequate polymer selection during the development of spray-dried amorphous solid dispersions (SDASDs. Binary ASDs of four drugs and seven polymers were produced at 20:80, 40:60, 60:40, and 80:20 (w/w. Samples were systematically analyzed using modulated differential scanning calorimetry (mDSC and X-ray powder diffraction (XRPD. Principal component analysis (PCA was used to qualitatively assess the predictability of screening methods with regards to SDASD development. Poor correlation was found between theoretical models and experimentally-obtained results. Additionally, the limited ability of usual screening methods to predict the miscibility of SDASDs did not guarantee the appropriate selection of lead excipient for the manufacturing of robust SDASDs. Contrary to standard approaches, our novel screening device allowed the selection of optimal polymer and drug loading and established insight into the final properties and performance of SDASDs at an early stage, therefore enabling the optimization of the scaled-up late-stage development.

  12. Prediction of Phase Behavior of Spray-Dried Amorphous Solid Dispersions: Assessment of Thermodynamic Models, Standard Screening Methods and a Novel Atomization Screening Device with Regard to Prediction Accuracy.

    Science.gov (United States)

    Ousset, Aymeric; Chavez, Pierre-François; Meeus, Joke; Robin, Florent; Schubert, Martin Alexander; Somville, Pascal; Dodou, Kalliopi

    2018-03-07

    The evaluation of drug-polymer miscibility in the early phase of drug development is essential to ensure successful amorphous solid dispersion (ASD) manufacturing. This work investigates the comparison of thermodynamic models, conventional experimental screening methods (solvent casting, quench cooling), and a novel atomization screening device based on their ability to predict drug-polymer miscibility, solid state properties ( T g value and width), and adequate polymer selection during the development of spray-dried amorphous solid dispersions (SDASDs). Binary ASDs of four drugs and seven polymers were produced at 20:80, 40:60, 60:40, and 80:20 ( w / w ). Samples were systematically analyzed using modulated differential scanning calorimetry (mDSC) and X-ray powder diffraction (XRPD). Principal component analysis (PCA) was used to qualitatively assess the predictability of screening methods with regards to SDASD development. Poor correlation was found between theoretical models and experimentally-obtained results. Additionally, the limited ability of usual screening methods to predict the miscibility of SDASDs did not guarantee the appropriate selection of lead excipient for the manufacturing of robust SDASDs. Contrary to standard approaches, our novel screening device allowed the selection of optimal polymer and drug loading and established insight into the final properties and performance of SDASDs at an early stage, therefore enabling the optimization of the scaled-up late-stage development.

  13. An integrated miRNA functional screening and target validation method for organ morphogenesis

    OpenAIRE

    Rebustini, Ivan T.; Vlahos, Maryann; Packer, Trevor; Kukuruzinska, Maria A.; Maas, Richard L.

    2016-01-01

    The relative ease of identifying microRNAs and their increasing recognition as important regulators of organogenesis motivate the development of methods to efficiently assess microRNA function during organ morphogenesis. In this context, embryonic organ explants provide a reliable and reproducible system that recapitulates some of the important early morphogenetic processes during organ development. Here we present a method to target microRNA function in explanted mouse embryonic organs. Our ...

  14. Supplementary Material for: DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-01-01

    Abstract Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemannâ Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between

  15. Simulation studies for the in-vivo dose verification of particle therapy

    International Nuclear Information System (INIS)

    Rohling, Heide

    2015-01-01

    An increasing number of cancer patients is treated with proton beams or other light ion beams which allow to deliver dose precisely to the tumor. However, the depth dose distribution of these particles, which enables this precision, is sensitive to deviations from the treatment plan, as e.g. anatomical changes. Thus, to assure the quality of the treatment, a non-invasive in-vivo dose verification is highly desired. This monitoring of particle therapy relies on the detection of secondary radiation which is produced by interactions between the beam particles and the nuclei of the patient's tissue. Up to now, the only clinically applied method for in-vivo dosimetry is Positron Emission Tomography which makes use of the β + -activity produced during the irradiation (PT-PET). Since from a PT-PET measurement the applied dose cannot be directly deduced, the simulated distribution of β + -emitting nuclei is used as a basis for the analysis of the measured PT-PET data. Therefore, the reliable modeling of the production rates and the spatial distribution of the β + -emitters is required. PT-PET applied during instead of after the treatment is referred to as in-beam PET. A challenge concerning in-beam PET is the design of the PET camera, because a standard full-ring scanner is not feasible. Thus, for in-beam PET and PGI dedicated detection systems and, moreover, profound knowledge about the corresponding radiation fields are required. Using various simulation codes, this thesis contributes to the modelling of the β + -emitters and photons produced during particle irradiation, as well as to the evaluation and optimization of hardware for both techniques. Concerning the modeling of the production of the relevant β + -emitters, the abilities of the Monte Carlo simulation code PHITS and of the deterministic, one-dimensional code HIBRAC were assessed. HIBRAC was substantially extended to enable the modeling of the depth-dependent yields of specific nuclides. For proton

  16. Screening methods for the development of air-toxics emission factors

    International Nuclear Information System (INIS)

    Bursey, J.T.

    1991-09-01

    Under the program the literature has been surveyed to determine the applicability of existing methodology. The primary goal was to use methodology applicable to the largest number of analytes listed in the Clean Air Act Amendments with the full realization that a broad coverage by a methodology may require some sacrifice of sensitivity and accuracy. The need for validation of proposed methodologies has been recognized. Assignments of analytes to a specific methodology have been made on the basis of previous validation studies and/or physical properties (available physical properties for the chemicals of the Clean Air Act list are supplied in an appendix). The range of applicability of a given sampling or analytical method, when available, is included as a part of the method description. Tables are included which summarize the potentially applicable sampling and analytical methods for chemicals listed in the Clean Air Act Amendments. General information on cost for the sampling and analysis procedures is presented

  17. A screening method for detection of hexavalent chromium levels in soils

    Directory of Open Access Journals (Sweden)

    Débora V Franco

    2011-01-01

    Full Text Available A rapid and low cost method to determine Cr(VI in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

  18. Direct microscopical versus cultural method in screening for candidiasis among non gravid nigerian women.

    Science.gov (United States)

    Elegbe, I A; Botu, M

    1982-09-17

    The incidence of candidiasis in 125 symptomless, non-gravid women in Ile-Ife State Hospital, Ile-Ife, Oyo-State of Nigeria was determined by either microscopic observation or cultural methods. Among the three techniques investigated, the cultural method had the highest recovery rate with 60% of the cultures from 125 patients positive. Statistical analysis of the data (X2) demonstrated a significant difference between the recovery rates at the P less than 0.01 level. The implications of these findings were discussed in the text.

  19. A novel method of dental panoramic tomogram analysis: a perspective tool for a screening test for osteoporosis.

    Science.gov (United States)

    Božič, Marko; Ihan Hren, Nataša

    2013-12-01

    The purpose of this study was to test a new method of dental panoramic tomogram (DPT) analysis to show the differences of mandibular bone volume and relative bone density (RBD) in order to detect osteoporosis. A case-control study compared 62 women with osteoporosis (O) and 24 women with osteopenia (o) to a control group of 33 women with normal bone mineral density (N). DPTs were analyzed using an original method resulting in anatomic and RBD indexes as well as using previously described methods: panoramic mandibular index (PMI) and mandibular cortical width (MCW). One anatomic and four RBD indexes differed statistically significantly between the group O and N and three RBD indexes differed statistically significantly between o and N. PMI did not show statistically significant differences between the groups. The MCW differed significantly at two measured sites between O and N. Average values of RBD indexes were statistically significantly different between O and N and also between o and N. Important differences regarding RBD were confirmed using a new and original method of common DPT analysis. This method could serve as a screening tool for osteoporosis. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  20. Dansyl chloride derivatization of methamphetamine: a method with advantages for screening and analysis of methamphetamine in urine.

    Science.gov (United States)

    Yamada, Hideyuki; Yamahara, Ayako; Yasuda, Satsuki; Abe, Masamiki; Oguri, Kazuta; Fukushima, Sunao; Ikeda-Wada, Sachiko

    2002-01-01

    The screening and quantitation of methamphetamine (MP) in urine using dansyl chloride (DNC) as the derivatization reagent were studied. Urinary MP derivatized with DNC could be detected by visual observation of the fluorescence in a solid-phase extraction column such as a Sep-Pak C18 cartridge to which the whole reaction solution was applied. The DNC-derivatized MP was eluted from the cartridge and then identified and quantitated by gas chromatography-mass spectrometry (GC-MS) and high-performance liquid chromatography (HPLC). In the GC-MS analysis with the MS detector in the electron-impact mode, DNC-derivatized MP and amphetamine (AP), exhibited diagnostic molecular ion peaks. The intensities of the molecular ions were 15% (DNC-MP) and 35% (DNC-AP) of the base peak (a fragment ion because of the loss of dimethylnaphthalene from M+), demonstrating that this method of derivatization has a major advantage for confirming APs by GC-MS. MP derivatized with DNC could be determined by HPLC with ultraviolet detection. Because a good correlation (r = 0.95) between the GC-MS and HPLC method for urinary MP was confirmed, both HPLC and GC-MS appear to be useful tools for determining urinary MP. The intensity of the cartridge fluorescence due to DNC-derivatized MP was approximately related to the urinary content of MP determined by HPLC or GC-MS, although a false positive in the visual fluorescence was observed in some urinary specimens from healthy volunteers. From these results, screening and confirmation/determination following DNC derivatization is proposed as a suitable method for the analysis of MP.

  1. Vulnerable Elderly Survey 13 as a screening method for frailty in Polish elderly surgical patient--prospective study.

    Science.gov (United States)

    Kenig, Jakub; Richter, Piotr; Zychiewicz, Beata; Olszewska, Urszula

    2014-03-01

    The Vulnerable Elders Survey (VES-13) is a simple function based frailty screening tool that can be also administered by the nonclinical personnel within 5 minutes and has been validated in the out- and in patient clinic and acute medical care settings. The aim of the study was to validate the accuracy of the VES-13 screening method for predicting the frailty syndrome based on a CGA in polish surgical patients. We included prospectively 106 consecutive patients ≥65, that qualify for abdominal surgery (both due to oncological and benign reasons), at the tertiary referral hospital.We evaluated the diagnostic performance of VES-13 score comparing to the results from the CGA, accepted as the gold standard for identifying at risk frail elderly patients. The prevalence of frailty as diagnosed by CGA was 59.4%. There was significantly higher number of frail patients in the oncological group (78% vs. 31%; ppatients cannot replace the comprehensive geriatric assessment; this is due to the insufficient discriminative power to select patients for further assessment. It might be helpful in a busy clinical practice and in facilities that do not have trained personal for geriatric assessment.

  2. Modified Cervicography and Visual Inspection With Acetic Acid as an Alternative Screening Method for Cervical Precancerous Lesions.

    Science.gov (United States)

    Purwoto, Gatot; Dianika, Hasra Depiesa; Putra, Andre; Purbadi, Sigit; Nuranna, Laila

    2017-12-01

    We compared the diagnostic accuracy between visual inspection with acetic acid (VIA) and modified cervicography as an alternative screening method for cervical precancerous lesions. A diagnostic cross-sectional study was performed at the outpatient clinic at an Indonesian national referral hospital from February until April 2015. We collected samples from patients who sequentially underwent VIA examination, modified cervicography, and colposcopy. A total of 185 patients were included in this study. Modified cervicography showed positive results in 7.6% of patients, while 7.0% of patients had a VIA positive result. This is compared to 5.4% of patients showing abnormal colposcopy results. From those results, we obtained that sensitivity and specificity of VIA were 96.0% and 90.9%. Meanwhile, sensitivity and specificity of modified cervicography were 97.7% and 90.9%, respectively, compared to colposcopy as a gold standard. Modified cervicography and VIA are reliable tools for cervical cancer screening, with comparable sensitivity and specificity. Modified cervicography can be used as a supplementary tool to improve the documentation of VIA and as an alternative to VIA alone.

  3. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  4. A double-screening method to identify reliable candidate non-synonymous SNPs from chicken EST data.

    Science.gov (United States)

    Kim, H; Schmidt, C J; Decker, K S; Emara, M G

    2003-08-01

    Discovery of non-synonymous single nucleotide polymorphisms (nsSNP), which cause amino acid substitutions, is important because they are more likely to alter protein function than synonymous SNPs (sSNP) or those SNPs that do not result in amino acid changes. By changing the coding sequences, nsSNP may play a role in heritable differences between individual organisms. In the chicken and many other vertebrates, the main obstacle for identifying nsSNP is that there is insufficient protein and mRNA sequence information for self-species referencing and thus, determination of the correct reading frame for expressed sequence tags (ESTs) is difficult. Therefore, in order to estimate the correct reading frame at nsSNP in chicken ESTs, a double-screening approach was designed using self- or cross-species protein referencing, in addition to the ESTScan coding region estimation programme. Starting with 23 427 chicken ESTs, 1210 potential SNPs were discovered using a phred/phrap/polyphred/consed pipeline process and among these, 108 candidate nsSNP were identified with the double screening method. A searchable SNP database (chicksnps) for the candidate chicken SNPs, including both nsSNPs and sSNPs is available at http://chicksnps.afs.udel.edu. The chicken SNP data described in this paper have been submitted to the data base SNP under National Center for Biotechnology Information assay ID ss4387050-ss4388259.

  5. An Efficient Implementation of the Nwat-MMGBSA Method to Rescore Docking Results in Medium-Throughput Virtual Screenings

    Directory of Open Access Journals (Sweden)

    Irene Maffucci

    2018-03-01

    Full Text Available Nwat-MMGBSA is a variant of MM-PB/GBSA based on the inclusion of a number of explicit water molecules that are the closest to the ligand in each frame of a molecular dynamics trajectory. This method demonstrated improved correlations between calculated and experimental binding energies in both protein-protein interactions and ligand-receptor complexes, in comparison to the standard MM-GBSA. A protocol optimization, aimed to maximize efficacy and efficiency, is discussed here considering penicillopepsin, HIV1-protease, and BCL-XL as test cases. Calculations were performed in triplicates on both classic HPC environments and on standard workstations equipped by a GPU card, evidencing no statistical differences in the results. No relevant differences in correlation to experiments were also observed when performing Nwat-MMGBSA calculations on 4 or 1 ns long trajectories. A fully automatic workflow for structure-based virtual screening, performing from library set-up to docking and Nwat-MMGBSA rescoring, has then been developed. The protocol has been tested against no rescoring or standard MM-GBSA rescoring within a retrospective virtual screening of inhibitors of AmpC β-lactamase and of the Rac1-Tiam1 protein-protein interaction. In both cases, Nwat-MMGBSA rescoring provided a statistically significant increase in the ROC AUCs of between 20 and 30%, compared to docking scoring or to standard MM-GBSA rescoring.

  6. Improving Patient-Centered Care for Young People in General Practice With a Codesigned Screening App: Mixed Methods Study.

    Science.gov (United States)

    Webb, Marianne Julie; Wadley, Greg; Sanci, Lena Amanda

    2017-08-11

    Despite experiencing a high prevalence and co-occurrence of mental health disorders and health-compromising behaviors, young people tend not to seek professional help for these concerns. However, they do regularly attend primary care, making primary care providers ideally situated to identify and discuss mental health and lifestyle issues as part of young people's routine health care. The aim was to investigate whether using a codesigned health and lifestyle-screening app, Check Up GP, in general practice influenced young people's assessment of the quality of their care (measures of patient-centered care and youth friendliness), and their disclosure of sensitive issues. In addition, this study aimed to explore young people's acceptance and experience of using a screening app during regular health care. This was a mixed methods implementation study of Check Up GP with young people aged 14 to 25 years attending a general practice clinic in urban Melbourne, Australia. A 1-month treatment-as-usual group was compared to a 2-month intervention group in which young people and their general practitioners (GPs) used Check Up GP. Young people in both groups completed an exit survey immediately after their consultation about disclosure, patient-centered and youth-friendly care, and judgment. In addition, participants in the intervention group were surveyed about app acceptability and usability and their willingness to use it again. Semistructured interviews with participants in the intervention group expanded on themes covered in the survey. The exit survey was completed by 30 young people in the treatment-as-usual group and 85 young people in the intervention group. Young people using Check Up GP reported greater disclosure of health issues (Papp was a "good idea" and only 1% (1/85) thought it a "bad idea." Thematic analysis of qualitative interviews with 14 participants found that Check Up GP created scope to address unmet health needs and increased sense of preparedness

  7. A novel method “CHROMagar” for screening vancomycin-resistant ...

    African Journals Online (AJOL)

    Infection with vancomycin-resistant enterococci (VRE) is reported to be increasing and becoming a problem especially in health care systems with prolonged survival in the environment. In this study, we compared the performance characteristics of CHROMagar with conventional methods for detection of VRE in clinical ...

  8. Screening for microplastics in sediment, water, marine invertebrates and fish: method development and microplastic accumulation

    NARCIS (Netherlands)

    Karlsson, Therese; Vethaak, A.D.; Carney Almroth, Bethany; Ariese, Freek; van Velzen, M.J.M.; Hassellöv, Martin; Leslie, H.A.

    2017-01-01

    Measurements of microplastics in biota and abiotic matrices are key elements of exposure and risk assessments for this emerging environmental pollutant. We investigated the abundance of microplastics in field-collected biota, sediment and water. An improved sediment extraction method, based on

  9. Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops.

    Science.gov (United States)

    Olšovská, J; Kameník, Z; Čejka, P; Jurková, M; Mikyška, A

    2013-11-15

    Hops represent an important natural source of bioactive polyphenols, particularly proanthocyanidins, which can contribute to prevention of several civilization diseases, owing to their antioxidant and radical scavenging activity. We have developed a high-throughput ultra-high-performance liquid chromatography time-of-flight mass spectrometry profiling method, which can be used for monitoring of bioactive proanthocyanidins in hops. The method was applied for analysis of hops of four Czech varieties (Saaz, Sladek, Preminat and Agnus) from the 2011 crop (9 localities, 11 samples) and the 2012 crop (24 localities, 40 samples). Hop samples were extracted by acetone and the analytes were separated on the Acquity UPLC BEH Shield RP18 column. Partial validation of the method revealed a satisfactory intra-day repeatability of the method for retention times (relative standard deviation within 1.39%) as well as areas under the peaks (within 9.89%). Experimental data were evaluated using principal component analysis and cluster analysis. Significant amounts of di-, tri- and tetramer proanthocyanidins consisting of (epi)catechin and (epi)gallocatechin were found in the hop samples. The dependence of the proantocyanidin composition on both the variety and the growing locality was observed. Specifically, the traditional Saaz variety contained more frequently oligomers formed by (epi)catechin units only, whereas the varieties Premiant and Agnus produced oligomers consisting of (epi)catechin as well as (epi)gallocatechin units. The relative abundance of proanthocyanidins in studied hop varieties from the two crops, 2011 and 2012, did correspond to each other. In the further perspective, the method may also be used for prediction of qualitative marks or authenticity verification of hops. © 2013 Elsevier B.V. All rights reserved.

  10. A note on the catch-up time method for estimating lead or sojourn time in prostate cancer screening

    NARCIS (Netherlands)

    G. Draisma (Gerrit); J.M. van Rosmalen (Joost)

    2013-01-01

    textabstractModels of cancer screening assume that cancers are detectable by screening before being diagnosed clinically through symptoms. The duration of this preclinical phase is called sojourn time, and it determines how much diagnosis might be advanced in time by the screening test (lead time).

  11. Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening

    Directory of Open Access Journals (Sweden)

    Robson L. F. Amaral

    2017-08-01

    Full Text Available Introduction: Cell-based assays using three-dimensional (3D cell cultures may reflect the antitumor activity of compounds more accurately, since these models reproduce the tumor microenvironment better.Methods: Here, we report a comparative analysis of cell behavior in the two most widely employed methods for 3D spheroid culture, forced floating (Ultra-low Attachment, ULA, plates, and hanging drop (HD methods, using the RT4 human bladder cancer cell line as a model. The morphology parameters and growth/metabolism of the spheroids generated were first characterized, using four different cell-seeding concentrations (0.5, 1.25, 2.5, and 3.75 × 104 cells/mL, and then, subjected to drug resistance evaluation.Results: Both methods generated spheroids with a smooth surface and round shape in a spheroidization time of about 48 h, regardless of the cell-seeding concentration used. Reduced cell growth and metabolism was observed in 3D cultures compared to two-dimensional (2D cultures. The optimal range of spheroid diameter (300–500 μm was obtained using cultures initiated with 0.5 and 1.25 × 104 cells/mL for the ULA method and 2.5 and 3.75 × 104 cells/mL for the HD method. RT4 cells cultured under 3D conditions also exhibited a higher resistance to doxorubicin (IC50 of 1.00 and 0.83 μg/mL for the ULA and HD methods, respectively compared to 2D cultures (IC50 ranging from 0.39 to 0.43.Conclusions: Comparing the results, we concluded that the forced floating method using ULA plates was considered more suitable and straightforward to generate RT4 spheroids for drug screening/cytotoxicity assays. The results presented here also contribute to the improvement in the standardization of the 3D cultures required for widespread application.

  12. Factors Influencing Choices for Colorectal Cancer Screening Among Previously Unscreened African and Caucasian Americans: Findings from a Triangulation Mixed Methods Investigation

    Science.gov (United States)

    Ruffin, Mack T.; Creswell, John W.; Jimbo, Masahito

    2014-01-01

    We investigated factors that influence choice of colorectal cancer (CRC) screening test and assessed the most- and least-preferred options among fecal occult blood testing (FOBT), flexible sigmoidoscopy, colonoscopy, and double contrast barium enema among adults with varied race, gender, and geographic region demographics. Mixed methods data collection consisted of 10 focus group interviews and a survey of the 93 focus group participants. Participants were ≥50 years of age and reported not having been screened for colorectal cancer in the last ten years. Analyses examined differences by race, gender, and geographic location. Participants had modest knowledge about CRC and there were fewer correct answers to knowledge questions by African Americans. Participants recognized value of early detection, and identified health symptoms and their doctor's recommendation as influential for obtaining CRC screening. They chose colonoscopy and FOBT as the most preferred tests, while barium enema was least preferred. The analysis revealed intra-group variations in preference, though there were no significant differences by race, gender, or location. Openness of discussing this sensitive topic, lack of knowledge about colorectal cancer and screening costs, and diversity of preferences expressed within study groups suggest the importance of patient-physician dialogue about colorectal cancer screening options. New approaches to promoting colorectal cancer screening need to explore methods to facilitate patients establishing and expressing preferences among the screening options. PMID:19082695

  13. Depression Screening

    Science.gov (United States)

    ... Depression Screening Substance Abuse Screening Alcohol Use Screening Depression Screening (PHQ-9) - Instructions The following questions are ... this tool, there is also text-only version . Depression Screening - Manual Instructions The following questions are a ...

  14. Lipid extraction methods from microalgal biomass harvested by two different paths: screening studies toward biodiesel production.

    Science.gov (United States)

    Ríos, Sergio D; Castañeda, Joandiet; Torras, Carles; Farriol, Xavier; Salvadó, Joan

    2013-04-01

    Microalgae can grow rapidly and capture CO2 from the atmosphere to convert it into complex organic molecules such as lipids (biodiesel feedstock). High scale economically feasible microalgae based oil depends on optimizing the entire process production. This process can be divided in three very different but directly related steps (production, concentration, lipid extraction and transesterification). The aim of this study is to identify the best method of lipid extraction to undergo the potentiality of some microalgal biomass obtained from two different harvesting paths. The first path used all physicals concentration steps, and the second path was a combination of chemical and physical concentration steps. Three microalgae species were tested: Phaeodactylum tricornutum, Nannochloropsis gaditana, and Chaetoceros calcitrans One step lipid extraction-transesterification reached the same fatty acid methyl ester yield as the Bligh and Dyer and soxhlet extraction with n-hexane methods with the corresponding time, cost and solvent saving. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Fast methods for screening of trichothecenes in fungal cultures using gas chromatography-tandem mass spectrometry

    DEFF Research Database (Denmark)

    Nielsen, Kristian Fog; Thrane, Ulf

    2001-01-01

    The paper presents a fast method for trichothecene profiling and chemotaxonomic studies in species of Fusarium, Stachybotrys, Trichoderma and Memnoniella. Micro scale extracted crude Fusarium extracts were derivatised using pentafluoropropionic anhydride and analysed by gas chromatography......-acetoxyscirpentriol, nivalenol, fusarenon-X, deoxynivalenol, 15-acetyl- deoxynivalenol and 3-acetyl-deoxynivalenol possible during a 23-min GC run. A slightly modified method could detect trichothecenes produced by Stachybotrys, Memnoniella and Trichoderma, by hydrolysing crude extracts prior to derivatisation...... with heptafluorobuturyl imidazole. All types of derivatised extracts could be reanalysed using negative ion chemical ionisation (NICI) GC-MS for molecular mass determination and verification purposes. A retention time index could be used for correction in retention time drifts between sequences and worked both in EI...

  16. A simple, rapid and inexpensive screening method for the identification of Pythium insidiosum.

    Science.gov (United States)

    Tondolo, Juliana Simoni Moraes; Loreto, Erico Silva; Denardi, Laura Bedin; Mario, Débora Alves Nunes; Alves, Sydney Hartz; Santurio, Janio Morais

    2013-04-01

    Growth of Pythium insidiosum mycelia around minocycline disks (30μg) did not occur within 7days of incubation at 35°C when the isolates were grown on Sabouraud, corn meal, Muller-Hinton or RPMI agar. This technique offers a simple and rapid method for the differentiation of P. insidiosum from true filamentous fungi. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A practical method for screening for b-galactosidase secreting microbial colonies

    Directory of Open Access Journals (Sweden)

    Barreto Eriana S.

    2000-01-01

    Full Text Available Microbial colonies were replicated on YNB® agar plates overlaid with soft agar containing the glucose-oxidase/peroxidase (BIOTROL® system. The pink color developed around the colonies was the result of the reaction of the glucose generated by the extracellular hydrolysis of lactose by beta-galactosidase, indicating secretion of this enzyme. This method proved to be very convenient for testing hundreds of colonies grown on agar plates for beta-galactosidase secretion by microbial cells.

  18. SCREENING FOR ANTI ULCER ACTIVITY OF CONVOLVULUS PLURICAULIS USING PYLORIC LIGATION METHOD IN WISTER RATS.

    OpenAIRE

    Sharath S S; Preethy J; Surendra kumar G; Revannaswamy A; Muralidhar P; Sujith Tumkur Rajashekar; Prabhavathi; Rohini KR

    2015-01-01

    Peptic ulcer disease is a chronic problem of the gastrointestinal tract characterized by mucosal damage secondary to pepsin and gastric acid secretion. Herbal medicines are generally used in cases when drugs are to be used for chronic periods. The study was conducted to evaluate antiulcerogenic activity of convolvulus pluricaulis in wistar rats. The antiulcer activity was carried out employing - Pyloric ligation method. The rats were randomly divided into 4 groups of 6 animals each. First ...

  19. Rapid screening of toxic salbutamol, ractopamine, and clenbuterol in pork sample by high-performance liquid chromatography—UV method

    Directory of Open Access Journals (Sweden)

    Kunping Yan

    2016-04-01

    Full Text Available A rapid and simple high-performance liquid chromatography–UV method was developed for the separation and quantification of salbutamol, ractopamine, and clenbuterol in pork. A mixture of acetonitrile–formic acid–ammonium acetate was used as the mobile phase to separate three β-agonists on a C18 column with gradient. The effects of the addition of formic acid and ammonium acetate to mobile phases on the separation of β-agonists were investigated. These additives can greatly improve the resolution and sensitivity. Under the optimized chromatographic condition, this separation does not need extra sample preparation. Complete baseline separation of three β-agonists was achieved in 0.99. Excellent method reproducibility was found by intra- and interday precisions with a relative standard deviation of < 3%. The detection limit (S/N = 3 was found to be <0.05 μg/L; this method can be used for routine screening of the β-agonist residues in foods of animal origin before being identified by confirmatory methods.

  20. Rapid screening of toxic salbutamol, ractopamine, and clenbuterol in pork sample by high-performance liquid chromatography-UV method.

    Science.gov (United States)

    Yan, Kunping; Zhang, Huiqun; Hui, Wenli; Zhu, Hongli; Li, Xinbo; Zhong, Fangyi; Tong, Xiu'e; Chen, Chao

    2016-04-01

    A rapid and simple high-performance liquid chromatography-UV method was developed for the separation and quantification of salbutamol, ractopamine, and clenbuterol in pork. A mixture of acetonitrile-formic acid-ammonium acetate was used as the mobile phase to separate three β-agonists on a C18 column with gradient. The effects of the addition of formic acid and ammonium acetate to mobile phases on the separation of β-agonists were investigated. These additives can greatly improve the resolution and sensitivity. Under the optimized chromatographic condition, this separation does not need extra sample preparation. Complete baseline separation of three β-agonists was achieved in 0.99. Excellent method reproducibility was found by intra- and interday precisions with a relative standard deviation of < 3%. The detection limit (S/N = 3) was found to be <0.05 μg/L; this method can be used for routine screening of the β-agonist residues in foods of animal origin before being identified by confirmatory methods. Copyright © 2016. Published by Elsevier B.V.

  1. A rapid and simple chemiluminescence method for screening levels of inosine and hypoxanthine in non-traumatic chest pain patients.

    Science.gov (United States)

    Farthing, Don E; Sica, Domenic; Hindle, Michael; Edinboro, Les; Xi, Lei; Gehr, Todd W B; Gehr, Lynne; Farthing, Christine A; Larus, Terri L; Fakhry, Itaf; Karnes, H Thomas

    2011-01-01

    A rapid and simple chemiluminescence method was developed for detection of inosine and hypoxanthine in human plasma. The method utilized a microplate luminometer with direct injectors to automatically dispense reagents during sample analysis. Enzymatic conversions of inosine to hypoxanthine, followed by hypoxanthine to xanthine to uric acid, generated superoxide anion radicals as a useful metabolic by-product. The free radicals react with Pholasin(®) , a sensitive photoprotein used for chemiluminescence detection, to produce measurable blue-green light. The use of Pholasin(®) and a chemiluminescence signal enhancer, Adjuvant-K™, eliminated the need for plasma clean-up steps prior to analysis. The method used 20 μL of heparinized plasma, with complete analysis of total hypoxanthine levels (inosine is metabolized to hypoxanthine using purine nucleoside phosphorylase) in approximately 3.7 min. The rapid chemiluminescence method demonstrated the capability of differentiating total hypoxanthine levels between healthy individuals, and patients presenting with non-traumatic chest pain and potential acute cardiac ischemia. The results support the potential use of chemiluminescence methodology as a diagnostic tool to rapidly screen for elevated levels of inosine and hypoxanthine in human plasma, potential biomarkers of acute cardiac ischemia. Copyright © 2009 John Wiley & Sons, Ltd.

  2. The Rapid and Sensitive Quantitative Determination of Galactose by Combined Enzymatic and Colorimetric Method: Application in Neonatal Screening.

    Science.gov (United States)

    Kianmehr, Anvarsadat; Mahrooz, Abdolkarim; Ansari, Javad; Oladnabi, Morteza; Shahbazmohammadi, Hamid

    2016-05-01

    The quantitative measurement of galactose in blood is essential for the early diagnosis, treatment, and dietary monitoring of galactosemia patients. In this communication, we aimed to develop a rapid, sensitive, and cost-effective combined method for galactose determination in dry blood spots. This procedure was based on the combination of enzymatic reactions of galactose dehydrogenase (GalDH), dihydrolipoyl dehydrogenase (DLD), and alkaline phosphates with a colorimetric system. The incubation time and the concentration of enzymes used in new method were also optimized. The analytical performance was studied by the precision, recovery, linearity, and sensitivity parameters. Statistical analysis was applied to method comparison experiment. The regression equation and correlation coefficient (R (2)) were Y = 0.0085x + 0.032 and R (2) = 0.998, respectively. This assay exhibited a recovery in the range of 91.7-114.3 % and had the limit detection of 0.5 mg/dl for galactose. The between-run coefficient of variation (CV) was between 2.6 and 11.1 %. The within-run CV was between 4.9 and 9.2 %. Our results indicated that the new and reference methods were in agreement because no significant biases exist between them. Briefly, a quick and reliable combined enzymatic and colorimetric assay was presented for application in newborn mass screening and monitoring of galactosemia patients.

  3. Method of screening radiation induced jute mutants for resistance to the jute weevil, Apion corchori marsh (coleoptera, curculionidae)

    Energy Technology Data Exchange (ETDEWEB)

    Shahjahan, M.

    1973-04-01

    The jute variety, D-154 (Corchorus capsularis), was treated with ionizing radiation and several jute plant mutants were evolved from it. They were the C-22 (seg), C-26 (seg), C-29 (seg), C-34, C-34 p.c., C-35 and C-38 (seg). These mutants were cultivated in the Tongi Atomic Energy Agricultural Experiment Station, Dacca, and exposed to natural infestation for estimating their resistance to the jute weevil, Apion corchori Marsh. But there was no known way of determining their damage by the jute weevils. Therefore, it was considered very essential to find out an effective screening method for evaluating the resistance of the jute weevils in the jute plants. Three methods were found to be more or less equally effective. They were the average attack, height-unit and frequency method. The results obtained by each one of them were analyzed and compared. Each method recorded the highest attack for C-34 and the lowest attack for both the C-38 (seg) and C-22 (seg). Hence the C-34 mutant seemed to be more susceptible when compared with other jute plant mutants.

  4. Nonlinear Microwave Imaging for Breast-Cancer Screening Using Gauss–Newton's Method and the CGLS Inversion Algorithm

    DEFF Research Database (Denmark)

    Rubæk, Tonny; Meaney, P. M.; Meincke, Peter

    2007-01-01

    Breast-cancer screening using microwave imaging is emerging as a new promising technique as a supplement to X-ray mammography. To create tomographic images from microwave measurements, it is necessary to solve a nonlinear inversion problem, for which an algorithm based on the iterative Gauss-Newton...... method has been developed at Dartmouth College. This algorithm determines the update values at each iteration by solving the set of normal equations of the problem using the Tikhonov algorithm. In this paper, a new algorithm for determining the iteration update values in the Gauss-Newton algorithm...... algorithm is compared to the Gauss-Newton algorithm with Tikhonov regularization and is shown to reconstruct images of similar quality using fewer iterations....

  5. Contact angle measurement - a reliable supportive method for screening water-resistance of ultraviolet-protecting products in vivo.

    Science.gov (United States)

    Hagens, R; Mann, T; Schreiner, V; Barlag, H G; Wenck, H; Wittern, K-P; Mei, W

    2007-08-01

    Substantivity of sunscreen formulations is affected by the wash-out rate of ultraviolet-absorber and -reflector compounds in water. Water-resistance of sunscreen formulations is currently determined according to a standardized European Cosmetic Toiletry and Perfumery Association (COLIPA) protocol, encompassing the determination of a minimal erythemal dose before and after a defined immersion step in water. It can be supposed that the higher the wettability of a treated skin area, the higher is the wash-out rate of sunscreen compounds. This present report addresses the validity of determining the wettability of treated skin alone as a measure for the water-resistance of sunscreen products. The report addresses the robustness, accuracy and congruence of a recently developed wettability test, based on the measurement of the contact angle (CA) of a sessile water drop on treated skin areas. Contact angle data of 66 sunscreen formulations are compared with the corresponding results of 81 water-resistance tests, using the sun protection factor (SPF)/immersion/SPF method. Sunscreen products tested by the CA method were applied to the skin of the volar forearm of test subjects at a defined dose and drying-time, using a standardized application and recording device. Contact angles between a sessile water drop and skin were recorded by a Charge-Coupled Device (CCD) camera and subjected to automatic contour analysis. Taking the SPF/immersion/SPF method as gold standard, accuracy parameters of the CA method were determined. By using an appropriate cut-off level of CAs, the CA method has a specificity and positive-predictive value of 100%, and turns out to be a reliable screening method to identify water-resistant formulations. Based on our findings, those formulations that give CAs above 30 degrees may be categorized water-proof without further testing by the COLIPA water-resistance method.

  6. Validation of the AlamarBlue® assay as a fast screening method to determine the antimicrobial activity of botanical extracts

    OpenAIRE

    Tyc, O.; Tomás-Menor, L.; Garbeva, P.V.; Barrajón-Catalán, E.; Micol, V.

    2016-01-01

    Plant compounds are a potential source of new antimicrobial molecules against a variety of infections. Plant extracts suppose complex phytochemical libraries that may be used for the first stages of the screening process for antimicrobials. However, their large variability and complexity require fast and inexpensive methods that allow a rapid and adequate screening for antimicrobial activity against a variety of bacteria and fungi. In this study, a multi-well plate assay using the AlamarBlue®...

  7. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H.

    2000-01-01

    Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionising radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enabled a rapid identification of the radiation treatment

  8. Various methods for assessing static lower extremity alignment: implications for prospective risk-factor screenings.

    Science.gov (United States)

    Nguyen, Anh-Dung; Boling, Michelle C; Slye, Carrie A; Hartley, Emily M; Parisi, Gina L

    2013-01-01

    Accurate, efficient, and reliable measurement methods are essential to prospectively identify risk factors for knee injuries in large cohorts. To determine tester reliability using digital photographs for the measurement of static lower extremity alignment (LEA) and whether values quantified with an electromagnetic motion-tracking system are in agreement with those quantified with clinical methods and digital photographs. Descriptive laboratory study. Laboratory. Thirty-three individuals participated and included 17 (10 women, 7 men; age = 21.7 ± 2.7 years, height = 163.4 ± 6.4 cm, mass = 59.7 ± 7.8 kg, body mass index = 23.7 ± 2.6 kg/m2) in study 1, in which we examined the reliability between clinical measures and digital photographs in 1 trained and 1 novice investigator, and 16 (11 women, 5 men; age = 22.3 ± 1.6 years, height = 170.3 ± 6.9 cm, mass = 72.9 ± 16.4 kg, body mass index = 25.2 ± 5.4 kg/m2) in study 2, in which we examined the agreement among clinical measures, digital photographs, and an electromagnetic tracking system. We evaluated measures of pelvic angle, quadriceps angle, tibiofemoral angle, genu recurvatum, femur length, and tibia length. Clinical measures were assessed using clinically accepted methods. Frontal- and sagittal-plane digital images were captured and imported into a computer software program. Anatomic landmarks were digitized using an electromagnetic tracking system to calculate static LEA. Intraclass correlation coefficients and standard errors of measurement were calculated to examine tester reliability. We calculated 95% limits of agreement and used Bland-Altman plots to examine agreement among clinical measures, digital photographs, and an electromagnetic tracking system. Using digital photographs, fair to excellent intratester (intraclass correlation coefficient range = 0.70-0.99) and intertester (intraclass correlation coefficient range = 0.75-0.97) reliability were observed for static knee alignment and limb

  9. A high-throughput colourimetric method for the determination of pH in crystallization screens

    OpenAIRE

    Kirkwood, Jobie; Wilson, Julie; O'keefe, Simon; Hargreaves, David

    2014-01-01

    The crystallization of proteins is dependent on the careful control of numerous parameters, one of these being pH. The pH of crystallization is generally reported as that of the buffer; however, the true pH has been found to be as many as four pH units away. Measurement of pH with a meter is time-consuming and requires the reformatting of the crystallization solution. To overcome this, a high-throughput method for pH determination of buffered solutions has been developed with results comparab...

  10. Screening tests for hazard classification of complex waste materials – Selection of methods

    International Nuclear Information System (INIS)

    Weltens, R.; Vanermen, G.; Tirez, K.; Robbens, J.; Deprez, K.; Michiels, L.

    2012-01-01

    In this study we describe the development of an alternative methodology for hazard characterization of waste materials. Such an alternative methodology for hazard assessment of complex waste materials is urgently needed, because the lack of a validated instrument leads to arbitrary hazard classification of such complex waste materials. False classification can lead to human and environmental health risks and also has important financial consequences for the waste owner. The Hazardous Waste Directive (HWD) describes the methodology for hazard classification of waste materials. For mirror entries the HWD classification is based upon the hazardous properties (H1–15) of the waste which can be assessed from the hazardous properties of individual identified waste compounds or – if not all compounds are identified – from test results of hazard assessment tests performed on the waste material itself. For the latter the HWD recommends toxicity tests that were initially designed for risk assessment of chemicals in consumer products (pharmaceuticals, cosmetics, biocides, food, etc.). These tests (often using mammals) are not designed nor suitable for the hazard characterization of waste materials. With the present study we want to contribute to the development of an alternative and transparent test strategy for hazard assessment of complex wastes that is in line with the HWD principles for waste classification. It is necessary to cope with this important shortcoming in hazardous waste classification and to demonstrate that alternative methods are available that can be used for hazard assessment of waste materials. Next, by describing the pros and cons of the available methods, and by identifying the needs for additional or further development of test methods, we hope to stimulate research efforts and development in this direction. In this paper we describe promising techniques and argument on the test selection for the pilot study that we have performed on different

  11. Application of a microbiological screening method for the indication of irradiation of poultry meat

    International Nuclear Information System (INIS)

    Wirtanen, G.; Karwoski, M.; Sjoberg, A.-M.; Salo, S.

    1996-01-01

    The FDA (Food and Drug Administration of the Department of Health and Human Services, USA) ruling of May 1990 permits the use of irradiation of fresh or frozen poultry and poultry parts, including ground and mechanically separated poultry products, at absorbed doses of 1.5 to 3 kGy to control foodborne pathogens and bacteria. The aim of this study was to apply a microbiological method (DEFT/APC) to assess the possible irradiation treatment of samples of frozen poultry meat. (author)

  12. Establish an automated flow injection ESI-MS method for the screening of fragment based libraries: Application to Hsp90.

    Science.gov (United States)

    Riccardi Sirtori, Federico; Caronni, Dannica; Colombo, Maristella; Dalvit, Claudio; Paolucci, Mauro; Regazzoni, Luca; Visco, Carlo; Fogliatto, Gianpaolo

    2015-08-30

    ESI-MS is a well established technique for the study of biopolymers (nucleic acids, proteins) and their non covalent adducts, due to its capacity to detect ligand-target complexes in the gas phase and allows inference of ligand-target binding in solution. In this article we used this approach to investigate the interaction of ligands to the Heat Shock Protein 90 (Hsp90). This enzyme is a molecular chaperone involved in the folding and maturation of several proteins which has been subjected in the last years to intensive drug discovery efforts due to its key role in cancer. In particular, reference compounds, with a broad range of dissociation constants from 40pM to 100μM, were tested to assess the reliability of ESI-MS for the study of protein-ligand complexes. A good agreement was found between the values measured with a fluorescence polarization displacement assay and those determined by mass spectrometry. After this validation step we describe the setup of a medium throughput screening method, based on ESI-MS, suitable to explore interactions of therapeutic relevance biopolymers with chemical libraries. Our approach is based on an automated flow injection ESI-MS method (AFI-MS) and has been applied to screen the Nerviano Medical Sciences proprietary fragment library of about 2000 fragments against Hsp90. In order to discard false positive hits and to discriminate those of them interacting with the N-terminal ATP binding site, competition experiments were performed using a reference inhibitor. Gratifyingly, this group of hits matches with the ligands previously identified by NMR FAXS techniques and confirmed by X-ray co-crystallization experiments. These results support the use of AFI-MS for the screening of medium size libraries, including libraries of small molecules with low affinity typically used in fragment based drug discovery. AFI-MS is a valid alternative to other techniques with the additional opportunities to identify compounds interacting with

  13. Screening Internet forum participants for depression symptoms by assembling and enhancing multiple NLP methods.

    Science.gov (United States)

    Karmen, Christian; Hsiung, Robert C; Wetter, Thomas

    2015-06-01

    Depression is a disease that can dramatically lower quality of life. Symptoms of depression can range from temporary sadness to suicide. Embarrassment, shyness, and the stigma of depression are some of the factors preventing people from getting help for their problems. Contemporary social media technologies like Internet forums or micro-blogs give people the opportunity to talk about their feelings in a confidential anonymous environment. However, many participants in such networks may not recognize the severity of their depression and their need for professional help. Our approach is to develop a method that detects symptoms of depression in free text, such as posts in Internet forums, chat rooms and the like. This could help people appreciate the significance of their depression and realize they need to seek help. In this work Natural Language Processing methods are used to break the textual information into its grammatical units. Further analysis involves detection of depression symptoms and their frequency with the help of words known as indicators of depression and their synonyms. Finally, similar to common paper-based depression scales, e.g., the CES-D, that information is incorporated into a single depression score. In this evaluation study, our depressive mood detection system, DepreSD (Depression Symptom Detection), had an average precision of 0.84 (range 0.72-1.0 depending on the specific measure) and an average F measure of 0.79 (range 0.72-0.9). Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. In-vivo visualisation of the anatomical structures related to the acupuncture points Dai mai and Shen mai by MRI: A single-case pilot study

    International Nuclear Information System (INIS)

    Moncayo, Roy; Rudisch, Ansgar; Diemling, Markus; Kremser, Christian

    2007-01-01

    The concept of acupuncture point localisation in Traditional Chinese Medicine (TCM) is based on millenary practical experience. Modern imaging methods such as PET, MRI and SPECT have been used primary for the investigation of the mechanisms of action of acupuncture. In this pilot single-case study we have evaluated the technical possibilities for in-vivo imaging of the anatomical relations of acupuncture points using state of the art MRI. Preliminary experiments relating to the quality of acupuncture needles under the setting of MRI were done both with stainless steel and gold needles. In a second step, in-vivo imaging was carried out. A licensed acupuncture practitioner (RM) chose two points belonging to the so-called extraordinary vessels. In 2 sequential, separate procedures, he inserted himself gold acupuncture needles using a neutral technique (known as Ping Bu Ping Xie) into the Dai mai and Shen mai points, i.e. gall bladder 26 and bladder 62. Imaging was done on a Siemens Magnetom Avanto MR scanner using a head array and body coil. Mainly T1-weighted imaging sequences, as routinely used for patient exams, were used to obtain multi-slice images. In the preliminary experiments only acupuncture needles made of gold showed enough stability in order to be used for further imaging procedures. Using an onion and a banana as an object, further studies showed that the gold needles produced a void defect that corresponds to the tip of the inserted needle, while at the same time an artefactually increased diameter was observed. The in-vivo experiments showed that the Dai mai point was in relation to the abdominal internal oblique muscle. The Shen mai point artefact showed up close to the longus and brevis peroneal tendons at the fibular malleolus. Side effects related to heating or burning were not observed. Improved anatomical recognition was obtained using 3D-volume rendering techniques. Through an adequate choice of acupuncture material (gold needles) as well as of

  15. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    Directory of Open Access Journals (Sweden)

    Martin Stofanko

    2013-01-01

    Full Text Available Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations.

  16. A new simple screening method for the detection of paralytic shellfish poisoning toxins

    Science.gov (United States)

    Cheng, Jinping; Pi, Shuaishuai; Ye, Shufeng; Gao, Haomin; Yao, Lei; Jiang, Zhenyi; Song, Yuling; Xi, Lei

    2012-09-01

    The current testing for paralytic shellfish poisoning (PSP) in shellfish is based on the mouse bioassay (MBA). To alleviate animal welfare concerns, we evaluated the utility of using sublethal indicators of toxicity as an alternative to measuring time to death. Live mice were injected with a PSP congener and the changes in neurotransmitter levels were measured 60, 90, and 120 min after injection. Acetylcholine (ACh) was the most sensitive marker for PSP toxicity. The changes in neurotransmitter levels were most pronounced in the blood. Thus, measurement of Ach levels in the blood may serve as a sensitive predictor for PSP that would not require sacrifice of the mice. This method was relatively simple, sensitive (less than 1 μg/kg weight, equivalent to 20 ng/mL), low maintenance, and rapid (less than 60 min).

  17. Application of a rapid screening method to detect irradiated meat in Brazil

    International Nuclear Information System (INIS)

    Villavicencio, A.L.C.H.; Delincee, H.

    1998-01-01

    Complete text of publication follows. Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionizing radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In fact, DNA fragmentation measured in single cells by agarose gel electrophoresis - DNA Comet Assay - has shown to offer great potential as a rapid tool to detect whether a wide variety of foodstuffs has been radiation processed. However, more work is needed to exploit the full potential of this promising technique. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma-rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enable a rapid identification of the radiation treatment

  18. Establishment of screening method for mutant cell and analysis of base sequence of its mutated gene

    International Nuclear Information System (INIS)

    Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi

    1999-01-01

    The purpose of this study was to develop a method for effective detection of the changes in DNA sequences due to radiation-induced mutation and further to establish techniques for risk evaluation and its reduction in human bodies. A transgene including E. coli gpt gene was transfected to produce a transgenic mouse model for detecting a mutation. E. coli gpt gene, a reporter gene for detection of point mutation was inserted into a shuttle vector, λEG10 and the vector was micro-injected into mouse fertilized eggs. Genome DNA was extracted from the bone marrow and the testis of its F1 mice and the presence of λEG10 DNA was confirmed by PCR method and Southern hybridization technique. A system which effectively detect a deletion mutation (Spi selection) was inserted into a shuttle vector and the mutation rate was determined using the transgenic mouse. The number of copies of the transfected gene was estimated through comparison with those for the previous transgenic mice such as Muta TM , Big Blue TM mouse. The number of copies of λEG10 DNA was about 30 in BDF1-derived mouse and 80 in C57BL16J-derived one. The rate of mutation in gpt gene was significantly increased in the bone morrow of mice intraperitoneally administered with ethylnitrosourea at 150 mg/kg of body weight. The rate of Spi mutation was dose-dependently increased in the spleen of mice exposed to γ-radiation (5, 10, 50 Gy). These results indicate that the transgenic mouse, 'gpt Δ' developed was available for in vivo detection and analysis of various types of mutation. (M.N.)

  19. Opportunistische screening...

    NARCIS (Netherlands)

    Postma, M.J.; Welte, R.; Van Den Hoek, J.A.R.; Van Doornum, G.J.J.; Coutinho, R.A.; Jager, J.C.

    1999-01-01

    Objective. To estimate the cost effectiveness of Chlamydia trachomatis (CT) screening of young women visiting general practitioners. Design. Economic model analysis. Methods. Data on the health care needs for CT complications were derived from various sources; costing was done using estimated cost

  20. Vision Screening

    Science.gov (United States)

    ... an efficient and cost-effective method to identify children with visual impairment or eye conditions that are likely to lead ... main goal of vision screening is to identify children who have or are at ... visual impairment unless treated in early childhood. Other problems that ...

  1. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    Science.gov (United States)

    2009-01-01

    and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method was found to perform well. The test is currently being implemented for screening of several hundred thousand samples per year at a number of major Danish slaughterhouses to shorten the post-slaughter storage time and facilitate the swift export of fresh meat. PMID:19422711

  2. Large Scale Screening of Southern African Plant Extracts for the Green Synthesis of Gold Nanoparticles Using Microtitre-Plate Method

    Directory of Open Access Journals (Sweden)

    Abdulrahman M. Elbagory

    2016-11-01

    Full Text Available The preparation of gold nanoparticles (AuNPs involves a variety of chemical and physical methods. These methods use toxic and environmentally harmful chemicals. Consequently, the synthesis of AuNPs using green chemistry has been under investigation to develop eco-friendly nanoparticles. One approach to achieve this is the use of plant-derived phytochemicals that are capable of reducing gold ions to produce AuNPs. The aim of this study was to implement a facile microtitre-plate method to screen a large number of aqueous plant extracts to determine the optimum concentration (OC for the bio-synthesis of the AuNPs. Several AuNPs of different sizes and shapes were successfully synthesized and characterized from 17 South African plants. The characterization was done using Ultra Violet-Visible Spectroscopy, Dynamic Light Scattering, High Resolution Transmission Electron Microscopy and Energy-Dispersive X-ray Spectroscopy. We also studied the effects of temperature on the synthesis of the AuNPs and showed that changes in temperatures affect the size and dispersity of the generated AuNPs. We also evaluated the stability of the synthesized AuNPs and showed that some of them are stable in biological buffer solutions.

  3. A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.

    Science.gov (United States)

    Chen, Longzheng; Li, Wei; Katin-Grazzini, Lorenzo; Ding, Jing; Gu, Xianbin; Li, Yanjun; Gu, Tingting; Wang, Ren; Lin, Xinchun; Deng, Ziniu; McAvoy, Richard J; Gmitter, Frederick G; Deng, Zhanao; Zhao, Yunde; Li, Yi

    2018-01-01

    Developing CRISPR/Cas9-mediated non-transgenic mutants in asexually propagated perennial crop plants is challenging but highly desirable. Here, we report a highly useful method using an Agrobacterium -mediated transient CRISPR/Cas9 gene expression system to create non-transgenic mutant plants without the need for sexual segregation. We have also developed a rapid, cost-effective, and high-throughput mutant screening protocol based on Illumina sequencing followed by high-resolution melting (HRM) analysis. Using tetraploid tobacco as a model species and the phytoene desaturase ( PDS ) gene as a target, we successfully created and expediently identified mutant plants, which were verified as tetra-allelic mutants. We produced pds mutant shoots at a rate of 47.5% from tobacco leaf explants, without the use of antibiotic selection. Among these pds plants, 17.2% were confirmed to be non-transgenic, for an overall non-transgenic mutation rate of 8.2%. Our method is reliable and effective in creating non-transgenic mutant plants without the need to segregate out transgenes through sexual reproduction. This method should be applicable to many economically important, heterozygous, perennial crop species that are more difficult to regenerate.

  4. Development of a targeted GC/MS screening method and validation of an HPLC/DAD quantification method for piperazines–amphetamines mixtures in seized material

    Directory of Open Access Journals (Sweden)

    Yacine Boumrah

    2014-09-01

    Full Text Available Piperazine-related drugs are sold as party pills in the form of tablets, capsules, liquids or powders. These party pills can contain several piperazine derivatives, or even a mixture of piperazines and amphetamine derivatives. This paper describes a screening method using a gas chromatography–mass spectrometry technique allowing the separation and the identification of active components within these mixtures by a combined silylation and acylation derivatization procedure. The studied substances–namely: 1-benzylpiperazine (BZP, 1-(3,4-methylenedioxyben-zylpiperazine (MDBP, 1-(3-trifluoromethylphenylpiperazine (TFMPP, 1-(3-chlorophenyl piperazine (mCPP, 1-(4-methoxyphenyl piperazine (MeOPP, amphetamine, methamphetamine, ephedrine, pseudoephedrine, 3,4-methylenedioxy-N-methamphetamine (MDMA, 3,4-methylenedi-oxyamphetamine (MDA, 3,4-methylenedioxy-N-ethylamphetamine (MDEA and N-methyl-1,3-benzodioxolylbutanamine (MBDB–are separated.

  5. Footboards: Indigenous and novel method of screening for diabetes peripheral neuropathy – A pilot study

    Directory of Open Access Journals (Sweden)

    Akram Hussain Bijli

    2017-01-01

    Full Text Available Background: To validate the effectiveness of indigenously designed “footboard (FB” in early diagnosis of diabetic peripheral neuropathy (PNP by comparing it with Semmes–Weinstein monofilament (SWM and vibration perception (VP. Materials and Methods: Two hundred and forty-four patients with diabetes were examined for PNP using SWM and 128 Hz tuning fork. The findings were compared with indigenously designed FBs with 1, 2, and 3 mm elevations. Results: Out of 108 patients who did not have protective sensation as per SWM, only 10 (9.2% felt 1 mm board bearings, and out of 72 patients who did not feel vibration, only 8 (11.1% felt 1 mm board bearings. Out of 136 patients who had protective sensation, 128 (94.11% felt 2 mm elevated board bearings, and out of 172 patients who had VP, only 152 patients (88.3% felt 2 mm board bearings. With SWM as standard, the sensitivities and specificities, respectively, were 63% and 90% (1 mm board, and 94% and 60% (2 mm board. With VP, the sensitivities and specificities, respectively, were 59% and 90% (1 mm board, and 88% and 61% (2 mm board. Conclusions: FB, which simultaneously tests touch and pressure sensation, shows a high level of performance in detecting at-risk feet. FB may be simple, time-efficient, and inexpensive test for detection of neuropathy and needs further validation in a larger study.

  6. A computational method for the systematic screening of reaction barriers in enzymes

    DEFF Research Database (Denmark)

    Hediger, Martin Robert; Svendsen, Casper Steinmann; De Vico, Luca

    2013-01-01

    -xylobioside (ONPX2). The estimated reaction barrier for wild-type (WT) BCX is 18.5 kcal/mol, which is in good agreement with the experimental activation free energy value of 17.0 kcal/mol extracted from the observed k cat using transition state theory (Joshi et al., 2001). The PM6 reaction profiles for eight single...... point mutations are recomputed using FMO-MP2/PCM/6-31G(d) single points. PM6 predicts an increase in barrier height for all eight mutants while FMO predicts an increase for six of the eight mutants. Both methods predict that the largest change in barrier occurs for N35F, where PM6 and FMO predict a 9...... and E172) was mutated to every other amino acid. Based on results from the single mutants we construct a set of 111 double mutants consisting of all possible pairs of single mutants with the lowest barrier for a particular position and compute their reaction profile. None of the mutants have, to our...

  7. On the in-vivo photochemical rate parameters for PDT reactive oxygen species modeling

    Science.gov (United States)

    Kim, Michele M.; Ghogare, Ashwini A.; Greer, Alexander; Zhu, Timothy C.

    2017-01-01

    Photosensitizer photochemical parameters are crucial data in accurate dosimetry for photodynamic therapy (PDT) based on photochemical modeling. Progress has been made in the last few decades in determining the photochemical properties of commonly used photosensitizers (PS), but mostly in solution or in-vitro. Recent developments allow for the estimation of some of these photochemical parameters in-vivo. This review will cover the currently available in-vivo photochemical properties of photosensitizers as well as the techniques for measuring those parameters. Furthermore, photochemical parameters that are independent of environmental factors or are universal for different photosensitizers will be examined. Most photosensitizers discussed in this review are of the type II (singlet oxygen) photooxidation category, although type I photosensitizers that involve other reactive oxygen species (ROS) will be discussed as well. The compilation of these parameters will be essential for ROS modeling of PDT. PMID:28166056

  8. Synthesis and in-vivo detection of boronated compounds for use in BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Kabalka, G.W.

    1992-01-01

    The primary objective of the DOE program at The University of Tennessee Graduate School of Medicine is the development of effective molecular medicine for use in neutron-capture therapy (NCT). The research focuses primarily on the preparation of new boron-rich NCT agents and the technology to detect them in-vivo. The detection technology involves the development of effective magnetic resonance imaging (MRI) and spectroscopy (MRS) techniques for verifying and measuring NCT agents in-vivo. The synthetic program is directed toward the design of novel boron NCT (BNCT) agents which are targeted to the cell nucleus and gadolinium liposomes targeted to the liver. The UT-DOE program is unique in that it has access to both state-of-the-art whole-body and microscopy MRI instruments.

  9. Static and mobile DXA scanner in-vivo cross-calibration study

    International Nuclear Information System (INIS)

    Griffin, J.G.L.; Knapp, K.M.; Pearce, G.

    2013-01-01

    In-vitro cross-calibration of DXA scanning equipment, with a phantom device, has been recommended for assessing agreement between devices co-located within DXA scanning services. This study evaluated in-vivo and in-vitro cross-calibration of a static and a mobile DXA scanner within the same service in their individual clinical settings. 50 individuals from a volunteer group were recruited to take part in this study and had DXA measurements made on two GE Lunar Prodigy Advance (GE Lunar, Bedford, UK) scanners. Results in this study showed that the scanners agreed, with no clinically significant differences in BMD measurements made at the same site on the individual devices used in this study. The in-vivo cross-calibration of the instruments was a useful experience, which demonstrated closely calibrated systems and raised the profile of the bone densitometry service within the hospital.

  10. Multicentre validation of 4-well azole agar plates as a screening method for detection of clinically relevant azole-resistant Aspergillus fumigatus

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Verweij, Paul E; Mouton, Johan W

    2017-01-01

    Objectives: Azole-resistant Aspergillus fumigatus is emerging worldwide. Reference susceptibility testing methods are technically demanding and no validated commercial susceptibility tests for moulds currently exist. In this multicentre study a 4-well azole-containing screening agar method was ev...

  11. Assessing the feasibility of linkage disequilibrium methods for mapping complex traits : An initial screen for bipolar disorder loci on chromosome 18

    NARCIS (Netherlands)

    Escamilla, MA; McInnes, LA; Spesny, M; Reus, [No Value; Service, SK; Shimayoshi, N; Tyler, DJ; Silva, S; Molina, J; Gallegos, A; Meza, L; Cruz, ML; Batki, S; Vinogradov, S; Neylan, T; Nguyen, JB; Fournier, E; Araya, C; Barondes, SH; Leon, P; Sandkuijl, LA; Freimer, NB

    Linkage disequilibrium (LD) analysis:has been promoted as a method of mapping disease genes, particularly in isolated populations, but has not yet been used for genome-screening studies of complex disorders. We present results of a study to investigate the feasibility of LD methods for

  12. Validation of a qualitative screening method for pesticides in fruits and vegetables by gas chromatography quadrupole-time of flight mass spectrometry with atmospheric pressure chemical ionization

    NARCIS (Netherlands)

    Portoles, T.; Mol, J.G.J.; Sancho, J.V.; Lopez, F.J.; Hernandez, F.

    2014-01-01

    A wide-scope screening method was developed for the detection of pesticides in fruit and vegetables. The method was based on gas chromatography coupled to a hybrid quadrupole time-of-flight mass spectrometer with an atmospheric pressure chemical ionization source (GC-(APCI)QTOF MS). A non-target

  13. The tetramethylammonium chloride method for screening of cDNA libraries using highly degenerate oligonucleotides obtained by backtranslation of amino-acid sequences

    DEFF Research Database (Denmark)

    Honoré, B; Madsen, Peder; Leffers, H

    1993-01-01

    We describe a method for screening of cDNA libraries with highly degenerate oligonucleotides using tetramethylammonium chloride (TMAC). This method is a convenient alternative to using probes generated by the polymerase chain reaction (PCR), especially when these cannot easily be made. Nylon...

  14. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in the field in barley.

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Rengasamy, Pichu; McDonald, Glenn K

    2012-06-01

    Success in breeding crops for yield and other quantitative traits depends on the use of methods to evaluate genotypes accurately under field conditions. Although many screening criteria have been suggested to distinguish between genotypes for their salt tolerance under controlled environmental conditions, there is a need to test these criteria in the field. In this study, the salt tolerance, ion concentrations, and accumulation of compatible solutes of genotypes of barley with a range of putative salt tolerance were investigated using three growing conditions (hydroponics, soil in pots, and natural saline field). Initially, 60 genotypes of barley were screened for their salt tolerance and uptake of Na(+), Cl(-), and K(+) at 150 mM NaCl and, based on this, a subset of 15 genotypes was selected for testing in pots and in the field. Expression of salt tolerance in saline solution culture was not a reliable indicator of the differences in salt tolerance between barley plants that were evident in saline soil-based comparisons. Significant correlations were observed in the rankings of genotypes on the basis of their grain yield production at a moderately saline field site and their relative shoot growth in pots at EC(e) 7.2 [Spearman's rank correlation (rs)=0.79] and EC(e) 15.3 (rs=0.82) and the crucial parameter of leaf Na(+) (rs=0.72) and Cl(-) (rs=0.82) concentrations at EC(e) 7.2 dS m(-1). This work has established screening procedures that correlated well with grain yield at sites with moderate levels of soil salinity. This study also showed that both salt exclusion and osmotic tolerance are involved in salt tolerance and that the relative importance of these traits may differ with the severity of the salt stress. In soil, ion exclusion tended to be more important at low to moderate levels of stress but osmotic stress became more important at higher stress levels. Salt exclusion coupled with a synthesis of organic solutes were shown to be important components of

  15. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in th