Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Directory of Open Access Journals (Sweden)
Jonathan M. LaMantia
2018-04-01
Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.
Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun
2016-06-04
Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.
Identification of novel intronic BRCA1 variants of uncertain ...
Indian Academy of Sciences (India)
in a Thai hereditary breast cancer family. Adisorn Ratanaphan, Pornpen Panomwan, Bhutorn Canyuk and Tanaphon Maipang. J. Genet. 90, 327–331. Table 1. Oligodeoxyribonucleotide primers used for PCR amplification of BRCA1 exon–intron 7 boundary sequences. Primers. Nucleotide position. Primer sequence (5 –3 ).
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)
Energy Technology Data Exchange (ETDEWEB)
McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))
1991-09-25
Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.
Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P
1996-01-01
Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR
Directory of Open Access Journals (Sweden)
Neng Chen
2014-07-01
Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Ding, Qianlan; Wu, Xi; Lu, Yeling; Chen, Changming; Shen, Rui; Zhang, Xi; Jiang, Zhengwen; Wang, Xuefeng
2016-07-01
To develop a digitalized intron 22 inversion (Inv22) detection in patients with severe haemophilia A. The design included two tests: A genotyping test included two multiplex pre-amplification of LD-PCR (PLP) with two combinations of five primers to amplify wild-type and chimeric int22h alleles; a carrier mosaicism test was similar to the genotyping test except only amplification of chimeric int22h alleles by removing one primer from each of two combinations. AccuCopy detection was used to quantify PLP products. PLP product patterns in the genotyping test allowed identifying all known Inv22. Quantitative patterns accurately represented the product patterns. The results of 164 samples detected by the genotyping test were consistent with those obtained by LD-PCR detection. Limit of detection (LOD) of the carrier mosaicism test was at least 2% of heterozygous cells with Inv22. Performing the test in two obligate mothers with negative Inv22 from two sporadic pedigrees mosaic rates of blood and hair root of the mother from pedigree 1 were 8.3% and >20%, respectively and negative results were obtained in pedigree 2. AccuCopy quantification combined with PLP (AQ-PLP) method was confirmed to be rapid and reliable for genotyping Inv22 and highly sensitive to carrier mosaicism detection. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Directory of Open Access Journals (Sweden)
Maayan Amit
2012-05-01
Full Text Available During evolution segments of homeothermic genomes underwent a GC content increase. Our analyses reveal that two exon-intron architectures have evolved from an ancestral state of low GC content exons flanked by short introns with a lower GC content. One group underwent a GC content elevation that abolished the differential exon-intron GC content, with introns remaining short. The other group retained the overall low GC content as well as the differential exon-intron GC content, and is associated with longer introns. We show that differential exon-intron GC content regulates exon inclusion level in this group, in which disease-associated mutations often lead to exon skipping. This group's exons also display higher nucleosome occupancy compared to flanking introns and exons of the other group, thus “marking” them for spliceosomal recognition. Collectively, our results reveal that differential exon-intron GC content is a previously unidentified determinant of exon selection and argue that the two GC content architectures reflect the two mechanisms by which splicing signals are recognized: exon definition and intron definition.
Directory of Open Access Journals (Sweden)
Liang Rubing
2010-08-01
Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M
2015-04-01
We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.
Molecular genetic analysis of cereal β-amylase genes using exon-primed intron-crossing (EPIC PCR
Directory of Open Access Journals (Sweden)
Stratula Olga
2014-01-01
Full Text Available The proteins encoded by cereal β-amylase genes Bamy1 and Bamy2 genes play an important role in seedling germination and in the brewing process. Here, we use exon-primed intron-crossing (EPIC to analyse Bamy1 and Bamy2 genetic diversity among 38 accessions belonging to six Poaceae tribes. DNA sequence alignment of multiple Poaceae species β-amylase sequences allowed design of EPIC primers that simultaneously amplify Bamy1 and Bamy2 in all the cereal species investigated. The genetic variation observed in the samples investigated is analysed and discussed, and illustrates the effectiveness of this approach for intra- and interspecific analysis in plant species.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Recurrent loss of specific introns during angiosperm evolution.
Directory of Open Access Journals (Sweden)
Hao Wang
2014-12-01
Full Text Available Numerous instances of presence/absence variations for introns have been documented in eukaryotes, and some cases of recurrent loss of the same intron have been suggested. However, there has been no comprehensive or phylogenetically deep analysis of recurrent intron loss. Of 883 cases of intron presence/absence variation that we detected in five sequenced grass genomes, 93 were confirmed as recurrent losses and the rest could be explained by single losses (652 or single gains (118. No case of recurrent intron gain was observed. Deep phylogenetic analysis often indicated that apparent intron gains were actually numerous independent losses of the same intron. Recurrent loss exhibited extreme non-randomness, in that some introns were removed independently in many lineages. The two larger genomes, maize and sorghum, were found to have a higher rate of both recurrent loss and overall loss and/or gain than foxtail millet, rice or Brachypodium. Adjacent introns and small introns were found to be preferentially lost. Intron loss genes exhibited a high frequency of germ line or early embryogenesis expression. In addition, flanking exon A+T-richness and intron TG/CG ratios were higher in retained introns. This last result suggests that epigenetic status, as evidenced by a loss of methylated CG dinucleotides, may play a role in the process of intron loss. This study provides the first comprehensive analysis of recurrent intron loss, makes a series of novel findings on the patterns of recurrent intron loss during the evolution of the grass family, and provides insight into the molecular mechanism(s underlying intron loss.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Novel intron markers to study the phylogeny of closely related mammalian species
Directory of Open Access Journals (Sweden)
Castresana Jose
2010-11-01
Full Text Available Abstract Background Multilocus phylogenies can be used to infer the species tree of a group of closely related species. In species trees, the nodes represent the actual separation between species, thus providing essential information about their evolutionary history. In addition, multilocus phylogenies can help in analyses of species delimitation, gene flow and genetic differentiation within species. However, few adequate markers are available for such studies. Results In order to develop nuclear markers that can be useful in multilocus studies of mammals, we analyzed the mammalian genomes of human, chimpanzee, macaque, dog and cow. Rodents were excluded due to their unusual genomic features. Introns were extracted from the mammalian genomes because of their greater genetic variability and ease of amplification from the flanking exons. To an initial set of more than 10,000 one-to-one orthologous introns we applied several filters to select introns that belong to single-copy genes, show neutral evolutionary rates and have an adequate length for their amplification. This analysis led to a final list of 224 intron markers randomly distributed along the genome. To experimentally test their validity, we amplified twelve of these introns in a panel of six mammalian species. The result was that seven of these introns gave rise to a PCR band of the expected size in all species. In addition, we sequenced these bands and analyzed the accumulation of substitutions in these introns in five pairs of closely related species. The results showed that the estimated genetic distances in the five species pairs was quite variable among introns and that this divergence cannot be directly predicted from the overall intron divergence in mammals. Conclusions We have designed a new set of 224 nuclear introns with optimal features for the phylogeny of closely related mammalian species. A large proportion of the introns tested experimentally showed a perfect amplification
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.
Directory of Open Access Journals (Sweden)
Indhu Kanakaraj
Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.
Directory of Open Access Journals (Sweden)
S. DÍEZ
1999-11-01
Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de
Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons
Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil
2012-01-01
Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Genotyping of PCR-based polymorphisms and linkage-disequilibrium analysis at the NF1 locus
Energy Technology Data Exchange (ETDEWEB)
Purandare, S.M.; Viskochil, D.H.; Cawthon, R. [Univ. of Utah, Salt Lake City, UT (United States)] [and others
1996-07-01
Six polymorphism across the NF1 gene have been adapted for genotyping through application of PCR-based assays. Three exon-based polymorphisms - at positions 702, 2034, and 10647 in the NF1 cDNA - were genotyped by mutagenically separated PCR (MS-PCR). A fourth polymorphism, DV1.9, is an L1 insertion element in intron 30, and the other two polymorphisms, GXAlu and EVI-20, are short tandem repeats in intron 27b. All the polymorphisms were evaluated in a cohort of 110 CEPH individuals who previously had been analyzed by use of eight RFLPs at the NF1 locus. Pairwise linkage-disequilibrium analyses with the six PCR-based polymorphisms and their flanking markers demonstrated disequilibrium between all tested loci. Genotypes of the four diallelic polymorphisms (702, 2034, 10647, and DV1.9) were also evaluated in cohorts from the CEPH, African, and Japanese populations. The CEPH and Japanese cohorts showed similar heterozygosities and linkage-disequilibrium coefficients. The African cohort showed a higher degree of heterozygosity and lower linkage-disequilibrium values, compared with the CEPH and Japanese cohorts. 36 refs., 2 figs., 3 tabs.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.
Jay, Zackary J; Inskeep, William P
2015-07-09
Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Sequence features responsible for intron retention in human
Directory of Open Access Journals (Sweden)
Sakabe Noboru
2007-02-01
Full Text Available Abstract Background One of the least common types of alternative splicing is the complete retention of an intron in a mature transcript. Intron retention (IR is believed to be the result of intron, rather than exon, definition associated with failure of the recognition of weak splice sites flanking short introns. Although studies on individual retained introns have been published, few systematic surveys of large amounts of data have been conducted on the mechanisms that lead to IR. Results TTo understand how sequence features are associated with or control IR, and to produce a generalized model that could reveal previously unknown signals that regulate this type of alternative splicing, we partitioned intron retention events observed in human cDNAs into two groups based on the relative abundance of both isoforms and compared relevant features. We found that a higher frequency of IR in human is associated with individual introns that have weaker splice sites, genes with shorter intron lengths, higher expression levels and lower density of both a set of exon splicing silencers (ESSs and the intronic splicing enhancer GGG. Both groups of retained introns presented events conserved in mouse, in which the retained introns were also short and presented weaker splice sites. Conclusion Although our results confirmed that weaker splice sites are associated with IR, they showed that this feature alone cannot explain a non-negligible fraction of events. Our analysis suggests that cis-regulatory elements are likely to play a crucial role in regulating IR and also reveals previously unknown features that seem to influence its occurrence. These results highlight the importance of considering the interplay among these features in the regulation of the relative frequency of IR.
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Directory of Open Access Journals (Sweden)
Rui Mao
2017-10-01
Full Text Available Intron retention, one of the most prevalent alternative splicing events in plants, can lead to introns retained in mature mRNAs. However, in comparison with constitutively spliced introns (CSIs, the relevantly distinguishable features for retained introns (RIs are still poorly understood. This work proposes a computational pipeline to discover novel RIs from multiple next-generation RNA sequencing (RNA-Seq datasets of Arabidopsis thaliana. Using this pipeline, we detected 3,472 novel RIs from 18 RNA-Seq datasets and re-confirmed 1,384 RIs which are currently annotated in the TAIR10 database. We also use the expression of intron-containing isoforms as a new feature in addition to the conventional features. Based on these features, RIs are highly distinguishable from CSIs by machine learning methods, especially when the expressional odds of retention (i.e., the expression ratio of the RI-containing isoforms relative to the isoforms without RIs for the same gene reaches to or larger than 50/50. In this case, the RIs and CSIs can be clearly separated by the Random Forest with an outstanding performance of 0.95 on AUC (the area under a receiver operating characteristics curve. The closely related characteristics to the RIs include the low strength of splice sites, high similarity with the flanking exon sequences, low occurrence percentage of YTRAY near the acceptor site, existence of putative intronic splicing silencers (ISSs, i.e., AG/GA-rich motifs and intronic splicing enhancers (ISEs, i.e., TTTT-containing motifs, and enrichment of Serine/Arginine-Rich (SR proteins and heterogeneous nuclear ribonucleoparticle proteins (hnRNPs.
Introns in the genome of bacteriophage T4
International Nuclear Information System (INIS)
Gott, J.M.
1987-01-01
RNA from T4-infected cells yields multiple end-labeled species when incubated with [α- 32 P]GTP under self-splicing conditions. One of these corresponds to the previously characterized intron from the T4 td gene and, as shown in this work, the others represent additional group I introns in T4. Two loci distinct from the td gene were found to hybridize to the mixed GTP-labeled T4 RNA probe. These were mapped to the unlinked genes nrdB and sunY. Cloned DNA from the nrdB region that contained the intron was shown to generate characteristic group I splice products with RNA synthesized in vivo or in vitro. The splice junction of the nrdB gene was determined and the nature of the RNA reaction products characterized. In vivo expression of the nrdB gene and the open reading frame within the intron was studied using in-frame lacZ fusions and primer extension analyses. The data suggest that expression of the intron open reading frame is highly regulated during T4 infection. Possible regulatory mechanisms are discussed
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Lopez, Genghis H; Turner, Robyn M; McGowan, Eunike C; Schoeman, Elizna M; Scott, Stacy A; O'Brien, Helen; Millard, Glenda M; Roulis, Eileen V; Allen, Amanda J; Liew, Yew-Wah; Flower, Robert L; Hyland, Catherine A
2018-03-01
The RhD blood group antigen is extremely polymorphic and the DEL phenotype represents one such class of polymorphisms. The DEL phenotype prevalent in East Asian populations arises from a synonymous substitution defined as RHD*1227A. However, initially, based on genomic and cDNA studies, the genetic basis for a DEL phenotype in Taiwan was attributed to a deletion of RHD Exon 9 that was never verified at the genomic level by any other independent group. Here we investigate the genetic basis for a Caucasian donor with a DEL partial D phenotype and compare the genomic findings to those initial molecular studies. The 3'-region of the RHD gene was amplified by long-range polymerase chain reaction (PCR) for massively parallel sequencing. Primers were designed to encompass a deletion, flanking Exon 9, by standard PCR for Sanger sequencing. Targeted sequencing of exons and flanking introns was also performed. Genomic DNA exhibited a 1012-bp deletion spanning from Intron 8, across Exon 9 into Intron 9. The deletion breakpoints occurred between two 25-bp repeat motifs flanking Exon 9 such that one repeat sequence remained. Deletion mutations bordered by repeat sequences are a hallmark of slipped-strand mispairing (SSM) event. We propose this genetic mechanism generated the germline deletion in the Caucasian donor. Extensive studies show that the RHD*1227A is the most prevalent DEL allele in East Asian populations and may have confounded the initial molecular studies. Review of the literature revealed that the SSM model explains some of the extreme polymorphisms observed in the clinically significant RhD blood group antigen. © 2017 AABB.
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Directory of Open Access Journals (Sweden)
Hamidreza Monavari
2013-12-01
Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Directory of Open Access Journals (Sweden)
Ariel Escobar
2013-03-01
Full Text Available Tuberculosis and brucellosis remain important causes of morbidity and mortality in many countries, for the detection of both diseases requires efficient and sensitive tool for effectuate the diagnosis. This study was aimed to evaluate and compare the duplex PCR versus the nested PCR, for detection of Brucella spp. (BR and Mycobacterium spp. (TB. A total of 100 samples of tissues from tracheo-bronchial lymph nodes, bovine lung and bacterial isolate as positive controls were used. Were evaluated ten combinations of primers which were designed to flank the segment of the 16S rRNA sequence (RB and antigen gen MPB70 (TB, the best result for the Duplex PCR was obtained with the primers Bru-2F/Bru-2R for BR and Tub-1F/Tub-N-R for TB. The amplification of the products was 225 and 230-bp respectively. In order to compare the results of the proposed technique, all samples were initially analyzed and compared between PCR and nested PCR (Kappa, k = 0.85 and the concordance between Duplex PCR and nested PCR (k = 0.88 for the two bacteria was very good.
Mobile group II intron based gene targeting in Lactobacillus plantarum WCFS1.
Sasikumar, Ponnusamy; Paul, Eldho; Gomathi, Sivasamy; Abhishek, Albert; Sasikumar, Sundaresan; Selvam, Govindan Sadasivam
2016-10-01
The usage of recombinant lactic acid bacteria for delivery of therapeutic proteins to the mucosa has been emerging. In the present study, an attempt was made to engineer a thyA mutant of Lactobacillus plantarum (L. plantarum) using lactococcal group II intron Ll.LtrB for the development of biologically contained recombinant L. plantarum for prevention of calcium oxalate stone disease. The 3 kb Ll.LtrB intron donor cassettes from the source vector pACD4C was PCR amplified, ligated into pSIP series of lactobacillus vector pLp_3050sAmyA, yielding a novel vector pLpACD4C (8.6 kb). The quantitative real-time PCR experiment shows 94-fold increased expression of Ll.LtrB intron and 14-fold increased expression of ltrA gene in recombinant L. plantarum containing pLpACD4C. In order to target the thyA gene, the potential intron RNA binding sites in the thyA gene of L. plantarum was predicted with help of computer algorithm. The insertion location 188|189s of thyA gene (lowest E-0.134) was chosen and the wild type intron Ll.LtrB was PCR modified, yielding a retargeted intron of pLpACDthyA. The retargeted intron was expressed by using induction peptide (sppIP), subsequently the integration of intron in thyA gene was identified by PCR screening and finally ThyA - mutant of L. plantarum (ThyA18) was detected. In vitro growth curve result showed that in the absence of thymidine, colony forming units of mutant ThyA18 was decreased, whereas high thymidine concentration (10 μM) supported the growth of the culture until saturation. In conclusion, ThyA - mutant of L. plantarum (ThyA18) constructed in this study will be used as a biologically contained recombinant probiotic to deliver oxalate decarboxylase into the lumen for treatment of hyperoxaluria and calcium oxalate stone deposition. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin
2014-03-01
Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent
2013-09-25
Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.
Directory of Open Access Journals (Sweden)
A Eslami
2012-12-01
Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubulin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleotide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the position 443 was substituted through a nucleotide A creating a restriction site for restriction endonuclease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achieving a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respectively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris
2017-08-01
The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
Energy Technology Data Exchange (ETDEWEB)
Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)
1994-09-01
Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.
Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers
International Nuclear Information System (INIS)
Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.
2007-01-01
Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased
Introns: The Functional Benefits of Introns in Genomes
Directory of Open Access Journals (Sweden)
Bong-Seok Jo
2015-12-01
Full Text Available The intron has been a big biological mystery since it was first discovered in several aspects. First, all of the completely sequenced eukaryotes harbor introns in the genomic structure, whereas no prokaryotes identified so far carry introns. Second, the amount of total introns varies in different species. Third, the length and number of introns vary in different genes, even within the same species genome. Fourth, all introns are copied into RNAs by transcription and DNAs by replication processes, but intron sequences do not participate in protein-coding sequences. The existence of introns in the genome should be a burden to some cells, because cells have to consume a great deal of energy to copy and excise them exactly at the correct positions with the help of complicated spliceosomal machineries. The existence throughout the long evolutionary history is explained, only if selective advantages of carrying introns are assumed to be given to cells to overcome the negative effect of introns. In that regard, we summarize previous research about the functional roles or benefits of introns. Additionally, several other studies strongly suggesting that introns should not be junk will be introduced.
Introns: The Functional Benefits of Introns in Genomes.
Jo, Bong-Seok; Choi, Sun Shim
2015-12-01
The intron has been a big biological mystery since it was first discovered in several aspects. First, all of the completely sequenced eukaryotes harbor introns in the genomic structure, whereas no prokaryotes identified so far carry introns. Second, the amount of total introns varies in different species. Third, the length and number of introns vary in different genes, even within the same species genome. Fourth, all introns are copied into RNAs by transcription and DNAs by replication processes, but intron sequences do not participate in protein-coding sequences. The existence of introns in the genome should be a burden to some cells, because cells have to consume a great deal of energy to copy and excise them exactly at the correct positions with the help of complicated spliceosomal machineries. The existence throughout the long evolutionary history is explained, only if selective advantages of carrying introns are assumed to be given to cells to overcome the negative effect of introns. In that regard, we summarize previous research about the functional roles or benefits of introns. Additionally, several other studies strongly suggesting that introns should not be junk will be introduced.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Kiemnec-Tyburczy, Karen M.; Richmond, Jonathan Q.; Savage, Anna E.; Zamudio, Kelly R.
2010-01-01
Genes encoded by the major histocompatibility complex (MHC) play key roles in the vertebrate immune system. However, our understanding of the evolutionary processes and underlying genetic mechanisms shaping these genes is limited in many taxa, including amphibians, a group currently impacted by emerging infectious diseases. To further elucidate the evolution of the MHC in frogs (anurans) and develop tools for population genetics, we surveyed allelic diversity of the MHC class II ??1 domain in both genomic and complementary DNA of seven New World species in the genus Rana (Lithobates). To assign locus affiliation to our alleles, we used a "gene walking" technique to obtain intron 2 sequences that flanked MHC class II?? exon 2. Two distinct intron sequences were recovered, suggesting the presence of at least two class II?? loci in Rana. We designed a primer pair that successfully amplified an orthologous locus from all seven Rana species. In total, we recovered 13 alleles and documented trans-species polymorphism for four of the alleles. We also found quantitative evidence of selection acting on amino acid residues that are putatively involved in peptide binding and structural stability of the ??1 domain of anurans. Our results indicated that primer mismatch can result in polymerase chain reaction (PCR) bias, which influences the number of alleles that are recovered. Using a single locus may minimize PCR bias caused by primer mismatch, and the gene walking technique was an effective approach for generating single-copy orthologous markers necessary for future studies of MHC allelic variation in natural amphibian populations. ?? 2010 Springer-Verlag.
PCR artifact in testing for homologous recombination in genomic editing in zebrafish.
Directory of Open Access Journals (Sweden)
Minho Won
Full Text Available We report a PCR-induced artifact in testing for homologous recombination in zebrafish. We attempted to replace the lnx2a gene with a donor cassette, mediated by a TALEN induced double stranded cut. The donor construct was flanked with homology arms of about 1 kb at the 5' and 3' ends. Injected embryos (G0 were raised and outcrossed to wild type fish. A fraction of the progeny appeared to have undergone the desired homologous recombination, as tested by PCR using primer pairs extending from genomic DNA outside the homology region to a site within the donor cassette. However, Southern blots revealed that no recombination had taken place. We conclude that recombination happened during PCR in vitro between the donor integrated elsewhere in the genome and the lnx2a locus. We conclude that PCR alone may be insufficient to verify homologous recombination in genome editing experiments in zebrafish.
Origin of introns by 'intronization' of exonic sequences
DEFF Research Database (Denmark)
Irimia, Manuel; Rukov, Jakob Lewin; Penny, David
2008-01-01
The mechanisms of spliceosomal intron creation have proved elusive. Here we describe a new mechanism: the recruitment of internal exonic sequences ('intronization') in Caenorhabditis species. The numbers of intronization events and introns gained by other mechanisms are similar, suggesting that i...
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li
2003-09-01
Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.
Detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluids of pigs by PCR
DEFF Research Database (Denmark)
Baumeister, A.K.; Runge, M.; Ganter, Martin
1998-01-01
In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification...... other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Frus medium...... inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 10(2) CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11...
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Araj, G F; Talhouk, R S; Itani, L Y; Jaber, W; Jamaleddine, G W
2000-09-01
American University of Beirut Medical Center, Lebanon. To assess the performance of a polymerase chain reaction (PCR) using primers that flank 542 bp within IS6110 in Mycobacterium tuberculosis (TB) vs. microscopy and BACTEC culture, in the diagnosis of tuberculosis. A total of 82 clinical respiratory pulmonary specimens and 73 samples from BACTEC vials were tested by the three methods. Of 24 smear-positive culture-positive (SP-CP) and 11 smear-negative culture-positive (SN-CP) TB specimens, PCR detected 83% and 64%, respectively. Among 17 specimens yielding mycobacteria other than tuberculosis (MOTT), the PCR was positive in 33% SP-CP and 14% SN-CP specimens. Among the 73 BACTEC vials, PCR was positive in 36 of 38 (95%) yielding culture-positive TB, and in one of 20 (5%) yielding culture positive MOTT. None of the 30 smear-negative culture-negative (SN-CN) clinical specimens and 15 of the CN vials were positive by PCR. The overall sensitivity of PCR was 77% and 95% for TB detection in respiratory specimens and BACTEC vials, respectively, and the specificity was 94% in both. Because a substantial number of TB cases are missed, especially in SN-CP specimens, a PCR-based assay utilizing these primers cannot be used reliably, alone, in clinical laboratory diagnosis of mycobacterial respiratory infections.
Use of intron-exonic marker in assessment of genetic diversity of two subspecies of Thymus daenensis
Directory of Open Access Journals (Sweden)
Ahmad Ismaili
2013-11-01
Full Text Available Study of genetic diversity in medicinal plant is very important for improvement and evolutionary variations. In this study, assessment of genetic diversity in two subspecies of Thymus daenensis was evaluated, using intron-exonic markers. Thirty primers produced 633 polymorphic bands (98% polymorphism. The highest polymorphic information content (PIC included ISJ5 and ISJ9 primers and the lowest PIC also included IT15-32 primer. The highest marker index (MI produced by IT10-6 primer. Results of Analysis of Molecular Variance (AMOVA showed that intra-sub specific variation was more than inter-sub specific variation. Dendrogram obtained from Cluster analysis, using NTSYS-pc software and UPGMA method based on Dice's similarity matrix, divided accessions into 4 groups. The maximum range of genetic similarity was observed between two accessions of sub-species daenensis. Two accessions of Fars and Semnan formed a separate group. Results showed that clustering based on molecular data and principal coordinate analysis had a medium alignment. Grouping based on cluster analysis also could separate two subspecies of Thymus daenensis. Results obtained from this study showed that intron-exonic markers had an effective potential in assessment of genetic relationships between the two sub-species of daenensis.
Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R
2007-01-01
We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.
Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu
2018-03-15
The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Warenholt Janina
2011-01-01
Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck
Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR
International Nuclear Information System (INIS)
Ben salem, Issam
2007-01-01
Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...
African Journals Online (AJOL)
The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
Microsatellites grant more stable flanking genes
Directory of Open Access Journals (Sweden)
Joukhadar Reem
2012-10-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are DNA sequences that include tandem copies of specific sequences no longer than six bases. SSRs are ubiquitous in all genomes and highly mutable. Presentation of the hypothesis Results from previous studies suggest that flanking regions of SSR are exhibit high stability in a wide range of organisms. We hypothesized that the SSRs ability to discard weak DNA polymerases could be responsible for this unusual stability. . When the weak polymerases are being decayed over SSRs, the flanking sequences would have higher opportunity to be replicated by more stable DNA polymerases. We present evidence of the molecular basis of our hypothesis. Testing the hypothesis The hypothesis could be tested by examining the activity of DNA polymerase during and after a number of PCRs. The PCR reactions should be run with the same SSR locus possessing differences in the SSR length. The hypothesis could also be tested by comparing the mutational rate of a transferred gene between two transformations. The first one has a naked T-DNA (transferred DNA, while the second one has the same T-DNA flanked with two SSRs. Implications of the hypothesis In any transformation experiment, flanking the T-DNA fragment with SSR sequences would result in more stably transferred genes. This process would decrease the unpredictable risks that may occur because of the mutational pressure on this foreign segment.
Directory of Open Access Journals (Sweden)
Liran eCarmel
2012-04-01
Full Text Available The intron-exon architecture of many eukaryotic genes raises the intriguing question of whether this unique organization serves any function, or is it simply a result of the spread of functionless introns in eukaryotic genomes. In this review, we show that introns in contemporary species fulfill a broad spectrum of functions, and are involved in virtually every step of mRNA processing. We propose that this great diversity of intronic functions supports the notion that introns were indeed selfish elements in early eukaryotes, but then independently gained numerous functions in different eukaryotic lineages. We suggest a novel criterion of evolutionary conservation, dubbed intron positional conservation, which can identify functional introns.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Werge, Thomas
2005-01-01
The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...
Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
M Heiat
2010-07-01
Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Bottomless barrel-sponge species in the Indo-Pacific?
Setiawan, Edwin; Voogd, Nicole J De; Wörheide, Gert; Erpenbeck, Dirk
2016-07-06
The use of nuclear markers, in addition to traditional mitochondrial markers, helps to clarify hidden patterns of genetic structure in natural populations (Palumbi & Baker, 1994). This is particularly evident among demosponges that possess slow mitochondrial evolutionary rates compared to Bilateria, where nuclear intron markers can aid in the understanding of shallow level phylogenetic relationships (Shearer et al., 2002). Ideally, these nuclear markers (i) are evolutionary well-conserved across different lineages, (ii) produce amplicons holding a number of sites with sufficient variability to answer the relevant phylogenetic question, (iii) derive from single copy genes (see review in Zhang & Hewitt, 2003). A popular method to amplify intron markers uses EPIC (Exon-Primed, Intron-Crossing) primers that anneal to the more conserved flanking exon regions and subsequently bridge the intron during amplification (Palumbi & Baker, 1994).
Jonathan M. LaMantia; Ambika Chandra; David R. Huff
2018-01-01
Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong
2017-02-01
There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D
2017-12-01
In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Towards barcode markers in Fungi: an intron map of Ascomycota mitochondria.
Santamaria, Monica; Vicario, Saverio; Pappadà, Graziano; Scioscia, Gaetano; Scazzocchio, Claudio; Saccone, Cecilia
2009-06-16
A standardized and cost-effective molecular identification system is now an urgent need for Fungi owing to their wide involvement in human life quality. In particular the potential use of mitochondrial DNA species markers has been taken in account. Unfortunately, a serious difficulty in the PCR and bioinformatic surveys is due to the presence of mobile introns in almost all the fungal mitochondrial genes. The aim of this work is to verify the incidence of this phenomenon in Ascomycota, testing, at the same time, a new bioinformatic tool for extracting and managing sequence databases annotations, in order to identify the mitochondrial gene regions where introns are missing so as to propose them as species markers. The general trend towards a large occurrence of introns in the mitochondrial genome of Fungi has been confirmed in Ascomycota by an extensive bioinformatic analysis, performed on all the entries concerning 11 mitochondrial protein coding genes and 2 mitochondrial rRNA (ribosomal RNA) specifying genes, belonging to this phylum, available in public nucleotide sequence databases. A new query approach has been developed to retrieve effectively introns information included in these entries. After comparing the new query-based approach with a blast-based procedure, with the aim of designing a faithful Ascomycota mitochondrial intron map, the first method appeared clearly the most accurate. Within this map, despite the large pervasiveness of introns, it is possible to distinguish specific regions comprised in several genes, including the full NADH dehydrogenase subunit 6 (ND6) gene, which could be considered as barcode candidates for Ascomycota due to their paucity of introns and to their length, above 400 bp, comparable to the lower end size of the length range of barcodes successfully used in animals. The development of the new query system described here would answer the pressing requirement to improve drastically the bioinformatics support to the DNA Barcode
Directory of Open Access Journals (Sweden)
Stuart F. McDaniel
2013-04-01
Full Text Available Premise of the study: We developed and tested primers for 218 nuclear loci for studying population genetics, phylogeography, and genome evolution in bryophytes. Methods and Results: We aligned expressed sequence tags (ESTs from Ceratodon purpureus to the Physcomitrella patens genome sequence, and designed primers that are homologous to conserved exons but span introns in the P. patens genome. We tested these primers on four isolates from New York, USA; Otavalo, Ecuador; and two laboratory isolates from Austria (WT4 and GG1. The median genome-wide nucleotide diversity was 0.008 substitutions/site, but the range was large (0–0.14, illustrating the among-locus heterogeneity in the species. Conclusions: These loci provide a valuable resource for finely resolved, genome-wide population genetic and species-level phylogenetic analyses of C. purpureus and its relatives.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Development of EST-derived markers in Dendrobium from EST of related taxa
Narisa Juejun; Chataporn Chunwongse; Julapark Chunwongse
2013-01-01
Public databases are useful for molecular marker development. The major aim of this study was to develop expressedsequence tag (EST)-derived markers in Dendrobium from available ESTs of Phalaenopsis and Dendrobium. A total of 6063sequences were screened for simple sequence repeats (SSRs) and introns. Primers flanking these regions were generated andtested on genomic DNAs of Phalaenopsis and Dendrobium. Twenty-three percent of amplifiable Phalaenopsis EST-derivedmarkers were cross-genera trans...
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Exon-primed intron-crossing (EPIC markers for non-model teleost fishes
Directory of Open Access Journals (Sweden)
Riethoven Jean-Jack M
2010-03-01
Full Text Available Abstract Background Exon-primed intron-crossing (EPIC markers have three advantages over anonymous genomic sequences in studying evolution of natural populations. First, the universal primers designed in exon regions can be applied across a broad taxonomic range. Second, the homology of EPIC-amplified sequences can be easily determined by comparing either their exon or intron portion depending on the genetic distance between the taxa. Third, having both the exon and intron fragments could help in examining genetic variation at the intraspecific and interspecific level simultaneously, particularly helpful when studying species complex. However, the paucity of EPIC markers has hindered multilocus studies using nuclear gene sequences, particularly in teleost fishes. Results We introduce a bioinformatics pipeline for developing EPIC markers by comparing the whole genome sequences between two or more species. By applying this approach on five teleost fishes whose genomes were available in the Ensembl database http://www.ensembl.org, we identified 210 EPIC markers that have single-copy and conserved exon regions with identity greater than 85% among the five teleost fishes. We tested 12 randomly chosen EPIC markers in nine teleost species having a wide phylogenetic range. The success rate of amplifying and sequencing those markers varied from 44% to 100% in different species. We analyzed the exon sequences of the 12 EPIC markers from 13 teleosts. The resulting phylogeny contains many traditionally well-supported clades, indicating the usefulness of the exon portion of EPIC markers in reconstructing species phylogeny, in addition to the value of the intron portion of EPIC markers in interrogating the population history. Conclusions This study illustrated an effective approach to develop EPIC markers in a taxonomic group, where two or more genome sequences are available. The markers identified could be amplified across a broad taxonomic range of teleost
A method for accurate detection of genomic microdeletions using real-time quantitative PCR
Directory of Open Access Journals (Sweden)
Bassett Anne S
2005-12-01
Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
PCR approach for rapid detection of Escherichia coli in tempe using a specific primer
Directory of Open Access Journals (Sweden)
Siti Harnina Bintari
2014-12-01
Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.
The Biology of Intron Gain and Loss
DEFF Research Database (Denmark)
Jeffares, Daniel C; Mourier, Tobias; Penny, David
2006-01-01
Intron density in eukaryote genomes varies by more than three orders of magnitude, so there must have been extensive intron gain and/or intron loss during evolution. A favored and partial explanation for this range of intron densities has been that introns have accumulated stochastically in large...... on introns depending on the biology of the organism and the gene involved....
Detection of Mycoplasma hyopneumoniae in Bronchoalveolar Lavage Fluids of Pigs by PCR
Baumeister, A. Katrin; Runge, Martin; Ganter, Martin; Feenstra, Anne A.; Delbeck, Friedrich; Kirchhoff, Helga
1998-01-01
In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 102 CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11 other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Friis medium and (ii) with DNA extracted from the BALFs. In addition, PCR was performed with postmortem lung washings from 19 of the 40 pigs, and immunofluorescence tests were carried out with sections of lungs from 18 of the 40 pigs. M. hyopneumoniae could not be detected in 18 of the 40 pigs by any of the five methods tested. The remaining 22 pigs showed a positive reaction by the PCR with DNA extracted from the BALFs and variable positive reactions by the other tests. A complete correspondence could be observed between the immunofluorescence test result and the result of PCR with DNA. The investigation shows that the PCR with DNA extracted from BALFs is a suitable technique for the sensitive and specific in vivo detection of M. hyopneumoniae. PMID:9650949
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Qurollo, Barbara A; Archer, Nikole R; Schreeg, Megan E; Marr, Henry S; Birkenheuer, Adam J; Haney, Kaitlin N; Thomas, Brittany S; Breitschwerdt, Edward B
2017-03-07
Babesiosis is a protozoal, tick transmitted disease found worldwide in humans, wildlife and domesticated animals. Commonly used approaches to diagnose babesiosis include microscopic examination of peripheral blood smears, detection of circulating antibodies and PCR. To screen and differentiate canine Babesia infections many PCR assays amplify the 18S rRNA gene. These sequences contain hypervariable regions flanked by highly conserved regions allowing for amplification of a broad-range of Babesia spp. However, differences in the 18S rRNA gene sequence of distantly related clades can make it difficult to design assays that will amplify all Babesia species while excluding the amplification of other eukaryotes. By targeting Babesia mitochondrial genome (mtDNA), we designed a novel three primer qPCR with greater sensitivity and broader screening capabilities to diagnose and differentiate Babesia spp. Using 13 Babesia mtDNA sequences, a region spanning two large subunit rRNA gene fragments (lsu5-lsu4) was aligned to design three primers for use in a qPCR assay (LSU qPCR) capable of amplifying a wide range of Babesia spp. Plasmid clones were generated and used as standards to determine efficiency, linear dynamic range and analytical sensitivity. Animals naturally infected with vector-borne pathogens were tested retrospectively and prospectively to determine relative clinical sensitivity and specificity by comparing the LSU qPCR to an established 18S rDNA qPCR. The LSU qPCR efficiencies ranged between 92 and 100% with the limit of detection at five copies/reaction. The assay did not amplify mammalian host or other vector-borne pathogen gDNA except Cytauxzoon felis (a feline protozoal pathogen). The LSU qPCR assay amplified 12 different Babesia. sp. and C. felis from 31/31 (100%) archived samples, whereas the 18S qPCR amplified only 26/31 (83.9%). By prospective analysis, 19/394 diagnostic accessions (4.8%) were LSU qPCR positive, compared to 11/394 (2.8%) 18S rDNA qPCR
Differentiation and fiber type-specific activity of a muscle creatine kinase intronic enhancer
Directory of Open Access Journals (Sweden)
Tai Phillip WL
2011-07-01
Full Text Available Abstract Background Hundreds of genes, including muscle creatine kinase (MCK, are differentially expressed in fast- and slow-twitch muscle fibers, but the fiber type-specific regulatory mechanisms are not well understood. Results Modulatory region 1 (MR1 is a 1-kb regulatory region within MCK intron 1 that is highly active in terminally differentiating skeletal myocytes in vitro. A MCK small intronic enhancer (MCK-SIE containing a paired E-box/myocyte enhancer factor 2 (MEF2 regulatory motif resides within MR1. The SIE's transcriptional activity equals that of the extensively characterized 206-bp MCK 5'-enhancer, but the MCK-SIE is flanked by regions that can repress its activity via the individual and combined effects of about 15 different but highly conserved 9- to 24-bp sequences. ChIP and ChIP-Seq analyses indicate that the SIE and the MCK 5'-enhancer are occupied by MyoD, myogenin and MEF2. Many other E-boxes located within or immediately adjacent to intron 1 are not occupied by MyoD or myogenin. Transgenic analysis of a 6.5-kb MCK genomic fragment containing the 5'-enhancer and proximal promoter plus the 3.2-kb intron 1, with and without MR1, indicates that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers (types I and IIa, respectively, but is not required for expression in fast-twitch muscle fibers (types IIb and IId. Conclusions In this study, we discovered that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers and that MR1's positive transcriptional activity depends on a paired E-box MEF2 site motif within a SIE. This is the first study to delineate the DNA controls for MCK expression in different skeletal muscle fiber types.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Rogozin, Igor B; Wolf, Yuri I; Sorokin, Alexander V; Mirkin, Boris G; Koonin, Eugene V
2003-09-02
Sequencing of eukaryotic genomes allows one to address major evolutionary problems, such as the evolution of gene structure. We compared the intron positions in 684 orthologous gene sets from 8 complete genomes of animals, plants, fungi, and protists and constructed parsimonious scenarios of evolution of the exon-intron structure for the respective genes. Approximately one-third of the introns in the malaria parasite Plasmodium falciparum are shared with at least one crown group eukaryote; this number indicates that these introns have been conserved through >1.5 billion years of evolution that separate Plasmodium from the crown group. Paradoxically, humans share many more introns with the plant Arabidopsis thaliana than with the fly or nematode. The inferred evolutionary scenario holds that the common ancestor of Plasmodium and the crown group and, especially, the common ancestor of animals, plants, and fungi had numerous introns. Most of these ancestral introns, which are retained in the genomes of vertebrates and plants, have been lost in fungi, nematodes, arthropods, and probably Plasmodium. In addition, numerous introns have been inserted into vertebrate and plant genes, whereas, in other lineages, intron gain was much less prominent.
Directory of Open Access Journals (Sweden)
Paula Rogério Fernandes
2008-09-01
Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Shahzad, K.
2015-01-01
Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.
International Nuclear Information System (INIS)
Lina, M.; Dadang, S.; Suhadi, F.
2002-01-01
Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer
Splinkerette PCR for mapping transposable elements in Drosophila.
Directory of Open Access Journals (Sweden)
Christopher J Potter
2010-04-01
Full Text Available Transposable elements (such as the P-element and piggyBac have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transposon insertion, or simplifying recombination experiments. The most commonly used transgene mapping method is inverse PCR (iPCR. Although usually effective, limitations with iPCR hinder its ability to isolate flanking genomic DNA in complex genomic loci, such as those that contain natural transposons. Here we report the adaptation of the splinkerette PCR (spPCR method for the isolation of flanking genomic DNA of any P-element or piggyBac. We report a simple and detailed protocol for spPCR. We use spPCR to 1 map a GAL4 enhancer trap located inside a natural transposon, pinpointing a master regulatory region for olfactory neuron expression in the brain; and 2 map all commonly used centromeric FRT insertion sites. The ease, efficiency, and efficacy of spPCR could make it a favored choice for the mapping of transposable element in Drosophila.
DEFF Research Database (Denmark)
Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl
2002-01-01
sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
International Nuclear Information System (INIS)
Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael
2014-01-01
The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
DEFF Research Database (Denmark)
Balint, Adam; Tenk, Miklós; Deim, Zoltán
2009-01-01
A real-time PCR assay, based on Primer-Probe Energy Transfer (PriProET), was developed to improve the detection and quantification of porcine circovirus type 2 (PVC2). PCV2 is recognised as the essential infectious agent in post-weaning multisystemic wasting syndrome (PMWS) and has been associated...... in different organs. The data obtained in this study correlate with those described earlier; namely, the viral load in 1 ml plasma and in 500 ng tissue DNA exceeds 10(7) copies in the case of PMWS. The results indicate that the new assay provides a specific, sensitive and robust tool for the improved detection...... and quantification of PCV2....
Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha
2012-01-01
Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780
A Novel PCR Assay for Detecting Brucella abortus and Brucella melitensis.
Alamian, Saeed; Esmaelizad, Majid; Zahraei, Taghi; Etemadi, Afshar; Mohammadi, Mohsen; Afshar, Davoud; Ghaderi, Soheila
2017-02-01
Brucellosis is a major zoonotic disease that poses a significant public health threat worldwide. The classical bacteriological detection process used to identify Brucella spp. is difficult and time-consuming. This study aimed to develop a novel molecular assay for detecting brucellosis. All complete sequences of chromosome 1 with 2.1-Mbp lengths were compared among all available Brucella sequences. A unique repeat sequence (URS) locus on chromosome 1 could differentiate Brucella abortus from Brucella melitensis . A primer set was designed to flank the unique locus. A total of 136 lymph nodes and blood samples were evaluated and classified by the URS-polymerase chain reaction (PCR) method in 2013-2014. Biochemical tests and bacteriophage typing as the golden standard indicated that all Brucella spp. isolates were B. melitensis biovar 1 and B. abortus biovar 3. The PCR results were the same as the bacteriological method for detecting Brucella spp. The sensitivity and specificity of the URS-PCR method make it suitable for detecting B. abortus and B. melitensis . Quick detection of B. abortus and B. melitensis can provide the most effective strategies for control of these bacteria. The advantage of this method over other presented methods is that both B. abortus and B. melitensis are detectable in a single test tube. Furthermore, this method covered 100% of all B. melitensis and B. abortus biotypes. The development of this URS-PCR method is the first step toward the development of a novel kit for the molecular identification of B. abortus and B. melitensis .
Directory of Open Access Journals (Sweden)
Kenji Fukunaga
2015-12-01
Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.
Tuomi, Jari Michael; Voorbraak, Frans; Jones, Douglas L.; Ruijter, Jan M.
2010-01-01
For real-time monitoring of PCR amplification of DNA, quantitative PCR (qPCR) assays use various fluorescent reporters. DNA binding molecules and hybridization reporters (primers and probes) only fluoresce when bound to DNA and result in the non-cumulative increase in observed fluorescence.
Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.
2016-01-01
We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Imprecise intron losses are less frequent than precise intron losses but are not rare in plants.
Ma, Ming-Yue; Zhu, Tao; Li, Xue-Nan; Lan, Xin-Ran; Liu, Heng-Yuan; Yang, Yu-Fei; Niu, Deng-Ke
2015-05-27
In this study, we identified 19 intron losses, including 11 precise intron losses (PILs), six imprecise intron losses (IILs), one de-exonization, and one exon deletion in tomato and potato, and 17 IILs in Arabidopsis thaliana. Comparative analysis of related genomes confirmed that all of the IILs have been fixed during evolution. Consistent with previous studies, our results indicate that PILs are a major type of intron loss. However, at least in plants, IILs are unlikely to be as rare as previously reported. This article was reviewed by Jun Yu and Zhang Zhang. For complete reviews, see the Reviewers' Reports section.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-11-01
Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.
Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR
Directory of Open Access Journals (Sweden)
Hoseong Choi
2013-03-01
Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
International Nuclear Information System (INIS)
Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham
2007-01-01
The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)
Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N
2018-06-01
Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Extensive intron gain in the ancestor of placental mammals
2011-01-01
Background Genome-wide studies of intron dynamics in mammalian orthologous genes have found convincing evidence for loss of introns but very little for intron turnover. Similarly, large-scale analysis of intron dynamics in a few vertebrate genomes has identified only intron losses and no gains, indicating that intron gain is an extremely rare event in vertebrate evolution. These studies suggest that the intron-rich genomes of vertebrates do not allow intron gain. The aim of this study was to search for evidence of de novo intron gain in domesticated genes from an analysis of their exon/intron structures. Results A phylogenomic approach has been used to analyse all domesticated genes in mammals and chordates that originated from the coding parts of transposable elements. Gain of introns in domesticated genes has been reconstructed on well established mammalian, vertebrate and chordate phylogenies, and examined as to where and when the gain events occurred. The locations, sizes and amounts of de novo introns gained in the domesticated genes during the evolution of mammals and chordates has been analyzed. A significant amount of intron gain was found only in domesticated genes of placental mammals, where more than 70 cases were identified. De novo gained introns show clear positional bias, since they are distributed mainly in 5' UTR and coding regions, while 3' UTR introns are very rare. In the coding regions of some domesticated genes up to 8 de novo gained introns have been found. Intron densities in Eutheria-specific domesticated genes and in older domesticated genes that originated early in vertebrates are lower than those for normal mammalian and vertebrate genes. Surprisingly, the majority of intron gains have occurred in the ancestor of placentals. Conclusions This study provides the first evidence for numerous intron gains in the ancestor of placental mammals and demonstrates that adequate taxon sampling is crucial for reconstructing intron evolution. The
Reenacting the birth of an intron
Energy Technology Data Exchange (ETDEWEB)
Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.; Rokhsar, Daniel S.
2011-07-01
An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.
Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A
2016-01-01
The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.
Pan, Tzu-Yu; Chiou, Shyh-Shin; Wang, Chun-Chi; Wu, Shou-Mei
2014-12-01
An inverse-shifting polymerase chain reaction (IS-PCR) combined with short-end capillary gel electrophoresis (CGE) was developed for genotyping of intron 22 inversion Type 1 (Inv22-1) and Type 2 (Inv22-2) of hemophilia A (HA). Severe HA cases are affected by intron 22 inversion around 45-50%. Inv22-1 has higher frequency than Inv22-2. The aim of this study is to distinguish them by genotyping. In order to improve Inv22 genotyping efficiency, five primers were designed and applied to differentiate the wild type, Inv22-1, Inv22-2 and carrier. Three amplicons of 405, 457 and 512 bp were recognized for wild type; 333, 457 and 584 bp for Inv22-1; 385, 405 and 584 bp for Inv22-2. The Inv22-1 carrier has 5 amplicons including 333, 405, 457, 512, 584 bp and Inv22-2 carrier is differentiated by 385, 405, 457, 512 and 584 bp. The amplicons between Inv22-1 and Inv22-2 carriers are only different in 333 bp for Inv22-1 carrier and 385 bp for Inv22-2 carrier. Capillary gel electrophoresis (CGE) was used for separation within 5 min. The separation voltage was set at 8 kV (cathode at detector), and the temperature was kept at 25°C. The sieving matrix was 89 mM Tris, 89 mM boric acid, 2mM EDTA containing 0.4% (w/v) HPMC and 1 μM of YO-PRO(®)-1 Iodide. Total of 50 HA patients (including 35 non-Inv22, 14 Inv22-1, and one Inv22-2 patients) and 7 HA carriers were diagnosed in the application. Seven random samples (5 patients and 2 carriers) were subjected to comparison and gave identical results of DNA sequencing and this modified IS-PCR. Copyright © 2014 Elsevier B.V. All rights reserved.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Directory of Open Access Journals (Sweden)
Mario Torrado
2018-01-01
Full Text Available Marfan syndrome (MFS is an autosomal dominantly inherited connective tissue disorder, mostly caused by mutations in the fibrillin-1 (FBN1 gene. We, by using targeted next-generation sequence analysis, identified a novel intronic FBN1 mutation (the c.2678-15C>A variant in a MFS patient with aortic dilatation. The computational predictions showed that the heterozygous c.2678-15C>A intronic variant might influence the splicing process by differentially affecting canonical versus cryptic splice site utilization within intron 22 of the FBN1 gene. RT-PCR and Western blot analyses, using FBN1 minigenes transfected into HeLa and COS-7 cells, revealed that the c.2678-15C>A variant disrupts normal splicing of intron 22 leading to aberrant 13-nt intron 22 inclusion, frameshift, and premature termination codon. Collectively, the results strongly suggest that the c.2678-15C>A variant could lead to haploinsufficiency of the FBN1 functional protein and structural connective tissue fragility in MFS complicated by aorta dilation, a finding that further expands on the genetic basis of aortic pathology.
The peculiarities of large intron splicing in animals.
Directory of Open Access Journals (Sweden)
Samuel Shepard
Full Text Available In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These "large introns" must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5' and 3' acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing-a consecutive splicing from the 5'-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites.
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
Comparison of agglutination test, microscopy and nPCR for ...
African Journals Online (AJOL)
action (nPCR) for the detection of T. gondii infection in mice (n=399) inoculated with heart .... Direct Agglutination Test (DAT) (Toxo screen DA, Biomerieux®, France) fol- ... 0.3 µl external forward Primer (50 µM), 0.3 µl external reverse Primer.
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Shahzad, K.; Rauf, M.; Ahmed, M.; Malik, Z. A.; Habib, I.; Ahmed, Z.; Mahmood, K.; Ali, R.; Masmoudi, K.; Lemtiri-Chlieh, Fouad; Gehring, Christoph A; Berkowitz, G. A.; Saeed, N. A.
2015-01-01
Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
SCREENING OF COMMON FLAX FAD GENES BY PCR
Directory of Open Access Journals (Sweden)
Veronika Štefúnová
2013-02-01
Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Directory of Open Access Journals (Sweden)
Kyusik Jeong
2011-04-01
Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.
Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A
2002-02-01
The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.
Evolution of the Exon-Intron Structure in Ciliate Genomes.
Directory of Open Access Journals (Sweden)
Vladyslav S Bondarenko
Full Text Available A typical eukaryotic gene is comprised of alternating stretches of regions, exons and introns, retained in and spliced out a mature mRNA, respectively. Although the length of introns may vary substantially among organisms, a large fraction of genes contains short introns in many species. Notably, some Ciliates (Paramecium and Nyctotherus possess only ultra-short introns, around 25 bp long. In Paramecium, ultra-short introns with length divisible by three (3n are under strong evolutionary pressure and have a high frequency of in-frame stop codons, which, in the case of intron retention, cause premature termination of mRNA translation and consequent degradation of the mis-spliced mRNA by the nonsense-mediated decay mechanism. Here, we analyzed introns in five genera of Ciliates, Paramecium, Tetrahymena, Ichthyophthirius, Oxytricha, and Stylonychia. Introns can be classified into two length classes in Tetrahymena and Ichthyophthirius (with means 48 bp, 69 bp, and 55 bp, 64 bp, respectively, but, surprisingly, comprise three distinct length classes in Oxytricha and Stylonychia (with means 33-35 bp, 47-51 bp, and 78-80 bp. In most ranges of the intron lengths, 3n introns are underrepresented and have a high frequency of in-frame stop codons in all studied species. Introns of Paramecium, Tetrahymena, and Ichthyophthirius are preferentially located at the 5' and 3' ends of genes, whereas introns of Oxytricha and Stylonychia are strongly skewed towards the 5' end. Analysis of evolutionary conservation shows that, in each studied genome, a significant fraction of intron positions is conserved between the orthologs, but intron lengths are not correlated between the species. In summary, our study provides a detailed characterization of introns in several genera of Ciliates and highlights some of their distinctive properties, which, together, indicate that splicing spellchecking is a universal and evolutionarily conserved process in the biogenesis of short
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Beng Hooi Phang
Full Text Available Multiple single nucleotide polymorphisms (SNPs have been identified in the tumor suppressor gene p53, though the relevance of many of them is unclear. Some of them are also differentially distributed in various ethnic populations, suggesting selective functionality. We have therefore sequenced all exons and flanking regions of p53 from the Singaporean Chinese population and report here the characterization of some novel and uncharacterized SNPs - four in intron 1 (nucleotide positions 8759/10361/10506/11130, three in intron 3 (11968/11969/11974 and two in the 3'UTR (19168/19514. Allelic frequencies were determined for all these and some known SNPs, and were compared in a limited scale to leukemia and lung cancer patient samples. Intron 2 (11827 and 7 (14181/14201 SNPs were found to have a high minor allele frequency of between 26-47%, in contrast to the lower frequencies found in the US population, but similar in trend to the codon 72 polymorphism (SNP12139 that shows a distribution pattern correlative with latitude. Several of the SNPs were linked, such as those in introns 1, 3 and 7. Most interestingly, we noticed the co-segregation of the intron 2 and the codon 72 SNPs, the latter which has been shown to be expressed in an allele-specific manner, suggesting possible regulatory cross-talk. Association analysis indicated that the T/G alleles in both the co-segregating intron 7 SNPs and a 4tagSNP haplotype was strongly associated increased susceptibility to lung cancer in non-smoker females [OR: 1.97 (1.32, 3.394]. These data together demonstrate high SNP diversity in p53 gene between different populations, highlighting ethnicity-based differences, and their association with cancer risk.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Directory of Open Access Journals (Sweden)
Miyazawa Takayuki
2010-12-01
Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.
Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.
West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D
1995-01-01
A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625
A simple RT-PCR-based strategy for screening connexin identity
Directory of Open Access Journals (Sweden)
M. Urban
1999-08-01
Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.
Malonyl CoA decarboxylase deficiency: C to T transition in intron 2 of the MCD gene.
Surendran, S; Sacksteder, K A; Gould, S J; Coldwell, J G; Rady, P L; Tyring, S K; Matalon, R
2001-09-15
Malonyl CoA decarboxylase (MCD) is an enzyme involved in the metabolism of fatty acids synthesis. Based on reports of MCD deficiency, this enzyme is particular important in muscle and brain metabolism. Mutations in the MCD gene result in a deficiency of MCD activity, that lead to psychomotor retardation, cardiomyopathy and neonatal death. To date however, only a few patients have been reported with defects in MCD. We report here studies of a patient with MCD deficiency, who presented with hypotonia, cardiomyopathy and psychomotor retardation. DNA sequencing of MCD revealed a homozygous intronic mutation, specifically a -5 C to T transition near the acceptor site for exon 3. RT-PCR amplification of exons 2 and 3 revealed that although mRNA from a normal control sample yielded one major DNA band, the mutant mRNA sample resulted in two distinct DNA fragments. Sequencing of the patient's two RT-PCR products revealed that the larger molecular weight fragments contained exons 2 and 3 as well as the intervening intronic sequence. The smaller size band from the patient contained the properly spliced exons, similar to the normal control. Western blotting analysis of the expressed protein showed only a faint band in the patient sample in contrast to a robust band in the control. In addition, the enzyme activity of the mutant protein was lower than that of the control protein. The data indicate that homozygous mutation in intron 2 disrupt normal splicing of the gene, leading to lower expression of the MCD protein and MCD deficiency. Copyright 2001 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Heath Sekou
2007-02-01
Full Text Available Abstract Background The human bacterial pathogen Campylobacter jejuni contains two subspecies: C. jejuni subsp. jejuni (Cjj and C. jejuni subsp. doylei (Cjd. Although Cjd strains are isolated infrequently in many parts of the world, they are obtained primarily from human clinical samples and result in an unusual clinical symptomatology in that, in addition to gastroenteritis, they are associated often with bacteremia. In this study, we describe a novel multiplex PCR method, based on the nitrate reductase (nap locus, that can be used to unambiguously subspeciate C. jejuni isolates. Results Internal and flanking napA and napB primer sets were designed, based on existing C. jejuni and Campylobacter coli genome sequences to create two multiplex PCR primer sets, nap mpx1 and nap mpx2. Genomic DNA from 161 C. jejuni subsp. jejuni (Cjj and 27 C. jejuni subsp. doylei (Cjd strains were amplified with these multiplex primer sets. The Cjd strains could be distinguished clearly from the Cjj strains using either nap mpx1 or mpx2. In addition, combination of either nap multiplex method with an existing lpxA speciation multiplex method resulted in the unambiguous and simultaneous speciation and subspeciation of the thermophilic Campylobacters. The Cjd nap amplicons were also sequenced: all Cjd strains tested contained identical 2761 bp deletions in napA and several Cjd strains contained deletions in napB. Conclusion The nap multiplex PCR primer sets are robust and give a 100% discrimination of C. jejuni subspecies. The ability to rapidly subspeciate C. jejuni as well as speciate thermophilic Campylobacter species, most of which are pathogenic in humans, in a single amplification will be of value to clinical laboratories in strain identification and the determination of the environmental source of campylobacterioses caused by Cjd. Finally, the sequences of the Cjd napA and napB loci suggest that Cjd strains arose from a common ancestor, providing clues as to
Patterns of intron gain and conservation in eukaryotic genes
Directory of Open Access Journals (Sweden)
Wolf Yuri I
2007-10-01
Full Text Available Abstract Background: The presence of introns in protein-coding genes is a universal feature of eukaryotic genome organization, and the genes of multicellular eukaryotes, typically, contain multiple introns, a substantial fraction of which share position in distant taxa, such as plants and animals. Depending on the methods and data sets used, researchers have reached opposite conclusions on the causes of the high fraction of shared introns in orthologous genes from distant eukaryotes. Some studies conclude that shared intron positions reflect, almost entirely, a remarkable evolutionary conservation, whereas others attribute it to parallel gain of introns. To resolve these contradictions, it is crucial to analyze the evolution of introns by using a model that minimally relies on arbitrary assumptions. Results: We developed a probabilistic model of evolution that allows for variability of intron gain and loss rates over branches of the phylogenetic tree, individual genes, and individual sites. Applying this model to an extended set of conserved eukaryotic genes, we find that parallel gain, on average, accounts for only ~8% of the shared intron positions. However, the distribution of parallel gains over the phylogenetic tree of eukaryotes is highly non-uniform. There are, practically, no parallel gains in closely related lineages, whereas for distant lineages, such as animals and plants, parallel gains appear to contribute up to 20% of the shared intron positions. In accord with these findings, we estimated that ancestral introns have a high probability to be retained in extant genomes, and conversely, that a substantial fraction of extant introns have retained their positions since the early stages of eukaryotic evolution. In addition, the density of sites that are available for intron insertion is estimated to be, approximately, one in seven basepairs. Conclusion: We obtained robust estimates of the contribution of parallel gain to the observed
Directory of Open Access Journals (Sweden)
Rafael Nisa-Martínez
Full Text Available Bacterial group II introns are self-splicing catalytic RNAs and mobile retroelements that have an open reading frame encoding an intron-encoded protein (IEP with reverse transcriptase (RT and RNA splicing or maturase activity. Some IEPs carry a DNA endonuclease (En domain, which is required to cleave the bottom strand downstream from the intron-insertion site for target DNA-primed reverse transcription (TPRT of the inserted intron RNA. Host factors complete the insertion of the intron. By contrast, the major retrohoming pathway of introns with IEPs naturally lacking endonuclease activity, like the Sinorhizobium meliloti intron RmInt1, is thought to involve insertion of the intron RNA into the template for lagging strand DNA synthesis ahead of the replication fork, with possible use of the nascent strand to prime reverse transcription of the intron RNA. The host factors influencing the retrohoming pathway of such introns have not yet been described. Here, we identify key candidates likely to be involved in early and late steps of RmInt1 retrohoming. Some of these host factors are common to En+ group II intron retrohoming, but some have different functions. Our results also suggest that the retrohoming process of RmInt1 may be less dependent on the intracellular free Mg2+ concentration than those of other group II introns.
Voorbij, Annemarie M. W. Y.; van Steenbeek, Frank G.; Vos-Loohuis, Manon; Martens, Ellen E. C. P.; Hanson-Nilsson, Jeanette M.; van Oost, Bernard A.; Kooistra, Hans S.; Leegwater, Peter A.
2011-01-01
Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism. PMID:22132174
Directory of Open Access Journals (Sweden)
Mallya Meera
2008-09-01
Full Text Available Abstract Background Regulation of the expression of particular genes can rely on mechanisms that are different from classical transcriptional and translational control. The LY6G5B and LY6G6D genes encode LY-6 domain proteins, whose expression seems to be regulated in an original fashion, consisting of an intron retention event which generates, through an early premature stop codon, a non-coding transcript, preventing expression in most cell lines and tissues. Results The MHC LY-6 non-coding transcripts have shown to be stable and very abundant in the cell, and not subject to Nonsense Mediated Decay (NMD. This retention event appears not to be solely dependent on intron features, because in the case of LY6G5B, when the intron is inserted in the artificial context of a luciferase expression plasmid, it is fully spliced but strongly stabilises the resulting luciferase transcript. In addition, by quantitative PCR we found that the retained and spliced forms are differentially expressed in tissues indicating an active regulation of the non-coding transcript. EST database analysis revealed that these genes have an alternative expression pathway with the formation of Transcription Induced Chimeras (TIC. This data was confirmed by RT-PCR, revealing the presence of different transcripts that would encode the chimeric proteins CSNKβ-LY6G5B and G6F-LY6G6D, in which the LY-6 domain would join to a kinase domain and an Ig-like domain, respectively. Conclusion In conclusion, the LY6G5B and LY6G6D intron-retained transcripts are not subjected to NMD and are more abundant than the properly spliced forms. In addition, these genes form chimeric transcripts with their neighbouring same orientation 5' genes. Of interest is the fact that the 5' genes (CSNKβ or G6F undergo differential splicing only in the context of the chimera (CSNKβ-LY6G5B or G6F-LY6G6C and not on their own.
Directory of Open Access Journals (Sweden)
Camara Mark D
2008-05-01
Full Text Available Abstract Background Since it was first described in the mid-1990s, quantitative real time PCR (Q-PCR has been widely used in many fields of biomedical research and molecular diagnostics. This method is routinely used to validate whole transcriptome analyses such as DNA microarrays, suppressive subtractive hybridization (SSH or differential display techniques such as cDNA-AFLP (Amplification Fragment Length Polymorphism. Despite efforts to optimize the methodology, misleading results are still possible, even when standard optimization approaches are followed. Results As part of a larger project aimed at elucidating transcriptome-level responses of Pacific oysters (Crassostrea gigas to various environmental stressors, we used microarrays and cDNA-AFLP to identify Expressed Sequence Tag (EST fragments that are differentially expressed in response to bacterial challenge in two heat shock tolerant and two heat shock sensitive full-sib oyster families. We then designed primers for these differentially expressed ESTs in order to validate the results using Q-PCR. For two of these ESTs we tested fourteen primer pairs each and using standard optimization methods (i.e. melt-curve analysis to ensure amplification of a single product, determined that of the fourteen primer pairs tested, six and nine pairs respectively amplified a single product and were thus acceptable for further testing. However, when we used these primers, we obtained different statistical outcomes among primer pairs, raising unexpected but serious questions about their reliability. We hypothesize that as a consequence of high levels of sequence polymorphism in Pacific oysters, Q-PCR amplification is sub-optimal in some individuals because sequence variants in priming sites results in poor primer binding and amplification in some individuals. This issue is similar to the high frequency of null alleles observed for microsatellite markers in Pacific oysters. Conclusion This study highlights
Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.
Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan
2017-05-12
Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.
Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário
2017-10-03
A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.
Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário
2017-01-01
A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.
Prevost, S; Andre, S; Remize, F
2010-12-01
Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.
Site-specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron.
Johnson, Cayla M; Fisher, Derek J
2013-01-01
Chlamydia trachomatis is an obligate, intracellular bacterial pathogen that has until more recently remained recalcitrant to genetic manipulation. However, the field still remains hindered by the absence of tools to create selectable, targeted chromosomal mutations. Previous work with mobile group II introns demonstrated that they can be retargeted by altering DNA sequences within the intron's substrate recognition region to create site-specific gene insertions. This platform (marketed as TargeTron™, Sigma) has been successfully employed in a variety of bacteria. We subsequently modified TargeTron™ for use in C. trachomatis and as proof of principle used our system to insertionally inactivate incA, a chromosomal gene encoding a protein required for homotypic fusion of chlamydial inclusions. C. trachomatis incA::GII(bla) mutants were selected with ampicillin and plaque purified clones were then isolated for genotypic and phenotypic analysis. PCR, Southern blotting, and DNA sequencing verified proper GII(bla) insertion, while continuous passaging in the absence of selection demonstrated that the insertion was stable. As seen with naturally occurring IncA(-) mutants, light and immunofluorescence microscopy confirmed the presence of non-fusogenic inclusions in cells infected with the incA::GII(bla) mutants at a multiplicity of infection greater than one. Lack of IncA production by mutant clones was further confirmed by Western blotting. Ultimately, the ease of retargeting the intron, ability to select for mutants, and intron stability in the absence of selection makes this method a powerful addition to the growing chlamydial molecular toolbox.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Analysis of ribosomal protein gene structures: implications for intron evolution.
Directory of Open Access Journals (Sweden)
2006-03-01
Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.
Directory of Open Access Journals (Sweden)
Kristel Kaer
Full Text Available Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown.Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals.Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Inheritance of the group I rDNA intron in Tetrahymena pigmentosa
DEFF Research Database (Denmark)
Nielsen, Henrik; Simon, E M; Engberg, J
1992-01-01
- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing...
Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab
2016-07-01
The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.
The ability to form full-length intron RNA circles is a general property of nuclear group I introns
DEFF Research Database (Denmark)
Nielsen, Henrik; Fiskaa, Tonje; Birgisdottir, Asa Birna
2003-01-01
at the expense of the host. The circularization pathway has distinct structural requirements that differ from those of splicing and appears to be specifically suppressed in vivo. The ability to form full-length circles is found in all types of nuclear group I introns, including those from the Tetrahymena...... ribosomal DNA. The biological function of the full-length circles is not known, but the fact that the circles contain the entire genetic information of the intron suggests a role in intron mobility....
Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.
Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D
2002-12-20
A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Use of species-specific PCR for the identification of 10 sea cucumber species
Wen, Jing; Zeng, Ling
2014-11-01
We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.
Introns Protect Eukaryotic Genomes from Transcription-Associated Genetic Instability.
Bonnet, Amandine; Grosso, Ana R; Elkaoutari, Abdessamad; Coleno, Emeline; Presle, Adrien; Sridhara, Sreerama C; Janbon, Guilhem; Géli, Vincent; de Almeida, Sérgio F; Palancade, Benoit
2017-08-17
Transcription is a source of genetic instability that can notably result from the formation of genotoxic DNA:RNA hybrids, or R-loops, between the nascent mRNA and its template. Here we report an unexpected function for introns in counteracting R-loop accumulation in eukaryotic genomes. Deletion of endogenous introns increases R-loop formation, while insertion of an intron into an intronless gene suppresses R-loop accumulation and its deleterious impact on transcription and recombination in yeast. Recruitment of the spliceosome onto the mRNA, but not splicing per se, is shown to be critical to attenuate R-loop formation and transcription-associated genetic instability. Genome-wide analyses in a number of distant species differing in their intron content, including human, further revealed that intron-containing genes and the intron-richest genomes are best protected against R-loop accumulation and subsequent genetic instability. Our results thereby provide a possible rationale for the conservation of introns throughout the eukaryotic lineage. Copyright © 2017 Elsevier Inc. All rights reserved.
... how to do these exercises at home. Nonsteroidal anti-inflammatory drugs (NSAIDs) and physical therapy may be prescribed for flank pain caused by spinal arthritis. Antibiotics are used to treat most kidney infections. You ...
Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW
1998-01-01
Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki
2010-11-01
Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.
Three distinct modes of intron dynamics in the evolution of eukaryotes.
Carmel, Liran; Wolf, Yuri I; Rogozin, Igor B; Koonin, Eugene V
2007-07-01
Several contrasting scenarios have been proposed for the origin and evolution of spliceosomal introns, a hallmark of eukaryotic genes. A comprehensive probabilistic model to obtain a definitive reconstruction of intron evolution was developed and applied to 391 sets of conserved genes from 19 eukaryotic species. It is inferred that a relatively high intron density was reached early, i.e., the last common ancestor of eukaryotes contained >2.15 introns/kilobase, and the last common ancestor of multicellular life forms harbored approximately 3.4 introns/kilobase, a greater intron density than in most of the extant fungi and in some animals. The rates of intron gain and intron loss appear to have been dropping during the last approximately 1.3 billion years, with the decline in the gain rate being much steeper. Eukaryotic lineages exhibit three distinct modes of evolution of the intron-exon structure. The primary, balanced mode, apparently, operates in all lineages. In this mode, intron gain and loss are strongly and positively correlated, in contrast to previous reports on inverse correlation between these processes. The second mode involves an elevated rate of intron loss and is prevalent in several lineages, such as fungi and insects. The third mode, characterized by elevated rate of intron gain, is seen only in deep branches of the tree, indicating that bursts of intron invasion occurred at key points in eukaryotic evolution, such as the origin of animals. Intron dynamics could depend on multiple mechanisms, and in the balanced mode, gain and loss of introns might share common mechanistic features.
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
Directory of Open Access Journals (Sweden)
Annemarie M W Y Voorbij
Full Text Available Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity
Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.
Directory of Open Access Journals (Sweden)
Xiangdong Kong
Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.
Frequent gain and loss of introns in fungal cytochrome b genes.
Directory of Open Access Journals (Sweden)
Liang-Fen Yin
Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.
Directory of Open Access Journals (Sweden)
MH Feiz-Haddad
2008-09-01
Full Text Available "nBackground: Trichomoniasis, caused by Trichomonas vaginalis, is one of the most common sexually transmitted infections in the world. Diagnosis of T. vaginalis is performed by different methods, including wet mount, culture, serological methods and PCR, which required laboratory equipments and expert laboratory personnel. The aim of this study was evaluation of immunochromatographic strip test (Xenostrip-Tv for diagnosis of vaginal trichomoniasis compared with wet mount and PCR assay."nMethods: In this prospective study vaginal swabs were obtained from 100 women with genital complaints demanding a speculum examination, referred to Imam Khomeini and Amir Kabir hospitals in Ahwaz, Khuzestan Province. Samples were first examined by wet mount and Xenostrip-Tv. PCR assay was performed in the next step using TVK3 and TVK7 primers initially. The positive samples were then confirmed by the second PCR assay using TVA5-1 and TVA6 primers."nResults: PCR with TVA5-1 and TVA6 primers was determined as gold standard. The wet mount as well as Xenostrip-Tv sensitivity and specificity were 73.3% and 100%, respectively in comparison with gold standard. The sensitivity and specificity of PCR with primers TVK3 and TVK7 were also determined as 100% and 96.6%, respectively. The infection rates were 14% for wet mount and Xenostrip-Tv, 21% for PCR with primers TVK3 plus TVK7 and 19% with the gold standard PCR using TVA5-1 and TVA6 primers."nConclusion: Xenostrip- Tv could be used for diagnosis of vaginal trichomoniasis in regions with no laboratory diagnostic facilities.
Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production
Directory of Open Access Journals (Sweden)
Junji Tominaga4
2012-04-01
Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.
Intron Retention and TE Exonization Events in ZRANB2
Directory of Open Access Journals (Sweden)
Sang-Je Park
2012-01-01
Full Text Available The Zinc finger, RAN-binding domain-containing protein 2 (ZRANB2, contains arginine/serine-rich (RS domains that mediate its function in the regulation of alternative splicing. The ZRANB2 gene contains 2 LINE elements (L3b, Plat_L3 between the 9th and 10th exons. We identified the exonization event of a LINE element (Plat_L3. Using genomic PCR, RT-PCR amplification, and sequencing of primate DNA and RNA samples, we analyzed the evolutionary features of ZRANB2 transcripts. The results indicated that 2 of the LINE elements were integrated in human and all of the tested primate samples (hominoids: 3 species; Old World monkey: 8 species; New World monkey: 6 species; prosimian: 1 species. Human, rhesus monkey, crab-eating monkey, African-green monkey, and marmoset harbor the exon derived from LINE element (Plat_L3. RT-PCR amplification revealed the long transcripts and their differential expression patterns. Intriguingly, these long transcripts were abundantly expressed in Old World monkey lineages (rhesus, crab-eating, and African-green monkeys and were expressed via intron retention (IR. Thus, the ZRANB2 gene produces 3 transcript variants in which the Cterminus varies by transposable elements (TEs exonization and IR mechanisms. Therefore, ZRANB2 is valuable for investigating the evolutionary mechanisms of TE exonization and IR during primate evolution.
Directory of Open Access Journals (Sweden)
Kyusik Jeong
2011-04-01
Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.
Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching
2016-01-01
Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.
Directory of Open Access Journals (Sweden)
Andrea Cristine Koishi
2010-12-01
Full Text Available INTRODUCTION: Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. METHODS: In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. RESULTS: The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. CONCLUSIONS: The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.INTRODUÇÃO: A paracoccidioidomicose é uma infecção sistêmica causada pelo Paracoccidioides brasiliensis. MÉTODOS: Neste estudo, uma semi-nested PCR foi desenvolvida para o diagnóstico da paracoccidioidomicose. Os oligonucleotídeos iniciadores ITS1 e ITS4 foram usados na primeira reação, enquanto os oligonucleotídeos iniciadores MJ03 e ITS1 foram usados na segunda reação. A semi-nested PCR foi usada para investigar biopsias de cinco pacientes com lesões orais que se assemelhavam a paracoccidioidomicose. RESULTADOS: A semi-nested PCR foi positiva para quatro amostras e negativa para a amostra de um paciente, posteriormente diagnosticado com leishmaniose. CONCLUSÕES: A semi-nested PCR descrita aqui é útil para o diagnóstico da paracoccidioidomicose.
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Sex identification of four penguin species using locus-specific PCR.
Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng
2013-01-01
Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Ying, S.-Y.; Lin, S.-L.
2005-01-01
MicroRNAs (miRNAs), small single-stranded regulatory RNAs capable of interfering with intracellular mRNAs that contain partial complementarity, are useful for the design of new therapies against cancer polymorphism and viral mutation. MiRNA was originally discovered in the intergenic regions of the Caenorhabditis elegans genome as native RNA fragments that modulate a wide range of genetic regulatory pathways during animal development. However, neither RNA promoter nor polymerase responsible for miRNA biogenesis was determined. Recent findings of intron-derived miRNA in C. elegans, mouse, and human have inevitably led to an alternative pathway for miRNA biogenesis, which relies on the coupled interaction of Pol-II-mediated pre-mRNA transcription and intron excision, occurring in certain nuclear regions proximal to genomic perichromatin fibrils
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Panca J. Santoso
2013-07-01
Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
Directory of Open Access Journals (Sweden)
Nielsen Peter E
2010-06-01
Full Text Available Abstract Background Modulation of pre-mRNA splicing by antisense molecules is a promising mechanism of action for gene therapeutic drugs. In this study, we have examined the potential of peptide nucleic acid (PNA 9-aminoacridine conjugates to modulate the pre-mRNA splicing of the mdm2 human cancer gene in JAR cells. Methods We screened 10 different 15 mer PNAs targeting intron2 at both the 5' - and the 3'-splice site for their effects on the splicing of mdm2 using RT-PCR analysis. We also tested a PNA (2512 targeting the 3'-splice site of intron3 with a complementarity of 4 bases to intron3 and 11 bases to exon4 for its splicing modulation effect. This PNA2512 was further tested for the effects on the mdm2 protein level as well as for inhibition of cell growth in combination with the DNA damaging agent camptothecin (CPT. Results We show that several of these PNAs effectively inhibit the splicing thereby producing a larger mRNA still containing intron2, while skipping of exon3 was not observed by any of these PNAs. The most effective PNA (PNA2406 targeting the 3'-splice site of intron2 had a complementarity of 4 bases to intron2 and 11 bases to exon3. PNA (2512 targeting the 3'-splice site of intron3 induced both splicing inhibition (intron3 skipping and skipping of exon4. Furthermore, treatment of JAR cells with this PNA resulted in a reduction in the level of MDM2 protein and a concomitant increase in the level of tumor suppressor p53. In addition, a combination of this PNA with CPT inhibited cell growth more than CPT alone. Conclusion We have identified several PNAs targeting the 5'- or 3'-splice sites in intron2 or the 3'-splice site of intron3 of mdm2 pre-mRNA which can inhibit splicing. Antisense targeting of splice junctions of mdm2 pre-mRNA may be a powerful method to evaluate the cellular function of MDM2 splice variants as well as a promising approach for discovery of mdm2 targeted anticancer drugs.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Methylation-Specific PCR Unraveled
Directory of Open Access Journals (Sweden)
Sarah Derks
2004-01-01
Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.
Culture independent PCR: an alternative enzyme discovery strategy
DEFF Research Database (Denmark)
Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene
2005-01-01
Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glyco...... the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology....
Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies
Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco
2005-01-01
Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and
Group-specific multiplex PCR detection systems for the identification of flying insect prey.
Directory of Open Access Journals (Sweden)
Daniela Sint
Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.
Figure 1. T. tor species. Figure 2. Long PCR products of ...
Indian Academy of Sciences (India)
Annam
Figure 2. Long PCR products of mitochondrial DNA from the fish T. tor. Lane 1, amplified product using L-12321-Leu and S-LA-16S-H primers. Lane 2, amplified product using H-12321 –Leu and S-LA-16S-L primers. Lane M, 1-Kb DNA ladder. 8 kb ...
A reliable and feasible qPCR strategy for titrating AAV vectors.
Wang, Feng; Cui, Xiuling; Wang, Mingxi; Xiao, Weidong; Xu, Ruian
2013-07-05
Previous studies have revealed that traditional real-time quantitative PCR (qPCR) underestimates adeno-associated virus (AAV) titer. Because the inverted terminal repeat (ITR) exists in all AAV vectors, the only remaining element from the wild genome could form special configurations to interfere with qPCR titration. To solve this problem, a modified and universal qPCR method was tested and established. In this work, there was a great variation in titration of ssAAV2-EGFP (Enhanced Green Fluorescence Protein) and scAAV2-EGFP genome by traditional qPCR. For ssAAV2-EGFP, the highest titer was found by using the targeting EGFP primers and the lowest titer was measured by those targeting bovine growth hormone polyA element (pBGH) primers. Experimental data were reverse for ssAAV2-EGFP and scAAV2-EGFP. Here we report an improved and universal SmaI qPCR method, based on cleaving all ITRs in AAV2 genome by SmaI with several advantages: (1) impact of all ITRs in ssAAV2 and scAAV2 was dismissed; (2) titers increased remarkably, up to 7-fold, especially for scAAV2; (3) the variation of titers was reduced when different primers were applied. A similar phenomenon was also observed in other ssAAV2 and scAAV2 products when the range of titration was at 3×107 to 7×109 V.G/µl in this study. This modified qPCR strategy can increase rAAV' titer and reduce titration variance, possibly become a universal method for titrating AAV vectors.
Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.
Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan
2014-11-01
Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico 90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.
Determination of self-(incompatibility in some Turkish cultivated and wild apricots
Directory of Open Access Journals (Sweden)
Pinar Hasan
2015-01-01
Full Text Available In this study, self-(in compatibility of 34 wild apricot genotypes, called as Sakit apricots, sampled from Sakit valley located in east Mediterranean region of Turkey and 9 well known Turkish apricot cultivars were determined by using molecular methods. Genomic PCR with S-RNase and SFB-specific primers was conducted using the degenerate primers EM-PC2consFD and EM-PC3consRD for the amplification of the second intron region of the S-RNase gene. To amplify the first intron, the fluorescently labelled (JOE forward primer SRc-F was used in combination with the reverse primer SRc-R. According to the results, Sc (self-compatible allele is not present in all wild and cultivated materials. All wild genotypes had same S allele (S6S19 composition indicating they do not carry the SC-haplotype. These wild materials previously reported self-compatible by fruit set studies on field. Mutations rendering the S-locus non-functional in these genotypes can be supposed and checked in the future. The most important dried apricot cultivars of Turkey such as Hacihaliloglu, Kabaasi, and Cataloglu were observed to be self-incompatible cultivars.
The Half-Life of the HSV-1 1.5 kb LAT Intron is similar to the half-Life of the 2.0 kb LAT Intron
Brinkman, Kerry K.; Mishra, Prakhar; Fraser, Nigel W.
2013-01-01
Herpes Simplex Virus type 1 (HSV-1) establishes a latent infection in the sensory neurons of the peripheral nervous system of humans. Although about 80 genes are expressed during the lytic cycle of the virus infection, essentially only one gene is expressed during the latent cycle. This gene is known as the latency associated transcript (LAT) and it appears to play a role in the latency cycle through an anti-apoptotic function in the 5’ end of the gene and miRNA encoded along the length of the transcript which down regulate some of the viral immediate early (IE) gene products. The LAT gene is about 8.3 kb long and consists of two exons separated by an unusual intron. The intron between the exons consists of two nested introns. This arrangement of introns has been called a twintron. Furthermore, the larger (2 kb) intron has been shown to be very stable. In this study we measure the stability of the shorter 1.5 kb nested intron and find its half-life is similar to the longer intron. This was achieved by deleting the 0.5 kb overlapping intron from a plasmid construct designed to express the LAT transcript from a tet-inducible promoter, and measuring the half-life of the 1.5 kb intron in tissue culture cells. This finding supports the hypothesis that it is the common branch-point region of these nested introns that is responsible for their stability. PMID:23335177
Development of PCR method for diagnosing of honey bee American Foulbrood disease
Directory of Open Access Journals (Sweden)
Modirrousta, H.
2012-06-01
Full Text Available American foulbrood (AFB disease is caused by the sporeforming bacterium Paenibacillus larvae larvae. Traditional diagnosis is based on culture technique is time and laboratory work consuming. In this study with standard strain, PCR was developed by specific primers and PCR products were electrophoresed on 0.8 % agarose gel. The PCR primers were selected on the basis of the 16S rRNA gene and amplify a 700-bp amplicon. Detection limits were determined for suspensions of bacteria and spores and also honey and larvae experimentally contaminated. The lowest number of bacteria and spores that were able to detect were respectively 28, 33, 330 and 243 cfu /ml. This PCR technique can be used to identification of the presence of Paenibacillus larvae larvae spores in honey samples, brood samples or on the colonies that grow on medium.
Directory of Open Access Journals (Sweden)
María Fernanda Garcés
2017-04-01
Conclusions: Inversions of intron 22 and 1 were found in half of this group of patients. These results are reproducible and useful to identify the two most frequent mutations in severe hemophilia A patients.
Directory of Open Access Journals (Sweden)
Young-Tak Kim
2015-06-01
Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.
Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR
Directory of Open Access Journals (Sweden)
Kelly Grace Magalhães
2004-06-01
Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.
Vela, J; Vitorica, J; Ruano, D
2001-12-01
We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.
Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes
Directory of Open Access Journals (Sweden)
Mostafa Bakhshi
2017-07-01
Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.
Newly evolved introns in human retrogenes provide novel insights into their evolutionary roles
Directory of Open Access Journals (Sweden)
Kang Li-Fang
2012-07-01
Full Text Available Abstract Background Retrogenes generally do not contain introns. However, in some instances, retrogenes may recruit internal exonic sequences as introns, which is known as intronization. A retrogene that undergoes intronization is a good model with which to investigate the origin of introns. Nevertheless, previously, only two cases in vertebrates have been reported. Results In this study, we systematically screened the human (Homo sapiens genome for retrogenes that evolved introns and analyzed their patterns in structure, expression and origin. In total, we identified nine intron-containing retrogenes. Alignment of pairs of retrogenes and their parents indicated that, in addition to intronization (five cases, retrogenes also may have gained introns by insertion of external sequences into the genes (one case or reversal of the orientation of transcription (three cases. Interestingly, many intronizations were promoted not by base substitutions but by cryptic splice sites, which were silent in the parental genes but active in the retrogenes. We also observed that the majority of introns generated by intronization did not involve frameshifts. Conclusions Intron gains in retrogenes are not as rare as previously thought. Furthermore, diverse mechanisms may lead to intron creation in retrogenes. The activation of cryptic splice sites in the intronization of retrogenes may be triggered by the change of gene structure after retroposition. A high percentage of non-frameshift introns in retrogenes may be because non-frameshift introns do not dramatically affect host proteins. Introns generated by intronization in human retrogenes are generally young, which is consistent with previous findings for Caenorhabditis elegans. Our results provide novel insights into the evolutionary role of introns.
Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N
1992-12-01
The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.
An efficient method to find potentially universal population genetic markers, applied to metazoans
Directory of Open Access Journals (Sweden)
Chenuil Anne
2010-09-01
Full Text Available Abstract Background Despite the impressive growth of sequence databases, the limited availability of nuclear markers that are sufficiently polymorphic for population genetics and phylogeography and applicable across various phyla restricts many potential studies, particularly in non-model organisms. Numerous introns have invariant positions among kingdoms, providing a potential source for such markers. Unfortunately, most of the few known EPIC (Exon Primed Intron Crossing loci are restricted to vertebrates or belong to multigenic families. Results In order to develop markers with broad applicability, we designed a bioinformatic approach aimed at avoiding multigenic families while identifying intron positions conserved across metazoan phyla. We developed a program facilitating the identification of EPIC loci which allowed slight variation in intron position. From the Homolens databases we selected 29 gene families which contained 52 promising introns for which we designed 93 primer pairs. PCR tests were performed on several ascidians, echinoderms, bivalves and cnidarians. On average, 24 different introns per genus were amplified in bilaterians. Remarkably, five of the introns successfully amplified in all of the metazoan genera tested (a dozen genera, including cnidarians. The influence of several factors on amplification success was investigated. Success rate was not related to the phylogenetic relatedness of a taxon to the groups that most influenced primer design, showing that these EPIC markers are extremely conserved in animals. Conclusions Our new method now makes it possible to (i rapidly isolate a set of EPIC markers for any phylum, even outside the animal kingdom, and thus, (ii compare genetic diversity at potentially homologous polymorphic loci between divergent taxa.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Mastan, Shaik G.
2011-05-10
Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.
Directory of Open Access Journals (Sweden)
Danielli Barreto Maciel
2010-12-01
Full Text Available Studies were performed to analyze the genetic characterization using RFLP-ITS and Intron (primer EI1 markers and the amplification of the cap20 pathogenicity gene by PCR in Colletotrichum gloeosporioides isolates of different hosts plant. The genetic variability was accessed using RFLP-ITS and Intron markers and grouping by UPGMA method. Primers to cap20 gene were constructed using selected sequences of the GenBank (National Center of Biotechnology Information, http://www.ncbi.nlm.nih.gov with the Primer 3 program. The dendrograms analysis showed that the RFLP-ITS marker was more informative to separate the Colletotrichum sp, and that primer EI1 demonstrated greater genetic diversity. The amplification of the DNA of the Colletotrichum isolates to the cap20 gene with primers P1 and P2 indicated that this gene could present variations into C. gloeosporioides related with the host, and also that it was present in other Colletotrichum sp.Estudos foram realizados para analisar a caracterização genética usando marcadores de RFLP-ITS e ISSP e a amplicação do gene de patogenicidade cap20 por PCR em isolados de Colletotrichum gloeosporioides de diferentes hospedeiros. Primers para o gene cap20 foram construídos a partir de seqüências selecionadas do GenBank (National Center of Biotechnology Information, http://www.ncbi.nlm.nih.gov com o programa Primer 3. A análise dos dendrogramas revelou que o marcador RFLP-ITS foi mais informativo em separar as espécies de Colletotrichum, e que o primer EI1 evidenciou maior diversidade genética. A amplificação do DNA dos isolados de Colletotrichum para o gene cap20 com os primers P1 e P2 indicou que este gene pode apresentar variações dentro de C. gloeosporioides relacionada ao hospedeiro, e que também está presente em outras espécies de Colletotrichum.
Directory of Open Access Journals (Sweden)
Aline Diniz Cabral
2009-12-01
Full Text Available Neospora caninum, a cause of abortion and stillbirth in cattle, was studied by histology, immunohistochemistry, and nested-PCR, using primers from the Nc5 region of the genomic DNA (PCR PLUS and primers from the ITS1 region of the ribosomal DNA (PCR JB. A total of 105 fetal samples sent to the Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico from January 2006 to May 2008 were examined for evidence of N. caninum. Histological examination revealed 71.4% with non-suppurative inflammation in the heart, lung, liver, kidney, placenta, and brain. Immunohistochemistry detected infections in 8.6% of the samples, mainly in the brain, placenta, and heart. Nested-PCR JB revealed 6.7% with infections, while nested-PCR PLUS returned 20.9% positive results, mainly in brain and placenta, and in the pooled liver and heart. Kappa statistics demonstrated little agreement among the three techniques. The three methods are complementary, since they have distinct diagnostic characteristics and were combined to give a positivity rate of 24.8%.Pesquisou-se Neospora caninum como causador de abortamento e natimortalidade em bovinos, por meio de exame histopatológico (hematoxilina-eosina, imunoistoquímica (IHQ e nested-PCR, utilizando primers da região Nc5 do DNA genômico (PCR PLUS e primers da região ITS1 do DNA ribossomal (PCR JB. Foram avaliadas 105 amostras de abortamento bovino entre janeiro de 2006 a maio de 2008, encaminhadas ao Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico para diagnóstico diferencial de causas infecciosas. Observou-se em 71,4% das amostras lesões histológicas (HE caracterizadas pela presença de células inflamatórias mononucleares no coração, pulmão, fígado, rim, placenta e cérebro. A IHQ detectou 8,57% de positividade, sendo maior no cérebro, placenta e coração. A nested-PCR JB revelou 6,66% de casos positivos, enquanto que a nested-PCR PLUS apresentou maior taxa
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis
Directory of Open Access Journals (Sweden)
V Hallur
2015-01-01
Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Targeted resequencing and variant validation using pxlence PCR assays
Directory of Open Access Journals (Sweden)
Frauke Coppieters
2016-01-01
Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.
Ben Ali, Sina-Elisabeth; Madi, Zita Erika; Hochegger, Rupert; Quist, David; Prewein, Bernhard; Haslberger, Alexander G.; Brandes, Christian
2014-01-01
Genetic mutations must be avoided during the production and use of seeds. In the European Union (EU), Directive 2001/18/EC requires any DNA construct introduced via transformation to be stable. Establishing genetic stability is critical for the approval of genetically modified organisms (GMOs). In this study, genetic stability of two GMOs was examined using high resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) employing Scorpion primers for amplification. The genetic variability of the transgenic insert and that of the flanking regions in a single oilseed rape variety (GT73) and a stacked maize (MON88017 × MON810) was studied. The GT73 and the 5' region of MON810 showed no instabilities in the examined regions. However; two out of 100 analyzed samples carried a heterozygous point mutation in the 3' region of MON810 in the stacked variety. These results were verified by direct sequencing of the amplified PCR products as well as by sequencing of cloned PCR fragments. The occurrence of the mutation suggests that the 5' region is more suitable than the 3' region for the quantification of MON810. The identification of the single nucleotide polymorphism (SNP) in a stacked event is in contrast to the results of earlier studies of the same MON810 region in a single event where no DNA polymorphism was found. PMID:25365178
Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S
Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.
Reich, J D; Alexander, T W; Chatterton, S
2016-05-01
Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2) = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the
Multiplex polymerase chain reaction (PCR) and fluorescence-based ...
African Journals Online (AJOL)
reading 7
2011-12-28
Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.
Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang
2003-09-01
A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.
Gell, I; Cubero, J; Melgarejo, P
2007-12-01
To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.
Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR
Huijsdens, Xander W.; Linskens, Ronald K.; Mak, Mariëtte; Meuwissen, Stephan G. M.; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.
2002-01-01
The use of real-time quantitative PCR (5' nuclease PCR assay) as a tool to study the gastrointestinal microflora that adheres to the colonic mucosa was evaluated. We developed primers and probes based on the 16S ribosomal DNA gene sequences for the detection of Escherichia coli and Bacteroides
DEFF Research Database (Denmark)
Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren
2005-01-01
Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....
Vitali, Beatrice; Pugliese, Ciro; Biagi, Elena; Candela, Marco; Turroni, Silvia; Bellen, Gert; Donders, Gilbert G G; Brigidi, Patrizia
2007-09-01
The microbial flora of the vagina plays a major role in preventing genital infections, including bacterial vaginosis (BV) and candidiasis (CA). An integrated approach based on PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and real-time PCR was used to study the structure and dynamics of bacterial communities in vaginal fluids of healthy women and patients developing BV and CA. Universal eubacterial primers and Lactobacillus genus-specific primers, both targeted at 16S rRNA genes, were used in DGGE and real-time PCR analysis, respectively. The DGGE profiles revealed that the vaginal flora was dominated by Lactobacillus species under healthy conditions, whereas several potentially pathogenic bacteria were present in the flora of women with BV. Lactobacilli were the predominant bacterial population in the vagina for patients affected by CA, but changes in the composition of Lactobacillus species were observed. Real-time PCR analysis allowed the quantitative estimation of variations in lactobacilli associated with BV and CA diseases. A statistically significant decrease in the relative abundance of lactobacilli was found in vaginal fluids of patients with BV compared to the relative abundance of lactobacilli in the vaginal fluids of healthy women and patients with CA.
Directory of Open Access Journals (Sweden)
Mojtaba Tahmoorespur
2016-04-01
Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR
Luo, Guizhen; Mitchell, Thomas G.
2002-01-01
A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...
Customizable PCR-microplate array for differential identification of multiple pathogens.
Woubit, Abdela; Yehualaeshet, Teshome; Roberts, Sherrelle; Graham, Martha; Kim, Moonil; Samuel, Temesgen
2013-11-01
Customizable PCR-microplate arrays were developed for the rapid identification of Salmonella Typhimurium, Salmonella Saintpaul, Salmonella Typhi, Shigella dysenteriae, Escherichia coli O157:H7, Francisella tularensis subsp. tularensis, Francisella tularensis subsp. novicida, Vibrio cholerae, Vibrio parahaemolyticus, Yersinia pestis, and Yersinia pseudotuberculosis. Previously, we identified highly specific primers targeting each of these pathogens. Here, we report the development of customizable PCR-microplate arrays for simultaneous identification of the pathogens using the primers identified. A mixed aliquot of genomic DNA from 38 strains was used to validate three PCR-microplate array formats. Identical PCR conditions were used to run all the samples on the three formats. Specific amplifications were obtained on all three custom plates. In preliminary tests performed to evaluate the sensitivity of these assays in samples inoculated in the laboratory with Salmonella Typhimurium, amplifications were obtained from 1 g of beef hot dog inoculated at as low as 9 CFU/ml or from milk inoculated at as low as 78 CFU/ml. Such microplate arrays could be valuable tools for initial identification or secondary confirmation of contamination by these pathogens.
[Development of indel markers for molecular authentication of Panax ginseng and P. quinquefolius].
Wang, Rong-Bo; Tian, Hui-Li; Wang, Hong-Tao; Li, Gui-Sheng
2018-04-01
Panax ginseng and P. quinquefolius are two kinds of important medicinal herbs. They are morphologically similar but have different pharmacological effects. Therefore, botanical origin authentication of these two ginsengs is of great importance for ensuring pharmaceutical efficacy and food safety. Based on the fact that intron position in orthologous genes is highly conserved across plant species, intron length polymorphisms were exploited from unigenes of ginseng. Specific primers were respectively designed for these two species based on their insertion/deletion sequences of cytochrome P450 and glyceraldehyde 3-phosphate dehydrogenase, and multiplex PCR was conducted for molecular authentication of P.ginseng and P. quinquefolius. The results showed that the developed multiplex PCR assay was effective for molecular authentication of P.ginseng and P. quinquefolius without strict PCR condition and the optimization of reaction system.This study provides a preferred ideal marker system for molecular authentication of ginseng,and the presented method can be employed in origin authentication of other herbal preparations. Copyright© by the Chinese Pharmaceutical Association.
Genetic variations among Echinococcus granulosus isolates in Egypt using RAPD-PCR.
Taha, Hoda A
2012-11-01
Cystic echinococcosis (CE), caused by hydatid cysts, is a widespread and hazardous disease in humans and animals worldwide. The aim of the current study was to investigate the genetic variations among Echinococcus granulosus cyst strains isolated from sheep, camel, pig, and donkey using RAPD-PCR analysis. Seven primers of arbitrary sequences were used in the PCR reactions. The screened primers gave total patterns ranging from 27 to 39 reproducible bands for each isolate. Each population isolate gave its specific pattern. Although distinct polymorphic patterns were obtained among the four isolates, there were several shared bands among them in each primer used. A comparison of the different RAPD-PCR patterns showed that primers P1, P3, and OPH 04 yielded band patterns that revealed a high degree of divergence among the four isolates of E. granulosus that allowed easy distinction between them. The remaining primers (P2, P4, P5, and OPH14) amplified DNA fragments that were common to two or more isolates but diversified in the other two or three isolates. The study revealed that the most closely related isolates were of donkey and camel where the similarity coefficent between them ranging from 53 % to 78 %, followed by isolates of pig and sheep (sc = 40 % to 68 %), while the similarity coefficent between isolates of camel and sheep was 33-45 %, between camel and pig was 36 to 57 %, between donkey and pig was 37 to 52 %, and between donkey and sheep was 35 to 54 % which means that they more or distant from each other. In conclusion, hydatid cysts isolated from camel may have the genotypic characters of donkey strain.
PCR amplification on microarrays of gel immobilized oligonucleotides
Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei
2003-11-04
The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.
Correlation of PTPN11 polymorphism at intron 3 with gastric cancer
Directory of Open Access Journals (Sweden)
Li ZHANG
2011-05-01
Full Text Available Objective To explore the correlation of protein-tyrosine-phosphatase nonreceptor-type 11(PTPN11 polymorphism at intron 3 with gastric cancer in Chinese population,and the feasibility and accuracy of employing mastrix-assisted laser desorption ionization time-of-flight mass spectrogram(MALDI-TOF-MS in genotyping of this SNP.Methods Two hundred and forty-seven patients with gastric cancer,212 cancer-free patients and 160 cord blood samples were enrolled in present study.Genotypes of PTPN11 G/A polymorphism at intron 3 were determined by MALDI-TOF-MS analysis,and direct sequencing of PCR products with 20 samples of the gene locus was done for checking the accuracy of MALDI-TOF-MS.Histological examination,Helicobacter pylori culture,rapid urease test,serum anti-H.pylori antibodies(ELISA and urease colloidal gold test were performed to evaluate H.pylori infection.Results Direct sequencing of 20 random selected samples were well consistent with the MALDI-TOF-MS results.The rates of H.pylori infection were 73.68% in gastric cancer patients and 75.47% in cancer-free patients,implying no significant difference between the two groups.The distributions of genotypes were in Hardy Weinberg equilibrium in both gastric cancer patients and controls.There were no significant differences in the genotype frequencies between the 2 groups(P>0.05.Compared with the GG genotype,GA+AA genotype could not influence the risk of gastric cancer.When stratified for status,PTPN11 polymorphism was not associated with age,gender and H.pylori infection states in both cancer patients and controls.Conclusion It seems that PTPN11 G/A polymorphism at intron 3 has no affection on the risk of gastric cancer in Chinese population.
Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N
2015-07-01
The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.
Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D
2018-06-01
We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
Drosophila polytene chromosome bands formed by gene introns.
Zhimulev, I F; Boldyreva, L V; Demakova, O V; Poholkova, G V; Khoroshko, V A; Zykova, T Yu; Lavrov, S A; Belyaeva, E S
2016-01-01
Genetic organization of bands and interbands in polytene chromosomes has long remained a puzzle for geneticists. It has been recently demonstrated that interbands typically correspond to the 5'-ends of house-keeping genes, whereas adjacent loose bands tend to be composed of coding sequences of the genes. In the present work, we made one important step further and mapped two large introns of ubiquitously active genes on the polytene chromosome map. We show that alternative promoter regions of these genes map to interbands, whereas introns and coding sequences found between those promoters correspond to loose grey bands. Thus, a gene having its long intron "sandwiched" between to alternative promoters and a common coding sequence may occupy two interbands and one band in the context of polytene chromosomes. Loose, partially decompacted bands appear to host large introns.
Remarkable sequence conservation of the last intron in the PKD1 gene.
Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P
2003-10-01
The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.
Directory of Open Access Journals (Sweden)
Anja Pfeifer
Full Text Available BACKGROUND: The a2 mating type locus gene lga2 is critical for uniparental mitochondrial DNA inheritance during sexual development of Ustilago maydis. Specifically, the absence of lga2 results in biparental inheritance, along with efficient transfer of intronic regions in the large subunit rRNA gene between parental molecules. However, the underlying role of the predicted LAGLIDADG homing endonuclease gene I-UmaI located within the group II intron LRII1 has remained unresolved. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the enzymatic activity of I-UmaI in vitro based on expression of a tagged full-length and a naturally occurring mutant derivative, which harbors only the N-terminal LAGLIDADG domain. This confirmed Mg²⁺-dependent endonuclease activity and cleavage at the LRII1 insertion site to generate four base pair extensions with 3' overhangs. Specifically, I-UmaI recognizes an asymmetric DNA sequence with a minimum length of 14 base pairs (5'-GACGGGAAGACCCT-3' and tolerates subtle base pair substitutions within the homing site. Enzymatic analysis of the mutant variant indicated a correlation between the activity in vitro and intron homing. Bioinformatic analyses revealed that putatively functional or former functional I-UmaI homologs are confined to a few members within the Ustilaginales and Agaricales, including the phylogenetically distant species Lentinula edodes, and are linked to group II introns inserted into homologous positions in the LSU rDNA. CONCLUSIONS/SIGNIFICANCE: The present data provide strong evidence that intron homing efficiently operates under conditions of biparental inheritance in U. maydis. Conversely, uniparental inheritance may be critical to restrict the transmission of mobile introns. Bioinformatic analyses suggest that I-UmaI-associated introns have been acquired independently in distant taxa and are more widespread than anticipated from available genomic data.
Computational Analysis of an Evolutionarily Conserved VertebrateMuscle Alternative Splicing Program
Energy Technology Data Exchange (ETDEWEB)
Das, Debopriya; Clark, Tyson A.; Schweitzer, Anthony; Marr,Henry; Yamamoto, Miki L.; Parra, Marilyn K.; Arribere, Josh; Minovitsky,Simon; Dubchak, Inna; Blume, John E.; Conboy, John G.
2006-06-15
A novel exon microarray format that probes gene expression with single exon resolution was employed to elucidate critical features of a vertebrate muscle alternative splicing program. A dataset of 56 microarray-defined, muscle-enriched exons and their flanking introns were examined computationally in order to investigate coordination of the muscle splicing program. Candidate intron regulatory motifs were required to meet several stringent criteria: significant over-representation near muscle-enriched exons, correlation with muscle expression, and phylogenetic conservation among genomes of several vertebrate orders. Three classes of regulatory motifs were identified in the proximal downstream intron, within 200nt of the target exons: UGCAUG, a specific binding site for Fox-1 related splicing factors; ACUAAC, a novel branchpoint-like element; and UG-/UGC-rich elements characteristic of binding sites for CELF splicing factors. UGCAUG was remarkably enriched, being present in nearly one-half of all cases. These studies suggest that Fox and CELF splicing factors play a major role in enforcing the muscle-specific alternative splicing program, facilitating expression of a set of unique isoforms of cytoskeletal proteins that are critical to muscle cell differentiation. Supplementary materials: There are four supplementary tables and one supplementary figure. The tables provide additional detailed information concerning the muscle-enriched datasets, and about over-represented oligonucleotide sequences in the flanking introns. The supplementary figure shows RT-PCR data confirming the muscle-enriched expression of exons predicted from the microarray analysis.
International Nuclear Information System (INIS)
R, Maria Lina; S, Dadang; Suhadi, F.
2000-01-01
To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
A site-specific endonuclease encoded by a typical archaeal intron
DEFF Research Database (Denmark)
Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene
1993-01-01
The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...
Directory of Open Access Journals (Sweden)
Kwang-Pyo Kim
2015-09-01
Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
Beck, Rose C; Kohn, Debra J; Tuohy, Marion J; Prayson, Richard A; Yen-Lieberman, Belinda; Procop, Gary W
2004-03-01
We evaluated 2 methods, a LightCycler PCR assay and pyrosequencing for the detection of the JC polyoma virus (JCV) in fixed brain tissue of 10 patients with and 3 control patients without progressive multifocal leukoencephalopathy (PML). Nucleic acid extraction was performed after deparaffinization and proteinase K digestion. The LightCycler assay differentiates the BK virus (BKV), JCV, and SV40 using melt curve analysis. Conventional PCR was used with the same primers to generate products for pyrosequencing. Two sequencing primers were used that differentiate the polyoma viruses. Seven of 11 biopsies (1 patient had 2 biopsies) with PML were positive for JCV by real-time PCR and/or PCR/pyrosequencing. Three of 4 remaining biopsies were positive by real-time PCR but had melting points between JCV and SV40. The 4 specimens that were negative or atypical by LightCycler PCR were positive by traditional PCR, but 1 had an amplicon of lower molecular weight by gel electrophoresis. These were shown to represent JCV by at least 1 of the 2 pyrosequencing primers. The biopsies from patients without PML were PCR negative. Both the LightCycler and pyrosequencing assays are useful for confirming JCV in brain biopsies from patients with PML, but variant JCVs may require supplementary methods to confirm JCV infection.
Directory of Open Access Journals (Sweden)
Trognitz Friederike
2007-02-01
Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi
2017-08-15
Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon
Directory of Open Access Journals (Sweden)
Irma Suriyani
2015-05-01
Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
Komparasi Metode Isolasi DNA Patogen Antraknosa dan Bulai untuk Deteksi PCR
Directory of Open Access Journals (Sweden)
Ade Syahputra
2016-11-01
Full Text Available Polymerase chain reaction (PCR is an important tool for detection, identification and monitoring of quarantine pests in Indonesia. DNA isolation method from target organism is an important step to provide adequate DNA template for performing PCR. Objective of the research was to compare conventional, commercial kit, FTA-card and its modification methods of DNA isolation to be used in PCR detection for Colletotrichum acutatum and Peronosclerospora sorghi from chili and maize, respectively. DNA obtained from various isolation methods were measured using UV-vis nanodrop-spectrophotometry. DNA amplification was performed using DNA concentration of 15 ng µL-1 from each isolation method with gradual primer concentrations of 0.4; 0.6; 0.8; and 1.0 mM. The highest concentration of DNA was achieved with conventional methods for C. acutatum from pure culture and P. sorghi from maize leaf. Best DNA purity was obtained from isolation method using commercial kit for C. acutatum from infected fruit (1.94 and from conventional method for C. acutatum from pure culture (1.91. The highest total yield of isolated DNA was achieved by modified FTA-card for C. acutatum from pure culture. In general DNA amplification using various primer concentration gave positive results although DNA bands intensity was varied from faint to very bright. Furthermore PCR optimization using the best primer concentration from previous reaction showed that all DNA templates resulted in thick and bright DNA bands.
Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments
Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu
2017-01-01
In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Directory of Open Access Journals (Sweden)
Chang-Gi Back
2015-09-01
Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos
2003-03-01
SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.
Directory of Open Access Journals (Sweden)
Tomasz Kulik
2012-12-01
Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.
Specific PCR-based detection of Alternaria helianthi
DEFF Research Database (Denmark)
Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.
2012-01-01
Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Directory of Open Access Journals (Sweden)
Takao Ito
Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong
2018-02-28
A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.
Samuel, Stylianos; Papayiannis, Lambros C; Leroch, Michaela; Veloukas, Thomas; Hahn, Matthias; Karaoglanidis, George S
2011-08-01
Previous studies have shown that resistance of Botrytis cinerea to QoI fungicides has been attributed to the G143A mutation in the cytochrome b (cytb) gene, while, in a part of the fungal population, an intron has been detected at codon 143 of the gene, preventing QoI resistance. During 2005-2009, 304 grey mould isolates were collected from strawberry, tomato, grape, kiwifruit, cucumber and apple in Greece and screened for resistance to pyraclostrobin and for the presence of the cytb intron, using a novel real-time TaqMan PCR assay developed in the present study. QoI-resistant phenotypes existed only within the population collected from strawberries. All resistant isolates possessed the G143A mutation. Differences were observed in the genotypic structure of cytb. Individuals possessing the intron were found at high incidence in apple fruit and greenhouse-grown tomato and cucumber populations, whereas in the strawberry population the intron frequency was lower. Cultivation of QoI-resistant and QoI-sensitive isolates for ten culture cycles on artificial nutrient medium in the presence or absence of fungicide selection showed that QoI resistance was stable. The results of the study suggest that a high risk for selection of QoI-resistant strains exists in crops heavily treated with QoIs, in spite of the widespread occurrence of the cytb intron in B. cinerea populations. The developed real-time TaqMan PCR constitutes a powerful tool to streamline detection of the mutation by reducing pre- and post-amplification manipulations, and can be used for rapid screening and quantification of QoI resistance. Copyright © 2011 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Zhiyuan Wu
2014-01-01
Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia
2018-04-01
The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.
Garrido-Jurado, Inmaculada; Landa, Blanca B; Quesada-Moraga, Enrique
2016-01-01
The described protocol allows detecting as low as 10 fg the entomopathogenic fungal endophyte Beauveria bassiana in host plants by using a two-step nested PCR with the ITS1F/ITS4 and BB.fw and BB.rv primer pairs. On the other hand, a qPCR protocol using BB.fw and BB.rv primers is also available allowing the quantification of up to 26 fg of B. bassiana DNA per 20 ng of leaf DNA.
Detection and Analysis of Circular RNAs by RT-PCR.
Panda, Amaresh C; Gorospe, Myriam
2018-03-20
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication
Directory of Open Access Journals (Sweden)
Jafari A
1999-11-01
Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.
Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.
Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren
2013-03-01
Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
Directory of Open Access Journals (Sweden)
Kanako Komaki-Yasuda
Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.
Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon
2015-10-01
Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.
Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P
2003-08-01
The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.
Family of autocatalytic group I introns in bacteriophage T4
International Nuclear Information System (INIS)
Shub, D.A.; Xu, M.Q.; Gott, J.M.; Zeeh, A.; Wilson, L.D.
1987-01-01
The discovery of an intron in phage T4 encouraged the authors to look for additional group I introns in the T4 genome. Further examples would permit sequence and structural comparisons that might lend insight into their evolutionary origin. Additionally, they hoped that their locations within the T4 genome would infer a possible regulatory function in prokaryotic gene expression. They took advantage of the fact that, since G is added to the 5' end of the intron, autocatalytic group I introns could be specifically labeled in vitro for use as probes for DNA blotting experiments. If Group I introns were in more than just the td gene, multiple RNA species should be labeled when total RNA is extracted from T4-infected cells and incubated with [α- 32 P]GTP in vitro. When used as a probe for a Southern blot of T4 DNA, this RNA should hybridize to several DNA bands
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Silva, da K.R.A.; Salles, J.F.; Seldin, L.; Elsas, van J.D.
2003-01-01
In this study, a Paenibacillus-specific PCR system, based on the specific primer PAEN515F in combination with bacterial primer R1401, was tested and used to amplify specific fragments of the 16S rRNA gene from rhizosphere DNA. The amplicons were used in a second (semi-nested) PCR for DGGE, in which
da Silva, Katia Regina Araujo; Falcao Salles, Joana; Seldin, Lucy; van Elsas, Jan
In this study, a Paenibacillus-specific PCR system, based on the specific primer PAEN515F in combination with bacterial primer R1401, was tested and used to amplify specific fragments of the 16S rRNA gene from rhizosphere DNA. The amplicons were used in a second (semi-nested) PCR for DGGE, in which
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Parallel loss of plastid introns and their maturase in the genus Cuscuta.
McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; Leebens-Mack, Jim; dePamphilis, Claude W
2009-06-19
Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.
Parallel loss of plastid introns and their maturase in the genus Cuscuta.
Directory of Open Access Journals (Sweden)
Joel R McNeal
2009-06-01
Full Text Available Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.
Cloning-free genome alterations in Saccharomyces cerevisiae using adaptamer-mediated PCR
DEFF Research Database (Denmark)
Reid, Robert J D; Lisby, Michael; Rothstein, Rodney
2002-01-01
. Furthermore, many of the techniques described here rely on preexisting and commercially available adaptamer sets that can be obtained inexpensively rather than designing new primers for every experiment. Although a cost is incurred when performing multiple PCR amplifications, the increase in recombination...... efficiency is dramatic. Finally, the adaptamer-mediated PCR fusion methodology is versatile and can be applied to varied genome manipulations....
The splicing of tiny introns of Paramecium is controlled by MAGO.
Contreras, Julia; Begley, Victoria; Marsella, Laura; Villalobo, Eduardo
2018-07-15
The exon junction complex (EJC) is a key element of the splicing machinery. The EJC core is composed of eIF4A3, MAGO, Y14 and MLN51. Few accessory proteins, such as CWC22 or UPF3, bind transiently to the EJC. The EJC has been implicated in the control of the splicing of long introns. To ascertain whether the EJC controls the splicing of short introns, we used Paramecium tetraurelia as a model organism, since it has thousands of very tiny introns. To elucidate whether EJC affects intron splicing in P. tetraurelia, we searched for EJC protein-coding genes, and silenced those genes coding for eIF4A3, MAGO and CWC22. We found that P. tetraurelia likely assembles an active EJC with only three of the core proteins, since MLN51 is lacking. Silencing of eIF4A3 or CWC22 genes, but not that of MAGO, caused lethality. Silencing of the MAGO gene caused either an increase, decrease, or no change in intron retention levels of some intron-containing mRNAs used as reporters. We suggest that a fine-tuning expression of EJC genes is required for steady intron removal in P. tetraurelia. Taking into consideration our results and those published by others, we conclude that the EJC controls splicing independently of the intron size. Copyright © 2018 Elsevier B.V. All rights reserved.
U12 type introns were lost at multiple occasions during evolution
Directory of Open Access Journals (Sweden)
Bartschat Sebastian
2010-02-01
Full Text Available Abstract Background Two categories of introns are known, a common U2 type and a rare U12 type. These two types of introns are removed by distinct spliceosomes. The phylogenetic distribution of spliceosomal RNAs that are characteristic of the U12 spliceosome, i.e. the U11, U12, U4atac and U6atac RNAs, suggest that U12 spliceosomes were lost in many phylogenetic groups. We have now examined the distribution of U2 and U12 introns in many of these groups. Results U2 and U12 introns were predicted by making use of available EST and genomic sequences. The results show that in species or branches where U12 spliceosomal components are missing, also U12 type of introns are lacking. Examples are the choanoflagellate Monosiga brevicollis, Entamoeba histolytica, green algae, diatoms, and the fungal lineage Basidiomycota. Furthermore, whereas U12 splicing does not occur in Caenorhabditis elegans, U12 introns as well as U12 snRNAs are present in Trichinella spiralis, which is deeply branching in the nematode tree. A comparison of homologous genes in T. spiralis and C. elegans revealed different mechanisms whereby U12 introns were lost. Conclusions The phylogenetic distribution of U12 introns and spliceosomal RNAs give further support to an early origin of U12 dependent splicing. In addition, this distribution identifies a large number of instances during eukaryotic evolution where such splicing was lost.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
Group II intron inhibits conjugative relaxase expression in bacteria by mRNA targeting
Piazza, Carol Lyn; Smith, Dorie
2018-01-01
Group II introns are mobile ribozymes that are rare in bacterial genomes, often cohabiting with various mobile elements, and seldom interrupting housekeeping genes. What accounts for this distribution has not been well understood. Here, we demonstrate that Ll.LtrB, the group II intron residing in a relaxase gene on a conjugative plasmid from Lactococcus lactis, inhibits its host gene expression and restrains the naturally cohabiting mobile element from conjugative horizontal transfer. We show that reduction in gene expression is mainly at the mRNA level, and results from the interaction between exon-binding sequences (EBSs) in the intron and intron-binding sequences (IBSs) in the mRNA. The spliced intron targets the relaxase mRNA and reopens ligated exons, causing major mRNA loss. Taken together, this study provides an explanation for the distribution and paucity of group II introns in bacteria, and suggests a potential force for those introns to evolve into spliceosomal introns. PMID:29905149
Localized Retroprocessing as a Model of Intron Loss in the Plant Mitochondrial Genome.
Cuenca, Argelia; Ross, T Gregory; Graham, Sean W; Barrett, Craig F; Davis, Jerrold I; Seberg, Ole; Petersen, Gitte
2016-08-03
Loss of introns in plant mitochondrial genes is commonly explained by retroprocessing. Under this model, an mRNA is reverse transcribed and integrated back into the genome, simultaneously affecting the contents of introns and edited sites. To evaluate the extent to which retroprocessing explains intron loss, we analyzed patterns of intron content and predicted RNA editing for whole mitochondrial genomes of 30 species in the monocot order Alismatales. In this group, we found an unusually high degree of variation in the intron content, even expanding the hitherto known variation among angiosperms. Some species have lost some two-third of the cis-spliced introns. We found a strong correlation between intron content and editing frequency, and detected 27 events in which intron loss is consistent with the presence of nucleotides in an edited state, supporting retroprocessing. However, we also detected seven cases of intron loss not readily being explained by retroprocession. Our analyses are also not consistent with the entire length of a fully processed cDNA copy being integrated into the genome, but instead indicate that retroprocessing usually occurs for only part of the gene. In some cases, several rounds of retroprocessing may explain intron loss in genes completely devoid of introns. A number of taxa retroprocessing seem to be very common and a possibly ongoing process. It affects the entire mitochondrial genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes
TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Microbial community analysis of shallow subsurface samples with PCR-DGGE
Energy Technology Data Exchange (ETDEWEB)
Itaevaara, M.; Suihko, M. -L.; Kapanen, A.; Piskonen, R.; Juvonen, R. [VTT Biotechnology, Espoo (Finland)
2005-11-15
This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing
Microbial community analysis of shallow subsurface samples with PCR-DGGE
International Nuclear Information System (INIS)
Itaevaara, M.; Suihko, M.-L.; Kapanen, A.; Piskonen, R.; Juvonen, R.
2005-11-01
This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the
Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-08-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.
Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-01-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744
Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio
2003-09-01
Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.
Molecular characterization of Salmonella isolates by REP-PCR and RAPD analysis.
Albufera, U; Bhugaloo-Vial, P; Issack, M I; Jaufeerally-Fakim, Y
2009-05-01
Eighteen Salmonella isolates from both human and food (non-human) sources (fish, meat, and poultry) were characterized using conventional culture methods, biochemical, serological, and molecular analyses. REP-PCR and RAPD produced DNA profiles for differentiation purposes. Enterobacterial repetitive intergenic consensus (ERIC), repetitive extragenic palindronic (REP) and BOXAIR primers were selected for REP-PCR and two arbitrary primers, namely OPP-16 and OPS-11 were used for RAPD to generate DNA fingerprints from the Salmonella isolates. REP-PCR method showed greater discriminatory power in differentiating closely related strains of the related strains of Salmonella and produced more complex banding patterns as compared with RAPD. A dendogram was constructed with both sets of profiles using SPSS Version 13.0 computer software and showed that most human isolates were separately clustered from the non-human isolates. Two of the human isolates were closely related to some of the non-human isolates. A good correlation was also observed between the serogrouping of the O antigen and the molecular profiles obtained from REP-PCR and RAPD data of the Salmonella isolates. The results of a principal coordinate analysis (PCA) corresponded to the clustering in the dendrogram.
Energy Technology Data Exchange (ETDEWEB)
Miranda, S.R.P.; Gwon, S.; DeGasperi, R. [New York Univ. Medical Center, NY (United States)] [and others
1994-09-01
Tay-Sachs disease (TSD) is an autosomal recessive storage disorder caused by a deficiency of the lysosomal enzyme, {beta}-N-acetylhexosaminidase A (Hex A), a heteropolymer composed of two polypeptides, {alpha} and {beta}. Mutations in the {alpha}-chain gene render the enzyme defective, resulting in the accumulation of g{sub m2} ganglioside in the nervous system. Deficiency of Hex A was detected in a non-Ashkenazic girl of Mexican origin indicating infantile onset of TSD. Molecular investigation of the {alpha}-chain gene excluded the typical Ashkenazic 4 bp insertion in the exon 11 and the intron 12 splice-junction mutations by Hae III and Dde I restriction analysis, respectively. Single strand conformation polymorphism (SSCP) analysis showed a different pattern in the sample where exon 11 and flanking regions were amplified in the patient DNA as compared to the migration of control DNA. Sequencing of PCR amplified genomic DNA containing exon 11 and flanking intronic regions showed a single base substitution (G {r_arrow} A) at position IVS-11 +1. This mutation creates a recognition site for the restriction enzyme Mbo II. Digestion of exon 11 and flanking regions with Mbo II demonstrated homozygosity of the patient for this mutation and heterozygosity in the mother. mRNA from cultured fibroblasts obtained from a normal control and from the propositus was reverse transcribed. The cDNAs coding for Hex A {alpha}-chain were amplified in four overlapping fragments. In the patient sample it was not possible to amplify the fragment containing the exon 11/intron 11 junction, indicating that this mutation alters normal RNA processing of the Hex A pre-mRNA resulting in the deficiency of Hex A activity.
Felske, A; Akkermans, A D; De Vos, W M
1998-11-01
A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.
Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João
2014-01-01
Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Directory of Open Access Journals (Sweden)
Bugert Peter
2009-12-01
Full Text Available Abstract Background Interleukin-6 (IL-6 promoter polymorphisms at positions -597(G→A, -572(G→C and -174(G→C were shown to have a clinical impact on different major diseases. At present PCR-SSP protocols for IL-6 -597/-572/-174haplotyping are elaborate and require large amounts of genomic DNA. Findings We describe an improved typing technique requiring a decreased number of PCR-reactions and a reduced PCR-runtime due to optimized PCR-conditions. Conclusion This enables a fast and efficient determination of IL-6 -597/-572/-174haplotypes in clinical diagnosis and further evaluation of IL-6 promoter polymorphisms in larger patient cohorts.
Gupta, Sarika; Kumari, Kajal; Das, Jyotirmoy; Lata, Charu; Puranik, Swati; Prasad, Manoj
2011-07-01
Introns are noncoding sequences in a gene that are transcribed to precursor mRNA but spliced out during mRNA maturation and are abundant in eukaryotic genomes. The availability of codominant molecular markers and saturated genetic linkage maps have been limited in foxtail millet (Setaria italica (L.) P. Beauv.). Here, we describe the development of 98 novel intron length polymorphic (ILP) markers in foxtail millet using sequence information of the model plant rice. A total of 575 nonredundant expressed sequence tag (EST) sequences were obtained, of which 327 and 248 unique sequences were from dehydration- and salinity-stressed suppression subtractive hybridization libraries, respectively. The BLAST analysis of 98 EST sequences suggests a nearly defined function for about 64% of them, and they were grouped into 11 different functional categories. All 98 ILP primer pairs showed a high level of cross-species amplification in two millets and two nonmillets species ranging from 90% to 100%, with a mean of ∼97%. The mean observed heterozygosity and Nei's average gene diversity 0.016 and 0.171, respectively, established the efficiency of the ILP markers for distinguishing the foxtail millet accessions. Based on 26 ILP markers, a reasonable dendrogram of 45 foxtail millet accessions was constructed, demonstrating the utility of ILP markers in germplasm characterizations and genomic relationships in millets and nonmillets species.
Directory of Open Access Journals (Sweden)
Rafael Herrera-Esparza
2013-01-01
Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Directory of Open Access Journals (Sweden)
Hansson Per
2005-11-01
Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Directory of Open Access Journals (Sweden)
Cielo M. León
2017-10-01
Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.
León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.
2017-01-01
Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670
Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars
2015-01-01
Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (pnested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.
Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein
2016-01-01
We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.
[Application of rapid PCR to authenticate medicinal snakes].
Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man
2014-10-01
To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.
Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu
2013-04-01
The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.
An innovative and integrated approach based on DNA walking to identify unauthorised GMOs.
Fraiture, Marie-Alice; Herman, Philippe; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H
2014-03-15
In the coming years, the frequency of unauthorised genetically modified organisms (GMOs) being present in the European food and feed chain will increase significantly. Therefore, we have developed a strategy to identify unauthorised GMOs containing a pCAMBIA family vector, frequently present in transgenic plants. This integrated approach is performed in two successive steps on Bt rice grains. First, the potential presence of unauthorised GMOs is assessed by the qPCR SYBR®Green technology targeting the terminator 35S pCAMBIA element. Second, its presence is confirmed via the characterisation of the junction between the transgenic cassette and the rice genome. To this end, a DNA walking strategy is applied using a first reverse primer followed by two semi-nested PCR rounds using primers that are each time nested to the previous reverse primer. This approach allows to rapidly identify the transgene flanking region and can easily be implemented by the enforcement laboratories. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage
Zheng, Xiaoyan; Hu, Chunyun; Spooner, David; Liu, Jing; Cao, Jiashu; Teng, Yuanwen
2011-09-14
The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae) of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS) revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG) are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh) were selected to investigate their molecular evolution and phylogenetic utility. DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Our study represents the first phylogenetic analyses based on LCNGs in Pyrus. Ancient and recent duplications lead
Directory of Open Access Journals (Sweden)
Cao Jiashu
2011-09-01
Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based
DEFF Research Database (Denmark)
Høie, S.; Dalsgaard, Inger; Aase, I.L.
1999-01-01
. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...
IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR
Directory of Open Access Journals (Sweden)
Ervi Salwati
2012-09-01
Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results. Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction
Application of bioinformatics on the detection of pathogens by Pcr
International Nuclear Information System (INIS)
Rezig, Slim; Sakhri, Saber
2007-01-01
Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)
Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A
2015-06-01
The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Comparative Analysis of Vertebrate Dystrophin Loci Indicate Intron Gigantism as a Common Feature
Pozzoli, Uberto; Elgar, Greg; Cagliani, Rachele; Riva, Laura; Comi, Giacomo P.; Bresolin, Nereo; Bardoni, Alessandra; Sironi, Manuela
2003-01-01
The human DMD gene is the largest known to date, spanning > 2000 kb on the X chromosome. The gene size is mainly accounted for by huge intronic regions. We sequenced 190 kb of Fugu rubripes (pufferfish) genomic DNA corresponding to the complete dystrophin gene (FrDMD) and provide the first report of gene structure and sequence comparison among dystrophin genomic sequences from different vertebrate organisms. Almost all intron positions and phases are conserved between FrDMD and its mammalian counterparts, and the predicted protein product of the Fugu gene displays 55% identity and 71% similarity to human dystrophin. In analogy to the human gene, FrDMD presents several-fold longer than average intronic regions. Analysis of intron sequences of the human and murine genes revealed that they are extremely conserved in size and that a similar fraction of total intron length is represented by repetitive elements; moreover, our data indicate that intron expansion through repeat accumulation in the two orthologs is the result of independent insertional events. The hypothesis that intron length might be functionally relevant to the DMD gene regulation is proposed and substantiated by the finding that dystrophin intron gigantism is common to the three vertebrate genes. [Supplemental material is available online at www.genome.org.] PMID:12727896
Accurate quantification of supercoiled DNA by digital PCR
Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul
2016-01-01
Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649
Escherichia coli H-Genotyping PCR: a Complete and Practical Platform for Molecular H Typing.
Banjo, Masaya; Iguchi, Atsushi; Seto, Kazuko; Kikuchi, Taisei; Harada, Tetsuya; Scheutz, Flemming; Iyoda, Sunao
2018-06-01
In Escherichia coli , more than 180 O groups and 53 H types have been recognized. The O:H serotyping of E. coli strains is an effective method for identifying strains with pathogenic potential and classifying them into clonal groups. In particular, the serotyping of Shiga toxin-producing E. coli (STEC) strains provides valuable information to evaluate the routes, sources, and prevalence of agents in outbreak investigations and surveillance. Here, we present a complete and practical PCR-based H-typing system, E. coli H-genotyping PCR, consisting of 10 multiplex PCR kits with 51 single PCR primer pairs. Primers were designed based on a detailed comparative analysis of sequences from all H-antigen (flagellin)-encoding genes, fliC and its homologs. The specificity of this system was confirmed by using all H type reference strains. Additionally, 362 serotyped wild strains were also used to evaluate its practicality. All 277 H-type-identified isolates gave PCR products that corresponded to the results of serological H typing. Moreover, 76 nonmotile and nine untypeable strains could be successfully subtyped into any H type by the PCR system. The E. coli H-genotyping PCR developed here allows broader, rapid, and low-cost subtyping of H types and will assist epidemiological studies as well as surveillance of pathogenic E. coli . Copyright © 2018 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Marjan Saeedi
2014-01-01
Full Text Available Primary localized cutaneous amyloidosis (PLCA is a chronic skin disorder, caused by amyloid material deposition in the upper dermis. Autosomal dominant PLCA has been mapped earlier to pathogenic missense mutations in the OSMR gene, which encodes the oncostatin M receptor ß subunit (OSMRß. OSMRß is interleukin-6 family cytokine receptors and possesses two ligands, oncostatin M and interleukin-31, which both have biologic roles in inflammation and keratinocyte cell proliferation, differentiation, and apoptosis. Here, we identified a new OSMR mutation in a Kurdish family for the first time. Blood samples were taken from all the affected individuals in the family. DNA extraction was performed using salting out technique. Primers were designed for intron flanking individual exons of OSMR gene which were subjected to direct sequencing after PCR amplification for each sample. Sequencing showed a C/T substitution at position 613 in the proband. This mutation results in an L613S (leucine 613 to serine amino acid change. The identified mutation was observed in all affected family members but not in 100 ethnically matched healthy controls. Elucidating the molecular basis of familial PLCA provides new insight into mechanisms of itch in human skin and may lead to new therapeutic targets for pruritus.
Oliveira, Valdinéia Aparecida; Vicente, Maristela Araújo; Fietto, Luciano Gomes; de Miranda Castro, Ieso; Coutrim, Maurício Xavier; Schüller, Dorit; Alves, Henrique; Casal, Margarida; de Oliveira Santos, Juliana; Araújo, Leandro Dias; da Silva, Paulo Henrique Alves; Brandão, Rogelio Lopes
2008-01-01
Saccharomyces cerevisiae strains from different regions of Minas Gerais, Brazil, were isolated and characterized aiming at the selection of starter yeasts to be used in the production of cachaça, the Brazilian sugar cane spirit. The methodology established took into account the screening for biochemical traits desirable in a yeast cachaça producer, such as no H2S production, high tolerance to ethanol and high temperatures, high fermentative capacity, and the abilities to flocculate and to produce mycocins. Furthermore, the yeasts were exposed to drugs such as 5,5′,5"-trifluor-d,l-leucine and cerulenin to isolate those that potentially overproduce higher alcohols and esters. The utilization of a random amplified polymorphic DNA-PCR method with primers based on intron splicing sites flanking regions of the COX1 gene, as well as microsatellite analysis, was not sufficient to achieve good differentiation among selected strains. In contrast, karyotype analysis allowed a clear distinction among all strains. Two selected strains were experimentally evaluated as cachaça producers. The results suggest that the selection of strains as fermentation starters requires the combined use of biochemical and molecular criteria to ensure the isolation and identification of strains with potential characteristics to produce cachaça with a higher quality standard. PMID:18065624
DEFF Research Database (Denmark)
Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka
2013-01-01
A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350......-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...... between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU...
Directory of Open Access Journals (Sweden)
Yogita Maheshwari
Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.
Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.
2006-01-01
Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...
Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method
Directory of Open Access Journals (Sweden)
Eva Renčová
2014-01-01
Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Directory of Open Access Journals (Sweden)
Jean-Luc Da Lage
Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.
Class I self-splicing introns are found in the T-even bacteriophage family
International Nuclear Information System (INIS)
Chu, F.K.; Maley, F.; Maley, G.F.
1987-01-01
The thymidylate synthase gene (td) and ribonucleotide reductase B2 subunit gene (nrdB) EMBO both of bacteriophage T4 in origin, are procaryotic intron-containing protein-encoding genes. To screen for other procaryotic introns, southern hybridization analysis of several procaryotic genomes was carried out, using T4 phage td DNA restriction fragments and synthetic oligodeoxynucleotides defining strategic td exon and intron regions. Furthermore, the labeling pattern of total RNA with [α- 32 P]GTP, a typical reaction of self-splicing RNAs (class I), was examined. Experimental data implicate multiple self-splicing introns only in the T-even phages: five (1, 0.9, 0.83, 0.75 and 0.6 kb) in T4 and three (1, 0.9 and 0.75 kb) each in T2 and T6 phages. Northern hybridization analysis of total RNA extracted from T-even phage-infected cells confirms that the 1 kb RNA from each phage is in fact the excised intron segment from the precursor RNA transcribed from an intron-containing td gene in each case. This RNA cyclizes to form a contiguous circular molecule. The 0.6 kb RNA is most likely the T4 phage nrdB intron which seems to be absent from the corresponding gene in T2 and T6. The remaining RNA species are candidates for other self-splicing introns in these phages
PCR strategy for identification and differentiation of small pox and other orthopoxviruses.
Ropp, S L; Jin, Q; Knight, J C; Massung, R F; Esposito, J J
1995-08-01
Rapid identification and differentiation of orthopoxviruses by PCR were achieved with primers based on genome sequences encoding the hemagglutinin (HA) protein, an infected-cell membrane antigen that distinguishes orthopoxviruses from other poxvirus genera. The initial identification step used a primer pair of consensus sequences for amplifying an HA DNA fragment from the three known North American orthopoxviruses (raccoonpox, skunkpox, and volepox viruses), and a second pair for amplifying virtually the entire HA open reading frame of the Eurasian-African orthopoxviruses (variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and gerbilpox viruses). RsaI digest electropherograms of the amplified DNAs of the former subgroup provided species differentiation, and TaqI digests differentiated the Eurasian-African orthopoxviruses, including vaccinia virus from the vaccinia virus subspecies buffalopox virus. Endonuclease HhaI digest patterns distinguished smallpox variola major viruses from alastrim variola minor viruses. For the Eurasian-African orthopoxviruses, a confirmatory step that used a set of higher-sequence-homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross-contaminated orthopoxvirus DNA samples; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity. Finally, a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species, which enabled production of a single DNA fragment of a particular size that indicated the specific species.
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear
Directory of Open Access Journals (Sweden)
Gholamreza HASSANPOUR
2016-12-01
Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design
Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G
2014-01-01
The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from
Directory of Open Access Journals (Sweden)
Hua-Ying Fu
2016-01-01
Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.
Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.
2005-01-01
Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and
Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
Quantitative Real-time PCR detection of putrescine-producing Gram-negative bacteria
Directory of Open Access Journals (Sweden)
Kristýna Maršálková
2017-01-01
Full Text Available Biogenic amines are indispensable components of living cells; nevertheless these compounds could be toxic for human health in higher concentrations. Putrescine is supposed to be the major biogenic amine associated with microbial food spoilage. Development of reliable, fast and culture-independent molecular methods to detect bacteria producing biogenic amines deserves the attention, especially of the food industry in purpose to protect health. The objective of this study was to verify the newly designed primer sets for detection of two inducible genes adiA and speF together in Salmonella enterica and Escherichia coli genome by Real-time PCR. These forenamed genes encode enzymes in the metabolic pathway which leads to production of putrescine in Gram-negative bacteria. Moreover, relative expression of these genes was studied in E. coli CCM 3954 strain using Real-time PCR. In this study, sets of new primers for the detection two inducible genes (speF and adiA in Salmonella enterica and E. coli by Real-time PCR were designed and tested. Amplification efficiency of a Real-time PCR was calculated from the slope of the standard curves (adiA, speF, gapA. An efficiency in a range from 95 to 105 % for all tested reactions was achieved. The gene expression (R of adiA and speF genes in E. coli was varied depending on culture conditions. The highest gene expression of adiA and speF was observed at 6, 24 and 36 h (RadiA ~ 3, 5, 9; RspeF ~11, 10, 9; respectively after initiation of growth of this bacteria in nutrient broth medium enchired with amino acids. The results show that these primers could be used for relative quantification analysis of E. coli.
Detection of Streptococcus pneumoniae in whole blood by PCR.
Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D
1995-03-01
Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple
Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR
Directory of Open Access Journals (Sweden)
Roman Wölfel
2012-08-01
Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.
Directory of Open Access Journals (Sweden)
Mary Scruggs
2008-04-01
Full Text Available A polymerase chain reaction (PCR based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme, a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS gene (FUM1- previously FUM5 responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, and 12 of other Fusarium species. In addition, 13 species of other fungal genera, from four phyla, were tested as negative controls. Among the four sets, primer set B consistently amplified a 419- bp fragment from the DNA 96% of all F. verticillioides strains and 83% of F. proliferatum. All other fungi tested were negative using primer set B. A total of 38% of the F. verticillioides strains grown on a selective liquid medium produced fumonisin and 92% formed the toxin on standard rice medium. When fumonisin formed in culture, PCR assay using primer set B detected every strain of F. verticillioides, but only amplified 80% of F. proliferatum strains that produced the toxin. PCR detection was consistent at 100 pg/μl concentration of genomic DNA from 4 F. verticillioides strains, but varied at 10 pg/μl. Two duplicate greenhouse tests using artificially inoculated maize plants, had greater levels of F. verticillioides detected after re-evaluting using primer set B than from culturing of the tissues. The molecular protocols described in this study requires only 1 day for completion compared to approximately 10 days for cultural work and morphological determination. In conclusion, conventional PCR assay using primer set B provides a sensitive and accurate detection assay that can be used as a primary or secondary confirmation method for identification and occurrence of F. verticillioides within the maize tissues. However, studies using primer set B for
Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee
2011-01-01
Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089
Park, S.; Kim, H.; Kim, M.; Lee, Y.; Han, J.
2011-12-01
The 2010 outbreak of foot and mouth disease (FMD) in South Korea caused about 4,054 carcass burial sites to dispose the carcasses. Potential environmental impacts by leachate of carcass on groundwater have been issued and it still needs to be studied. Therefore, we tried to develop robust and sensitive tool to immediately determine a groundwater contamination by the leachate from carcass burial. For tracking both an agricultural fecal contamination source and the leachate in groundwater, competitive real-time PCR and PCR method were developed using various PCR primer sets designed to detect E. Coli uidA gene and mtDNA(cytochrome B, cytB) of the animal species such as ovine, porcine, caprine, and bovine. The designed methods were applied to tract the animal species in livestock wastewater and leachate of carcass under appropriate PCR or real-time PCR condition. In the result, mtDNA primer sets for individual (Cow or Pig) and multiple (Cow and Pig) amplification, and E. Coli uidA primers for fecal source amplification were specific and sensitive to target genes. To determine contamination source, concentration of amplified mtDNA and uidA was competitively quantified in Livestock wastewater, leachate of carcass, and groundwater. The highest concentration of mtDNA and uidA showed in leachate of carcass and livestock wastewater, respectively. Groundwater samples possibly contaminated by leachate of carcass were analyzed by this assay and it was able to prove contamination source.
International Nuclear Information System (INIS)
Bu Hengfu; Chen Juan; Shen Rongsen; Ma Liren; Xu Yongqiang
1996-01-01
Southern blotting hybridization (SBH) using a 32 P-labeled probe is one of the most practical methods for genetic diagnosis of pathogen. On the basis of establishing PCR and nested PCR for detecting human cytomegalovirus (HCMV), a 32 P-labeled probe was prepared with the amplified products of 613 bp PCR outer primers and hybridized with 300 bp inner primer amplified product, resulting in increase in detecting sensitivity from 17 ng (in 1.2% agarose electrophoresis) before SBH to 500 pg (autoradiographed), in other words, increasing the sensitivity of detecting HCMV by 10 2 dilutions after using SBH. The method of PCR and SBH using a 32 P-labeled probe could detect less than 1 gene copy of HCMV, therefore, it is a rapid and reliable diagnosis method for detecting HCMV latent infection
DEFF Research Database (Denmark)
Adriko, John; Aritua, V.; Mortensen, Carmen Nieves
2012-01-01
The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...
Molecular characterization of a new member of the lariat capping twin-ribozyme introns
DEFF Research Database (Denmark)
Tang, Yunjia; Nielsen, Henrik; Masquida, Benoît
2014-01-01
BACKGROUND: Twin-ribozyme introns represent a complex class of mobile group I introns that harbour a lariat capping (LC) ribozyme and a homing endonuclease gene embedded in a conventional self-splicing group I ribozyme (GIR2). Twin-ribozyme introns have so far been confined to nucleolar DNA in Na...
Characteristics of binding sites of intergenic, intronic and exonic ...
African Journals Online (AJOL)
user
2013-03-06
Mar 6, 2013 ... miR-1587). Such part of mRNA is very important for its regulation via several miRNA. Interaction of intronic miRNAs with mRNAs genes coding in-miRNA. Oncogenes (51) are host genes and target genes for in-. miRNAs. Majority of these in-miRNAs are encoded in intron. Five of the studied genes (ATF2, ...
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Directory of Open Access Journals (Sweden)
Assawamakin Anunchai
2007-08-01
, this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at http://bioinfo.biotec.or.th/WASP.
National Research Council Canada - National Science Library
Metzgar, David; Osuna, Miguel; Yingst, Samuel; Rakha, Magda; Earhart, Kenneth; Elyan, Diaa; Esmat, Hala; Saad, Magdi D; Kajon, Adriana; Wu, Jianguo; Gray, Gregory C; Ryan, Margaret A; Russell, Kevin L
2005-01-01
.... Species and serotype identities were determined using several well-validated multiplex PCR protocols culled from the literature and supplemented with a few novel primer sets designed to identify rare types...
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2012-03-01
Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.
Directory of Open Access Journals (Sweden)
Stefania Cazzavillan
2003-03-01
Full Text Available In situ PCR, amplification of target DNA sequences in fixed cells, is a very useful molecular biology tecnique with potential to combine the high sensitivity of tube PCR with the precise anatomical localization of the targeted bsequences. It allows the study of low copy viral or bacterial DNA. In this study we document the utility of directin situ PCR with single primer pair by applying it to 3 infectious agents in different model systems: Borrelia burgdorferi in 5 Eritema migrans lesions and 55 primitive cutaneous B cell lymphomas, Chlamydia pneumoniae in 200 autoptic atheromasic lesions, and Papilloma virus in 20 CIN 1 (mild cervical dysplasia. In situ PCR seems to be a very promising tecnique; however, the prerequisite for the success of in situ PCR is conditioned by optimal standardization of the key variables which, on the other hand, are influenced by tissue composition.
Development of a PCR Assay to detect Papillomavirus Infection in the Snow Leopard
Directory of Open Access Journals (Sweden)
Eng Curtis
2011-07-01
Full Text Available Abstract Background Papillomaviruses (PVs are a group of small, non-encapsulated, species-specific DNA viruses that have been detected in a variety of mammalian and avian species including humans, canines and felines. PVs cause lesions in the skin and mucous membranes of the host and after persistent infection, a subset of PVs can cause tumors such as cervical malignancies and head and neck squamous cell carcinoma in humans. PVs from several species have been isolated and their genomes have been sequenced, thereby increasing our understanding of the mechanism of viral oncogenesis and allowing for the development of molecular assays for the detection of PV infection. In humans, molecular testing for PV DNA is used to identify patients with persistent infections at risk for developing cervical cancer. In felids, PVs have been isolated and sequenced from oral papillomatous lesions of several wild species including bobcats, Asian lions and snow leopards. Since a number of wild felids are endangered, PV associated disease is a concern and there is a need for molecular tools that can be used to further study papillomavirus in these species. Results We used the sequence of the snow leopard papillomavirus UuPV1 to develop a PCR strategy to amplify viral DNA from samples obtained from captive animals. We designed primer pairs that flank the E6 and E7 viral oncogenes and amplify two DNA fragments encompassing these genes. We detected viral DNA for E6 and E7 in genomic DNA isolated from saliva, but not in paired blood samples from snow leopards. We verified the identity of these PCR products by restriction digest and DNA sequencing. The sequences of the PCR products were 100% identical to the published UuPV1 genome sequence. Conclusions We developed a PCR assay to detect papillomavirus in snow leopards and amplified viral DNA encompassing the E6 and E7 oncogenes specifically in the saliva of animals. This assay could be utilized for the molecular
Establishment of a Pcr Technique for Determination of Htlv-1 Infection in Paraffin-Embedded Tissues
Directory of Open Access Journals (Sweden)
M Rastin
2007-04-01
Full Text Available Introduction: HTLV-1 , the first known human retrovirus belongs to oncovirus subfamily of retroviruses. The major characteristic of HTLV-1 is its highly restricted geographic prevalence. Northern part of Khorasan is an endemic region of HTLV-1 infection. Epidemiological studies can help in designing preventive programs for HTLV-1 infection. The aim of this study was the establishment of a PCR technique for determination of HTLV-1 infection in paraffin-embedded tissues. Methods: In this experimental laboratory study for establishment of a technique, PCR was initially optimized using Beta-actin primers on various formalin fixed paraffin-embedded tissues from liver, spleen, skin and lymph nodes. The optimized concentration of Mgcl2 was 2mm, primer was 8 pmol. Optimized concentration of DNA was different according to the kind of tissue. HTLV-1 infection was determined by applying tax, pol, env and LTR primers on 50 paraffin-embedded lymph node tissues . The reporoducibility of this technique was shown for skin and lymph node tissues infected with HTLV-1. Resuls: In 50 lymph node tissues, one case with pathologic diagnosis of NHL was positive with all 5 sets of primers (tax, Pol, env and LTR primers and the other case was positive with only two sets of tax primers but was negative with pol, env and LTR primers. The prevalence of infection was 2% among lymph node specimens. (1 of 50 specimens and if the second case is considered, the prevalence would be 4%. Conclusion: Comparison of the results of this study with another study on blood specimens (seroprevalence2.3% was not statistically significant thus confirming the results of one another. (P=0.883
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.
1999-01-01
Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
Liu, Yunlong; Wu, Haiping; Zhou, Qiang; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua
2017-06-15
Aberrations of gene methylation in stool DNA (sDNA) is an effective biomarker for non-invasive colorectal cancer diagnosis. However, it is challenging to accurately quantitate the gene methylation levels in sDNA due to the low abundance and degradation of sDNA. In this study, a digital quantification strategy was proposed by combining emulsion PCR (emPCR) with hydrogel immobilized bead-array. The assay includes following steps: bisulfite conversion of sDNA, pre-amplification by PCR with specific primers containing 5' universal sequences, emPCR of pre-amplicons with beaded primers to achieve single-molecular amplification and identification of hydrogel embedding beads coated with amplicons. The sensitivity and the specificity of the method are high enough to pick up 0.05% methylated targets from unmethylated DNA background. The successful detection of hypermethylated vimentin gene in clinical stool samples suggests that the proposed method should be a potential tool for non-invasive colorectal cancer screening. Copyright © 2016 Elsevier B.V. All rights reserved.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Chi-Chun Ho
2017-10-01
Full Text Available Thiopurines are clinically useful in the management of diverse immunological and malignant conditions. Nevertheless, these purine analogues can cause lethal myelosuppression, which may be prevented by prospective testing for variants in the thiopurine S-methyltransferase (TPMT and, in East Asians, Nudix hydrolase 15 (NUDT15 genes. Two single-tube, tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR assays were developed to genotype the common loss-of-function variants NUDT15 c.415C>T (rs116855232 and TPMT*3C c.719A>G (rs1142345. In a group of 60 unselected patients, one and seven were found to be homozygous and heterozygous, respectively, for NUDT15 c.415C>T; one was found to be heterozygous for TPMT*3C c.719A>G. There was no non-specific amplification, and the genotypes were 100% concordant with Sanger sequencing. Limit-of-detection for both assays was below 1 ng of heterozygous template per reaction. Time- and cost-effective ARMS-PCR assays, suitable for genotyping East-Asian patients for thiopurine intolerance, were successfully developed and validated.
do Carmo Teixeira, Diva; Luc Danet, Jean; Eveillard, Sandrine; Cristina Martins, Elaine; de Jesus Junior, Waldir Cintra; Takao Yamamoto, Pedro; Aparecido Lopes, Silvio; Beozzo Bassanezi, Renato; Juliano Ayres, Antonio; Saillard, Colette; Bové, Joseph Marie
2005-06-01
Symptoms of huanglongbing (HLB), one of the most serious diseases of citrus in Asia and Africa, have been noticed in March 2004 in the Araraquara region of São Paulo State, Brazil. HLB has not been reported previously from America. The causal HLB bacteria, Candidatus Liberibacter africanus in Africa and Candidatus Liberibacter asiaticus in Asia, can be detected in symptomatic citrus leaves by PCR amplification of their 16S rDNA with previously described primers. When this technique was applied to 43 symptomatic leaf samples from the Araraquara region, all PCR reactions were negative. This suggested that a new pathogen, not detected by the above primers, could be involved in HLB in the State of São Paulo. Indeed, by using universal primers for amplification of bacterial 16S rDNA, a new liberibacter species, Candidatus Liberibacter americanus, has recently been identified. Specific primers for PCR amplification of the 16S rDNA of Ca. L. americanus have been selected. Using these primers, the new liberibacter could be detected in 214 symptomatic leaf samples tested. The leaves of two additional samples were infected with Candidatus Liberibacter asiaticus, and two further samples contained both Ca. L. americanus and Ca. L. asiaticus. The samples came from 47 farms in 35 municipalities. The psyllid vector of Ca. L. asiaticus, Diaphorina citri, is established in South, Central, and North America (Florida and Texas). Ca. L. americanus could be detected by PCR in several batches of D. citri psyllids collected on symptomatic sweet orange trees infected with Ca. L. americanus, strongly suggesting that D. citri is the vector of Ca. L. americanus. The results reported here confirm the presence of HLB in the State of São Paulo. Ca. L. americanus is the most widely distributed pathogen.
Right psoas abscess following right flank trauma: a case report ...
African Journals Online (AJOL)
This is a case of 15 year old boy who presented with three weeks history of right flank pain, two weeks history of fever and five days history of inability to walk well. There was history of right flank trauma a week before the onset of right flank pain. He had earlier presented in two different hospitals before he was brought to our ...
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
Srivastava, Rishi; Bajaj, Deepak; Sayal, Yogesh K; Meher, Prabina K; Upadhyaya, Hari D; Kumar, Rajendra; Tripathi, Shailesh; Bharadwaj, Chellapilla; Rao, Atmakuri R; Parida, Swarup K
2016-11-01
The discovery and large-scale genotyping of informative gene-based markers is essential for rapid delineation of genes/QTLs governing stress tolerance and yield component traits in order to drive genetic enhancement in chickpea. A genome-wide 119169 and 110491 ISM (intron-spanning markers) from 23129 desi and 20386 kabuli protein-coding genes and 7454 in silico InDel (insertion-deletion) (1-45-bp)-based ILP (intron-length polymorphism) markers from 3283 genes were developed that were structurally and functionally annotated on eight chromosomes and unanchored scaffolds of chickpea. A much higher amplification efficiency (83%) and intra-specific polymorphic potential (86%) detected by these markers than that of other sequence-based genetic markers among desi and kabuli chickpea accessions was apparent even by a cost-effective agarose gel-based assay. The genome-wide physically mapped 1718 ILP markers assayed a wider level of functional genetic diversity (19-81%) and well-defined phylogenetics among domesticated chickpea accessions. The gene-derived 1424 ILP markers were anchored on a high-density (inter-marker distance: 0.65cM) desi intra-specific genetic linkage map/functional transcript map (ICC 4958×ICC 2263) of chickpea. This reference genetic map identified six major genomic regions harbouring six robust QTLs mapped on five chromosomes, which explained 11-23% seed weight trait variation (7.6-10.5 LOD) in chickpea. The integration of high-resolution QTL mapping with differential expression profiling detected six including one potential serine carboxypeptidase gene with ILP markers (linked tightly to the major seed weight QTLs) exhibiting seed-specific expression as well as pronounced up-regulation especially in seeds of high (ICC 4958) as compared to low (ICC 2263) seed weight mapping parental accessions. The marker information generated in the present study was made publicly accessible through a user-friendly web-resource, "Chickpea ISM-ILP Marker Database
Rice1265 Array: PCR check - RMOS | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available rophoresis were applied. Data analysis method Upper and Lower primer (refer to the ...cale cDNA analysis in RGP (rice genome research program). To check the clone uniqueness, PCR and gel-elect
Pehlivan, Sacide; Balci, Sibel Oguzkan; Aydeniz, Ali; Pehlivan, Mustafa; Sever, Tugce; Gursoy, Savas
2015-01-01
DNA repair genes are involved in several diseases such as cancers and autoimmune diseases. Previous studies indicated that a DNA repair system was involved in the development of rheumatoid arthritis (RA). In this study, we aimed to examine whether four polymorphisms in the DNA repair genes (xeroderma pigmentosum complementation group D [XPD], X-ray repair cross-complementing group 1 [XRCC1], and X-ray repair cross-complementing group 4 [XRCC4]) were associated with RA. Sixty-five patients with RA and 70 healthy controls (HCs) were examined for XPD (A-751G), XRCC1 (A399G), and XRCC4 (intron 3 VNTR and G-1394T) polymorphisms. All polymorphisms were genotyped by PCR and/or PCR-RFLP. The association between the polymorphisms and RA was analyzed using the chi-square test and de Finetti program. The intron 3 VNTR polymorphism in the XRCC4 gene showed an association with RA patients. The DI genotype was found lower in RA patients (χ(2)=8.227; p=0.0021), while the II genotype was higher in RA patients (χ(2)=5.285; p=0.010). There were deviations from the Hardy-Weinberg Equilibrium (HWE) in both intron 3 VNTR and G-1394T polymorphisms in the XRCC4 gene and in the polymorphism in the XRCC1 gene, and the observed genotype counts deviated from those expected according to the HWE (p=0.027, 0.004, and 0.002, respectively); however, there was no deviation in the other gene polymorphisms. There is no statistical difference between the RA patients and HCs for XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms (p>0.05). Although XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms have been extensively investigated in different clinical pictures, this is the first study to evaluate the role of these polymorphisms in the genetic etiopathogenesis of RA in Turkish patients. In conclusion, we suggested that the intron 3 VNTR polymorphism in the XRCC4 gene may be associated with the etiopathogenesis of RA as a marker of immune aging.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H
2009-11-01
Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
Venema, K.; Maathuis, A.J.H.
2003-01-01
A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12
Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan
2015-02-01
AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Akinori Kuzuya
2011-12-01
Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.
Architecture and Distribution of Introns in Core Genes of Four Fusarium Species
Directory of Open Access Journals (Sweden)
Mmatshepho M. Phasha
2017-11-01
Full Text Available Removal of introns from transcribed RNA represents a crucial step during the production of mRNA in eukaryotes. Available whole-genome sequences and expressed sequence tags (ESTs have increased our knowledge of this process and revealed various commonalities among eukaryotes. However, certain aspects of intron structure and diversity are taxon-specific, which can complicate the accuracy of in silico gene prediction methods. Using core genes, we evaluated the distribution and architecture of Fusarium circinatum spliceosomal introns, and linked these characteristics to the accuracy of the predicted gene models of the genome of this fungus. We also evaluated intron distribution and architecture in F. verticillioides, F. oxysporum, and F. graminearum, and made comparisons with F. circinatum. Results indicated that F. circinatum and the three other Fusarium species have canonical 5′ and 3′ splice sites, but with subtle differences that are apparently not shared with those of other fungal genera. The polypyrimidine tract of Fusarium introns was also found to be highly divergent among species and genes. Furthermore, the conserved adenosine nucleoside required during the first step of splicing is contained within unique branch site motifs in certain Fusarium introns. Data generated here show that introns of F. circinatum, as well as F. verticillioides, F. oxysporum, and F. graminearum, are characterized by a number of unique features such as the CTHAH and ACCAT motifs of the branch site. Incorporation of such information into genome annotation software will undoubtedly improve the accuracy of gene prediction methods used for Fusarium species and related fungi.
Directory of Open Access Journals (Sweden)
Agustin Krisna Wardani
2018-01-01
Kebutuhan kedelai yang mencapai 2,2 juta ton/tahun memaksa Indonesia mengimpor sebanyak 1,62 juta ton. Sebagian besar kedelai impor berupa kedelai transgenik. Dengan munculnya kedelai transgenik di Indonesia, perlu adanya pelabelan Produk Rekayasa Genetika (PRG untuk memenuhi hak-hak konsumen. Teknik yang dilakukan untuk mendeteksi PRG salah satunya menggunakan metode PCR. Penelitian ini bertujuan untuk mengetahui ada tidaknya gen transgenik pada produk susu bubuk kedelai dan formula soya, sehingga produk dapat digolongkan sebagai PRG atau tidak. Selain itu juga bertujuan untuk mengetahui suhu annealing optimum pada primer yang digunakan. Hasil penelitian didapatkan suhu annealing optimum primer CaMV 35S promotor adalah 60oC. Sedangkan untuk primer gen EPSPS-CP4 suhu annealing optimumnya 59oC. Untuk primer NOS terminator suhu annealing optimum tidak ditemukan. Dari amplifikasi DNA sampel, 6 sampel susu bubuk kedelai dan 5 sampel formula soya terdapat sisipan gen EPSPS-CP4 dan gen Promotor CaMV 35S. Dengan demikian 11 sampel tersebut dapat dikatakan sebagai PRG. Kata kunci: Produk rekayasa genetika; PCR; formula soya; susu kedelai bubuk; kedelai transgenik
PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.
Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q
2007-01-01
Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.
Directory of Open Access Journals (Sweden)
Qing Fan
Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis
DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS
Directory of Open Access Journals (Sweden)
Agnieszka MARKOWSKA
2011-01-01
Full Text Available Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examined rabbit population, and allele T with a frequency of 0.3816 of the examined rabbits.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Silvia Cristina Osaki
2013-06-01
Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.
Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.
Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice
2008-11-01
Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
Directory of Open Access Journals (Sweden)
Nao Nishida
Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.
Exon sequence requirements for excision in vivo of the bacterial group II intron RmInt1
Directory of Open Access Journals (Sweden)
Toro Nicolás
2011-05-01
Full Text Available Abstract Background Group II intron splicing proceeds through two sequential transesterification reactions in which the 5' and 3'-exons are joined together and the lariat intron is released. The intron-encoded protein (IEP assists the splicing of the intron in vivo and remains bound to the excised intron lariat RNA in a ribonucleoprotein particle (RNP that promotes intron mobility. Exon recognition occurs through base-pairing interactions between two guide sequences on the ribozyme domain dI known as EBS1 and EBS2 and two stretches of sequence known as IBS1 and IBS2 on the 5' exon, whereas the 3' exon is recognized through interaction with the sequence immediately upstream from EBS1 [(δ-δ' interaction (subgroup IIA] or with a nucleotide [(EBS3-IBS3 interaction (subgroup IIB and IIC] located in the coordination-loop of dI. The δ nucleotide is involved in base pairing with another intron residue (δ' in subgroup IIB introns and this interaction facilitates base pairing between the 5' exon and the intron. Results In this study, we investigated nucleotide requirements in the distal 5'- and 3' exon regions, EBS-IBS interactions and δ-δ' pairing for excision of the group IIB intron RmInt1 in vivo. We found that the EBS1-IBS1 interaction was required and sufficient for RmInt1 excision. In addition, we provide evidence for the occurrence of canonical δ-δ' pairing and its importance for the intron excision in vivo. Conclusions The excision in vivo of the RmInt1 intron is a favored process, with very few constraints for sequence recognition in both the 5' and 3'-exons. Our results contribute to understand how group II introns spread in nature, and might facilitate the use of RmInt1 in gene targeting.
Development and optimization of an efficient qPCR system for olive authentication in edible oils.
Alonso-Rebollo, Alba; Ramos-Gómez, Sonia; Busto, María D; Ortega, Natividad
2017-10-01
The applicability of qPCR in olive-oil authentication depends on the DNA obtained from the oils and the amplification primers. Therefore, four olive-specific amplification systems based on the trnL gene were designed (A-, B-, C- and D-trnL systems). The qPCR conditions, primer concentration and annealing temperature, were optimized. The systems were tested for efficiency and sensitivity to select the most suitable for olive oil authentication. The selected system (D-trnL) demonstrated specificity toward olive in contrast to other oleaginous species (canola, soybean, sunflower, maize, peanut and coconut) and showed high sensitivity in a broad linear dynamic range (LOD and LOQ: 500ng - 0.0625pg). This qPCR system enabled detection, with high sensitivity and specificity, of olive DNA isolated from oils processed in different ways, establishing it as an efficient method for the authentication of olive oil regardless of its category. Copyright © 2017 Elsevier Ltd. All rights reserved.
Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method
Directory of Open Access Journals (Sweden)
Alamian, S.
2015-04-01
Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.
Functional comparison of three transformer gene introns regulating conditional female lethality
The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...
International Nuclear Information System (INIS)
Silvennoinen, R; Lundan, T; Kairisto, V; Pelliniemi, T-T; Putkonen, M; Anttila, P; Huotari, V; Mäntymaa, P; Siitonen, S; Uotila, L; Penttilä, T-L; Juvonen, V; Selander, T; Remes, K
2014-01-01
Multiparameter flow cytometry (MFC) and allele-specific oligonucleotide real-time quantitative PCR (ASO RQ-PCR) are the two most sensitive methods to detect minimal residual disease (MRD) in multiple myeloma (MM). We compared these methods in 129 paired post-therapy samples from 22 unselected, consecutive MM patients in complete/near complete remission. Appropriate immunophenotypic and ASO RQ-PCR-MRD targets could be detected and MRD analyses constructed for all patients. The high PCR coverage could be achieved by gradual widening of the primer sets used for clonality detection. In addition, for 13 (55%) of the patients, reverse orientation of the ASO primer and individual design of the TaqMan probe improved the sensitivity and specificity of ASO RQ-PCR analysis. A significant nonlinear correlation prevailed between MFC-MRD and PCR-MRD when both were positive. Discordance between the methods was found in 32 (35%) paired samples, which were negative by MFC-MRD, but positive by ASO RQ-PCR. The findings suggest that with the described technique, ASO RQ-PCR can be constructed for all patients with MM. ASO RQ-PCR is slightly more sensitive in MRD detection than 6−10-color flow cytometry. Owing to technical demands ASO RQ-PCR could be reserved for patients in immunophenotypic remission, especially in efficacy comparisons between different drugs and treatment modalities
Zadoks, Ruth N; Tassi, Riccardo; Martin, Elena; Holopainen, Jani; McCallum, Sarah; Gibbons, James; Ballingall, Keith T
2014-10-01
Mastitis, inflammation of the mammary gland, is an important cause of disease, mortality, and production losses in dairy and meat sheep. Mastitis is commonly caused by intramammary infection with bacteria, which can be detected by bacterial culture or PCR. PathoProof (Thermo Fisher Scientific Ltd., Vantaa, Finland) is a commercially available real-time PCR system for the detection of bovine mastitis pathogens. Sheep differ from cattle in the bacterial species or bacterial strains that cause mastitis, as well as in the composition of their milk. The aim of this study was to evaluate whether the PathoProof system was suitable for detection of mastitis pathogens in sheep milk. Milk samples were collected aseptically from 219 udder halves of 113 clinically healthy ewes in a single flock. Aliquots were used for bacteriological culture and real-time PCR-based detection of bacteria. For species identified by culture, the diagnosis was confirmed by species-specific conventional PCR or by sequencing of a housekeeping gene. The majority of samples were negative by culture (74.4% of 219 samples) and real-time PCR (82.3% of 192 samples). Agreement was observed for 138 of 192 samples. Thirty-four samples were positive by culture only, mostly due to presence of species that are not covered by primers in the PCR system (e.g., Mannheimia spp.). Two samples were positive for Streptococcus uberis by culture but not by PCR directly from the milk samples. This was not due to inability of the PCR primers to amplify ovine Streptococcus uberis, as diluted DNA extracts from the same samples and DNA extracts from the bacterial isolates were positive by real-time PCR. For samples containing Staphylococcus spp., 11 samples were positive by culture and PCR, 9 by culture only, and 20 by PCR only. Samples that were negative by either method had lower bacterial load than samples that were positive for both methods, whereas no clear relation with species identity was observed. This study provides
Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena
2018-06-13
Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang
1994-01-01
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Energy Technology Data Exchange (ETDEWEB)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)
1994-07-15
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia
Directory of Open Access Journals (Sweden)
Gray Michael W
2005-08-01
Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
2013-01-01
Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252
Energy Technology Data Exchange (ETDEWEB)
Iwasaki, Takuya; Sada, Tetsutaro; Terai, Masanori; Sato, Yuko; Kurata, Takeshi [National Inst. of Infectious Diseases, Tokyo (Japan); Yamaguchi, Kazuyoshi; Yanagisawa, Akio; Sakai, Yuzo
1998-02-01
An animal model, experimentally induced squamous cell carcinoma was produced in hamster mucosa to establish a carcinogenic system inducible by interaction of a virus and chemical(s). Human hydatid mole and cholioepithelioma were chosen as the target subjects. Several tumor cells and host cells were isolated under microscopy and DNA was extracted from these cells to indentify the respective origins (maternal, paternal or host origin). The base sequence of HLADRB region was analyzed by PCR using synthetic primer and the tissue localization was examined by PCR in situ hybridization. A PCR product of 82 bp was found in 15 of 17 samples and there were 2 samples in which the product was not detectable with the constructed primer and 6 samples were negative. While significant differences were not observed by in situ hybridization compared with the negative control. (M.N.)