Single oligomer spectra probe chromophore nanoenvironments of tetrameric fluorescent proteins

NARCIS (Netherlands)

Blum, Christian; Meixner, Alfred J; Subramaniam, Vinod

2006-01-01

When analyzing the emission of a large number of individual chromophores embedded in a matrix, the spread of the observed parameters is a characteristic property for the particular chromophore-matrix system. To quantitatively assess the influence of the matrix on the single molecule emission

The gecko visual pigment: the chromophore dark exchange reaction.

Science.gov (United States)

Crescitelli, F

1988-02-01

This study confirms the occurrence of a dark-exchange reaction in the extracted 521-pigment of the Tokay gecko (G. gekko). The present study involved the exchange, in the dark, of the natural 11-cis-chromophore by the 9-cis-10-F-retinal analog. This analog is able to combine with the 521-opsin to regenerate a photopigment at 492 nm. In addition to this shift in absorbance from 521 to 492 nm, the analog photopigment has a photosensitivity some 2.4% that of the native 521-system in the chloride-sufficient state. These two properties of the regenerated analog pigment have simplified the demonstration of a dark exchange of chromophores. At 15 degrees C the 9-cis-10-F-analog replaces the 11-cis-chromophore by at least 30% (density-wise) in about 15 hr. This exchange occurs with the system in the chloride-deficient state. The presence of chloride during the period in the dark significantly reduces the magnitude of the exchange. Apparently, the protein has a more open structure at the chromophoric binding site, allowing this interchange of chromophores. The addition of chloride induces a conformational change at this site, 'burying' the Schiff base and reducing the exchange reaction. The biological implication of this mobile property of the gecko opsin is that it is similar to the behavior of the cone pigment iodopsin but is unlike that of rhodopsins. This supports the idea that the gecko visual cells, despite their appearance as rods, are phylogenetically related to ancestral photopic receptors.

Theoretical study of chromophores for biological sensing: Understanding the mechanism of rhodol based multi-chromophoric systems

Science.gov (United States)

Rivera-Jacquez, Hector J.; Masunov, Artëm E.

2018-06-01

Development of two-photon fluorescent probes can aid in visualizing the cellular environment. Multi-chromophore systems display complex manifolds of electronic transitions, enabling their use for optical sensing applications. Time-Dependent Density Functional Theory (TDDFT) methods allow for accurate predictions of the optical properties. These properties are related to the electronic transitions in the molecules, which include two-photon absorption cross-sections. Here we use TDDFT to understand the mechanism of aza-crown based fluorescent probes for metals sensing applications. Our findings suggest changes in local excitation in the rhodol chromophore between unbound form and when bound to the metal analyte. These changes are caused by a charge transfer from the aza-crown group and pyrazol units toward the rhodol unit. Understanding this mechanism leads to an optimized design with higher two-photon excited fluorescence to be used in medical applications.

Tautomeric forms of PPI dendrimers functionalized with 4-(4′-ethoxybenzoyloxy)salicylaldehyde chromophores

International Nuclear Information System (INIS)

Franckevičius, M.; Vaišnoras, R.; Marcos, M.; Serrano, J.L.; Gruodis, A.; Galikova, N.; Gulbinas, V.

2012-01-01

Highlights: ► SA chromophore groups are formed by bonding terminal groups to PPI dendrimers. ► SA chromophore groups reveal four most stable tautomeric forms. ► Tautomeric properties of SA groups depend on the dendrimer generation and solvent. ► Aggregation of SA chromophores facilitates formation of the trans-keto tautomers. ► Fluorescence of PPI SA dendrimers is attributed to nπ ∗ states of keto tautomers. -- Abstract: Bonding of the promesogenic unit derived from 4-(4′-ethoxybenzoyloxy)salicylaldehyde to the amino terminated PPI dendrimer chains results in formation of the salicylidenimine chromophore groups. Absorption and fluorescence investigations of the dendrimer solutions supported by the quantum chemistry calculations revealed that the chromophore groups may exist in enol and keto tautomeric forms with relative concentrations depending on the dendrimer generation and solvent. The dendrimer fluorescence is attributed to nπ ∗ states of keto tautomers which may also be formed from excited enol tautomers.

Electron transfer in silicon-bridged adjacent chromophores: the source for blue-green emission.

Science.gov (United States)

Bayda, Malgorzata; Angulo, Gonzalo; Hug, Gordon L; Ludwiczak, Monika; Karolczak, Jerzy; Koput, Jacek; Dobkowski, Jacek; Marciniak, Bronislaw

2017-05-10

Si-Bridged chromophores have been proposed as sources for blue-green emission in several technological applications. The origin of this dual emission is to be found in an internal charge transfer reaction. The current work is an attempt to describe the details of these processes in these kinds of substances, and to design a molecular architecture to improve their performance. Nuclear motions essential for intramolecular charge transfer (ICT) can involve processes from twisted internal moieties to dielectric relaxation of the solvent. To address these issues, we studied ICT between adjacent chromophores in a molecular compound containing N-isopropylcarbazole (CBL) and 1,4-divinylbenzene (DVB) linked by a dimethylsilylene bridge. In nonpolar solvents emission arises from the local excited state (LE) of carbazole whereas in solvents of higher polarity dual emission was detected (LE + ICT). The CT character of the additional emission band was concluded from the linear dependence of the fluorescence maxima on solvent polarity. Electron transfer from CBL to DVB resulted in a large excited-state dipole moment (37.3 D) as determined from a solvatochromic plot and DFT calculations. Steady-state and picosecond time-resolved fluorescence experiments in butyronitrile (293-173 K) showed that the ICT excited state arises from the LE state of carbazole. These results were analyzed and found to be in accordance with an adiabatic version of Marcus theory including solvent relaxation.

A Fragment-Cloud Model for Breakup of Asteroids with Varied Internal Structures

Science.gov (United States)

Wheeler, Lorien; Mathias, Donovan; Stokan, Ed; Brown, Peter

2016-01-01

As an asteroid descends toward Earth, it deposits energy in the atmosphere through aerodynamic drag and ablation. Asteroid impact risk assessments rely on energy deposition estimates to predict blast overpressures and ground damage that may result from an airburst, such as the one that occurred over Chelyabinsk, Russia in 2013. The rates and altitudes at which energy is deposited along the entry trajectory depend upon how the bolide fragments, which in turn depends upon its internal structure and composition. In this work, we have developed an analytic asteroid fragmentation model to assess the atmospheric energy deposition of asteroids with a range of structures and compositions. The modeling approach combines successive fragmentation of larger independent pieces with aggregate debris clouds released with each fragmentation event. The model can vary the number and masses of fragments produced, the amount of mass released as debris clouds, the size-strength scaling used to increase the robustness of smaller fragments, and other parameters. The initial asteroid body can be seeded with a distribution of independent fragment sizes amid a remaining debris mass to represent loose rubble pile conglomerations, can be given an outer regolith later, or can be defined as a coherent or fractured monolith. This approach enables the model to represent a range of breakup behaviors and reproduce detailed energy deposition features such as multiple flares due to successive burst events, high-altitude regolith blow-off, or initial disruption of rubble piles followed by more energetic breakup of the constituent boulders. These capabilities provide a means to investigate sensitivities of ground damage to potential variations in asteroid structure.

Structure of the red fluorescent protein from a lancelet (Branchiostoma lanceolatum): a novel GYG chromophore covalently bound to a nearby tyrosine

Energy Technology Data Exchange (ETDEWEB)

Pletnev, Vladimir Z., E-mail: vzpletnev@gmail.com; Pletneva, Nadya V.; Lukyanov, Konstantin A.; Souslova, Ekaterina A.; Fradkov, Arkady F.; Chudakov, Dmitry M.; Chepurnykh, Tatyana; Yampolsky, Ilia V. [Russian Academy of Sciences, Moscow (Russian Federation); Wlodawer, Alexander [National Cancer Institute, Frederick, MD 21702 (United States); Dauter, Zbigniew [National Cancer Institute, Argonne, IL 60439 (United States); Pletnev, Sergei, E-mail: vzpletnev@gmail.com [National Cancer Institute, Argonne, IL 60439 (United States); SAIC-Frederick, Argonne, IL 60439 (United States); Russian Academy of Sciences, Moscow (Russian Federation)

2013-09-01

The crystal structure of the novel red emitting fluorescent protein from lancelet Branchiostoma lanceolatum (Chordata) revealed an unusual five residues cyclic unit comprising Gly58-Tyr59-Gly60 chromophore, the following Phe61 and Tyr62 covalently bound to chromophore Tyr59. A key property of proteins of the green fluorescent protein (GFP) family is their ability to form a chromophore group by post-translational modifications of internal amino acids, e.g. Ser65-Tyr66-Gly67 in GFP from the jellyfish Aequorea victoria (Cnidaria). Numerous structural studies have demonstrated that the green GFP-like chromophore represents the ‘core’ structure, which can be extended in red-shifted proteins owing to modifications of the protein backbone at the first chromophore-forming position. Here, the three-dimensional structures of green laGFP (λ{sub ex}/λ{sub em} = 502/511 nm) and red laRFP (λ{sub ex}/λ{sub em} ≃ 521/592 nm), which are fluorescent proteins (FPs) from the lancelet Branchiostoma lanceolatum (Chordata), were determined together with the structure of a red variant laRFP-ΔS83 (deletion of Ser83) with improved folding. Lancelet FPs are evolutionarily distant and share only ∼20% sequence identity with cnidarian FPs, which have been extensively characterized and widely used as genetically encoded probes. The structure of red-emitting laRFP revealed three exceptional features that have not been observed in wild-type fluorescent proteins from Cnidaria reported to date: (i) an unusual chromophore-forming sequence Gly58-Tyr59-Gly60, (ii) the presence of Gln211 at the position of the conserved catalytic Glu (Glu222 in Aequorea GFP), which proved to be crucial for chromophore formation, and (iii) the absence of modifications typical of known red chromophores and the presence of an extremely unusual covalent bond between the Tyr59 C{sup β} atom and the hydroxyl of the proximal Tyr62. The impact of this covalent bond on the red emission and the large Stokes shift (�

Chromophore Structure of Photochromic Fluorescent Protein Dronpa: Acid-Base Equilibrium of Two Cis Configurations.

Science.gov (United States)

Higashino, Asuka; Mizuno, Misao; Mizutani, Yasuhisa

2016-04-07

Dronpa is a novel photochromic fluorescent protein that exhibits fast response to light. The present article is the first report of the resonance and preresonance Raman spectra of Dronpa. We used the intensity and frequency of Raman bands to determine the structure of the Dronpa chromophore in two thermally stable photochromic states. The acid-base equilibrium in one photochromic state was observed by spectroscopic pH titration. The Raman spectra revealed that the chromophore in this state shows a protonation/deprotonation transition with a pKa of 5.2 ± 0.3 and maintains the cis configuration. The observed resonance Raman bands showed that the other photochromic state of the chromophore is in a trans configuration. The results demonstrate that Raman bands selectively enhanced for the chromophore yield valuable information on the molecular structure of the chromophore in photochromic fluorescent proteins after careful elimination of the fluorescence background.

International fragmentation af produktionen og vertikal disintegration af styringsformer i produktionskæderne

DEFF Research Database (Denmark)

Refslund, Bjarke

Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...

Dielectric Properties of Azo Polymers: Effect of the Push-Pull Azo Chromophores

Directory of Open Access Journals (Sweden)

Xuan Zhang

2018-01-01

Full Text Available The relationship between the structure and the dielectric properties of the azo polymers was studied. Four azo polymers were synthesized through the azo-coupling reaction between the same precursor (PAZ and diazonium salts of 4-aminobenzoic acid ethyl ester, 4-aminobenzonitrile, 4-nitroaniline, and 2-amino-5-nitrothiazole, respectively. The precursor and azo polymers were characterized by 1H NMR, FT-IR, UV-vis, GPC, and DSC. The dielectric constant and dielectric loss of the samples were measured in the frequency range of 100 Hz–200 kHz. Due to the existence of the azo chromophores, the dielectric constant of the azo polymers increases compared with that of the precursor. In addition, the dielectric constant of the azo polymers increases with the increase of the polarity of the azo chromophores. A random copolymer (PAZ-NT-PAZ composed of the azo polymer PAZ-NT and the precursor PAZ was also prepared to investigate the content of the azo chromophores on the dielectric properties of the azo polymers. It showed that the dielectric constant increases with the increase of the azo chromophores. The results show that the dielectric constant of this kind of azo polymers can be controlled by changing the structures and contents of azo chromophores during the preparation process.

Synthesis and Properties of the p-Sulfonamide Analogue of the Green Fluorescent Protein (GFP) Chromophore: The Mimic of GFP Chromophore with Very Strong N-H Photoacid Strength.

Science.gov (United States)

Chen, Yi-Hui; Sung, Robert; Sung, Kuangsen

2018-04-06

The para-sulfonamide analogue ( p-TsABDI) of a green fluorescent protein (GFP) chromophore was synthesized to mimic the GFP chromophore. Its S 1 excited-state p K a * value in dimethylsulfoxide (DMSO) is -1.5, which is strong enough to partially protonate dipolar aprotic solvents and causes excited-state proton transfer (ESPT), so it can partially mimic the GFP chromophore to further study the ESPT-related photophysics and the blinking phenomenon of GFP. In comparison with 8-hydroxypyrene-1,3,6-trisulfonate (HPTS) (p K a = 7.4, p K a * = 1.3 in water), p-TsABDI (p K a = 6.7, p K a * = -1.5 in DMSO) is a better photoacid for pH-jump studies.

Bootstrap embedding: An internally consistent fragment-based method

Energy Technology Data Exchange (ETDEWEB)

Welborn, Matthew; Tsuchimochi, Takashi; Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)

2016-08-21

Strong correlation poses a difficult problem for electronic structure theory, with computational cost scaling quickly with system size. Fragment embedding is an attractive approach to this problem. By dividing a large complicated system into smaller manageable fragments “embedded” in an approximate description of the rest of the system, we can hope to ameliorate the steep cost of correlated calculations. While appealing, these methods often converge slowly with fragment size because of small errors at the boundary between fragment and bath. We describe a new electronic embedding method, dubbed “Bootstrap Embedding,” a self-consistent wavefunction-in-wavefunction embedding theory that uses overlapping fragments to improve the description of fragment edges. We apply this method to the one dimensional Hubbard model and a translationally asymmetric variant, and find that it performs very well for energies and populations. We find Bootstrap Embedding converges rapidly with embedded fragment size, overcoming the surface-area-to-volume-ratio error typical of many embedding methods. We anticipate that this method may lead to a low-scaling, high accuracy treatment of electron correlation in large molecular systems.

Ultraviolet-resonance femtosecond stimulated Raman study of the initial events in photoreceptor chromophore

Directory of Open Access Journals (Sweden)

Tahara T.

2013-03-01

Full Text Available Newly-developed ultraviolet-resonance femtosecond stimulated-Raman spectroscopy was utilized to study the initial structural evolution of photoactive yellow protein chromophore in solution. The obtained spectra changed drastically within 1 ps, demonstrating rapid in-plane deformations of the chromophore.

Engineering a genetically-encoded SHG chromophore by electrostatic targeting to the membrane

Directory of Open Access Journals (Sweden)

Yuka eJinno

2014-11-01

Full Text Available Although second harmonic generation (SHG microscopy provides unique imaging advantages for voltage imaging and other biological applications, genetically-encoded SHG chromophores remain relatively unexplored. SHG only arises from non-centrosymmetric media, so an anisotropic arrangement of chromophores is essential to provide strong SHG signals. Here, inspired by the mechanism by which K-Ras4B associates with plasma membranes, we sought to achieve asymmetric arrangements of chromophores at the membrane-cytoplasm interface using the fluorescent protein mVenus. After adding a farnesylation motif to the C-terminus of mVenus, nine amino acids composing its -barrel surface were replaced by lysine, forming an electrostatic patch. This protein (mVe9Knus-CVIM was efficiently targeted to the plasma membrane in a geometrically defined manner and exhibited SHG in HEK293 cells. In agreement with its design, mVe9Knus-CVIM hyperpolarizability was oriented at a small angle (~7.3º from the membrane normal. Genetically-encoded SHG chromophores could serve as a molecular platform for imaging membrane potential.

On Fragments and Geometry : The International Legal Order as Metaphor and How It Matters

NARCIS (Netherlands)

N.M. Rajkovic (Nikolas)

2013-01-01

markdownabstract__Abstract__ This article engages the narrative of fragmentation in international law by asserting that legal academics and professionals have failed to probe more deeply into ‘fragmentation’ as a concept and, more specifically, as a spatial metaphor. The contention here is that

Preparation and optical characteristics of layered perovskite-type lead-bromide-incorporated azobenzene chromophores

Science.gov (United States)

Sasai, Ryo; Shinomura, Hisashi

2013-02-01

Lead bromide-based layered perovskite powders with azobenzene derivatives were prepared by a homogeneous precipitation method. From the diffuse reflectance (DR) and photoluminescence (PL) spectra of the hybrid powder materials, the present hybrids exhibited sharp absorption and PL peaks originating from excitons produced in the PbBr42- layer. When the present hybrid powder was irradiated with UV light at 350 nm, the absorption band from the trans-azobenzene chromophore, observed around 350 nm, decreased, while the absorption band from the cis-azobenzene chromophore, observed around 450 nm, increased. These results indicate that azobenzene chromophores in the present hybrid materials exhibit reversible photoisomerization. Moreover, it was found that the PL intensity from the exciton also varied due to photoisomerization of the azobenzene chromophores in the present hybrid. Thus, for the first time we succeeded in preparing the azobenzene derivative lead-bromide-based layered perovskite with photochromism before and after UV light irradiation.

A possibly universal red chromophore for modeling color variations on Jupiter

Science.gov (United States)

Sromovsky, L. A.; Baines, K. H.; Fry, P. M.; Carlson, R. W.

2017-07-01

A new laboratory-generated chemical compound made from photodissociated ammonia (NH3) molecules reacting with acetylene (C2H2) was suggested as a possible coloring agent for Jupiter's Great Red Spot (GRS) by Carlson et al. (2016, Icarus 274, 106-115). Baines et al. (2016, Icarus, submitted) showed that the GRS spectrum measured by the visual channels of the Cassini VIMS instrument in 2000 could be accurately fit by a cloud model in which the chromophore appeared as a physically thin layer of small particles immediately above the main cloud layer of the GRS. Here we show that the same chromophore and same layer location can also provide close matches to the short wavelength spectra of many other cloud features on Jupiter, suggesting this material may be a nearly universal chromophore that could explain the various degrees of red coloration on Jupiter. This is a robust conclusion, even for 12% changes in VIMS calibration and large uncertainties in the refractive index of the main cloud layer due to uncertain fractions of NH4SH and NH3 in its cloud particles. The chromophore layer can account for color variations among north and south equatorial belts, equatorial zone, and the Great Red Spot, by varying particle size from 0.12 μm to 0.29 μm and 1-μm optical depth from 0.06 to 0.76. The total mass of the chromophore layer is much less variable, ranging from 18 to 30 μg/cm2, except in the equatorial zone, where it is only 10-13 μg/cm2. We also found a depression of the ammonia volume mixing ratio in the two belt regions, which averaged 0.4 - 0.5 ×10-4 immediately below the ammonia condensation level, while the other regions averaged twice that value.

Ultrafast dual photoresponse of isolated biological chromophores: link to the photoinduced mode-specific non-adiabatic dynamics in proteins

DEFF Research Database (Denmark)

Bochenkova, Anastasia; Andersen, Lars Henrik

2013-01-01

The anionic wild-type Green Fluorescent Protein (GFP) chromophore defines the entire class of naturally occurring chromophores, which are based on the oxydized tyrosine side chain. The GFP chromophore exhibits an enriched photoinduced non-adiabatic dynamics in the multiple excited-state decay cha...

Highly fluorescent benzofuran derivatives of the GFP chromophore

DEFF Research Database (Denmark)

Christensen, Mikkel Andreas; Jennum, Karsten Stein; Abrahamsen, Peter Bæch

2012-01-01

Intramolecular cyclization reactions of Green Fluorescent Protein chromophores (GFPc) containing an arylethynyl ortho-substituent at the phenol ring provide new aryl-substituted benzofuran derivatives of the GFPc. Some of these heteroaromatic compounds exhibit significantly enhanced fluorescence...

Absorption tuning of the green fluorescent protein chromophore: synthesis and studies of model compounds

DEFF Research Database (Denmark)

Brøndsted Nielsen, Mogens; Andersen, Lars Henrik; Rinza, Tomás Rocha

2011-01-01

The green fluorescent protein (GFP) chromophore is a heterocyclic compound containing a p-hydroxybenzylidine attached to an imidazol-5(4H)-one ring. This review covers the synthesis of a variety of model systems for elucidating the intrinsic optical properties of the chromophore in the gas phase ...

Synthesis and electro-optic properties of the chromophore-containing NLO polyarylate polymers

Science.gov (United States)

Ren, Haohui; Peng, Chengcheng; Bo, Shuhui; Fan, Guofang; Xu, Guangming; Zhao, Hui; Zhen, Zhen; Liu, Xinhou

2014-03-01

Base on the same two monomers, diphenolic acid (DPA) and isophthaloyl chloride (IPC), three chromophore-containing nonlinear optical (NLO) polyarylate polymers were prepared. A tricyanofuran (TCF)-acceptor type chromophore group was in main-chain (mPAR-chr1), side-chain (sPAR-chr1) and side-chain with a 1,1-bis(4-hydroxyphenyl)-1-phenyl-2,2,2-trifluoroethane (BPAPF) group (sPAR-F-chr1), respectively. The obtained polymers were characterized and evaluated by UV-Vis, 1H NMR, DSC and TGA. All the polymers exhibited good electro-optic (EO) activity. The relationship between EO coefficients (r33) and the chromophore concentration of the three polymers were also characterized and discussed. There were no obvious differences found in EO activity between mPAR-chr1 and sPAR-chr1 polyarylates with the same chromophore. The fluorinated block polyarylate sPAR-F-chr1 has the largest r33 value in these three polyarylates which is 52 pm/V at the wavelength of 1310 nm (which is almost twice the r33 value of normal polymers contained the same chormophore at the same content), when the concentration of chromophore 1 is 18wt.%. 85% of the r33 value was retained in the sPAR-F-chr1 after being heated at 85°C for 600 hours. The polymer sPAR-F-chr1, with good solubility, high Tg (above 200 °C) and side functional group at the same time, may probably be a practical NLO material. These properties make the new polyarylates have potential applications in EO devices such as EO modulators and switches.

Quantitative analysis of valence photoemission spectra and quasiparticle excitations at chromophore-semiconductor interfaces.

Science.gov (United States)

Patrick, Christopher E; Giustino, Feliciano

2012-09-14

Investigating quasiparticle excitations of molecules on surfaces through photoemission spectroscopy forms a major part of nanotechnology research. Resolving spectral features at these interfaces requires a comprehensive theory of electron removal and addition processes in molecules and solids which captures the complex interplay of image charges, thermal effects, and configurational disorder. Here, we develop such a theory and calculate the quasiparticle energy-level alignment and the valence photoemission spectrum for the prototype biomimetic solar cell interface between anatase TiO(2) and the N3 chromophore. By directly matching our calculated photoemission spectrum to experimental data, we clarify the atomistic origin of the chromophore peak at low binding energy. This case study sets a new standard in the interpretation of photoemission spectroscopy at complex chromophore-semiconductor interfaces.

Facile attachment of nonlinear optical chromophores to polycarbonates

NARCIS (Netherlands)

Faccini, M.; Balakrishnan, M.; Torosantucci, Riccardo; Driessen, A.; Reinhoudt, David; Verboom, Willem

2008-01-01

A versatile, generally applicable synthetic methodology for side-chain NLO polycarbonates was developed. This represents the first example of covalent incorporation of NLO chromophores to a prepolymerized polycarbonate backbone. This methodology allows to adjust the polymer backbone structure and to

Contrasting the excited-state dynamics of the photoactive yellow protein chromophore: Protein versus solvent environments

NARCIS (Netherlands)

Vengris, M.; Horst, M.A.; Zgrablic, G.; van Stokkum, I.H.M.; Haacke, S.; Chergui, M.; Hellingwerf, K.J.; van Grondelle, R.; Larsen, D.S.

2004-01-01

Wavelength- and time-resolved fluorescence experiments have been performed on the photoactive yellow protein, the E46Q mutant, the hybrids of these proteins containing a nonisomerizing "locked" chromophore, and the native and locked chromophores in aqueous solution. The ultrafast dynamics of these

Triplet excited state properties in variable gap π-conjugated donor–acceptor–donor chromophores

KAUST Repository

Cekli, Seda; Winkel, Russell W.; Alarousu, Erkki; Mohammed, Omar F.; Schanze, Kirk S.

2016-01-01

A series of variable band-gap donor–acceptor–donor (DAD) chromophores capped with platinum(II) acetylide units has been synthesized and fully characterized by electrochemical and photophysical methods, with particular emphasis placed on probing triplet excited state properties. A counter-intuitive trend of increasing fluorescence quantum efficiency and lifetime with decreasing excited state energy (optical gap) is observed across the series of DAD chromophores. Careful study of the excited state dynamics, including triplet yields (as inferred from singlet oxygen sensitization), reveals that the underlying origin of the unusual trend in the fluorescence parameters is that the singlet–triplet intersystem crossing rate and yield decrease with decreasing optical gap. It is concluded that the rate of intersystem crossing decreases as the LUMO is increasingly localized on the acceptor unit in the DAD chromophore, and this result is interpreted as arising because the extent of spin–orbit coupling induced by the platinum heavy metal centers decreases as the LUMO is more localized on the acceptor. In addition to the trend in intersystem crossing, the results show that the triplet decay rates follow the Energy Gap Law correlation over a 1.8 eV range of triplet energy and 1000-fold range of triplet decay rates. Finally, femtosecond transient absorption studies for the DAD chromophores reveals a strong absorption in the near-infrared region which is attributed to the singlet excited state. This spectral band appears to be general for DAD chromophores, and may be a signature of the charge transfer (CT) singlet excited state.

Triplet excited state properties in variable gap π-conjugated donor–acceptor–donor chromophores

KAUST Repository

Cekli, Seda

2016-02-12

A series of variable band-gap donor–acceptor–donor (DAD) chromophores capped with platinum(II) acetylide units has been synthesized and fully characterized by electrochemical and photophysical methods, with particular emphasis placed on probing triplet excited state properties. A counter-intuitive trend of increasing fluorescence quantum efficiency and lifetime with decreasing excited state energy (optical gap) is observed across the series of DAD chromophores. Careful study of the excited state dynamics, including triplet yields (as inferred from singlet oxygen sensitization), reveals that the underlying origin of the unusual trend in the fluorescence parameters is that the singlet–triplet intersystem crossing rate and yield decrease with decreasing optical gap. It is concluded that the rate of intersystem crossing decreases as the LUMO is increasingly localized on the acceptor unit in the DAD chromophore, and this result is interpreted as arising because the extent of spin–orbit coupling induced by the platinum heavy metal centers decreases as the LUMO is more localized on the acceptor. In addition to the trend in intersystem crossing, the results show that the triplet decay rates follow the Energy Gap Law correlation over a 1.8 eV range of triplet energy and 1000-fold range of triplet decay rates. Finally, femtosecond transient absorption studies for the DAD chromophores reveals a strong absorption in the near-infrared region which is attributed to the singlet excited state. This spectral band appears to be general for DAD chromophores, and may be a signature of the charge transfer (CT) singlet excited state.

Stabilization of structure in near-infrared fluorescent proteins by binding of biliverdin chromophore

Science.gov (United States)

Stepanenko, Olesya V.; Stepanenko, Olga V.; Bublikov, G. S.; Kuznetsova, I. M.; Verkhusha, V. V.; Turoverov, K. K.

2017-07-01

Near-infrared fluorescent proteins (NIR FPs) engineered from bacterial phytochromes and their mutants with different location of Cys residues, which able to bind a biliverdin chromophore, or without these Cys residues were studied using intrinsic tryptophan fluorescence, NIR fluorescence and circular dichroism. It was shown that a covalent binding of the biliverdin chromophore to a Cys residue via thioether group substantially stabilizes the spatial structure of NIR FPs. The stability of the protein structure and the chromophore association strength strongly depends on the location of Cys residues and decreases in the following order: a protein with Cys residues in both domains, a protein with Cys in PAS domains, and a protein with Cys in GAF domains. NIR FPs without Cys residues capable to covalently attach biliverdin have the lowest stability, comparable to NIR FP apoforms.

Dual Mechanism Nonlinear Response of Selected Metal Organic Chromophores

National Research Council Canada - National Science Library

Peak, John D

2007-01-01

13 The goal for the research described herein is the development of a series of transition metal based metal organic chromophores that display both two-photon and excited state absorption (TPA/ESA) character...

Performance of Popular XC-Functionals for the Description of Excitation Energies in GFP-Like Chromophore Models

DEFF Research Database (Denmark)

List, Nanna Holmgaard; Olsen, Jógvan Magnus Haugaard; Rocha-Rinza, Tomás

2012-01-01

this task. We present an evaluation of the performance of commonly used XC-functionals for the prediction of excitation energies of GFP-like chromophores. In particular, we have considered the TD-DFT vertical excitation energies of chromophores displaying different charge states. We compare the quality...

Smartphone snapshot mapping of skin chromophores under triple-wavelength laser illumination

Science.gov (United States)

Spigulis, Janis; Oshina, Ilze; Berzina, Anna; Bykov, Alexander

2017-09-01

Chromophore distribution maps are useful tools for skin malformation severity assessment and for monitoring of skin recovery after burns, surgeries, and other interactions. The chromophore maps can be obtained by processing several spectral images of skin, e.g., captured by hyperspectral or multispectral cameras during seconds or even minutes. To avoid motion artifacts and simplify the procedure, a single-snapshot technique for mapping melanin, oxyhemoglobin, and deoxyhemoglobin of in-vivo skin by a smartphone under simultaneous three-wavelength (448-532-659 nm) laser illumination is proposed and examined. Three monochromatic spectral images related to the illumination wavelengths were extracted from the smartphone camera RGB image data set with respect to crosstalk between the RGB detection bands. Spectral images were further processed accordingly to Beer's law in a three chromophore approximation. Photon absorption path lengths in skin at the exploited wavelengths were estimated by means of Monte Carlo simulations. The technique was validated clinically on three kinds of skin lesions: nevi, hemangiomas, and seborrheic keratosis. Design of the developed add-on laser illumination system, image-processing details, and the results of clinical measurements are presented and discussed.

Theoretical description of protein field effects on electronic excitations of biological chromophores

International Nuclear Information System (INIS)

Varsano, Daniele; Caprasecca, Stefano; Coccia, Emanuele

2017-01-01

Photoinitiated phenomena play a crucial role in many living organisms. Plants, algae, and bacteria absorb sunlight to perform photosynthesis, and convert water and carbon dioxide into molecular oxygen and carbohydrates, thus forming the basis for life on Earth. The vision of vertebrates is accomplished in the eye by a protein called rhodopsin, which upon photon absorption performs an ultrafast isomerisation of the retinal chromophore, triggering the signal cascade. Many other biological functions start with the photoexcitation of a protein-embedded pigment, followed by complex processes comprising, for example, electron or excitation energy transfer in photosynthetic complexes. The optical properties of chromophores in living systems are strongly dependent on the interaction with the surrounding environment (nearby protein residues, membrane, water), and the complexity of such interplay is, in most cases, at the origin of the functional diversity of the photoactive proteins. The specific interactions with the environment often lead to a significant shift of the chromophore excitation energies, compared with their absorption in solution or gas phase. The investigation of the optical response of chromophores is generally not straightforward, from both experimental and theoretical standpoints; this is due to the difficulty in understanding diverse behaviours and effects, occurring at different scales, with a single technique. In particular, the role played by ab initio calculations in assisting and guiding experiments, as well as in understanding the physics of photoactive proteins, is fundamental. At the same time, owing to the large size of the systems, more approximate strategies which take into account the environmental effects on the absorption spectra are also of paramount importance. Here we review the recent advances in the first-principle description of electronic and optical properties of biological chromophores embedded in a protein environment. We show

Theoretical description of protein field effects on electronic excitations of biological chromophores

Science.gov (United States)

Varsano, Daniele; Caprasecca, Stefano; Coccia, Emanuele

2017-01-01

Photoinitiated phenomena play a crucial role in many living organisms. Plants, algae, and bacteria absorb sunlight to perform photosynthesis, and convert water and carbon dioxide into molecular oxygen and carbohydrates, thus forming the basis for life on Earth. The vision of vertebrates is accomplished in the eye by a protein called rhodopsin, which upon photon absorption performs an ultrafast isomerisation of the retinal chromophore, triggering the signal cascade. Many other biological functions start with the photoexcitation of a protein-embedded pigment, followed by complex processes comprising, for example, electron or excitation energy transfer in photosynthetic complexes. The optical properties of chromophores in living systems are strongly dependent on the interaction with the surrounding environment (nearby protein residues, membrane, water), and the complexity of such interplay is, in most cases, at the origin of the functional diversity of the photoactive proteins. The specific interactions with the environment often lead to a significant shift of the chromophore excitation energies, compared with their absorption in solution or gas phase. The investigation of the optical response of chromophores is generally not straightforward, from both experimental and theoretical standpoints; this is due to the difficulty in understanding diverse behaviours and effects, occurring at different scales, with a single technique. In particular, the role played by ab initio calculations in assisting and guiding experiments, as well as in understanding the physics of photoactive proteins, is fundamental. At the same time, owing to the large size of the systems, more approximate strategies which take into account the environmental effects on the absorption spectra are also of paramount importance. Here we review the recent advances in the first-principle description of electronic and optical properties of biological chromophores embedded in a protein environment. We show

Simultaneous control of emission localization and two-photon absorption efficiency in dissymmetrical chromophores

International Nuclear Information System (INIS)

Tretiak, Sergei

2009-01-01

The aim of the present work is to demonstrate that combined spectral tuning of fluorescence and two-photon absorption (TPA) properties of multipolar chromophores can be achieved by introduction of slight electronic chemical dissymmetry. In that perspective, two novel series of structurally related chromophores have been designed and studied: a first series based on rod-like quadrupolar chromophores bearing different electron-donating (D) end groups and a second series based on three-branched octupolar chromophores built from a trigonal donating moiety and bearing various acceptor (A) peripheral groups. The influence of the electronic dissymmetry is investigated by combined experimental and theoretical studies of the linear and nonlinear optical properties of dissymmetric chromophores compared to their symmetrical counterparts. In both types of systems (i.e. quadrupoles and octupoles) experiments and theory reveal that excitation is essentially delocalized and that excitation involves synchronized charge redistribution between the different D and A moieties within the multipolar structure (i.e. concerted intramolecular charge transfer). In contrast, the emission stems only from a particular dipolar subunit bearing the strongest D or A moieties due to fast excitation localization after excitation prior to emission. Hence control of emission characteristics (polarization and emission spectrum) in addition to localization can be achieved by controlled introduction of electronic dissymmetry (i.e. replacement of one of the D or A end-groups by a slightly stronger D(prime) or A(prime) units). Interestingly dissymmetrical functionalization of both quadrupolar and octupolar compounds does not lead to significant loss in TPA responses and can even be beneficial due to the spectral broadening and peak position tuning that it allows. This study thus reveals an original molecular engineering route strategy allowing major TPA enhancement in multipolar structures due to concerted

Gas phase absorption studies of photoactive yellow protein chromophore derivatives.

Science.gov (United States)

Rocha-Rinza, Toms; Christiansen, Ove; Rajput, Jyoti; Gopalan, Aravind; Rahbek, Dennis B; Andersen, Lars H; Bochenkova, Anastasia V; Granovsky, Alexander A; Bravaya, Ksenia B; Nemukhin, Alexander V; Christiansen, Kasper Lincke; Nielsen, Mogens Brøndsted

2009-08-27

Photoabsorption spectra of deprotonated trans p-coumaric acid and two of its methyl substituted derivatives have been studied in gas phase both experimentally and theoretically. We have focused on the spectroscopic effect of the location of the two possible deprotonation sites on the trans p-coumaric acid which originate to either a phenoxide or a carboxylate. Surprisingly, the three chromophores were found to have the same absorption maximum at 430 nm, in spite of having different deprotonation positions. However, the absorption of the chromophore in polar solution is substantially different for the distinct deprotonation locations. We also report on the time scales and pathways of relaxation after photoexcitation for the three photoactive yellow protein chromophore derivatives. As a result of these experiments, we could detect the phenoxide isomer within the deprotonated trans p-coumaric acid in gas phase; however, the occurrence of the carboxylate is uncertain. Several computational methods were used simultaneously to provide insights and assistance in the interpretation of our experimental results. The calculated excitation energies S(0)-S(1) are in good agreement with experiment for those systems having a negative charge on a phenoxide moiety. Although our augmented multiconfigurational quasidegenerate perturbation theory calculations agree with experiment in the description of the absorption spectrum of anions with a carboxylate functional group, there are some puzzling disagreements between experiment and some calculational methods in the description of these systems.

Orientation phenomena in chromophore DR1-containing polymer films and their non-linear optical response

International Nuclear Information System (INIS)

Moencke, Doris; Mountrichas, Grigoris; Pispas, Stergios; Kamitsos, Efstratios I.

2011-01-01

The effectiveness of chromophore alignment in polymer films following corona poling can be assessed by the generated second harmonic signal. Optimization of the stability and strength of this nonlinear optical response may improve with a better understanding of the underlying principal order phenomena. Structural analysis by vibrational, optical, and 1 H NMR spectroscopy reveals side chain tacticity, aggregation effects, and changes in orientation as a function of temperature. Co-polymers with the functionalized chromophore Disperse Red 1 methacrylate (MDR1) were prepared for three different methacrylate types. High side chain polarity and short side chain length increase generally chromophore aggregation in films, whereas the very long poly-ether side chains in PMEO based co-polymers are wrapped separately around the DR1 entities. Side chain tacticity depends on space requirements, but also on the capacity of side groups to form OH-bridges. Side chain tacticity might present an additional parameter for the assessment of chromophore aggregation and poling induced alignments. Stepwise heating of co-polymer films causes an increase in the number of random over ordered side chain arrangements. Cross-linking by anhydride formation is observed after heating the methacrylic acid based co-polymer.

Preparation and optical characteristics of layered perovskite-type lead-bromide-incorporated azobenzene chromophores

International Nuclear Information System (INIS)

Sasai, Ryo; Shinomura, Hisashi

2013-01-01

Lead bromide-based layered perovskite powders with azobenzene derivatives were prepared by a homogeneous precipitation method. From the diffuse reflectance (DR) and photoluminescence (PL) spectra of the hybrid powder materials, the present hybrids exhibited sharp absorption and PL peaks originating from excitons produced in the PbBr 4 2− layer. When the present hybrid powder was irradiated with UV light at 350 nm, the absorption band from the trans-azobenzene chromophore, observed around 350 nm, decreased, while the absorption band from the cis-azobenzene chromophore, observed around 450 nm, increased. These results indicate that azobenzene chromophores in the present hybrid materials exhibit reversible photoisomerization. Moreover, it was found that the PL intensity from the exciton also varied due to photoisomerization of the azobenzene chromophores in the present hybrid. Thus, for the first time we succeeded in preparing the azobenzene derivative lead-bromide-based layered perovskite with photochromism before and after UV light irradiation. - Graphical abstract: For the first time, we succeeded in preparing the azobenzene derivative lead-bromide-based layered perovskite with photochromism before and after UV light irradiation. Highlights: ► PbBr-based layered perovskite with azobenezene derivatives could be synthesized by a homogeneous precipitation method. ► Azobenzene derivatives incorporated the present hybrid that exhibited reversible photoisomerization under UV and/or visible light irradiation. ► PL property of the present hybrid could also be varied by photoisomerization.

Unstable metacarpal and phalangeal fractures: treatment by internal fixation using AO mini-fragment plates and screws.

Science.gov (United States)

Mumtaz, Mohammad Umar; Farooq, Muneer Ahmad; Rasool, Altaf Ahmad; Kawoosa, Altaf Ahmad; Badoo, Abdul Rashid; Dhar, Shabir Ahmad

2010-07-01

Accurate open reduction and internal fixation for metacarpal and phalangeal fractures of the hand is required in less than 5% of the patients; otherwise, closed treatment techniques offer satisfactory results in most of these cases as these fractures are stable either before or after closed reduction. AO mini-fragment screws and plates, when used in properly selected cases, can provide rigid fixation, allowing early mobilization of joints and hence good functional results while avoiding problems associated with protruding K-wires and immobilization. The advantages of such internal fixation urged us to undertake such a study in our state where such hand injuries are commonly seen. Forty patients with 42 unstable metacarpal and phalangeal fractures were treated with open reduction and internal fixation using AO mini-fragment screws and plates over a period of three years in a prospective manner. The overall results were good in 78.5% of cases, fair in 19% of cases and poor in 2.5% of cases, as judged according to the criteria of the American Society for Surgery of the Hand. This technique is a reasonable option for treating unstable metacarpal and phalangeal fractures as it provides a highly rigid fixation, which is sufficient to allow early mobilization of the adjacent joints, thus helping to achieve good functional results.

Solid state supramolecular structure of diketopyrrolopyrrole chromophores: correlating stacking geometry with visible light absorption

OpenAIRE

Pop, Flavia; Lewis, William; Amabilino, David B.

2016-01-01

Mono- and di-alkylated 1,4-diketo-3,6-dithiophenylpyrrolo[3-4-c]pyrrole derivatives (TDPPs) have been synthesised and their solid state packing and absorption properties have been correlated. In this library of compounds the bulkier substituents distort the geometry of the chromophores and shift the lowest energy absorption band as a consequence of reduced π–π stacking and inter-chromophore overlap. Longitudinal displacement of the conjugated core is affected by donor–acceptor intermolecular ...

Red-light absorption and fluorescence of phytochrome chromophores: A comparative theoretical study

Energy Technology Data Exchange (ETDEWEB)

Falklöf, Olle; Durbeej, Bo, E-mail: bodur@ifm.liu.se

2013-11-08

Highlights: • Calculation of red-light absorption and emission of phytochrome chromophores. • Comparison of TD-DFT and ab initio methods. • Pure functionals show better accuracy than hybrid functionals. - Abstract: Currently, much experimental effort is being invested in the engineering of phytochromes, a large superfamily of photoreceptor proteins, into fluorescent proteins suitable for bioimaging in the near-infrared regime. In this work, we gain insight into the potential of computational methods to contribute to this development by investigating how well representative quantum chemical methods reproduce recently recorded red-light absorption and emission maxima of synthetic derivatives of the bilin chromophores of phytochromes. Focusing on the performance of time-dependent density functional theory but using also the ab initio CIS(D), CC2 and CASPT2 methods, we explore how various methodological considerations influence computed spectra and find, somewhat surprisingly, that density functionals lacking exact exchange reproduce the experimental measurements with smaller errors than functionals that include exact exchange. Thus, for the important class of chromophores that bilins constitute, the widely established trend that hybrid functionals give more accurate excitation energies than pure functionals does not apply.

Gas-phase infrared spectrum of the anionic GFP-chromophore

NARCIS (Netherlands)

Almasian, M.; Grzetic, J.; G. Berden,; Bakker, B.; Buma, W. J.; Oomens, J.

2012-01-01

The gas-phase IR spectrum of the anionic chromophore of the green fluorescent protein (p-hydroxy-benzylidene-2,3-dimethylimidazolidinone, HBDI) is recorded in the 800–1800 cm−1 frequency range using the free electron laser FELIX in combination with an electrospray ionization (ESI) Fourier

Effective photo-enhancement of cellular activity of fluorophore-octaarginine antisense PNA conjugates correlates with singlet oxygen formation, endosomal escape and chromophore lipophilicity

DEFF Research Database (Denmark)

Yarani, Reza; Shiraishi, Takehiko; Nielsen, Peter E.

2018-01-01

Photochemical internalization (PCI) is a cellular drug delivery method based on the generation of light-induced reactive oxygen species (ROS) causing damage to the endosomal membrane and thereby resulting in drug release to the cytoplasm. In our study a series of antisense fluorophore octaarginin...... indicate that efficient photodynamic endosomal escape is strongly dependent on the quantum yield for photochemical singlet oxygen formation, photostability as well as the lipophilicity of the chromophore....

CHROMOPHORIC DISSOLVED ORGANIC MATTER (CDOM) SOURCE CHARACTERIZATION IN THE LOUISIANA BIGHT

Science.gov (United States)

Chromophoric dissolved organic matter (CDOM) in the Mississippi plume region may have several distinct sources: riverine (terrestrial soils), wetland (terrestrial plants), biological production (phytoplankton, zooplankton, microbial), and sediments. Complex mixing, photodegradati...

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Chemical modification of glass surface with a monolayer of nonchromophoric and chromophoric methacrylate terpolymer

Energy Technology Data Exchange (ETDEWEB)

Janik, Ryszard [Department of Polymer Engineering and Technology, Wroclaw University of Technology, 50-370 Wroclaw (Poland); Kucharski, Stanislaw, E-mail: stanislaw.kucharski@pwr.wroc.pl [Department of Polymer Engineering and Technology, Wroclaw University of Technology, 50-370 Wroclaw (Poland); Sobolewska, Anna [Institute of Physical and Theoretical Chemistry, Wroclaw University of Technology, 50-370 Wroclaw (Poland); Barille, Regis [Institut des Sciences et Techniques Moleculaires d' Angers ' Moltech Anjou' , CNRS UMR 6200, 49045 Angers (France)

2010-11-15

The methacrylate terpolymers, a nonchromophoric and chromophoric one, containing 2-hydroxyethyl groups were reacted with 3-isocyanatopropyltriethoxysilane to obtain reactive polymers able to form covalent bonding with -SiOH groups of the glass surface via triethoxysilane group condensation. Chemical modification of the Corning 2949 glass plates treated in this way resulted in increase of wetting angle from 11{sup o} to ca. 70-73{sup o}. Determination of ellipsometric parameters revealed low value of the substrate refractive index as compared with that of bulk Corning 2949 glass suggesting roughness of the surface. The AFM image of the bare glass surface and that modified with terpolymer monolayer confirmed this phenomenon. Modification of the glass with the terpolymer monolayer made it possible to create the substrate surface well suited for deposition of familiar chromophore film by spin-coating. The chromophore polymer film deposited onto the modified glass surface was found to be resistant to come unstuck in aqueous solution.

Fiber optic-based fluorescence detection system for in vivo studies of exogenous chromophore pharmacokinetics

Science.gov (United States)

Doiron, Daniel R.; Dunn, J. B.; Mitchell, W. L.; Dalton, Brian K.; Garbo, Greta M.; Warner, Jon A.

1995-05-01

The detection and quantification of the concentration of exogenous chromophores in-vivo by their fluorescence is complicated by many physical and geometrical parameters. Measurement of such signals is advantageous in determining the pharmacokinetics of photosensitizers such as those used in photodynamic therapy (PDT) or to assist in the diagnosis of tissue histological state. To overcome these difficulties a ratio based fiber optic contact fluorometer has been developed. This fluorescence detection system (FDS) uses the ratio of the fluorescence emission peak of the exogenous chromophore to that of endogenous chromophores, i.e. autofluorescence, to correct for a variety of parameters affecting the magnitude of the measured signals. By doing so it also minimizes the range of baseline measurements prior to exogenous drug injection, for various tissue types. Design of the FDS and results of its testing in animals and patients using the second generation photosensitizer Tin ethyletiopurpurin (SnET2) are presented. These results support the feasibility and usefulness of the Ratio FDS system.

Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

Science.gov (United States)

Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.

2015-12-01

Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes.

FROM GLOBALIZATION TO FRAGMENTATION – A NEW BEGINNING IN THE INTERNATIONAL AFFAIRES

Directory of Open Access Journals (Sweden)

Liviu Neamţu

2009-11-01

Full Text Available Registration of regional and local, or even traditional brands, are becoming in today's an increasingly met phenomenon on international market in small and midsize companies struggle to protect certain markets and products. While large companies that hold independent or group trademarks and brands pursuing gradual transition of that trademarks from the level of global brands to the levels of technological brands, regional brands or positioned trademark to cover limited parts of the market to sell more effectively. In this way we find a fierce battle between the trend of globalization of markets and the fragmentation of the product supply on the global market.

Organic small molecule semiconducting chromophores for use in organic electronic devices

Energy Technology Data Exchange (ETDEWEB)

Welch, Gregory C.; Hoven, Corey V.; Nguyen, Thuc-Quyen

2018-02-13

Small organic molecule semi-conducting chromophores containing a pyridalthiadiazole, pyridaloxadiazole, or pyridaltriazole core structure are disclosed. Such compounds can be used in organic heterojunction devices, such as organic small molecule solar cells and transistors.

Band-engineering of TiO2 as a wide-band gap semiconductor using organic chromophore dyes

Science.gov (United States)

Wahyuningsih, S.; Kartini, I.; Ramelan, A. H.; Saputri, L. N. M. Z.; Munawaroh, H.

2017-07-01

Bond-engineering as applied to semiconductor materials refers to the manipulation of the energy bands in order to control charge transfer processes in a device. When the device in question is a photoelectrochemical cell, the charges affected by drift become the focus of the study. The ideal band gap of semiconductors for enhancement of photocatalyst activity can be lowered to match with visible light absorption and the location of conduction Band (CB) should be raised to meet the reducing capacity. Otherwise, by the addition of the chromofor organic dyes, the wide-band gab can be influences by interacation resulting between TiO2 surface and the dyes. We have done the impruvisation wide-band gap of TiO2 by the addition of organic chromophore dye, and the addition of transition metal dopand. The TiO2 morphology influence the light absorption as well as the surface modification. The organic chromophore dye was syntesized by formation complexes compound of Co(PAR)(SiPA)(PAR)= 4-(2-piridylazoresorcinol), SiPA = Silyl propil amine). The result showed that the chromophore groups adsorbed onto TiO2 surface can increase the visible light absorption of wide-band gab semiconductor. Initial absorption of a chromophore will affect light penetration into the material surfaces. The use of photonic material as a solar cell shows this phenomenon clearly from the IPCE (incident photon to current conversion efficiency) measurement data. Organic chromophore dyes of Co(PAR)(SiPA) exhibited the long wavelength absorption character compared to the N719 dye (from Dyesol).

Single Oligomer Spectra Probe Chromophore Nanoenvironments of Tetrameric Fluorescent Proteins

NARCIS (Netherlands)

Blum, Christian; Meixner, Alfred J.; Subramaniam, Vinod

2006-01-01

When analyzing the emission of a large number of individual chromophores embedded in a matrix, the spread of the observed parameters is a characteristic property for the particular chromophore−matrix system. To quantitatively assess the influence of the matrix on the single molecule emission

Depth distributions of light action spectra for skin chromophores

Science.gov (United States)

Barun, V. V.; Ivanov, A. P.

2010-03-01

Light action spectra over wavelengths of 300-1000 nm are calculated for components of the human cutaneous covering: melanin, basal (bloodless) tissue, and blood oxy- and deoxyhemoglobin. The transformation of the spectra with depth in biological tissue results from two factors. The first is the wavelength dependence of the absorption coefficient corresponding to a particular skin chromophore and the second is the spectral selectivity of the radiation flux in biological tissue. This factor is related to the optical properties of all chromophores. A significant change is found to take place in the spectral distribution of absorbed radiant power with increasing depth. The action spectrum of light for the molecular oxygen contained in all components of biological tissue is also studied in the 625-645 nm range. The spectra are found to change with both the volume fraction of blood vessels and the degree of oxygenation of the blood. These results are useful for analyzing processes associated with optical absorption that are possible mechanisms for the interaction of light with biological tissues: photodissociation of oxyhemoglobin and the light-oxygen effect.

Optomechanical Control of Quantum Yield in Trans-Cis Ultrafast Photoisomerization of a Retinal Chromophore Model.

Science.gov (United States)

Valentini, Alessio; Rivero, Daniel; Zapata, Felipe; García-Iriepa, Cristina; Marazzi, Marco; Palmeiro, Raúl; Fdez Galván, Ignacio; Sampedro, Diego; Olivucci, Massimo; Frutos, Luis Manuel

2017-03-27

The quantum yield of a photochemical reaction is one of the most fundamental quantities in photochemistry, as it measures the efficiency of the transduction of light energy into chemical energy. Nature has evolved photoreceptors in which the reactivity of a chromophore is enhanced by its molecular environment to achieve high quantum yields. The retinal chromophore sterically constrained inside rhodopsin proteins represents an outstanding example of such a control. In a more general framework, mechanical forces acting on a molecular system can strongly modify its reactivity. Herein, we show that the exertion of tensile forces on a simplified retinal chromophore model provokes a substantial and regular increase in the trans-to-cis photoisomerization quantum yield in a counterintuitive way, as these extension forces facilitate the formation of the more compressed cis photoisomer. A rationale for the mechanochemical effect on this photoisomerization mechanism is also proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of some colloid surfactants on spectrophotometric characteristics of metal chelates with chromophore organic reagents

International Nuclear Information System (INIS)

Chernova, R.K.

1977-01-01

Theoretical regularities and prospects of using surface active substances (SAS) in spectrophotometric determination of metal ions (including ions of rare-earth elements, transition metals, Be(3)) with chromophore chelating reagents were investigated. The chromophore reagents investigated were pyrocatechol violet, phenolcarboxylic acids of the triarylmethane series, fluorones, phthalexones and azo-compounds. As SAS certain long-chain quaternary ammonium and pyridinium salts (LQAS) were employed. From the results reported it follows that the introduction of LQAS in the system of Mesup(n+)-chromophore reagent is a rather effective method of enhancing the contrast rendition and, in some cases, the sensitivity and selectivity of the reagents. Explanations are suggested as to the factors which cause the changes observed in the contrast of the reactions in the presence of SAS; the underlying phenomena are the ligand-ligand interactions between the organic reagents and SAS and solubilization processes of the reaction products by the micelles of SAS

New closed-form approximation for skin chromophore mapping.

Science.gov (United States)

Välisuo, Petri; Kaartinen, Ilkka; Tuchin, Valery; Alander, Jarmo

2011-04-01

The concentrations of blood and melanin in skin can be estimated based on the reflectance of light. Many models for this estimation have been built, such as Monte Carlo simulation, diffusion models, and the differential modified Beer-Lambert law. The optimization-based methods are too slow for chromophore mapping of high-resolution spectral images, and the differential modified Beer-Lambert is not often accurate enough. Optimal coefficients for the differential Beer-Lambert model are calculated by differentiating the diffusion model, optimized to the normal skin spectrum. The derivatives are then used in predicting the difference in chromophore concentrations from the difference in absorption spectra. The accuracy of the method is tested both computationally and experimentally using a Monte Carlo multilayer simulation model, and the data are measured from the palm of a hand during an Allen's test, which modulates the blood content of skin. The correlations of the given and predicted blood, melanin, and oxygen saturation levels are correspondingly r = 0.94, r = 0.99, and r = 0.73. The prediction of the concentrations for all pixels in a 1-megapixel image would take ∼ 20 min, which is orders of magnitude faster than the methods based on optimization during the prediction.

Active and silent chromophore isoforms for phytochrome Pr photoisomerization: An alternative evolutionary strategy to optimize photoreaction quantum yields

Directory of Open Access Journals (Sweden)

Yang Yang

2014-01-01

Full Text Available Photoisomerization of a protein bound chromophore is the basis of light sensing of many photoreceptors. We tracked Z-to-E photoisomerization of Cph1 phytochrome chromophore PCB in the Pr form in real-time. Two different phycocyanobilin (PCB ground state geometries with different ring D orientations have been identified. The pre-twisted and hydrogen bonded PCBa geometry exhibits a time constant of 30 ps and a quantum yield of photoproduct formation of 29%, about six times slower and ten times higher than that for the non-hydrogen bonded PCBb geometry. This new mechanism of pre-twisting the chromophore by protein-cofactor interaction optimizes yields of slow photoreactions and provides a scaffold for photoreceptor engineering.

Associated depression in pseudophakic patients with intraocular lens with and without chromophore

Directory of Open Access Journals (Sweden)

Mendoza-Mendieta ME

2016-03-01

Full Text Available María Elena Mendoza-Mendieta, Ana Aurora Lorenzo-Mejía Association to Prevent Blindness in Mexico (APEC, Hospital “Dr Luis Sánchez Bulnes”, Mexico City, Mexico Background: With aging, the crystalline lens turns yellowish, which increases the absorption of wavelengths in the blue electromagnetic spectrum, reducing their photoreception in the retina. Since these wavelengths are the main stimulus in the regulation of the circadian rhythm, progressive reduction in their transmission is associated with chronic sleep disturbances and depression in elderly patients. Cataract extraction improves circadian photoreception at any age. However, lenses that block blue waves have 27% to 38% less melatonin suppression than lenses that block only ultraviolet (UV rays. Purpose: To assess the depression symptoms in subjects who have had bilateral phacoemulsification and intraocular lens (IOL implants, one group with yellow chromophore IOLs and the other group with transparent IOLs were compared. Setting: Association to Prevent Blindness in Mexico (APEC, Hospital “Dr Luis Sánchez Bulnes”. Design: This was an observational, cross-sectional, and single-center study. Materials and methods: Twenty-six subjects between 60 and 80 years of age, with a history of bilateral phacoemulsification and placement of the same type of IOL in both eyes from 4 to 12 months prior to the study, who attended the follow-up visits and agreed to participate in this study, and provided signed informed consent were included in the study. They were asked to answer the short version of the 15-item Geriatric Depression Scale. Results: The average age of the study participants was 72.5±5.94 years. The group without chromophore included 46.1% (n=12 of the patients and the group with chromophore included 53.9% (n=14 of the patients (P=0.088. Conclusion: In the group of patients with IOLs that block the passage of blue light, the depression rate was 21.4%, a rate similar to that

Water-Soluble Triarylborane Chromophores for One- and Two-Photon Excited Fluorescence Imaging of Mitochondria in Cells.

Science.gov (United States)

Griesbeck, Stefanie; Zhang, Zuolun; Gutmann, Marcus; Lühmann, Tessa; Edkins, Robert M; Clermont, Guillaume; Lazar, Adina N; Haehnel, Martin; Edkins, Katharina; Eichhorn, Antonius; Blanchard-Desce, Mireille; Meinel, Lorenz; Marder, Todd B

2016-10-04

Three water-soluble tetracationic quadrupolar chromophores comprising two three-coordinate boron π-acceptor groups bridged by thiophene-containing moieties were synthesised for biological imaging applications. Compound 3 containing the bulkier 5-(3,5-Me2 C6 H2 )-2,2'-(C4 H2 S)2 -5'-(3,5-Me2 C6 H2 ) bridge is stable over a long period of time, exhibits a high fluorescence quantum yield and strong one- and two-photon absorption (TPA), and has a TPA cross section of 268 GM at 800 nm in water. Confocal laser scanning fluorescence microscopy studies in live cells indicated localisation of the chromophore at the mitochondria; moreover, cytotoxicity measurements proved biocompatibility. Thus, chromophore 3 has excellent potential for one- and two-photon-excited fluorescence imaging of mitochondrial function in cells. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Public Values in Water Law: A Case of Substantive Fragmentation?

OpenAIRE

Ambrus, Monika; Gilissen, Herman Kasper; van Kempen, Jasper JH

2014-01-01

Horizontal fragmentation, from a public-values perspective, is a quite well-documented phenomenon in international (water) law. However, the literature does not provide any insight into vertical or substantive fragmentation, i.e. differences in the protection of public values at the various institutional levels. This article assesses whether there is substantive fragmentation in water law at the international, the European, the sub-regional (Danube River Basin), and the Dutch domestic level. ...

Heterocyclic Nonlinear Optical Chromophores Composed of Phenothiazine or Carbazole Donor and 2-Cyanomethylene-3-cyano-4,5,5- trimethyl-2,5-dihydrofuran Acceptor

International Nuclear Information System (INIS)

Cho, Min Ju; Kim, Ja Youn; Kim, Jae Hong; Lee, Seung Hwan; Choi, Dong Hoon; Dalton, Larry R.

2005-01-01

We prepared the new nonlinear optical chromophores that show fairly high microscopic nonlinearity through intramolecular charge transfer. Phenothiazine and carbazole units played an important role to contribute high electron donability and connect the resonance pathway via conjugative effect in the cyclized ring beside the aromatic ring. Theoretical calculation, electrochemical analysis, and absorption spectroscopic study gave us useful information about the energy states and microscopic nonlinearities of two serial chromophores. We compared the microscopic nonlinearities of four chromophores with the conjugation length and electron donability in the push-pull type NLO chromophores. The effect of gradient donability and lengthening the conjugation were investigated on the electronic state and microscopic nonlinearity

Fragmentation of atomic clusters: A theoretical study

International Nuclear Information System (INIS)

Lopez, M.J.; Jellinek, J.

1994-01-01

Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

Chromophore photophysics and dynamics in fluorescent proteins of the GFP family

International Nuclear Information System (INIS)

Nienhaus, Karin; Nienhaus, G Ulrich

2016-01-01

Proteins of the green fluorescent protein (GFP) family are indispensable for fluorescence imaging experiments in the life sciences, particularly of living specimens. Their essential role as genetically encoded fluorescence markers has motivated many researchers over the last 20 years to further advance and optimize these proteins by using protein engineering. Amino acids can be exchanged by site-specific mutagenesis, starting with naturally occurring proteins as templates. Optical properties of the fluorescent chromophore are strongly tuned by the surrounding protein environment, and a targeted modification of chromophore-protein interactions requires a profound knowledge of the underlying photophysics and photochemistry, which has by now been well established from a large number of structural and spectroscopic experiments and molecular-mechanical and quantum-mechanical computations on many variants of fluorescent proteins. Nevertheless, such rational engineering often does not meet with success and thus is complemented by random mutagenesis and selection based on the optical properties. In this topical review, we present an overview of the key structural and spectroscopic properties of fluorescent proteins. We address protein-chromophore interactions that govern ground state optical properties as well as processes occurring in the electronically excited state. Special emphasis is placed on photoactivation of fluorescent proteins. These light-induced reactions result in large structural changes that drastically alter the fluorescence properties of the protein, which enables some of the most exciting applications, including single particle tracking, pulse chase imaging and super-resolution imaging. We also present a few examples of fluorescent protein application in live-cell imaging experiments. (topical review)

Chromophore photophysics and dynamics in fluorescent proteins of the GFP family

Science.gov (United States)

Nienhaus, Karin; Nienhaus, G. Ulrich

2016-11-01

Proteins of the green fluorescent protein (GFP) family are indispensable for fluorescence imaging experiments in the life sciences, particularly of living specimens. Their essential role as genetically encoded fluorescence markers has motivated many researchers over the last 20 years to further advance and optimize these proteins by using protein engineering. Amino acids can be exchanged by site-specific mutagenesis, starting with naturally occurring proteins as templates. Optical properties of the fluorescent chromophore are strongly tuned by the surrounding protein environment, and a targeted modification of chromophore-protein interactions requires a profound knowledge of the underlying photophysics and photochemistry, which has by now been well established from a large number of structural and spectroscopic experiments and molecular-mechanical and quantum-mechanical computations on many variants of fluorescent proteins. Nevertheless, such rational engineering often does not meet with success and thus is complemented by random mutagenesis and selection based on the optical properties. In this topical review, we present an overview of the key structural and spectroscopic properties of fluorescent proteins. We address protein-chromophore interactions that govern ground state optical properties as well as processes occurring in the electronically excited state. Special emphasis is placed on photoactivation of fluorescent proteins. These light-induced reactions result in large structural changes that drastically alter the fluorescence properties of the protein, which enables some of the most exciting applications, including single particle tracking, pulse chase imaging and super-resolution imaging. We also present a few examples of fluorescent protein application in live-cell imaging experiments.

Chromophoric Dissolved Organic Material, Aqua MODIS, NPP, 0.125 degrees, East US

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — MODIS data is used to develop an index of the amount of chromophoric dissolved organic material (CDOM) in the surface waters. CDOM absorbs heavily in the blue...

Chromophoric Dissolved Organic Material, Aqua MODIS, NPP, 0.125 degrees, West US

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — MODIS data is used to develop an index of the amount of chromophoric dissolved organic material (CDOM) in the surface waters. CDOM absorbs heavily in the blue...

Photoabsorption of green and red fluorescent protein chromophore anions in vacuo.

Science.gov (United States)

Wan, Songbo; Liu, Shasha; Zhao, Guangjiu; Chen, Maodu; Han, Keli; Sun, Mengtao

2007-09-01

Photoabsorption properties of green and red fluorescent protein chromophore anions in vacuo were investigated theoretically, based on the experimental results in gas phase [Phys. Rev. Lett. 2001, 87, 228102; Phys. Rev. Lett. 2003, 90, 118103]. Their calculated transition energies in absorption with TD-DFT and ZINDO methods are directly compared to the experimental reports in gas phase, and the calculations with ZINDO method can correctly reproduce the absorption spectra. The orientation and strength of their transition dipole moments were revealed with transition density. We also showed the orientation and result of their intramolecular charge transfer with transition difference density. The calculated results show that with the increase of the extended conjugated system, the orientation of transition dipole moments and the orientation of charge transfer can be reversed. They are the linear responds with the external electric fields. These theoretical results reveal the insight understanding of the photoinduced dynamics of green and red fluorescent protein chromophore anions and cations in vacuo.

THE ROLE OF NITROGEN IN CHROMOPHORIC AND FLUORESCENT DISSOLVED ORGANIC MATTER FORMATION

Science.gov (United States)

Microbial and photochemical processes affect chromophoric dissolved organic matter (CDOM) dynamics in the ocean. Some evidence suggests that dissolved nitrogen plays a role in CDOM formation, although this has received little systematic attention in marine ecosystems. Coastal sea...

A Light-Induced Reaction with Oxygen Leads to Chromophore Decomposition and Irreversible Photobleaching in GFP-Type Proteins.

Science.gov (United States)

Grigorenko, Bella L; Nemukhin, Alexander V; Polyakov, Igor V; Khrenova, Maria G; Krylov, Anna I

2015-04-30

Photobleaching and photostability of proteins of the green fluorescent protein (GFP) family are crucially important for practical applications of these widely used biomarkers. On the basis of simulations, we propose a mechanism for irreversible bleaching in GFP-type proteins under intense light illumination. The key feature of the mechanism is a photoinduced reaction of the chromophore with molecular oxygen (O2) inside the protein barrel leading to the chromophore's decomposition. Using quantum mechanics/molecular mechanics (QM/MM) modeling we show that a model system comprising the protein-bound Chro(-) and O2 can be excited to an electronic state of the intermolecular charge-transfer (CT) character (Chro(•)···O2(-•)). Once in the CT state, the system undergoes a series of chemical reactions with low activation barriers resulting in the cleavage of the bridging bond between the phenolic and imidazolinone rings and disintegration of the chromophore.

Chromophores from photolyzed ammonia reacting with acetylene: Application to Jupiters Great Red Spot

Science.gov (United States)

Carlson, Robert W.; Baines, Kevin H.; Anderson, M. S.; Filacchione, G.; Simon, A. A.

2016-01-01

The high altitude of Jupiter's Great Red Spot (GRS) may enhance the upward flux of gaseous ammonia (NH3 ) into the high troposphere, where NH3 molecules can be photodissociated and initiate a chain of chemical reactions with downwelling acetylene molecules (C2H2 ). These reactions, experimentally studied earlier by (Ferris and Ishikawa [1987] Nature 326, 777-778) and (Ferris and Ishikawa [1988] J. Amer. Chem. Soc. 110, 4306-4312), produce chromophores that absorb in the visible and ultraviolet regions. In this work we photolyzed mixtures of NH3 and C2H2 using ultraviolet radiation with a wavelength of 214 nm and measured the spectral transmission of the deposited films in the visible region (400-740 nm). From these transmission data we estimated the imaginary indices of refraction. Assuming that ammonia grains at the top of the GRS clouds are coated with this material, we performed layered sphere and radiative transfer calculations to predict GRS reflection spectra. Comparison of those results with observed and previously unreported Cassini visible spectra and with true-color images of the GRS show that the unknown GRS chromophore is spectrally consistent with the coupled NH3-C2H2 photochemical products produced in our laboratory experiments. Using high-resolution mass spectrometry and infrared spectroscopy we infer that the chromophore-containing residue is composed of aliphatic azine, azo, and diazo compounds.

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

Determination of retinal chromophore structure in bacteriorhodopsin with resonance Raman spectroscopy.

Science.gov (United States)

Smith, S O; Lugtenburg, J; Mathies, R A

1985-01-01

The analysis of the vibrational spectrum of the retinal chromophore in bacteriorhodopsin with isotopic derivatives provides a powerful "structural dictionary" for the translation of vibrational frequencies and intensities into structural information. Of importance for the proton-pumping mechanism is the unambiguous determination of the configuration about the C13=C14 and C=N bonds, and the protonation state of the Schiff base nitrogen. Vibrational studies have shown that in light-adapted BR568 the Schiff base nitrogen is protonated and both the C13=C14 and C=N bonds are in a trans geometry. The formation of K625 involves the photochemical isomerization about only the C13=C14 bond which displaces the Schiff base proton into a different protein environment. Subsequent Schiff base deprotonation produces the M412 intermediate. Thermal reisomerization of the C13=C14 bond and reprotonation of the Schiff base occur in the M412------O640 transition, resetting the proton-pumping mechanism. The vibrational spectra can also be used to examine the conformation about the C--C single bonds. The frequency of the C14--C15 stretching vibration in BR568, K625, L550 and O640 argues that the C14--C15 conformation in these intermediates is s-trans. Conformational distortions of the chromophore have been identified in K625 and O640 through the observation of intense hydrogen out-of-plane wagging vibrations in the Raman spectra (see Fig. 2). These two intermediates are the direct products of chromophore isomerization. Thus it appears that following isomerization in a tight protein binding pocket, the chromophore cannot easily relax to a planar geometry. The analogous observation of intense hydrogen out-of-plane modes in the primary photoproduct in vision (Eyring et al., 1982) suggests that this may be a general phenomenon in protein-bound isomerizations. Future resonance Raman studies should provide even more details on how bacterio-opsin and retinal act in concert to produce an

Extraction of 16th Century Calender Fragments

DEFF Research Database (Denmark)

Holck, Jakob Povl; Etheridge, Christian

at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

The importance of charge-transfer interactions in determining chromophoric dissolved organic matter (CDOM) optical and photochemical properties.

Science.gov (United States)

Sharpless, Charles M; Blough, Neil V

2014-04-01

Absorption of sunlight by chromophoric dissolved natural organic matter (CDOM) is environmentally significant because it controls photic zone depth and causes photochemistry that affects elemental cycling and contaminant fate. Both the optics (absorbance and fluorescence) and photochemistry of CDOM display unusual properties that cannot easily be ascribed to a superposition of individual chromophores. These include (i) broad, unstructured absorbance that decreases monotonically well into the visible and near IR, (ii) fluorescence emission spectra that all fall into a single envelope regardless of the excitation wavelength, and (iii) photobleaching and photochemical quantum yields that decrease monotonically with increasing wavelength. In contrast to a simple superposition model, these phenomena and others can be reasonably well explained by a physical model in which charge-transfer interactions between electron donating and accepting chromophores within the CDOM control the optical and photophysical properties. This review summarizes current understanding of the processes underlying CDOM photophysics and photochemistry as well as their physical basis.

Chromophoric Dissolved Organic Material, Aqua MODIS, NPP, 0.125 degrees, Gulf of Mexico

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — MODIS data is used to develop an index of the amount of chromophoric dissolved organic material (CDOM) in the surface waters. CDOM absorbs heavily in the blue...

Chromophoric Dissolved Organic Material, Aqua MODIS, NPP, 0.05 degrees, Global, Science Quality

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — MODIS data is used to develop an index of the amount of chromophoric dissolved organic material (CDOM) in the surface waters. CDOM absorbs heavily in the blue...

Chromophore-protein coupling beyond nonpolarizable models: understanding absorption in green fluorescent protein

NARCIS (Netherlands)

Daday, C.; Curutchet, C.; Sinicropi, A.; Mennucci, B.; Filippi, Claudia

2015-01-01

The nature of the coupling of the photoexcited chromophore with the environment in a prototypical system like green fluorescent protein (GFP) is to date not understood, and its description still defies state-of-the-art multiscale approaches. To identify which theoretical framework of the

Photoresponsive Block Copolymers Containing Azobenzenes and Other Chromophores

Directory of Open Access Journals (Sweden)

Takaomi Kobayashi

2010-01-01

Full Text Available Photoresponsive block copolymers (PRBCs containing azobenzenes and other chromophores can be easily prepared by controlled polymerization. Their photoresponsive behaviors are generally based on photoisomerization, photocrosslinking, photoalignment and photoinduced cooperative motions. When the photoactive block forms mesogenic phases upon microphase separation of PRBCs, supramolecular cooperative motion in liquid-crystalline PRBCs enables them to self-organize into hierarchical structures with photoresponsive features. This offers novel opportunities to photocontrol microphase-separated nanostructures of well-defined PRBCs and extends their diverse applications in holograms, nanotemplates, photodeformed devices and microporous films.

Novel multi-chromophor light absorber concepts for DSSCs for efficient electron injection

Energy Technology Data Exchange (ETDEWEB)

Schuetz, Robert; Strothkaemper, Christian; Bartelt, Andreas; Hannappel, Thomas; Eichberger, Rainer [Helmholtz-Zentrum Berlin fuer Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Fasting, Carlo [Institut fuer Organische Chemie, Freie Universitaet Berlin, Takustrasse 3, 14195 Berlin (Germany); Thomas, Inara [Helmholtz-Zentrum Berlin fuer Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Institut fuer Organische Chemie, Freie Universitaet Berlin, Takustrasse 3, 14195 Berlin (Germany)

2011-07-01

Dye sensitized solar cells (DSSCs) operate by injecting electrons from the excited state of a light-harvesting dye into the continuum of conduction band states of a wide bandgap semiconductor. The light harvesting efficiency of pure organic dyes is limited by a narrow spectral electronic transition. A beneficial broad ground state absorption in the VIS region can be achieved by applying a single molecular dye system with multiple chromophors involving a Foerster resonance energy transfer (FRET) mechanism for an efficient electron injection. A model donor acceptor dye system capable for FRET chemically linked to colloidal TiO{sub 2} and ZnO nanorod surfaces was investigated in UHV environment. We used VIS/NIR femtosecond transient absorption spectroscopy and optical pump terahertz probe spectroscopy to study the charge injection dynamics of the antenna system. Different chromophors attached to a novel scaffold/anchor system connecting the organic absorber unit to the metal oxide semiconductor were probed.

Chemical Production using Fission Fragments

International Nuclear Information System (INIS)

Dawson, J. K.; Moseley, F.

1960-01-01

Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

Lake and sea populations of Mysis relicta (Crustacea, Mysida with different visual-pigment absorbance spectra use the same A1 chromophore.

Directory of Open Access Journals (Sweden)

Nikolai Belikov

Full Text Available Glacial-relict species of the genus Mysis (opossum shrimps inhabiting both fresh-water lakes and brackish sea waters in northern Europe show a consistent lake/sea dichotomy in eye spectral sensitivity. The absorbance peak (λmax recorded by microspectrophotometry in isolated rhabdoms is invariably 20-30 nm red-shifted in "lake" compared with "sea" populations. The dichotomy holds across species, major opsin lineages and light environments. Chromophore exchange from A1 to A2 (retinal → 3,4-didehydroretinal is a well-known mechanism for red-shifting visual pigments depending on environmental conditions or stages of life history, present not only in fishes and amphibians, but in some crustaceans as well. We tested the hypothesis that the lake/sea dichotomy in Mysis is due to the use of different chromophores, focussing on two populations of M. relicta from, respectively, a Finnish lake and the Baltic Sea. They are genetically very similar, having been separated for less than 10 kyr, and their rhabdoms show a typical lake/sea difference in λmax (554 nm vs. 529 nm. Gene sequencing has revealed no differences translating into amino acid substitutions in the transmembrane parts of their opsins. We determined the chromophore identity (A1 or A2 in the eyes of these two populations by HPLC, using as standards pure chromophores A1 and A2 as well as extracts from bovine (A1 and goldfish (A2 retinas. We found that the visual-pigment chromophore in both populations is A1 exclusively. Thus the spectral difference between these two populations of M. relicta is not due to the use of different chromophores. We argue that this conclusion is likely to hold for all populations of M. relicta as well as its European sibling species.

The crystal structure of human protein α1M reveals a chromophore-binding site and two putative protein–protein interfaces

International Nuclear Information System (INIS)

Zhang, Yangli; Gao, Zengqiang; Guo, Zhen; Zhang, Hongpeng; Zhang, Zhenzhen; Luo, Miao; Hou, Haifeng; Huang, Ailong; Dong, Yuhui; Wang, Deqiang

2013-01-01

Highlights: •We determined the first structure of human α1M with heavy electron density of the chromophore. •We proposed a new structural model of the chromophore. •We first revealed that the two conserved surface regions of α1M are proposed as putative protein–protein interface sites. -- Abstract: Lipocalin α1-microglobulin (α1M) is a conserved glycoprotein present in plasma and in the interstitial fluids of all tissues. α1M is linked to a heterogeneous yellow–brown chromophore of unknown structure, and interacts with several target proteins, including α1-inhibitor-3, fibronectin, prothrombin and albumin. To date, there is little knowledge about the interaction sites between α1M and its partners. Here, we report the crystal structure of the human α1M. Due to the crystallization occurring in a low ionic strength solution, the unidentified chromophore with heavy electron density is observed at a hydrophobic inner tube of α1M. In addition, two conserved surface regions of α1M are proposed as putative protein–protein interface sites. Further study is needed to unravel the detailed information about the interaction between α1M and its partners

Synthesis and Properties of Novel T-Type Polyurethanes Containing 2,5-Dioxynitrostilbenyl Group as a Nonlinear Optical Chromophore

International Nuclear Information System (INIS)

Lee, Ju Yeon; Lee, Won Jung; Park, Eun Ju; Bang, Han Bae; Rhee, Bum Ku; Jung, Chang Soo; Lee, Seung Mook; Lee, Jin Hyun

2003-01-01

Two approaches to minimize the randomization have been proposed. One is to use crosslinking method and the other is to use high T g polymers such as polyimides. Polyurethane matrix forms extensive hydrogen bond between urethane linkage and increases rigidity preventing the relaxation of induced dipoles. In this work we prepared new T-type polyurethanes containing dioxynitrostilbenyl group as a NLO-chromophore. We selected 2,5-dioxynitrostilbenyl group as NLO-chromophore because it will have a large dipole moment and is rather easy to synthesize. Furthermore 2,5-dioxynitrostilbenyl group constitutes a novel T-type NLO polyurthanes, in which the NLO chromophores are parts of polymer backbones. These T-type NLO polyurethanes are not shown in the literature. After confirming the structure of the resulting polymers we investigated the properties such as T g and second harmonic generation (SHG) activity (d 33 ). We now report the results of the initial phase of the work

High-density metals and metallic composites for improved fragmentation submunitions

International Nuclear Information System (INIS)

Craig, B.G.; Honnell, R.E.; Lederman, G.F. Jr.; Sandstrom, D.J.

1975-08-01

The fragmentation of cases (50.8-mm-id) made of tungsten, a tungsten alloy, and depleted uranium (D-38) can be controlled, and velocities greater than 1 mm/μs can be achieved for lethal size fragment weights. Fragmentation was controlled by internal grooves, by internal screens, and by a spheroid-in-weak-matrix scheme. A thin polymer liner was used inside of a grooved tungsten case in one experiment; this system performed exceptionally well. The ease of fabricating cases with D-38 or with the tungsten-alloy spheroid-in-matrix scheme offers an attractive advantage over tungsten and tungsten alloy

Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.

Science.gov (United States)

Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide

2018-04-24

We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.

Refractive index modulation in the polyurethane films containing diazo sulfonamide chromophores

Energy Technology Data Exchange (ETDEWEB)

Ortyl, E. [Insitute of Organic and Polymer Technology, WrocIaw University of Technology, 50-384 WrocIaw (Poland); Kucharski, S. [Insitute of Organic and Polymer Technology, WrocIaw University of Technology, 50-384 WrocIaw (Poland)]. E-mail: stanislaw.kucharski@pwr.wroc.pl; Gotszalk, T. [Faculty of Microsystem Electronics and Photonics, WrocIaw University of Technology, 50-384 WrocIaw (Poland)

2005-05-23

The series of photochromic polyurethanes was obtained by modification of precursor polymers prepared from 4,4'-diphenylmethane diisocyanate (MDI), hexamethylene 1,6-diisocyanate (HDI) or toluene 2,4-diisocyanate (TDI) and N,N'-di-(2-hydroxyethyl) aniline. The precursor polymers were functionalized by an azo-coupling reaction to form the polymers with different degrees of functionalization and various heterocyclic sulfonamide groups. Ellipsometric measurements showed a decrease of the refractive index during illumination of thin polymer films with white light. The change of real part of the refractive index was in the range of 0.0033-0.0296 depending on the polymer kind and chromophore content. It was found that photocurrent was generated in the polymer films deposited onto indium tin oxide (ITO) glass plates. For the polyurethanes containing sulfathiazole groups in side chains the current density was up to 180 nA/cm{sup 2}. The formation of diffraction grating in the polymer films was easily achieved using linearly polarized laser light (532 nm) in a standard two beam coupling (TBC) system. The diffraction efficiency of the first diffraction beam was dependent on the chromophore content reaching ca. 12% for the derivatives of sulfamethoxazole.

On the mechanism of non-radiative decay of blue fluorescent protein chromophore: New insight from the excited-state molecular dynamics simulations and potential energy calculations

Science.gov (United States)

Zhao, Li; Liu, Jian-Yong; Zhou, Pan-Wang

2017-11-01

A detailed theoretical investigation based on the ab initio on-the-fly surface hopping dynamics simulations and potential energy surfaces calculations has been performed to unveil the mechanism of the photoinduced non-adiabatic relaxation process of the isolated blue fluorescent protein (BFP) chromophore in gas phase. The data analysis presents that the dominant reaction coordinate of the BFP chromophore is driven by a rotation motion around the CC double bridging bond, which is in remarkable difference with a previous result which supports a Hula-Twist rotation pattern. Such behavior is consistent with the double bond rotation pattern of the GFP neutral chromophore. In addition, the dynamics simulations give an estimated decay time of 1.1 ps for the S1 state, which is agrees well with the experimental values measured in proteins. The present work offers a straightforward understanding for the decay mechanism of the BFP chromophore and suggestions of the photochemical properties of analogous protein chromophores. We hope the current work would be helpful for further exploration of the BFP photochemical and photophysical properties in various environments, and can provide guidance and prediction for rational design of the fluorescent proteins catering for different demands.

Ultrafast excited and ground-state dynamics of the green fluorescent protein chromophore in solution

NARCIS (Netherlands)

Vengris, M.; van Stokkum, I.H.M.; He, X.; Bell, A.F.; Tonge, P.J.; van Grondelle, R.; Larsen, D.S.

2004-01-01

Ultrafast dispersed pump-dump-probe spectroscopy was applied to HBDI (4′-hydroxybenzylidene-2,3-dimethylimidazolinone), a model green fluorescent protein (GFP) chromophore in solution with different protonation states. The measured three-dimensional data was analyzed using a global analysis method

DNA-Conjugated Organic Chromophores in DNA Stacking Interactions

DEFF Research Database (Denmark)

Filichev, Vyacheslav V.; Pedersen, Erik Bjerregaard

2009-01-01

Since the discovery of the intercalation of acridine derivatives into DNA (1961), chemists have synthesized many intercalators tethered to DNA. Advances in the chemical synthesis of modified nucleosides along with progress in oligonucleotide synthesis have made it possible to introduce organic ch...... review presents those efforts in the design of intercalators/organic chromophores as oligonucleotide conjugates that form a foundation for the generation of novel nucleic acid architectures......Since the discovery of the intercalation of acridine derivatives into DNA (1961), chemists have synthesized many intercalators tethered to DNA. Advances in the chemical synthesis of modified nucleosides along with progress in oligonucleotide synthesis have made it possible to introduce organic...

Dynamic Electron Correlation Effects on the Ground State Potential Energy Surface of a Retinal Chromophore Model.

Science.gov (United States)

Gozem, Samer; Huntress, Mark; Schapiro, Igor; Lindh, Roland; Granovsky, Alexander A; Angeli, Celestino; Olivucci, Massimo

2012-11-13

The ground state potential energy surface of the retinal chromophore of visual pigments (e.g., bovine rhodopsin) features a low-lying conical intersection surrounded by regions with variable charge-transfer and diradical electronic structures. This implies that dynamic electron correlation may have a large effect on the shape of the force fields driving its reactivity. To investigate this effect, we focus on mapping the potential energy for three paths located along the ground state CASSCF potential energy surface of the penta-2,4-dieniminium cation taken as a minimal model of the retinal chromophore. The first path spans the bond length alternation coordinate and intercepts a conical intersection point. The other two are minimum energy paths along two distinct but kinetically competitive thermal isomerization coordinates. We show that the effect of introducing the missing dynamic electron correlation variationally (with MRCISD) and perturbatively (with the CASPT2, NEVPT2, and XMCQDPT2 methods) leads, invariably, to a stabilization of the regions with charge transfer character and to a significant reshaping of the reference CASSCF potential energy surface and suggesting a change in the dominating isomerization mechanism. The possible impact of such a correction on the photoisomerization of the retinal chromophore is discussed.

Mechanism of ascorbic acid interference in biochemical tests that use peroxide and peroxidase to generate chromophore.

Science.gov (United States)

Martinello, Flávia; Luiz da Silva, Edson

2006-11-01

Ascorbic acid interferes negatively in peroxidase-based tests (Trinder method). However, the precise mechanism remains unclear for tests that use peroxide, a phenolic compound and 4-aminophenazone (4-AP). We determined the chemical mechanism of this interference, by examining the effects of ascorbic acid in the reaction kinetics of the production and reduction of the oxidized chromophore in urate, cholesterol, triglyceride and glucose tests. Reaction of ascorbic acid with the Trinder method constituents was also verified. Ascorbic acid interfered stoichiometrically with all tests studied. However, it had two distinct effects on the reaction rate. In the urate test, ascorbic acid decreased the chromophore formation with no change in its production kinetics. In contrast, in cholesterol, triglyceride and glucose tests, an increase in the lag phase of color development occurred. Of all the Trinder constituents, only peroxide reverted the interference. In addition, ascorbic acid did not interfere with oxidase activity nor reduce significantly the chromophore formed. Peroxide depletion was the predominant chemical mechanism of ascorbic acid interference in the Trinder method with phenolics and 4-AP. Distinctive effects of ascorbic acid on the reaction kinetics of urate, cholesterol, glucose and triglyceride might be due to the rate of peroxide production by oxidases.

Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

Directory of Open Access Journals (Sweden)

Muylaert An

2002-07-01

Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

Probing microhydration effect on the electronic structure of the GFP chromophore anion: Photoelectron spectroscopy and theoretical investigations

Energy Technology Data Exchange (ETDEWEB)

Bhaskaran-Nair, Kiran; Shelton, William A. [Cain Department of Chemical Engineering, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Center for Computation and Technology, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Valiev, Marat; Kowalski, Karol, E-mail: karol.kowalski@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, K8-91, P.O. Box 999, Richland, Washington 99352 (United States); Deng, S. H. M.; Wang, Xue-Bin, E-mail: xuebin.wang@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, K8-88, P.O. Box 999, Richland, Washington 99352 (United States)

2015-12-14

The photophysics of the Green Fluorescent Protein (GFP) chromophore is critically dependent on its local structure and on its environment. Despite extensive experimental and computational studies, there remain many open questions regarding the key fundamental variables that govern this process. One outstanding problem is the role of autoionization as a possible relaxation pathway of the excited state under different environmental conditions. This issue is considered in our work through combined experimental and theoretical studies of microsolvated clusters of the deprotonated p-hydroxybenzylidene-2,3-dimethylimidazolinone anion (HBDI{sup −}), an analog of the GFP chromophore. Through selective generation of microsolvated structures of predetermined size and subsequent analysis of experimental photoelectron spectra by high level ab initio methods, we are able to precisely identify the structure of the system, establish the accuracy of theoretical data, and provide reliable description of auto-ionization process as a function of hydrogen-bonding environment. Our study clearly illustrates the first few water molecules progressively stabilize the excited state of the chromophore anion against the autodetached neutral state, which should be an important trait for crystallographic water molecules in GFPs that has not been fully explored to date.

Acentric 2-D ensembles of D-br-A electron-transfer chromophores via vectorial orientation within amphiphilic n-helix bundle peptides for photovoltaic device applications.

Science.gov (United States)

Koo, Jaseung; Park, Jaehong; Tronin, Andrey; Zhang, Ruili; Krishnan, Venkata; Strzalka, Joseph; Kuzmenko, Ivan; Fry, H Christopher; Therien, Michael J; Blasie, J Kent

2012-02-14

We show that simply designed amphiphilic 4-helix bundle peptides can be utilized to vectorially orient a linearly extended donor-bridge-acceptor (D-br-A) electron transfer (ET) chromophore within its core. The bundle's interior is shown to provide a unique solvation environment for the D-br-A assembly not accessible in conventional solvents and thereby control the magnitudes of both light-induced ET and thermal charge recombination rate constants. The amphiphilicity of the bundle's exterior was employed to vectorially orient the peptide-chromophore complex at a liquid-gas interface, and its ends were tailored for subsequent covalent attachment to an inorganic surface, via a "directed assembly" approach. Structural data, combined with evaluation of the excited state dynamics exhibited by these peptide-chromophore complexes, demonstrate that densely packed, acentrically ordered 2-D monolayer ensembles of such complexes at high in-plane chromophore densities approaching 1/200 Å(2) offer unique potential as active layers in binary heterojunction photovoltaic devices.

Skin image illumination modeling and chromophore identification for melanoma diagnosis

Science.gov (United States)

Liu, Zhao; Zerubia, Josiane

2015-05-01

The presence of illumination variation in dermatological images has a negative impact on the automatic detection and analysis of cutaneous lesions. This paper proposes a new illumination modeling and chromophore identification method to correct lighting variation in skin lesion images, as well as to extract melanin and hemoglobin concentrations of human skin, based on an adaptive bilateral decomposition and a weighted polynomial curve fitting, with the knowledge of a multi-layered skin model. Different from state-of-the-art approaches based on the Lambert law, the proposed method, considering both specular reflection and diffuse reflection of the skin, enables us to address highlight and strong shading effects usually existing in skin color images captured in an uncontrolled environment. The derived melanin and hemoglobin indices, directly relating to the pathological tissue conditions, tend to be less influenced by external imaging factors and are more efficient in describing pigmentation distributions. Experiments show that the proposed method gave better visual results and superior lesion segmentation, when compared to two other illumination correction algorithms, both designed specifically for dermatological images. For computer-aided diagnosis of melanoma, sensitivity achieves 85.52% when using our chromophore descriptors, which is 8~20% higher than those derived from other color descriptors. This demonstrates the benefit of the proposed method for automatic skin disease analysis.

Production of Chromophoric Dissolved Organic Matter from Mangrove Leaf Litter and Floating Sargassum Colonies

Science.gov (United States)

Chromophoric dissolved organic matter (CDOM) strongly absorbs solar radiation in the blue-green and serves as the primary attenuator of water column ultraviolet radiation (UV-R). CDOM interferes with remote sensing of ocean chlorophyll and can control UV-R-induced damage to light...

Extension of Light-Harvesting Ability of Photosynthetic Light-Harvesting Complex 2 (LH2) through Ultrafast Energy Transfer from Covalently Attached Artificial Chromophores.

Science.gov (United States)

Yoneda, Yusuke; Noji, Tomoyasu; Katayama, Tetsuro; Mizutani, Naoto; Komori, Daisuke; Nango, Mamoru; Miyasaka, Hiroshi; Itoh, Shigeru; Nagasawa, Yutaka; Dewa, Takehisa

2015-10-14

Introducing appropriate artificial components into natural biological systems could enrich the original functionality. To expand the available wavelength range of photosynthetic bacterial light-harvesting complex 2 (LH2 from Rhodopseudomonas acidophila 10050), artificial fluorescent dye (Alexa Fluor 647: A647) was covalently attached to N- and C-terminal Lys residues in LH2 α-polypeptides with a molar ratio of A647/LH2 ≃ 9/1. Fluorescence and transient absorption spectroscopies revealed that intracomplex energy transfer from A647 to intrinsic chromophores of LH2 (B850) occurs in a multiexponential manner, with time constants varying from 440 fs to 23 ps through direct and B800-mediated indirect pathways. Kinetic analyses suggested that B800 chromophores mediate faster energy transfer, and the mechanism was interpretable in terms of Förster theory. This study demonstrates that a simple attachment of external chromophores with a flexible linkage can enhance the light harvesting activity of LH2 without affecting inherent functions of energy transfer, and can achieve energy transfer in the subpicosecond range. Addition of external chromophores, thus, represents a useful methodology for construction of advanced hybrid light-harvesting systems that afford solar energy in the broad spectrum.

Public Values in Water Law: A Case of Substantive Fragmentation?

NARCIS (Netherlands)

Ambrus, M.; Gilissen, Herman Kasper; van Kempen, Jasper

2014-01-01

Horizontal fragmentation, from a public-values perspective, is a quite well-documented phenomenon in international (water) law. However, the literature does not provide any insight into vertical or substantive fragmentation, i.e. differences in the protection of public values at the various

Public Values in Water Law : A Case of Substantive Fragmentation?

NARCIS (Netherlands)

Ambrus, Monika; Gilissen, Herman Kasper; van Kempen, Jasper JH

2014-01-01

Horizontal fragmentation, from a public-values perspective, is a quite well-documented phenomenon in international (water) law. However, the literature does not provide any insight into vertical or substantive fragmentation, i.e. differences in the protection of public values at the various

Resolving Electronic Transitions in Synthetic Fluorescent Protein Chromophores by Magnetic Circular Dichroism

Czech Academy of Sciences Publication Activity Database

Štěpánek, P.; Cowie, T. Y.; Šafařík, Martin; Šebestík, Jaroslav; Pohl, Radek; Bouř, Petr

2016-01-01

Roč. 17, č. 15 (2016), s. 2348-2354 ISSN 1439-4235 R&D Projects: GA ČR GA13-03978S; GA ČR(CZ) GA16-05935S Institutional support: RVO:61388963 Keywords : density functional calculations * fluorescence protein chromophores * magnetic circular dichroism * organic synthesis * spectral simulations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.075, year: 2016

Evaluation of radioiodinated and radiocopper labeled monovalent fragments of monoclonal antibody chCE7 for targeting of neuroblastoma

International Nuclear Information System (INIS)

Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August

1997-01-01

Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake

Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties

Science.gov (United States)

Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.

2003-12-01

A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.

Free volume modifications in chalcone chromophore doped PMMA films by electron irradiation: Positron annihilation study

Science.gov (United States)

Ismayil; Ravindrachary, V.; Praveena, S. D.; Mahesha, M. G.

2018-03-01

The free volume related fluorescence behaviour in electron beam irradiated chalcone chromophore doped Poly(methyl methacrylate) (PMMA) composite films have been studied using FTIR, UV-Visible, XRD and Positron Annihilation techniques. From the FTIR spectral study it is found that the formation of polarons and bipolaron takes place due to cross linking as well as chain scission processes at lower and higher doses respectively. It reveals that the formation of various polaronic defect levels upon irradiation is responsible for the creation of three optical energy band gaps within the polymer films as obtained from UV-Visible spectra. The crosslinking process at lower doses increases the distance between the pendant groups to reduce the interchain distance and chain scission process at higher doses decreases interchain separation to enhance the number of polarons in the polymer composites as suggested by XRD studies. The fluorescence studies show the enhancement of fluorescence emission at lower doses and reduction at higher doses under electron irradiation. The positron annihilation study suggests that the low radiation doses induce crosslinking which affect the free volume properties and in turn hinders the chalcone molecular rotation within the polymer composite. At higher doses chain scission process support polymer matrix relaxation and facilitates non-radiative transition of the chromophore upon excitation. This study shows that fluorescence enhancement and mobility of chromophore within the polymer matrix is directly related to the free volume around it.

Imidazole as a parent π-conjugated backbone in charge-transfer chromophores

Directory of Open Access Journals (Sweden)

Jiří Kulhánek

2012-01-01

Full Text Available Research activities in the field of imidazole-derived push–pull systems featuring intramolecular charge transfer (ICT are reviewed. Design, synthetic pathways, linear and nonlinear optical properties, electrochemistry, structure–property relationships, and the prospective application of such D-π-A organic materials are described. This review focuses on Y-shaped imidazoles, bi- and diimidazoles, benzimidazoles, bis(benzimidazoles, imidazole-4,5-dicarbonitriles, and imidazole-derived chromophores chemically bound to a polymer chain.

Design, Structure, and Optical Properties of Organic-Inorganic Perovskites Containing an Oligothiophene Chromophore.

Science.gov (United States)

Mitzi, David B.; Chondroudis, Konstantinos; Kagan, Cherie R.

1999-12-27

A quaterthiophene derivative, 5,5' "-bis(aminoethyl)-2,2':5',2' ':5' ',2' "-quaterthiophene (AEQT), has been selected for incorporation within the layered organic-inorganic perovskite structure. In addition to having an appropriate molecular shape and two tethering aminoethyl groups to bond to the inorganic framework, AEQT is also a dye and can influence the optical properties of lead(II) halide-based perovskites. Crystals of C(20)H(22)S(4)N(2)PbBr(4) were grown from a slowly cooled aqueous solution containing lead(II) bromide and quaterthiophene derivative (AEQT.2HBr) salts. The new layered perovskite adopts a monoclinic (C2/c) subcell with the lattice parameters a = 39.741(2) Å, b = 5.8420(3) Å, c = 11.5734(6) Å, beta = 92.360(1) degrees, and Z = 4. Broad superstructure peaks are observed in the X-ray diffraction data, indicative of a poorly ordered, doubled supercell along both the a and b axes. The quaterthiophene segment of AEQT(2+) is nearly planar, with a syn-anti-syn relationship between adjacent thiophene rings. Each quaterthiophene chromophore is ordered between nearest-neighbor lead(II) bromide sheets in a herringbone arrangement with respect to neighboring quaterthiophenes. Room temperature optical absorption spectra for thermally ablated films of the perovskites (AEQT)PbX(4) (X = Cl, Br, I) exhibit an exciton peak arising from the lead(II) halide sheets, along with absorption from the quaterthiophene moiety. No evidence of the inorganic sheet excitonic transition is observed in the photoluminescence spectra for any of the chromophore-containing perovskites. However, strong quaterthiophene photoluminescence is observed for X = Cl, with an emission peak at approximately lambda(max) = 532 nm. Similar photoluminescence is observed for the X = Br and I materials, but with substantial quenching, as the inorganic layer band gap decreases relative to the chromophore HOMO-LUMO gap.

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

CHROMOPHORIC DISSOLVED ORGANIC MATTER (CDOM) DERIVED FROM DECOMPOSITION OF VARIOUS VASCULAR PLANT AND ALGAL SOURCES

Science.gov (United States)

Chromophoric dissolved organic (CDOM) in aquatic environments is derived from the microbial decomposition of terrestrial and microbial organic matter. Here we present results of studies of the spectral properties and photoreactivity of the CDOM derived from several organic matter...

New hyperbranched polytriazoles containing isolation chromophore moieties derived from AB4 monomers through click chemistry under copper(I) catalysis: improved optical transparency and enhanced NLO effects.

Science.gov (United States)

Wu, Wenbo; Ye, Cheng; Yu, Gui; Liu, Yunqi; Qin, Jingui; Li, Zhen

2012-04-02

By modifying a synthetic procedure, two new hyperbranched polytriazoles (HP1 and HP2) containing isolation chromophores were synthesized successfully through click chemistry reactions under copper(I) catalysis. For the first time, these two polymers were derived from an AB(4)-type monomer, although they contain different end-capping chromophores. They are soluble in normal polar organic solvents and are well characterized. Thanks to the presence of the isolation chromophore, the two polymers demonstrate good nonlinear optical (NLO) properties and optical transparency, making them promising candidates for practical applications. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ultrafast dynamics of isolated model photoactive yellow protein chromophores: "Chemical perturbation theory" in the laboratory

NARCIS (Netherlands)

Vengris, M.; Larsen, D.S.; van der Horst, M.A.; Larsen, O.F.A.; Hellingwerf, K.J.; van Grondelle, R.

2005-01-01

Pump-probe and pump-dump probe experiments have been performed on several isolated model chromophores of the photoactive yellow protein (PYP). The observed transient absorption spectra are discussed in terms of the spectral signatures ascribed to solvation, excited-state twisting, and vibrational

How far can a single hydrogen bond tune the spectral properties of the GFP chromophore?

DEFF Research Database (Denmark)

Kiefer, Hjalte; Lattouf, Elie; Persen, Natascha Wardinghus

2015-01-01

Photoabsorption of the hydrogen-bonded complex of a neutral and an anionic Green Fluorescent Protein chromophore has been studied using a new dual-detection approach to action-absorption spectroscopy. Following absorption of one photon, dissociation through a single channel ensures that the full ...

The Ups and Downs of Repeated Cleavage and Internal Fragment Production in Top-Down Proteomics

Science.gov (United States)

Lyon, Yana A.; Riggs, Dylan; Fornelli, Luca; Compton, Philip D.; Julian, Ryan R.

2018-01-01

Analysis of whole proteins by mass spectrometry, or top-down proteomics, has several advantages over methods relying on proteolysis. For example, proteoforms can be unambiguously identified and examined. However, from a gas-phase ion-chemistry perspective, proteins are enormous molecules that present novel challenges relative to peptide analysis. Herein, the statistics of cleaving the peptide backbone multiple times are examined to evaluate the inherent propensity for generating internal versus terminal ions. The raw statistics reveal an inherent bias favoring production of terminal ions, which holds true regardless of protein size. Importantly, even if the full suite of internal ions is generated by statistical dissociation, terminal ions are predicted to account for at least 50% of the total ion current, regardless of protein size, if there are three backbone dissociations or fewer. Top-down analysis should therefore be a viable approach for examining proteins of significant size. Comparison of the purely statistical analysis with actual top-down data derived from ultraviolet photodissociation (UVPD) and higher-energy collisional dissociation (HCD) reveals that terminal ions account for much of the total ion current in both experiments. Terminal ion production is more favored in UVPD relative to HCD, which is likely due to differences in the mechanisms controlling fragmentation. Importantly, internal ions are not found to dominate from either the theoretical or experimental point of view. [Figure not available: see fulltext.

Hands as markers of fragmentation

Directory of Open Access Journals (Sweden)

A. Barnard

2005-07-01

Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

Direct and Indirect Electron Emission from the Green Fluorescent Protein Chromophore

Science.gov (United States)

Toker, Y.; Rahbek, D. B.; Klærke, B.; Bochenkova, A. V.; Andersen, L. H.

2012-09-01

Photoelectron spectra of the deprotonated green fluorescent protein chromophore have been measured in the gas phase at several wavelengths within and beyond the S0-S1 photoabsorption band of the molecule. The vertical detachment energy (VDE) was determined to be 2.68±0.1eV. The data show that the first electronically excited state is bound in the Franck-Condon region, and that electron emission proceeds through an indirect (resonant) electron-emission channel within the corresponding absorption band.

Photobleaching Kinetics of Chromophoric Dissolved Organic Matter Derived from Mangrove Leaf Litter and Floating Sargassum Colonies

Science.gov (United States)

We examined the photoreactivity of chromophoric dissolved organic matter (CDOM) derived from Rhizophora mangle (red mangrove) leaf litter and floating Sargassum colonies as these marine plants can be important contributors to coastal and open ocean CDOM pools, respectively. Mangr...

Preparation and third-order nonlinear optical property of poly(urethane-imide containing dispersed red chromophore

Directory of Open Access Journals (Sweden)

2008-11-01

Full Text Available A novel poly(urethane-imide (PUI containing dispersed red chromophore was synthesized. The PUI was characterized by FT-IR, UV-Vis, DSC and TGA. The results of DSC and TGA indicated that the PUI exhibited high thermal stability up to its glass-transition temperature (Tg of 196°C and 5% heat weight loss temperature of 229°C. According to UV-Vis spectrum and working curve, the maximum molar absorption coefficient and absorption wavelength were measured. They were used to calculate the third-order nonlinear optical coefficient χ(3. At the same time, the chromophore density of PUI, nonlinear refractive index coefficient and molecular hyperpolarizability of PUI were obtained. The fluorescence spectra of PUI and model compound DR-19 were determined at excitation wavelength 300 nm. The electron donor and acceptor in polymer formed the exciplex through the transfer of the electric charges. The results show that the poly(urethane-imide is a promising candidate for application in optical devices.

Photochemical degradation of chromophoric-dissolved organic matter exposed to simulated UV-B and natural solar radiation

NARCIS (Netherlands)

Zhang, Y.; Liu, M.; Qin, B.; Feng, S.

2009-01-01

Photochemical degradation of chromophoric-dissolved organic matter (CDOM) by UV-B radiation decreases CDOM absorption in the UV region and fluorescence intensity, and alters CDOM composition. CDOM absorption, fluorescence, and the spectral slope indicating the CDOM composition were studied using

Structural communication between the chromophore-binding pocket and the N-terminal extension in plant phytochrome phyB.

Science.gov (United States)

Velázquez Escobar, Francisco; Buhrke, David; Fernandez Lopez, Maria; Shenkutie, Sintayehu Manaye; von Horsten, Silke; Essen, Lars-Oliver; Hughes, Jon; Hildebrandt, Peter

2017-05-01

The N-terminal extension (NTE) of plant phytochromes has been suggested to play a functional role in signaling photoinduced structural changes. Here, we use resonance Raman spectroscopy to study the effect of the NTE on the chromophore structure of B-type phytochromes from two evolutionarily distant plants. NTE deletion seems to have no effect on the chromophore in the inactive Pr state, but alters the torsion of the C-D ring methine bridge and the surrounding hydrogen bonding network in the physiologically active Pfr state. These changes are accompanied by a shift of the conformational equilibrium between two Pfr substates, which might affect the thermal isomerization rate of the C-D double bond and, thus, account for the effect of the NTE on the dark reversion kinetics. © 2017 Federation of European Biochemical Societies.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Sea cucumbers reduce chromophoric dissolved organic matter in aquaculture tanks.

Science.gov (United States)

Sadeghi-Nassaj, Seyed Mohammad; Catalá, Teresa S; Álvarez, Pedro A; Reche, Isabel

2018-01-01

Mono-specific aquaculture effluents contain high concentrations of nutrients and organic matter, which affect negatively the water quality of the recipient ecosystems. A fundamental feature of water quality is its transparency. The fraction of dissolved organic matter that absorbs light is named chromophoric dissolved organic matter (CDOM). A sustainable alternative to mono-specific aquaculture is the multitrophic aquaculture that includes species trophically complementary named "extractive" species that uptake the waste byproducts. Sea cucumbers are recognized as efficient extractive species due to the consumption of particulate organic matter (POM). However, the effects of sea cucumbers on CDOM are still unknown. During more than one year, we monitored CDOM in two big-volume tanks with different trophic structure. One of the tanks (-holothurian) only contained around 810 individuals of Anemonia sulcata , whereas the other tank (+holothurian) also included 90 individuals of Holothuria tubulosa and Holothuria forskali . We routinely analyzed CDOM absorption spectra and determined quantitative (absorption coefficients at 325 nm) and qualitative (spectral slopes) optical parameters in the inlet waters, within the tanks, and in their corresponding effluents. To confirm the time-series results, we also performed three experiments. Each experiment consisted of two treatments: +holothurians (+H) and -holothurians (-H). We set up three +H tanks with 80 individuals of A. sulcata and 10 individuals of H. tubulosa in each tank and four -H tanks that contained only 80 individuals of A. sulcata . In the time-series, absorption coefficients at 325 nm ( a 325 ) and spectral slopes from 275 to 295 nm ( S 275-295 ) were significantly lower in the effluent of the +holothurian tank (average: 0.33 m -1 and 16 µm -1 , respectively) than in the effluent of the -holothurian tank (average: 0.69 m -1 and 34 µm -1 , respectively), the former being similar to those found in the inlet

The role of the [CpM(CO)2](-) chromophore in the optical properties of the [Cp2ThMCp(CO)2](+) complexes, where M = Fe, Ru and Os. A theoretical view.

Science.gov (United States)

Cantero-López, Plinio; Le Bras, Laura; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro

2015-12-14

The chemical bond between actinide and the transition metal unsupported by bridging ligands is not well characterized. In this paper we study the electronic properties, bonding nature and optical spectra in a family of [Cp2ThMCp(CO)2](+) complexes where M = Fe, Ru, Os, based on the relativistic two component density functional theory calculations. The Morokuma-Ziegler energy decomposition analysis shows an important ionic contribution in the Th-M interaction with around 25% of covalent character. Clearly, charge transfer occurs on Th-M bond formation, however the orbital term most likely represents a strong charge rearrangement in the fragments due to the interaction. Finally the spin-orbit-ZORA calculation shows the possible NIR emission induced by the [FeCp(CO)2](-) chromophore accomplishing the antenna effect that justifies the sensitization of the actinide complexes.

Characteristics of Chromophoric and Fluorescent Dissolved Organic Matter in the Nordic Seas

OpenAIRE

Makarewicz, Anna; Kowalczuk, Piotr; Sagan, Sławomir; Granskog, Mats A.; Pavlov, Alexey K.; Zdun, Agnieszka; Borzycka, Karolina; Zabłocka, Monika

2018-01-01

Optical properties of Chromophoric (CDOM) and Fluorescent Dissolved Organic Matter (FDOM) were characterized in the Nordic Seas including the West Spitsbergen Shelf during June–July of 2013, 2014 and 2015. The CDOM absorption coefficient at 350 nm, aCDOM(350) showed significant interannual variation. In 2013, the highest average aCDOM(350) values (aCDOM = 0.30 ± 0.12 m−1) were observed due to the influence of cold and low–saline wat...

Quark and gluon fragmentation in high energy e+e- annihilation

International Nuclear Information System (INIS)

Saxon, D.H.

1986-07-01

The paper on quark and gluon fragmentation in high energy e + e - annihilation is based on lectures given at the International School of High Energy Physics, Yugoslavia, 1986. Fragmentation Models, charged particle multiplicity, Bose-Einstein correlations, single particle inclusive distributions, hadrons in jets, leading particle effects, baryon production, comparison of quark and gluon jets, and the string effect, are all discussed. (UK)

Light transmission through intraocular lenses with or without yellow chromophore (blue light filter) and its potential influence on functional vision in everyday environmental conditions.

Science.gov (United States)

Owczarek, Grzegorz; Gralewicz, Grzegorz; Skuza, Natalia; Jurowski, Piotr

2016-01-01

In this research the factors used to evaluate the light transmission through two types of acrylic hydrophobic intraocular lenses, one that contained yellow chromophore that blocks blue light transmission and the other which did not contain that filter, were defined according to various light condition, e.g., daylight and at night. The potential influence of light transmission trough intraocular lenses with or without yellow chromophore on functional vision in everyday environmental conditions was analysed.

Synthesis and solution aggregation studies of a suite of mixed neutral and zwitterionic chromophores for second-order nonlinear optics.

Science.gov (United States)

Peddie, Victoria; Anderson, Jack; Harvey, Joanne E; Smith, Gerald J; Kay, Andrew

2014-11-07

We report details of the synthesis of a series of bi- and trichromophores. These compounds contain mixtures of chromophores that have zwitterionic (ZWI) and neutral ground state (NGS) components covalently attached to each other. The neutral ground state moieties are based on dyes with aniline donors--such as Disperse Red 1--whereas the zwitterionic components are derived from chromophores with pro-aromatic donors such as 1,4-dihydropyridinylidene. By combining both ZWI and NGS components, we aim to develop novel compounds for nonlinear optics in which there is an enhancement of the overall hyperpolarizability coupled with a decrease in the net dipole moment. Thus, this approach should eliminate the electrostatic effects that result when only one type of chromophore is used, and so reduce the likelihood of undesirable aggregation occurring. This, in turn, should enable us to realize organic materials with large macroscopic optical nonlinearities. An analysis of the UV-vis results suggests that there is a strong dependence on solvent polarity that determines whether the embedded constituents should be treated as discrete elements; in low polarity solvents, there appear to be strong intramolecular interactions occurring, particularly when a 1,4-quinolinylidene-based donor is used in the ZWI component.

Mojibake - The rehearsal of word fragments in verbal recall.

Science.gov (United States)

Lange-Küttner, Christiane; Sykorova, Eva

2015-01-01

Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the 'grain size' of word units (Ziegler and Goswami, 2005). In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF) English words versus geographical (UK) town names to control for content. We also tested unfamiliar international (INT) non-words and names of international (INT) European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words.

A Successful Attempt to Obtain the Linear Dependence Between One-Photon and Two-Photon Spectral Properties and Hammett Parameters of Various Aromatic Substituents in New π-Extended Asymmetric Organic Chromophores.

Science.gov (United States)

Hu, Nvdan; Gong, Yulong; Wang, Xinchao; Lu, Yao; Peng, Guangyue; Yang, Long; Zhang, Shengtao; Luo, Ziping; Li, Hongru; Gao, Fang

2015-11-01

A series of new asymmetric chromophores containing aromatic substituents and possessing the excellent π-extension in space were prepared through multi-steps routes. One-photon and two-photon spectral properties of these new chromophores could be tuned by these substituents finely and simultaneously. The linear correlation of the wave numbers of the one-photon absorption and emission maxima to Hammett parameters of these substituents was presented. Near infrared two-photon absorption emission integrated areas of the target chromophores were correlated linearly to Hammett constants of these substituted groups.

PHOTOREACTIVITY OF CHROMOPHORIC DISSOLVED ORGANIC MATTER (CDOM) DERIVED FROM DECOMPOSITION OF VARIOUS VASCULAR PLANT AND ALGAL SOURCES

Science.gov (United States)

Chromophoric dissolved organic matter (CDOM) in aquatic environments is derived from the microbial decomposition of terrestrial and microbial organic matter. Here we present results of studies of the spectral properties and photoreactivity of the CDOM derived from several organi...

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Improved Barriers to Turbine Engine Fragments: Final Annual Report

National Research Council Canada - National Science Library

Shockey, Donald

2002-01-01

This final annual technical report describes the progress rnade during year 4 of the SPI International Phase II effort to develop a computational capability for designing lightweight fragment barriers...

Improved Barriers to Turbine Engine Fragments: Interim Report II

National Research Council Canada - National Science Library

Shockey, Donald

1999-01-01

... the effects of uncontained engine bursts. SRI International is evaluating the ballistic effectiveness of fabric structures made from advanced polymers and developing a computational ability to design fragment barriers...

OSCILLATING FILAMENTS. I. OSCILLATION AND GEOMETRICAL FRAGMENTATION

Energy Technology Data Exchange (ETDEWEB)

Gritschneder, Matthias; Heigl, Stefan; Burkert, Andreas, E-mail: gritschm@usm.uni-muenchen.de [University Observatory Munich, LMU Munich, Scheinerstrasse 1, D-81679 Munich (Germany)

2017-01-10

We study the stability of filaments in equilibrium between gravity and internal as well as external pressure using the grid-based AMR code RAMSES. A homogeneous, straight cylinder below a critical line mass is marginally stable. However, if the cylinder is bent, such as with a slight sinusoidal perturbation, an otherwise stable configuration starts to oscillate, is triggered into fragmentation, and collapses. This previously unstudied behavior allows a filament to fragment at any given scale, as long as it has slight bends. We call this process “geometrical fragmentation.” In our realization, the spacing between the cores matches the wavelength of the sinusoidal perturbation, whereas up to now, filaments were thought to be only fragmenting on the characteristic scale set by the mass-to-line ratio. Using first principles, we derive the oscillation period as well as the collapse timescale analytically. To enable a direct comparison with observations, we study the line-of-sight velocity for different inclinations. We show that the overall oscillation pattern can hide the infall signature of cores.

Unmixing chromophores in human skin with a 3D multispectral optoacoustic mesoscopy system

Science.gov (United States)

Schwarz, Mathias; Aguirre, Juan; Soliman, Dominik; Buehler, Andreas; Ntziachristos, Vasilis

2016-03-01

The absorption of visible light by human skin is governed by a number of natural chromophores: Eumelanin, pheomelanin, oxyhemoglobin, and deoxyhemoglobin are the major absorbers in the visible range in cutaneous tissue. Label-free quantification of these tissue chromophores is an important step of optoacoustic (photoacoustic) imaging towards clinical application, since it provides relevant information in diseases. In tumor cells, for instance, there are metabolic changes (Warburg effect) compared to healthy cells, leading to changes in oxygenation in the environment of tumors. In malignant melanoma changes in the absorption spectrum have been observed compared to the spectrum of nonmalignant nevi. So far, optoacoustic imaging has been applied to human skin mostly in single-wavelength mode, providing anatomical information but no functional information. In this work, we excited the tissue by a tunable laser source in the spectral range from 413-680 nm with a repetition rate of 50 Hz. The laser was operated in wavelengthsweep mode emitting consecutive pulses at various wavelengths that allowed for automatic co-registration of the multispectral datasets. The multispectral raster-scan optoacoustic mesoscopy (MSOM) system provides a lateral resolution of melanin, oxyhemoglobin, and deoxyhemoglobin, three-dimensional absorption maps of all three absorbers were calculated from the multispectral dataset.

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

2,4,5-trihydroxy-3-methylacetophenone: A cellulosic chromophore as a case study of aromaticity

Science.gov (United States)

Nele Sophie Zwirchmayr; Thomas Elder; Markus Bacher; Andreas Hofinger-Horvath; Paul Kosma; Thomas. Rosenau

2017-01-01

The title compound (2,4,5-trihydroxy-3-methylacetophenone, 1) was isolated as chromophore from aged cellulosic pulps. The peculiar feature of the compound is its weak aromatic system that can be converted into nonaromatic (quinoid or cyclic aliphatic) tautomers, depending on the conditions and reaction partners. In alkaline media, the participation of quinoid canonic...

Rapid and accurate identification of isolates of Candida species by melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA)

NARCIS (Netherlands)

Decat, E.; van Mechelen, E.; Saerens, B.; Vermeulen, S.J.T.; Boekhout, T.; de Blaiser, S.; Vaneechoutte, M.; Deschaght, P.

2013-01-01

Rapid identification of clinically important yeasts can facilitate the initiation of anti-fungal therapy, since susceptibility is largely species-dependent. We evaluated melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA) as an identification

Sea cucumbers reduce chromophoric dissolved organic matter in aquaculture tanks

Directory of Open Access Journals (Sweden)

Seyed Mohammad Sadeghi-Nassaj

2018-02-01

Full Text Available Background Mono-specific aquaculture effluents contain high concentrations of nutrients and organic matter, which affect negatively the water quality of the recipient ecosystems. A fundamental feature of water quality is its transparency. The fraction of dissolved organic matter that absorbs light is named chromophoric dissolved organic matter (CDOM. A sustainable alternative to mono-specific aquaculture is the multitrophic aquaculture that includes species trophically complementary named “extractive” species that uptake the waste byproducts. Sea cucumbers are recognized as efficient extractive species due to the consumption of particulate organic matter (POM. However, the effects of sea cucumbers on CDOM are still unknown. Methods During more than one year, we monitored CDOM in two big-volume tanks with different trophic structure. One of the tanks (−holothurian only contained around 810 individuals of Anemonia sulcata, whereas the other tank (+holothurian also included 90 individuals of Holothuria tubulosa and Holothuria forskali. We routinely analyzed CDOM absorption spectra and determined quantitative (absorption coefficients at 325 nm and qualitative (spectral slopes optical parameters in the inlet waters, within the tanks, and in their corresponding effluents. To confirm the time-series results, we also performed three experiments. Each experiment consisted of two treatments: +holothurians (+H and –holothurians (−H. We set up three +H tanks with 80 individuals of A. sulcata and 10 individuals of H. tubulosa in each tank and four –H tanks that contained only 80 individuals of A. sulcata. Results In the time-series, absorption coefficients at 325 nm (a325 and spectral slopes from 275 to 295 nm (S275−295 were significantly lower in the effluent of the +holothurian tank (average: 0.33 m−1 and 16 µm−1, respectively than in the effluent of the −holothurian tank (average: 0.69 m−1 and 34 µm−1, respectively, the former

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Chromophore dynamics in the PYP photocycle from femtosecond stimulated Raman spectroscopy.

Science.gov (United States)

Creelman, Mark; Kumauchi, Masato; Hoff, Wouter D; Mathies, Richard A

2014-01-23

Femtosecond stimulated Raman spectroscopy (FSRS) is used to examine the structural dynamics of the para-hydroxycinnamic acid (HCA) chromophore during the first 300 ps of the photoactive yellow protein (PYP) photocycle, as the system transitions from its vertically excited state to the early ground state cis intermediate, I0. A downshift in both the C7═C8 and C1═O stretches upon photoexcitation reveals that the chromophore has shifted to an increasingly quinonic form in the excited state, indicating a charge shift from the phenolate moiety toward the C9═O carbonyl, which continues to increase for 170 fs. In addition, there is a downshift in the C9═O carbonyl out-of-plane vibration on an 800 fs time scale as PYP transitions from its excited state to I0, indicating that weakening of the hydrogen bond with Cys69 and out-of-plane rotation of the C9═O carbonyl are key steps leading to photoproduct formation. HOOP intensity increases on a 3 ps time scale during the formation of I0, signifying distortion about the C7═C8 bond. Once on the I0 surface, the C7═C8 and C1═O stretches blue shift, indicating recovery of charge to the phenolate, while persistent intensity in the HOOP and carbonyl out-of-plane modes reveal HCA to be a cissoid structure with significant distortion about the C7═C8 bond and of C9═O out of the molecular plane.

The Major Chromophore Arising from Glucose Degradation and Oxidative Stress Occurrence during Lens Proteins Glycation Induced by Glucose

Directory of Open Access Journals (Sweden)

Felipe Ávila

2017-12-01

Full Text Available Glucose autoxidation has been proposed as a key reaction associated with deleterious effects induced by hyperglycemia in the eye lens. Little is known about chromophores generated during glucose autoxidation. In this study, we analyzed the effect of oxidative and dicarbonyl stress in the generation of a major chromophore arising from glucose degradation (GDC and its association with oxidative damage in lens proteins. Glucose (5 mM was incubated with H2O2 (0.5–5 mM, Cu2+ (5–50 μM, glyoxal (0.5–5 mM or methylglyoxal (0.5–5 mM at pH 7.4, 5% O2, 37 °C, from 0 to 30 days. GDC concentration increased with incubation time, as well as when incubated in the presence of H2O2 and/or Cu2+, which were effective even at the lowest concentrations. Dicarbonylic compounds did not increase the levels of GDC during incubations. 1H, 13C and FT-IR spectra from the purified fraction containing the chromophore (detected by UV/vis spectroscopy showed oxidation products of glucose, including gluconic acid. Lens proteins solutions (10 mg/mL incubated with glucose (30 mM presented increased levels of carboxymethyl-lysine and hydrogen peroxide that were associated with GDC increase. Our results suggest a possible use of GDC as a marker of autoxidative reactions occurring during lens proteins glycation induced by glucose.

Electrospun Nanofibers from a Tricyanofuran-Based Molecular Switch for Colorimetric Recognition of Ammonia Gas.

Science.gov (United States)

Khattab, Tawfik A; Abdelmoez, Sherif; Klapötke, Thomas M

2016-03-14

A chromophore based on tricyanofuran (TCF) with a hydrazone (H) recognition moiety was developed. Its molecular-switching performance is reversible and has differential sensitivity towards aqueous ammonia at comparable concentrations. Nanofibers were fabricated from the TCF-H chromophore by electrospinning. The film fabricated from these nanofibers functions as a solid-state optical chemosensor for probing ammonia vapor. Recognition of ammonia vapor occurs by proton transfer from the hydrazone fragment of the chromophore to the ammonia nitrogen atom and is facilitated by the strongly electron withdrawing TCF fragment. The TCF-H chromophore was added to a solution of poly(acrylic acid), which was electrospun to obtain a nanofibrous sensor device. The morphology of the nanofibrous sensor was determined by SEM, which showed that nanofibers with a diameter range of 200-450 nm formed a nonwoven mat. The resultant nanofibrous sensor showed very good sensitivity in ammonia-vapor detection. Furthermore, very good reversibility and short response time were also observed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MOJIBAKE – The Rehearsal of Word Fragments In Verbal Recall

Directory of Open Access Journals (Sweden)

Dr. Christiane eLange-Küttner

2015-04-01

Full Text Available Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the ‘grain size’ of word units (Ziegler & Goswami, 2005. In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF English words versus geographical UK town names to control for content. We also tested unfamiliar international (INT non-words and names of international (INT European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words.

Mojibake – The rehearsal of word fragments in verbal recall

Science.gov (United States)

Lange-Küttner, Christiane; Sykorova, Eva

2015-01-01

Theories of verbal rehearsal usually assume that whole words are being rehearsed. However, words consist of letter sequences, or syllables, or word onset-vowel-coda, amongst many other conceptualizations of word structure. A more general term is the ‘grain size’ of word units (Ziegler and Goswami, 2005). In the current study, a new method measured the quantitative percentage of correctly remembered word structure. The amount of letters in the correct letter sequence as per cent of word length was calculated, disregarding missing or added letters. A forced rehearsal was tested by repeating each memory list four times. We tested low frequency (LF) English words versus geographical (UK) town names to control for content. We also tested unfamiliar international (INT) non-words and names of international (INT) European towns to control for familiarity. An immediate versus distributed repetition was tested with a between-subject design. Participants responded with word fragments in their written recall especially when they had to remember unfamiliar words. While memory of whole words was sensitive to content, presentation distribution and individual sex and language differences, recall of word fragments was not. There was no trade-off between memory of word fragments with whole word recall during the repetition, instead also word fragments significantly increased. Moreover, while whole word responses correlated with each other during repetition, and word fragment responses correlated with each other during repetition, these two types of word recall responses were not correlated with each other. Thus there may be a lower layer consisting of free, sparse word fragments and an upper layer that consists of language-specific, orthographically and semantically constrained words. PMID:25941500

Biogeneration of chromophoric dissolved organic matter by bacteria and krill in the southern ocean

OpenAIRE

Ortega-Retuerta, E.; Frazer, Thomas K.; Duarte, Carlos M.; Ruiz-Halpern, Sergio; Tovar-Sánchez, Antonio; Arrieta López de Uralde, Jesús M.; Reche, Isabel

2009-01-01

Chromophoric dissolved organic matter (CDOM), the optically active fraction of dissolved organic matter, is primarily generated by pelagic organisms in the open ocean. In this study, we experimentally determined the quantity and spectral quality of CDOM generated by bacterioplankton using two different substrates (with and without photoproducts) and by Antarctic krill Euphausia superba and evaluated their potential contributions to CDOM dynamics in the peninsular region of the Southern Ocean....

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

The biokinetics of uranium migrating from embedded DU fragments

International Nuclear Information System (INIS)

Leggett, R.W.; Pellmar, T.C.

2003-01-01

Military uses of depleted uranium (DU) munitions have resulted in casualties with embedded DU fragments. Assessment of radiological or chemical health risks from these fragments requires a model relating urinary U to the rate of migration of U from the fragments, and its accumulation in systemic tissues. A detailed biokinetic model for U has been published by the International Commission on Radiological Protection (ICRP), but its applicability to U migrating from embedded DU fragments is uncertain. Recently, ) conducted a study at the Armed Forces Radiobiology Research Institute (AFRRI) on the redistribution and toxicology of U in rats with implanted DU pellets, simulating embedded fragments. This paper compares the biokinetic data from that study with the behavior of commonly studied forms of U in rats (e.g., intravenously injected U nitrate). The comparisons indicate that the biokinetics of U migrating from embedded DU is similar to that of commonly studied forms of U with regard to long-term accumulation in kidneys, bone, and liver. The results provide limited support for the application of the ICRP's model to persons with embedded DU fragments. Additional information is needed with regard to the short-term behavior of migrating U and its accumulation in lymph nodes, brain, testicles, and other infrequently studied U repositories

Fragmentation of molecular ions in slow electron collisions

International Nuclear Information System (INIS)

Novotny, Steffen

2008-01-01

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD + the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2 nd order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H 2 + produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

Fragmentation of molecular ions in slow electron collisions

Energy Technology Data Exchange (ETDEWEB)

Novotny, Steffen

2008-06-25

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD{sup +} the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2{sup nd} order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H{sub 2}{sup +} produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

Directory of Open Access Journals (Sweden)

Caldeira Roberta L

2000-01-01

Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

Winter to spring variations of chromophoric dissolved organic matter in a temperate estuary (Po River, northern Adriatic Sea).

Science.gov (United States)

Berto, D; Giani, M; Savelli, F; Centanni, E; Ferrari, C R; Pavoni, B

2010-07-01

The light absorbing fraction of dissolved organic carbon (DOC), known as chromophoric dissolved organic matter (CDOM) showed wide seasonal variations in the temperate estuarine zone in front of the Po River mouth. DOC concentrations increased from winter through spring mainly as a seasonal response to increasing phytoplankton production and thermohaline stratification. The monthly dependence of the CDOM light absorption by salinity and chlorophyll a concentrations was explored. In 2003, neither DOC nor CDOM were linearly correlated with salinity, due to an exceptionally low Po river inflow. Though the CDOM absorbance coefficients showed a higher content of chromophoric dissolved organic matter in 2004 with respect to 2003, the spectroscopic features confirmed that the qualitative nature of CDOM was quite similar in both years. CDOM and DOC underwent a conservative mixing, only after relevant Po river freshets, and a change in optical features with an increase of the specific absorption coefficient was observed, suggesting a prevailing terrestrial origin of dissolved organic matter. Published by Elsevier Ltd.

Dynamic Failure and Fragmentation of a Hot-Pressed Boron Carbide

Science.gov (United States)

Sano, Tomoko; Vargas-Gonzalez, Lionel; LaSalvia, Jerry; Hogan, James David

2017-12-01

This study investigates the failure and fragmentation of a hot-pressed boron carbide during high rate impact experiments. Four impact experiments are performed using a composite-backed target configuration at similar velocities, where two of the impact experiments resulted in complete target penetration and two resulted in partial penetration. This paper seeks to evaluate and understand the dynamic behavior of the ceramic that led to either the complete or partial penetration cases, focusing on: (1) surface and internal failure features of fragments using optical, scanning electron, and transmission electron microscopy, and (2) fragment size analysis using state-of-the-art particle-sizing technology that informs about the consequences of failure. Detailed characterization of the mechanical properties and the microstructure is also performed. Results indicate that transgranular fracture was the primary mode of failure in this boron carbide material, and no stress-induced amorphization features were observed. Analysis of the fragment sizes for the partial and completely penetrated experiments revealed a possible correlation between larger fragment sizes and impact performance. The results will add insight into designing improved advanced ceramics for impact protection applications.

Fragmentation of deuteronated aromatic derivatives: The role of ion-neutral complexes

Science.gov (United States)

Harrison, Alex G.; Wang, Jian-Yao

1997-01-01

The low-energy collision-induced dissociation reactions of the MD+ ions of a number of alkyl phenyl ethers, alkylbenzenes, acetophenones and benzaldehyde have been studied as a function of collision energy to establish qualitatively the dependence of the fragmentation reactions observed on internal energy. Deuteronated alkyl phenyl ethers (ROC6H5·D+, R = C3H7, C4H9) fragment at low collision energies to form C6H5OHD+ + (R-H), the thermochemically favoured products; with increasing collision energy (and, hence, internal energy) formation of the alkyl ion R+ increases significantly in importance. Deuteronated alkylbenzenes (RC6H5, RC6H4R', R = C2H5, C3H7) similarly form the deuteronated benzene (the thermochemically favoured product) at low collision energies with formation of the alkyl ion R+ being observed at higher collision energies. The results for both systems are consistent with a fragmentation mechanism involving initial formation of an R+/aromatic ion/neutral complex. At low internal energies proton transfer occurs within this complex to form an ion/neutral complex consisting of the deuteronated aromatic and a neutral olefin; this complex fragments to the thermochemically favoured products. Since the transition state leading to these products is a "tight" transition state involving loss of rotational degrees of freedom, the proton transfer reaction is unfavourable entropically with respect to simple dissociation of the R+/aromatic complex to R+ + ArD. Consequently, these products increase in importance as the internal energy is increased. The fragmentation of deuteronated aromatic carbonyl compounds can also be rationalized by similar mechanisms involving the intermediacy of ion/neutral complexes. Deuteronated acetophenone forms only CH3CO+ at all collision energies; this is both the thermochemically and entropically favoured product. However, deuteronated p-aminoacetophenone forms deuteronated aniline, the thermochemically favoured product at low collision

Fragmented International Governance of Arctic Offshore Oil : Governance Challenges and Institutional Improvement

NARCIS (Netherlands)

Humrich, Christoph

The governance architecture in the Arctic region is subject to broad public and academic debate. Existing governance arrangements are not considered sufficient to minimize risks and impacts from Arctic offshore oil activities. These governance arrangements are fragmented between law of the sea

Dimeric fluorescent energy transfer dyes comprising asymmetric cyanine azole-indolenine chromophores

Science.gov (United States)

Glazer, Alexander N.; Benson, Scott C.

1998-01-01

Novel fluorescent heterodimeric DNA-staining energy transfer dyes are provided combining asymmetric cyanine azole-indolenine dyes, which provide for strong DNA affinity, large Stokes shifts and emission in the red region of the spectrum. The dyes find particular application in gel electrophoresis and for labels which may be bound to a variety of compositions in a variety of contexts. Kits and individual compounds are provided, where the kits find use for simultaneous detection of a variety of moieties, particularly using a single narrow wavelength irradiation source. The individual compounds are characterized by high donor quenching and high affinity to dsDNA as a result of optimizing the length of the linking group separating the two chromophores.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Benzimidazole acrylonitriles as multifunctional push-pull chromophores: Spectral characterisation, protonation equilibria and nanoaggregation in aqueous solutions

Science.gov (United States)

Horak, Ema; Vianello, Robert; Hranjec, Marijana; Krištafor, Svjetlana; Zamola, Grace Karminski; Steinberg, Ivana Murković

2017-05-01

Heterocyclic donor-π-acceptor molecular systems based on an N,N-dimethylamino phenylacrylonitrile benzimidazole skeleton have been characterised and are proposed for potential use in sensing applications. The benzimidazole moiety introduces a broad spectrum of useful multifunctional properties to the system including electron accepting ability, pH sensitivity and compatibility with biomolecules. The photophysical characterisation of the prototropic forms of these chromophores has been carried out in both solution and on immobilisation in polymer films. The experimental results are further supported by computational determination of pKa values. It is noticed that compound 3 forms nanoaggregates in aqueous solutions with aggregation-induced emission (AIE) at 600 nm. All the systems demonstrate spectral pH sensitivity in acidic media which shifts towards near-neutral values upon immobilisation in polymer films or upon aggregation in an aqueous environment (compound 3). The structure-property relationships of these functional chromophores, involving their spectral characteristics, acid-base equilibria, pKa values and aggregation effects have been determined. Potential applications of the molecules as pH and biomolecular sensors are proposed based on their pH sensitivity and AIE properties.

Chromophoric dissolved organic matter in experimental mesocosms maintained under different pCO2 levels

OpenAIRE

Rochelle-Newall, E.; Delille, B.; Frankignoulle, M.; Gattuso, J.-P.; Jacquet, S.; Riebesell, Ulf; Terbrüggen, A.; Zondervan, I.

2004-01-01

Chromophoric dissolved organic matter (CDOM) represents the optically active fraction of the bulk dissolved organic matter (DOM) pool. Recent evidence pointed towards a microbial source of CDOM in the aquatic environment and led to the proposal that phytoplankton is not a direct source of CDOM, but that heterotrophic bacteria, through reprocessing of DOM of algal origin, are an important source of CDOM. In a recent experiment designed at looking at the effects of elevated pCO2 on blooms of th...

Effect of intercalation and chromophore arrangement on the linear and nonlinear optical properties of model aminopyridine push–pull molecules

Czech Academy of Sciences Publication Activity Database

Bureš, F.; Cvejn, D.; Melánová, Klára; Beneš, L.; Svoboda, Jan; Zima, Vítězslav; Pytela, O.; Mikysek, T.; Růžičková, Z.; Kityk, I. V.; Wojciechowski, A.; AlZayed, N.

2016-01-01

Roč. 4, č. 3 (2016), s. 468-478 ISSN 2050-7526 R&D Projects: GA ČR(CZ) GA13-01061S Institutional support: RVO:61389013 Keywords : push-pull chromophore * intercalation * layered phosphates Subject RIV: CA - Inorganic Chemistry Impact factor: 5.256, year: 2016

Quantitative spatially resolved measurement of tissue chromophore concentrations using photoacoustic spectroscopy: application to the measurement of blood oxygenation and haemoglobin concentration

Science.gov (United States)

Laufer, Jan; Delpy, Dave; Elwell, Clare; Beard, Paul

2007-01-01

A new approach based on pulsed photoacoustic spectroscopy for non-invasively quantifying tissue chromophore concentrations with high spatial resolution has been developed. The technique is applicable to the quantification of tissue chromophores such as oxyhaemoglobin (HbO2) and deoxyhaemoglobin (HHb) for the measurement of physiological parameters such as blood oxygen saturation (SO2) and total haemoglobin concentration. It can also be used to quantify the local accumulation of targeted contrast agents used in photoacoustic molecular imaging. The technique employs a model-based inversion scheme to recover the chromophore concentrations from photoacoustic measurements. This comprises a numerical forward model of the detected time-dependent photoacoustic signal that incorporates a multiwavelength diffusion-based finite element light propagation model to describe the light transport and a time-domain acoustic model to describe the generation, propagation and detection of the photoacoustic wave. The forward model is then inverted by iteratively fitting it to measurements of photoacoustic signals acquired at different wavelengths to recover the chromophore concentrations. To validate this approach, photoacoustic signals were generated in a tissue phantom using nanosecond laser pulses between 740 nm and 1040 nm. The tissue phantom comprised a suspension of intralipid, blood and a near-infrared dye in which three tubes were immersed. Blood at physiological haemoglobin concentrations and oxygen saturation levels ranging from 2% to 100% was circulated through the tubes. The signal amplitude from different temporal sections of the detected photoacoustic waveforms was plotted as a function of wavelength and the forward model fitted to these data to recover the concentrations of HbO2 and HHb, total haemoglobin concentration and SO2. The performance was found to compare favourably to that of a laboratory CO-oximeter with measurement resolutions of ±3.8 g l-1 (±58 µM) and ±4

Quantitative spatially resolved measurement of tissue chromophore concentrations using photoacoustic spectroscopy: application to the measurement of blood oxygenation and haemoglobin concentration

Energy Technology Data Exchange (ETDEWEB)

Laufer, Jan; Delpy, Dave; Elwell, Clare; Beard, Paul [Department of Medical Physics and Bioengineering, University College London, Malet Place Engineering Building, London WC1E 6BT (United Kingdom)

2007-01-07

A new approach based on pulsed photoacoustic spectroscopy for non-invasively quantifying tissue chromophore concentrations with high spatial resolution has been developed. The technique is applicable to the quantification of tissue chromophores such as oxyhaemoglobin (HbO{sub 2}) and deoxyhaemoglobin (HHb) for the measurement of physiological parameters such as blood oxygen saturation (SO{sub 2}) and total haemoglobin concentration. It can also be used to quantify the local accumulation of targeted contrast agents used in photoacoustic molecular imaging. The technique employs a model-based inversion scheme to recover the chromophore concentrations from photoacoustic measurements. This comprises a numerical forward model of the detected time-dependent photoacoustic signal that incorporates a multiwavelength diffusion-based finite element light propagation model to describe the light transport and a time-domain acoustic model to describe the generation, propagation and detection of the photoacoustic wave. The forward model is then inverted by iteratively fitting it to measurements of photoacoustic signals acquired at different wavelengths to recover the chromophore concentrations. To validate this approach, photoacoustic signals were generated in a tissue phantom using nanosecond laser pulses between 740 nm and 1040 nm. The tissue phantom comprised a suspension of intralipid, blood and a near-infrared dye in which three tubes were immersed. Blood at physiological haemoglobin concentrations and oxygen saturation levels ranging from 2% to 100% was circulated through the tubes. The signal amplitude from different temporal sections of the detected photoacoustic waveforms was plotted as a function of wavelength and the forward model fitted to these data to recover the concentrations of HbO{sub 2} and HHb, total haemoglobin concentration and SO{sub 2}. The performance was found to compare favourably to that of a laboratory CO-oximeter with measurement resolutions of {+-}3

Quantitative spatially resolved measurement of tissue chromophore concentrations using photoacoustic spectroscopy: application to the measurement of blood oxygenation and haemoglobin concentration

International Nuclear Information System (INIS)

Laufer, Jan; Delpy, Dave; Elwell, Clare; Beard, Paul

2007-01-01

A new approach based on pulsed photoacoustic spectroscopy for non-invasively quantifying tissue chromophore concentrations with high spatial resolution has been developed. The technique is applicable to the quantification of tissue chromophores such as oxyhaemoglobin (HbO 2 ) and deoxyhaemoglobin (HHb) for the measurement of physiological parameters such as blood oxygen saturation (SO 2 ) and total haemoglobin concentration. It can also be used to quantify the local accumulation of targeted contrast agents used in photoacoustic molecular imaging. The technique employs a model-based inversion scheme to recover the chromophore concentrations from photoacoustic measurements. This comprises a numerical forward model of the detected time-dependent photoacoustic signal that incorporates a multiwavelength diffusion-based finite element light propagation model to describe the light transport and a time-domain acoustic model to describe the generation, propagation and detection of the photoacoustic wave. The forward model is then inverted by iteratively fitting it to measurements of photoacoustic signals acquired at different wavelengths to recover the chromophore concentrations. To validate this approach, photoacoustic signals were generated in a tissue phantom using nanosecond laser pulses between 740 nm and 1040 nm. The tissue phantom comprised a suspension of intralipid, blood and a near-infrared dye in which three tubes were immersed. Blood at physiological haemoglobin concentrations and oxygen saturation levels ranging from 2% to 100% was circulated through the tubes. The signal amplitude from different temporal sections of the detected photoacoustic waveforms was plotted as a function of wavelength and the forward model fitted to these data to recover the concentrations of HbO 2 and HHb, total haemoglobin concentration and SO 2 . The performance was found to compare favourably to that of a laboratory CO-oximeter with measurement resolutions of ±3.8 g l -1 (±58 �

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

International provision of trade services, trade, and fragmentation

OpenAIRE

Deardorff, Alan V.

2001-01-01

The author examines the special role that trade liberalization in services industries can play in stimulating trade in both services, and goods. International trade in goods requires inputs from such trade services as transportation, insurance, and finance, for example. Restrictions on services across borders, and within foreign countries add costs, and barriers to international trade. Lib...

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Magma Expansion and Fragmentation in a Propagating Dike (Invited)

Science.gov (United States)

Jaupart, C. P.; Taisne, B.

2010-12-01

The influence of magma expansion due to volatile exsolution and gas dilation on dike propagation is studied using a new numerical code. Many natural magmas contain sufficient amounts of volatiles for fragmentation to occur well below Earth's surface. Magma fragmentation has been studied for volcanic flows through open conduits but it should also occur within dikes that rise towards Earth's surface. We consider the flow of a volatile-rich magma in a hydraulic fracture. The mixture of melt and gas is treated as a compressible viscous fluid below the fragmentation level and as a gas phase carrying melt droplets above it. A numerical code solves for elastic deformation of host rocks, the flow of the magmatic mixture and fracturing at the dike tip. With volatile-free magma, a dike fed at a constant rate in a uniform medium adopts a constant shape and width and rises at a constant velocity. With volatiles involved, magma expands and hence the volume flux of magma increases. With no fragmentation, this enhanced flux leads to acceleration of the dike. Simple scaling laws allow accurate predictions of dike width and ascent rate for a wide range of conditions. With fragmentation, dike behavior is markedly different. Due to the sharp drop of head loss that occurs in gas-rich fragmented material, large internal overpressures develop below the tip and induce swelling of the nose region, leading to deceleration of the dike. Thus, the paradoxical result is that, with no viscous impediment on magma flow and a large buoyancy force, the dike stalls. This process may account for some of the tuffisite veins and intrusions that are found in and around magma conduits, notably in the Unzen drillhole, Japan. We apply these results to the two-month long period of volcanic unrest that preceded the May 1980 eruption of Mount St Helens. An initial phase of rapid earthquake migration from the 7-8 km deep reservoir to shallow levels was followed by very slow progression of magma within the

New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

Science.gov (United States)

Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

1999-10-01

In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy

International Nuclear Information System (INIS)

Agodi, C; Bondì, M; Cavallaro, M; Carbone, D; Cirrone, G A P; Cuttone, G; Abou-Haidar, Z; Alvarez, M A G; Bocci, A; Aumann, T; Durante, M; Balestra, F; Battistoni, G; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cappuzzello, F; Cortes-Giraldo, M A; Napoli, M De

2013-01-01

Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8 mm) carbon target.

FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy

Science.gov (United States)

Agodi, C.; Abou-Haidar, Z.; Alvarez, M. A. G.; Aumann, T.; Balestra, F.; Battistoni, G.; Bocci, A.; Bohlen, T. T.; Bondì, M.; Boudard, A.; Brunetti, A.; Carpinelli, M.; Cappuzzello, F.; Cavallaro, M.; Carbone, D.; Cirrone, G. A. P.; Cortes-Giraldo, M. A.; Cuttone, G.; De Napoli, M.; Durante, M.; Fernandez-Garcia, J. P.; Finck, C.; Foti, A.; Gallardo, M. I.; Golosio, B.; Iarocci, E.; Iazzi, F.; Ickert, G.; Introzzi, R.; Juliani, D.; Krimmer, J.; Kurz, N.; Labalme, M.; Lavagno, A.; Leifels, Y.; Le Fevre, A.; Leray, S.; Marchetto, F.; Monaco, V.; Morone, M. C.; Nicolosi, D.; Oliva, P.; Paoloni, A.; Patera, V.; Piersanti, L.; Pleskac, R.; Quesada, J. M.; Randazzo, N.; Romano, F.; Rossi, D.; Rosso, V.; Rousseau, M.; Sacchi, R.; Sala, P.; Sarti, A.; Scheidenberger, C.; Schuy, C.; Sciubba, A.; Sfienti, C.; Simon, H.; Sipala, V.; Spiriti, E.; Stuttge, L.; Tropea, S.; Younis, H.

2013-03-01

Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8mm) carbon target.

Phosphorescence parameters for platinum (II) organometallic chromophores: A study at the non-collinear four-component Kohn–Sham level of theory

DEFF Research Database (Denmark)

Norman, Patrick; Jensen, Hans Jørgen Aagaard

2012-01-01

A theoretical characterization of the phosphorescence decay traces of a prototypical platinum (II) organic chromophore has been conducted. The phosphorescence wavelength and radiative lifetime are predicted to equal 544 nm and 160 μs, respectively. The third triplet state is assigned as participa...

Nonlinear transient responses of beams and rings to impulse loading or fragment impact

International Nuclear Information System (INIS)

Witmer, E.A.; Stagliano, T.R.; Rodal, J.J.A.

1977-01-01

Nuclear power plant protective structures may be subjected to various external missiles such as aircraft and tornado-generated missiles: telephone poles, planks, pipes, rods, automobiles, and other blown vehicles. Also, 'internally-generated missiles' such as fragments from powerplant rotors and aircraft engine rotors may impact protective structures. The present paper is concerned with a very limited part of the cited fragment threat; namely, fragments from high speed rotating machinery such as (1) aircraft engine rotors and (2) stationary power plant turbine rotors. Further, it is assumed that the structures intended to contain or control these fragments consist of initially-isotopic elastic-plastic metals. Certain potential containment/control (C/C) structures behave in a planar (or two-dimensional) fashion while other fragment-attacked C/C structures will undergo general three-dimensional deformations. Predictions for only the former category of fragment-attacked structures are discussed in the present paper. Pertinent experimental data discussed on fragment-attacked structures include (a) steel-sphere impact data involving beam targets and (b) engine rotor fragment impact against a steel containment ring. In all of these cases large-deflection, elastic-plastic transient structural responses occur. (Auth.)

Gamma ray induced chromophore modification of softwood thermomechanical pulp

International Nuclear Information System (INIS)

Robert, S.; Daneault, C.; Viel, C.; Lepine, F.

1992-01-01

This study focuses on bleaching a softwood (black spruce, balsam fur) thermomechanical pulp with gamma rays. Gamma rays are known for their enormous penetrating power, along with their ionizing properties. They can generate highly energetic radicals capable of oxidizing lignin chromophores. The authors studied the influence of isopropyl alcohol, sodium borohydride, oxygen, hydrogen peroxide, nitrogen dioxide and water along with gamma ray irradiation of the pulps. The authors measured the optimal dose and dose rate, along with the influence of the radical scavengers like oxygen on the bleaching effect of gamma irradiated pulps. They observe various degrees of bleaching of these pulps. Evidence relates this bleaching to the generation of perhydroxyl anions upon irradiation of water. Also, they were able to pinpoint the influence of the dose rate on the rate of formation and disappearance of these perhydroxyl anions and their influence on bleaching kinetics. Stability toward photoyellowing, and photoyellowing's kinetic of papers from these pulps was also studied

Spatiotemporal Characterization of Chromophoric Dissolved Organic Matter (CDOM) and CDOM-DOC Relationships for Highly Polluted Rivers

OpenAIRE

Sijia Li; Jiquan Zhang; Guangyi Mu; Hanyu Ju; Rui Wang; Danjun Li; Ali Hassan Shabbir

2016-01-01

Spectral characteristics of CDOM (Chromophoric dissolved organic matter) in water columns are a key parameter for bio-optical modeling. Knowledge of CDOM optical properties and spatial discrepancy based on the relationship between water quality and spectral parameters in the Yinma River watershed with in situ data collected from highly polluted waters are exhibited in this study. Based on the comprehensive index method, the riverine waters showed serious contamination; especially the chemical...

Second harmonic generation and photochromic grating in polyurethane films containing diazo isoxazole chromophore

Science.gov (United States)

Marański, Krzysztof; Kucharski, Stanisław; Ortyl, Ewelina; Nunzi, Jean-Michel; Ahmadi-Kandjani, Sohrab; Dabos-Seignon, Sylvie; Chan, Siu-Wai; Barille, Regis

2008-08-01

The chromophoric intermediate: 2,2'-({4-[( E)-(5-methylisoxazol-3-yl)diazenyl]phenyl}-imino)diethanol was used in polyaddition reaction with di-isocyanate to obtain a new polyurethane polymeric material showing nonlinear optical and photochromic properties. The maximum absorption band of the polymer film was at 418 nm. The illumination of the film with crossed beams of the 488 nm Ar + laser yielded surface relief grating of regular structure. Measurement of the frequency doubling signal with 1064 nm laser indicated the polymer as interesting material for photooptical applications. The measured nonlinear optical coefficient, d33, reached 90.2 pm/V.

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Wide-range tuning of polymer microring resonators by the photobleaching of CLD-1 chromophores

Science.gov (United States)

Poon, Joyce K. S.; Huang, Yanyi; Paloczi, George T.; Yariv, Amnon; Zhang, Cheng; Dalton, Larry R.

2004-11-01

We present a simple and effective method for the postfabrication trimming of optical microresonators. We photobleach CLD-1 chromophores to tune the resonance wavelengths of polymer microring resonator optical notch filters. A maximum wavelength shift of -8.73 nm is observed. The resonators are fabricated with a soft-lithography molding technique and have an intrinsic Q value of 2.6×10^4 and a finesse of 9.3. The maximum extinction ratio of the resonator filters is -34 dB, indicating that the critical coupling condition has been satisfied.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Ferrocene-quinoxaline Y-shaped chromophores as fascinating second-order NLO building blocks for long lasting highly active SHG polymeric films.

Science.gov (United States)

Senthilkumar, Kabali; Thirumoorthy, Krishnan; Dragonetti, Claudia; Marinotto, Daniele; Righetto, Stefania; Colombo, Alessia; Haukka, Matti; Palanisami, Nallasamy

2016-07-26

The first example of a Y-shaped ferrocene quinoxaline derivative with a surprisingly high and stable second harmonic generation (SHG) response in composite polymeric films is reported. The interesting quadratic hyperpolarizability values of different substituted Y-shaped chromophores are also investigated in solution by the EFISH technique.

A Bragg curve counter with an internal production target for the measurement of the double-differential cross-section of fragment production induced by neutrons at energies of tens of MeV

International Nuclear Information System (INIS)

Sanami, T.; Hagiwara, M.; Oishi, T.; Hosokawa, M.; Kamada, S.; Tanaka, Su.; Iwamoto, Y.; Nakashima, H.; Baba, M.

2009-01-01

A Bragg curve counter equipped with an internal production target was developed for the measurements of double-differential cross-sections of fragment production induced by neutrons at energies of tens of MeV. The internal target permitted a large detection solid angle and thus the registration of processes at low production rates. In this specific geometry, the detection solid angle depends on the emission angle and the range of the particle. Therefore the energy, atomic number, and angle of trajectory of the particle have to be taken into account for the determination of the solid angle. For the selection of events with tracks confined within a defined cylindrical volume around the detector axis, a segmented anode was applied. The double-differential cross-sections for neutron-induced production of lithium, beryllium, and boron fragments from a carbon target were measured at 0 deg. for 65 MeV neutrons. The results are in good agreement with theoretical calculation using PHITS code with GEM and ISOBAR model.

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Characteristics and sources of chromophoric dissolved organic matter in lakes of the Yungui Plateau, China, differing in trophic state and altitude

NARCIS (Netherlands)

Zhang, Y.; Zhang, E.; Yin, Y.; Van Dijk, M.A.; Feng, L.; Shi, Z.; Liu, M.; Qina, B.

2010-01-01

The high-mountain lakes on the Yungui Plateau in China are exposed to high-intensity ultraviolet radiation, and contain low concentrations of chromophoric dissolved organic matter (CDOM). We determined CDOM absorption, fluorescence, composition, and source in 38 lakes on the Yungui Plateau at

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Symmetry Breaking in Platinum Acetylide Chromophores Studied by Femtosecond Two-Photon Absorption Spectroscopy

Science.gov (United States)

2014-02-01

used hyper- Raman and hyper-Rayleigh scattering to show that in some nominally centrosymmetric metal- free chromophores the inversion symmetry could be...67 618 320 1300 654 1300 NH2 742 18 53 590 30 160 782 93 51 602 160 650 644 420 OCH3 722 16 16 560 57 120 774 57 66 604 190 660 646 300 t-butyl 714...420 644 220 F 706 5.9 1.6 560 85 85 772 53 89 600 60 340 644 170 CF3 714 6.4 22 586 31 110 792 120 210 602 87 440 650 250 CN 732 29 28 590 32 120 814

The importance of nuclear quantum effects in spectral line broadening of optical spectra and electrostatic properties in aromatic chromophores

Science.gov (United States)

Law, Y. K.; Hassanali, A. A.

2018-03-01

In this work, we examine the importance of nuclear quantum effects on capturing the line broadening and vibronic structure of optical spectra. We determine the absorption spectra of three aromatic molecules indole, pyridine, and benzene using time dependent density functional theory with several molecular dynamics sampling protocols: force-field based empirical potentials, ab initio simulations, and finally path-integrals for the inclusion of nuclear quantum effects. We show that the absorption spectrum for all these chromophores are similarly broadened in the presence of nuclear quantum effects regardless of the presence of hydrogen bond donor or acceptor groups. We also show that simulations incorporating nuclear quantum effects are able to reproduce the heterogeneous broadening of the absorption spectra even with empirical force fields. The spectral broadening associated with nuclear quantum effects can be accounted for by the broadened distribution of chromophore size as revealed by a particle in the box model. We also highlight the role that nuclear quantum effects have on the underlying electronic structure of aromatic molecules as probed by various electrostatic properties.

[Photodegradation of chromophoric dissolved organic matter from Jiulong River Estuary under natural solar radiation].

Science.gov (United States)

Guo, Wei-dong; Cheng, Yuan-yue

2008-06-01

Low salinity water sample collected from Jiulong River Estuary filtered using 0.2 microm Millipore filter was exposed to natural solar radiation from 10:00 to 16:00 each day during one week period in early and late May, 2005. Photodegradation of fluorescence and absorption properties of CDOM (chromophoric dissolved organic matter) was observed. The results showed that humic-like fluorescence (lambda Ex/lambda Em = 350/450 nm), tryptophan-like fluorescence (lambda Ex/lambda Em = 225/350 nm) and absorption coefficient of CDOM can be significantly photodegraded during short-term solar exposure in early summer. These photodegradation processes followed the first-order dynamic equation. The degradation half time of humic-like fluorescence, tryptophan-like fluorescence and a (280) were calculated as 3.5-5.1 d, 3.0-4.5 d and 6.3 d. The absorption loss spectra of CDOM indicated that the solar UV radiation was responsible for the photochemical degradation of CDOM. The loss of humic-like fluorescence (70%) was obviously higher than loss of a (280) (about 40%), suggesting that photobleaching ability of CDOM fluorophores were much stronger than CDOM chromophores. However, the correlation relationship between humic-like fluorescence and absorption coefficient are still kept. A250/A350 of CDOM increased till the end of radiation experiment compared with the control group, suggesting photodegradation may decrease the average molecular size of CDOM. These findings show that terrestrial CDOM can be transformed and removed by photochemical decomposition after transport into the sea, and photodegradation might be an important sink for terrestrial CDOM.

Fragmentation of acetic acid ions with selected internal energies

Science.gov (United States)

Zha, Qingmei; Nishimura, Toshihide; Bertrand, Michel J.; Meisels, G. G.

1991-08-01

The unimolecular dissociation of acetic acid ion in the photon energy range 10.5-17.0 eV was studied using threshold photoelectron photoion coincidence mass spectrometry. The detailed breakdown graph was obtained and the fragmentation pathways were elucidated. The breakdown graph calculated using statistical theories was found to be consistent with the experimental data up to a photon energy of about 12.5 eV. The average kinetic energy release observed is higher than that calculated on the basis of quasi-equilibrium theory for the formation of COOH+ while it seems to be statistical for the formation of CH3CO+. The origin of kinetic energy release accompanying the formation of these two ions is discussed. The structure of [COH3]+ ion (m/z 31) is determined to be hydroxymethyl cation, CH2OH+, which could be formed by a two-step rearrangement prior to dissociation.

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

Chromophoric dissolved organic matter export from U.S. rivers

Science.gov (United States)

Spencer, Robert G. M.; Aiken, George R.; Dornblaser, Mark M.; Butler, Kenna D.; Holmes, R. Max; Fiske, Greg; Mann, Paul J.; Stubbins, Aron

2013-04-01

Chromophoric dissolved organic matter (CDOM) fluxes and yields from 15 major U.S. rivers draining an assortment of terrestrial biomes are presented. A robust relationship between CDOM and dissolved organic carbon (DOC) loads is established (e.g., a350 versus DOC; r2 = 0.96, p CDOM yields are also correlated to watershed percent wetland (e.g. a350; r2 = 0.81, p CDOM export from ungauged watersheds. A large variation in CDOM yields was found across the rivers. The two rivers in the north-eastern U.S. (Androscoggin and Penobscot), the Edisto draining into the South Atlantic Bight, and some rivers draining into the Gulf of Mexico (Atchafalaya and Mobile) exhibit the highest CDOM yields, linked to extensive wetlands in these watersheds. If the Edisto CDOM yield is representative of other rivers draining into the South Atlantic Bight, this would result in a CDOM load equivalent to that of the Mississippi from a region of approximately 10% of the Mississippi watershed, indicating the importance of certain regions with respect to the role of terrigenous CDOM in ocean color budgets.

Predicting dissolved lignin phenol concentrations in the coastal ocean from chromophoric dissolved organic matter (CDOM absorption coefficients

Directory of Open Access Journals (Sweden)

Cédric G. Fichot

2016-02-01

Full Text Available Dissolved lignin is a well-established biomarker of terrigenous dissolved organic matter (DOM in the ocean, and a chromophoric component of DOM. Although evidence suggests there is a strong linkage between lignin concentrations and chromophoric DOM (CDOM absorption coefficients in coastal waters, the characteristics of this linkage and the existence of a relationship that is applicable across coastal oceans remain unclear. Here, 421 paired measurements of dissolved lignin concentrations (sum of 9 lignin phenols and CDOM absorption coefficients (ag(λ were used to examine their relationship along the river-ocean continuum (0-37 salinity and across contrasting coastal oceans (sub-tropical, temperate, high-latitude. Overall, lignin concentrations spanned four orders of magnitude and revealed a strong, non-linear relationship with ag(λ. The characteristics of the relationship (shape, wavelength dependency, lignin-composition dependency and evidence from degradation indicators were all consistent with lignin being an important driver of CDOM variability in coastal oceans, and suggested physical mixing and long-term photodegradation were important in shaping the relationship. These observations were used to develop two simple empirical models for estimating lignin concentrations from ag(λ with a +/- 20% error relative to measured values. The models are expected to be applicable in most coastal oceans influenced by terrigenous inputs.

Fv-clasp: An Artificially Designed Small Antibody Fragment with Improved Production Compatibility, Stability, and Crystallizability.

Science.gov (United States)

Arimori, Takao; Kitago, Yu; Umitsu, Masataka; Fujii, Yuki; Asaki, Ryoko; Tamura-Kawakami, Keiko; Takagi, Junichi

2017-10-03

Antibody fragments are frequently used as a "crystallization chaperone" to aid structural analysis of complex macromolecules that are otherwise crystallization resistant, but conventional fragment formats have not been designed for this particular application. By fusing an anti-parallel coiled-coil structure derived from the SARAH domain of human Mst1 kinase to the variable region of an antibody, we succeeded in creating a novel chimeric antibody fragment of ∼37 kDa, termed "Fv-clasp," which exhibits excellent crystallization compatibility while maintaining the binding ability of the original IgG molecule. The "clasp" and the engineered disulfide bond at the bottom of the Fv suppressed the internal mobility of the fragment and shielded hydrophobic residues, likely contributing to the high heat stability and the crystallizability of the Fv-clasp. Finally, Fv-clasp antibodies showed superior "chaperoning" activity over conventional Fab fragments, and facilitated the structure determination of an ectodomain fragment of integrin α6β1. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

Measures to overcome consequences of agricultural land fragmentation: European experience and Ukrainian realities

Directory of Open Access Journals (Sweden)

Andriy Popov

2016-03-01

Full Text Available One of the land reform implementation results in Ukraine is the distribution of the state-owned agricultural land to the rural population in the form of physical land parcels. As a consequence, however, the land was subdivided into many small units. This land fragmentation has led to fundamental changes in the formation of the new agricultural enterprises and brought some negative consequences in their functioning. The problem of the land fragmentation in Ukraine is quite new and uninvestigated. The aim of the article is to analyze the existing measures (instruments in European countries for reducing the effects of agricultural land fragmentation and to determine the possibility of «transplantability» of Western experience to Ukraine. The principal measures to decrease the agricultural land fragmentation in European countries are: voluntary parcel exchange, land banking and land consolidation. The article presents the characteristics and comparative analysis of these measures. One of the four types of land fragmentation is a main problem of Ukraine, namely the discrepancy between the landownership and the land use. The Western European countries have been used the three instruments for reducing only two types of land fragmentation: the land use fragmentation and the internal fragmentation. Consequently, the using of Western European measures to decrease agricultural land fragmentation is impossible without their adaptation to the Ukrainian realities. Therefore, the actual problem in Ukraine today is to find the own measures to overcome the problem of agricultural land fragmentation based on the Western European experience.

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

[Effect of Charge-Transfer Complex on Ultraviolet-Visible (UV-Vis) Absorption Property of Chromophoric Dissolved Organic Matter (CDOM) in Waters of Typical Water-Level Fluctuation Zones of the Three Gorges Reservoir Areas].

Science.gov (United States)

Jiang, Tao; Liang, Jian; Zhang, Mu-xue; Wang, Ding-yong; Wei, Shi-qiang; Lu, Song

2016-02-15

As an important fraction of dissolved organic matter (DOM), chromophoric dissolved organic matter (CDOM) plays a key role in decision of the optical properties and photogeochemistry of DOM, and further affects pollutant fate and global carbon cycle. These optical properties are ascribed to two chromophoric systems including superposition of individual chromophores and charge-transfer (CT) complexation between electron donor (e.g., phenols and indoles) and acceptor (e.g., quinones and other oxidized aromatics) in DOM structures. Thus in this study, based on the "double-chromophoric system" model, DOM samples from four typical water-level fluctuation zones of Three Gorges Reservoir (TGR) areas were selected, to investigate the effect and contribution of charge-transfer complex to ultraviolet-visible (UV-Vis) absorption property of CDOM. Using NaBH, reduction method, original featureless absorption curve was classified into two independent curves caused by individual chromophoric group, which were derived from a simple superposition of independent chromophore and charge-transfer complex, respectively. Also, the changes in curve properties and specific parameters before and after NaBH4 reduction were compared. The results showed that in all DOM samples from the four sites of TGR, more than 35% of absorption was attributed from CT complex. Shibaozhai of Zhongxian and Zhenxi of Fuling showed the highest proportion ( > 50%). It suggested that the role of CT complex in CDOM property could not be neglected. After removal of CT complex, absorption curve showed blue-shift and CDOM concentration [a (355)] decreased significantly. Meanwhile, because of deforming of bonds by reduction, DOM structures became more dispersive and the molecular size was decreased, resulting in the lower spectral slope (S) observed, which evidentially supported that the supermolecular association structure of DOM was self-assembled through CT complex. Meanwhile, deceasing hydrophobic components led

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Sulfates as chromophores for multiwavelength photoacoustic imaging phantoms

Science.gov (United States)

Fonseca, Martina; An, Lu; Beard, Paul; Cox, Ben

2017-12-01

As multiwavelength photoacoustic imaging becomes increasingly widely used to obtain quantitative estimates, the need for validation studies conducted on well-characterized experimental phantoms becomes ever more pressing. One challenge that such studies face is the design of stable, well-characterized phantoms and absorbers with properties in a physiologically realistic range. This paper performs a full experimental characterization of aqueous solutions of copper and nickel sulfate, whose properties make them close to ideal as chromophores in multiwavelength photoacoustic imaging phantoms. Their absorption varies linearly with concentration, and they mix linearly. The concentrations needed to yield absorption values within the physiological range are below the saturation limit. The shape of their absorption spectra makes them useful analogs for oxy- and deoxyhemoglobin. They display long-term photostability (no indication of bleaching) as well as resistance to transient effects (no saturable absorption phenomena), and are therefore suitable for exposure to typical pulsed photoacoustic light sources, even when exposed to the high number of pulses required in scanning photoacoustic imaging systems. In addition, solutions with tissue-realistic, predictable, and stable scattering can be prepared by mixing sulfates and Intralipid, as long as an appropriate emulsifier is used. Finally, the Grüneisen parameter of the sulfates was found to be larger than that of water and increased linearly with concentration.

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

Ethyne-linked push-pull chromophores: implications of crystal structure and molecular electronics on the quadric nonlinear activity

Czech Academy of Sciences Publication Activity Database

Kautny, P.; Kriegner, H.; Bader, D.; Dušek, Michal; Reider, G.A.; Froehlich, J.; Stoeger, B.

2017-01-01

Roč. 17, č. 8 (2017), s. 4124-4136 ISSN 1528-7483 R&D Projects: GA ČR(CZ) GA15-12653S; GA MŠk LO1603 EU Projects: European Commission(XE) CZ.2.16/3.1.00/24510 Institutional support: RVO:68378271 Keywords : ethyne-linked materials * nonlinear optical chromophores * molecular structure * optical activity Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 4.055, year: 2016

Fragmentation and reactivity of energy-selected ferrocenium ions

International Nuclear Information System (INIS)

Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

2002-01-01

In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Quantum mechanical fragment methods based on partitioning atoms or partitioning coordinates.

Science.gov (United States)

Wang, Bo; Yang, Ke R; Xu, Xuefei; Isegawa, Miho; Leverentz, Hannah R; Truhlar, Donald G

2014-09-16

atoms for capping dangling bonds, and we have shown that they can greatly improve the accuracy. Finally we present a new approach that goes beyond QM/MM by combining the convenience of molecular mechanics with the accuracy of fitting a potential function to electronic structure calculations on a specific system. To make the latter practical for systems with a large number of degrees of freedom, we developed a method to interpolate between local internal-coordinate fits to the potential energy. A key issue for the application to large systems is that rather than assigning the atoms or monomers to fragments, we assign the internal coordinates to reaction, secondary, and tertiary sets. Thus, we make a partition in coordinate space rather than atom space. Fits to the local dependence of the potential energy on tertiary coordinates are arrayed along a preselected reaction coordinate at a sequence of geometries called anchor points; the potential energy function is called an anchor points reactive potential. Electrostatically embedded fragment methods and the anchor points reactive potential, because they are based on treating an entire system by quantum mechanical electronic structure methods but are affordable for large and complex systems, have the potential to open new areas for accurate simulations where combined QM/MM methods are inadequate.

Photoproduction of hydrogen peroxide in aqueous solution from model compounds for chromophoric dissolved organic matter (CDOM)

International Nuclear Information System (INIS)

Clark, Catherine D.; Bruyn, Warren de; Jones, Joshua G.

2014-01-01

Highlights: • CDOM produces hydrogen peroxide in sunlit surface waters. • Quinone moieties have been proposed as the photo-active chromophore in CDOM. • Hydrogen peroxide is produced in irradiated aqueous quinone solutions. • Concentrations and production rates are comparable to humic and fulvic acids. • Optical properties post-irradiation were similar to CDOM. - Abstract: To explore whether quinone moieties are important in chromophoric dissolved organic matter (CDOM) photochemistry in natural waters, hydrogen peroxide (H 2 O 2 ) production and associated optical property changes were measured in aqueous solutions irradiated with a Xenon lamp for CDOM model compounds (dihydroquinone, benzoquinone, anthraquinone, napthoquinone, ubiquinone, humic acid HA, fulvic acid FA). All compounds produced H 2 O 2 with concentrations ranging from 15 to 500 μM. Production rates were higher for HA vs. FA (1.32 vs. 0.176 mM h −1 ); values ranged from 6.99 to 0.137 mM h −1 for quinones. Apparent quantum yields (Θ app ; measure of photochemical production efficiency) were higher for HA vs. FA (0.113 vs. 0.016) and ranged from 0.0018 to 0.083 for quinones. Dihydroquinone, the reduced form of benzoquinone, had a higher production rate and efficiency than its oxidized form. Post-irradiation, quinone compounds had absorption spectra similar to HA and FA and 3D-excitation–emission matrix fluorescence spectra (EEMs) with fluorescent peaks in regions associated with CDOM

Behavior of fragmentation front in a porous viscoelastic material

Science.gov (United States)

Ichihara, M.; Takayama, K.

2002-12-01

We are developing laboratory experiments to investigate dynamics of magma fragmentation during explosive volcanic eruptions. Fragmentation of such a mixture as magma consisting of viscoelastic melt, bubbles and solid particles, is not known yet, and experiments are necessary to establish a mathematical model. It has been shown that viscoelastic silicone compound (Dow Corning 3179) is a useful analogous material to simulate magma fragmentation. In the previous work, a porous specimen made of the compound was rapidly decompressed and development of brittle fragmentation was observed. However, there were arguments that the experiment was different from actual processes which produce fragments as small as volcanic ash, because in the experiment the specimen was broken into only several pieces. This time, results of the improved experiments are presented. The experimental apparatus is a kind of a vertical shock tube, which mainly consists of a high pressure test section and low pressure chambers. The test section is made of acrylic tube of which inner diameter is 25 mm. The internal phenomenon is recorded by a high-speed video camera. Pressure is measured in the gas above and beneath the specimen by piezoelectric transducers. The specimen is prepared in the following way. First, an acrylic tube filled with the compound is put in a nitrogen tank and kept at 45 bar for more than 8 hours. The compound absorbs the gas and equilibrates with the nitrogen. Next, the tank is decompressed back to the atmospheric pressure slowly. Nitrogen exsolves and bubbles are formed in the compound quite uniformly. Finally, the expanded compound sticking out of both ends of the tube is cut down, and the tube containing the specimen is attached to the shock tube. The specimen is rapidly decompressed by 24, 16, and 8 bars. The high-speed video images demonstrate a sequence of the fragmentation process. We observe propagation of a clear fracture front at 50 m/s for 24 bar of decompression and at

Occlusion of chromophore oxides by Sol-Gel methods: Application to the synthesis of hematite-silica red pigments

Directory of Open Access Journals (Sweden)

Vicent, J. B.

2000-02-01

Full Text Available Heteromorphic pigments present the chromophore particle occluded in an encapsulating matrix which is thermally stable and insoluble in glazes. The occluded chromophore compound is also insoluble in the host matrix. In this work the mechanisms of formation of this type of pigments are analyzed and the occlusion of hematite into silica matrix is discussed. The formation of this hematite-silica red pigment follows a sintering-coarsening mechanism, and, consequently, the control of both hematite particles nucleation and their crystal growth results to be decisive to obtain a good coloring effectiveness.

En los pigmentos heteromórficos la partícula de cromóforo es ocluida en una matriz encapsuladora estable tanto termicamente como frente a los vidriados. El compuesto cromóforo ocluido y la matriz no coloreada son insolubles. En este trabajo se analiza los diferentes mecanismos de formación de estos pigmentos heteromórficos y se estudia la oclusión de hematita en sílice mediante métodos sol-gel acuoso. El pigmento sigue un mecanismo de sinterización-crecimiento cristalino por lo que es muy importante controlar el momento de nucleación y la velocidad de crecimiento de las partículas de hematita en el seno de la matriz.

Acceptor number-dependent ultrafast photo-physical properties of push-pull chromophores using time-resolved methods

Science.gov (United States)

Chi, Xiao-Chun; Wang, Ying-Hui; Gao, Yu; Sui, Ning; Zhang, Li-Quan; Wang, Wen-Yan; Lu, Ran; Ji, Wen-Yu; Yang, Yan-Qiang; Zhang, Han-Zhuang

2018-04-01

Three push-pull chromophores comprising a triphenylamine (TPA) as electron-donating moiety and functionalized β-diketones as electron acceptor units are studied by various spectroscopic techniques. The time-correlated single-photon counting data shows that increasing the number of electron acceptor units accelerates photoluminescence relaxation rate of compounds. Transient spectra data shows that intramolecular charge transfer (ICT) takes place from TPA units to β-diketones units after photo-excitation. Increasing the number of electron acceptor units would prolong the generation process of ICT state, and accelerate the excited molecule reorganization process and the relaxation process of ICT state.

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

Chromophoric dissolved organic matter export from U.S. rivers

Science.gov (United States)

Spencer, Robert G. M.; Aiken, George R.; Dornblaser, Mark M.; Butler, Kenna D.; Holmes, R. Max; Fiske, Greg; Mann, Paul J.; Stubbins, Aron

2013-01-01

Chromophoric dissolved organic matter (CDOM) fluxes and yields from 15 major U.S. rivers draining an assortment of terrestrial biomes are presented. A robust relationship between CDOM and dissolved organic carbon (DOC) loads is established (e.g., a350 versus DOC; r2 = 0.96, p CDOM yields are also correlated to watershed percent wetland (e.g. a350; r2 = 0.81, p CDOM export from ungauged watersheds. A large variation in CDOM yields was found across the rivers. The two rivers in the north-eastern U.S. (Androscoggin and Penobscot), the Edisto draining into the South Atlantic Bight, and some rivers draining into the Gulf of Mexico (Atchafalaya and Mobile) exhibit the highest CDOM yields, linked to extensive wetlands in these watersheds. If the Edisto CDOM yield is representative of other rivers draining into the South Atlantic Bight, this would result in a CDOM load equivalent to that of the Mississippi from a region of approximately 10% of the Mississippi watershed, indicating the importance of certain regions with respect to the role of terrigenous CDOM in ocean color budgets.

Chiral 1,2- and 1,3-diol-functionalized chromophores as Lego building blocks for coupled structures.

Science.gov (United States)

Spange, Stefan; Hofmann, Katja; Walfort, Bernhard; Rüffer, Tobias; Lang, Heinrich

2005-10-14

Chiral nitroanilines containing 1,2- or 1,3-diol functionalities have been synthesized by nucleophilic aromatic substitution of fluoronitroanilines with 1-aminopropane-2,3-diols and 2-aminopropane-1,3-diol in the melt. X-ray structure analyses confirm retention of the configuration of the chiral center. The novel chromophores are suitable to link reversibly to various substituted arylboronic acids which allows the construction of new solvatochromic sensor molecules suitable to response to solvent and anion coordination by fluoride. The solvatochromism of the new compounds has been studied using the Kamlet-Taft LSE relationship.

Mapping the Excited State Potential Energy Surface of a Retinal Chromophore Model with Multireference and Equation-of-Motion Coupled-Cluster Methods.

Science.gov (United States)

Gozem, Samer; Melaccio, Federico; Lindh, Roland; Krylov, Anna I; Granovsky, Alexander A; Angeli, Celestino; Olivucci, Massimo

2013-10-08

The photoisomerization of the retinal chromophore of visual pigments proceeds along a complex reaction coordinate on a multidimensional surface that comprises a hydrogen-out-of-plane (HOOP) coordinate, a bond length alternation (BLA) coordinate, a single bond torsion and, finally, the reactive double bond torsion. These degrees of freedom are coupled with changes in the electronic structure of the chromophore and, therefore, the computational investigation of the photochemistry of such systems requires the use of a methodology capable of describing electronic structure changes along all those coordinates. Here, we employ the penta-2,4-dieniminium (PSB3) cation as a minimal model of the retinal chromophore of visual pigments and compare its excited state isomerization paths at the CASSCF and CASPT2 levels of theory. These paths connect the cis isomer and the trans isomer of PSB3 with two structurally and energetically distinct conical intersections (CIs) that belong to the same intersection space. MRCISD+Q energy profiles along these paths provide benchmark values against which other ab initio methods are validated. Accordingly, we compare the energy profiles of MRPT2 methods (CASPT2, QD-NEVPT2, and XMCQDPT2) and EOM-SF-CC methods (EOM-SF-CCSD and EOM-SF-CCSD(dT)) to the MRCISD+Q reference profiles. We find that the paths produced with CASSCF and CASPT2 are topologically and energetically different, partially due to the existence of a "locally excited" region on the CASPT2 excited state near the Franck-Condon point that is absent in CASSCF and that involves a single bond, rather than double bond, torsion. We also find that MRPT2 methods as well as EOM-SF-CCSD(dT) are capable of quantitatively describing the processes involved in the photoisomerization of systems like PSB3.

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Electron impact ionization of size selected hydrogen clusters (H2)N: ion fragment and neutral size distributions.

Science.gov (United States)

Kornilov, Oleg; Toennies, J Peter

2008-05-21

Clusters consisting of normal H2 molecules, produced in a free jet expansion, are size selected by diffraction from a transmission nanograting prior to electron impact ionization. For each neutral cluster (H2)(N) (N=2-40), the relative intensities of the ion fragments Hn+ are measured with a mass spectrometer. H3+ is found to be the most abundant fragment up to N=17. With a further increase in N, the abundances of H3+, H5+, H7+, and H9+ first increase and, after passing through a maximum, approach each other. At N=40, they are about the same and more than a factor of 2 and 3 larger than for H11+ and H13+, respectively. For a given neutral cluster size, the intensities of the ion fragments follow a Poisson distribution. The fragmentation probabilities are used to determine the neutral cluster size distribution produced in the expansion at a source temperature of 30.1 K and a source pressure of 1.50 bar. The distribution shows no clear evidence of a magic number N=13 as predicted by theory and found in experiments with pure para-H2 clusters. The ion fragment distributions are also used to extract information on the internal energy distribution of the H3+ ions produced in the reaction H2+ + H2-->H3+ +H, which is initiated upon ionization of the cluster. The internal energy is assumed to be rapidly equilibrated and to determine the number of molecules subsequently evaporated. The internal energy distribution found in this way is in good agreement with data obtained in an earlier independent merged beam scattering experiment.

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Physics-Based Fragment Acceleration Modeling for Pressurized Tank Burst Risk Assessments

Science.gov (United States)

Manning, Ted A.; Lawrence, Scott L.

2014-01-01

As part of comprehensive efforts to develop physics-based risk assessment techniques for space systems at NASA, coupled computational fluid and rigid body dynamic simulations were carried out to investigate the flow mechanisms that accelerate tank fragments in bursting pressurized vessels. Simulations of several configurations were compared to analyses based on the industry-standard Baker explosion model, and were used to formulate an improved version of the model. The standard model, which neglects an external fluid, was found to agree best with simulation results only in configurations where the internal-to-external pressure ratio is very high and fragment curvature is small. The improved model introduces terms that accommodate an external fluid and better account for variations based on circumferential fragment count. Physics-based analysis was critical in increasing the model's range of applicability. The improved tank burst model can be used to produce more accurate risk assessments of space vehicle failure modes that involve high-speed debris, such as exploding propellant tanks and bursting rocket engines.

Fragmentation of molten copper drop caused by entrapment of liquid sodium

International Nuclear Information System (INIS)

Abe, N.; Sugiyama, K.; Nishimura, S.; Kinoshita, I.

2001-01-01

In core meltdown accidents, it is possible to occur thermal interactions between molten fuel and coolant. Analysis of the steam explosion, which is one of the most severe phenomena in such thermal interactions, is important for the safety evaluation. The steam explosion is a phenomenon that intensive pressure waves are caused by the explosive thermal interaction between high and low temperature liquids, and is considered to be one of the phenomena that can cause a serious failure of the nuclear reactor structures. In a large-scale steam explosion, the fragmentation of hot molten material causes a rapid increase of heat transfer area, and it is achieved to transmit instantaneously a large amount of heat to coolant. Two ideas are chiefly considered as the mechanism of the fragmentation. The one is the hypothesis that hydrodynamic effect causes fragmentation of hot liquid. According to this hypothesis, the high temperature drops flake off from the surface. The other is that fragmentation is caused by the interface instability accompanied by collapse of the steam bubble formed around a hot liquid. In this research, the possibility of the internal fragmentation caused by the coolant jet is focused in. Experiments were conducted on the condition that the surface of melt drops solidify at the moment drops contact the coolant. The possibility of the fragmentation of hot liquid from its surface was eliminated in this condition. To satisfy this condition, molten copper was chosen as hot liquid, and liquid sodium was used as coolant to verify the effect of the driving force of the sodium jet. (author)

Synthesis and Properties of Novel Polyurethane Containing Nitrophenylazocatecholic Group as NLO Chromophore

International Nuclear Information System (INIS)

Song, Mi Young; Kim, Mi Sung; Lee, Ju Yeon

2012-01-01

The promise of NLO polymers lies in their higher nonlinear optical activity, faster response time, and easy fabrication into electro-optic devices. In the developments of NLO polymers for electrooptic device applications, stabilization of electrically induced dipole alignment is one of important considerations; in this context, two approaches to minimize the randomization have been proposed, namely the use of cross-linked systems and the utilization of polymers with high glass transition temperature (T g ) such as polyimides. A polyurethane matrix forms extensive hydrogen bonding between urethane linkages, with increased rigidity preventing the relaxation of induced dipoles. Polyurethanes functionalized with hemicyanine and thiophene ring in side chain show an enhanced thermal stability of aligned dipoles. Polyurethanes with NLO chromophores, whose dipole moments are aligned transverse to the main chains, show large second-order nonlinearity with good thermal stability

Picosecond absorption studies of photoinduced charge separation in polyelectrolyte bound aromatic chromophores

Science.gov (United States)

Shand, M. A.; Rodgers, M. A. J.; Webber, S. E.

1991-02-01

Picosecond absorption studies of photoinduced electron transfer between aromatic chromophores bound to polymethacrylic acid (P) and methylviologen (MV 2+ have been carried out in aqueous solution. The diphenylanthracene copolymer/viologen system at pH 2.8 shows the corresponding redox products DPA + rad and MV + rad arising from the singlet state of DPA with a forward rate constant of electron transfer of 2.6 × 10 9 s -1. At pH 9.0 the quenching of the S 1 state of DPA occurs with no charge separated products being observed. The pyrene copolymer shows no evidence of charge separated products at any pH in the range 2.8-9.0. It is proposed that the differences in the radical pair kinetics arise from differences in the degree of binding of the ground state complexes formed by the donor and acceptor species.

UV-Vis spectroscopy of tyrosine side-groups in studies of protein structure. Part 1: basic principles and properties of tyrosine chromophore.

Science.gov (United States)

Antosiewicz, Jan M; Shugar, David

2016-06-01

Spectroscopic properties of tyrosine residues may be employed in structural studies of proteins. Here we discuss several different types of UV-Vis spectroscopy, like normal, difference and second-derivative UV absorption spectroscopy, fluorescence spectroscopy, linear and circular dichroism spectroscopy, and Raman spectroscopy, and corresponding optical properties of the tyrosine chromophore, phenol, which are used to study protein structure.

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Fractal statistics of brittle fragmentation

Directory of Open Access Journals (Sweden)

M. Davydova

2013-04-01

Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

Delineating the relationship between chromophoric dissolved organic matter (CDOM) variability and biogeochemical parameters in a shallow continental shelf

OpenAIRE

Sourav Das; Sugata Hazra; Aneesh A. Lotlikar; Isha Das; Sandip Giri; Abhra Chanda; Anirban Akhand; Sourav Maity; T. Srinivasa Kumar

2016-01-01

Absorption coefficient of chromophoric dissolved organic matter (CDOM) at 440 nm [aCDOM (440)], sea surface salinity (SSS), total suspended matter (TSM) and chlorophyll-a (chl-a) were measured during October, 2014 to March, 2015 in the shallow continental shelf waters of the Hugli Estuary, adjacent to West Bengal coast, India. The primary objective of the study was to characterize the relationship between aCDOM (440) and the above mentioned biogeochemical parameters. Upon analyzing the result...

Primary structure of human alpha 2-macroglobulin. I. Isolation of the 26 CNBr fragments, amino acid sequence of 13 small CNBr fragments, amino acid sequence of methionine-containing peptides, and alignment of all CNBr fragments

DEFF Research Database (Denmark)

Sottrup-Jensen, Lars; Stepanik, T M; Jones, C M

1984-01-01

-775). These fragments account for 603 of the 1451 residues of the subunits of alpha 2-macroglobulin. CB2 contains two glucosamine-based carbohydrate groups attached to Asn-23 and Asn-38, and one internal disulfide bridge connecting Cys-16 with Cys-54. CB6 contains one glucosamine-based carbohydrate group attached...... to Asn-1 and two internal disulfide bridges (Cys-5 bound to Cys-53 and Cys-23 bound to Cys-41, respectively); Cys-32 is bound to Cys-16 in CB8. CB7 contains two glucosamine-based carbohydrate groups attached to Asn-78 and Asn-92, CB8 contains 1 Cys residue (Cys-16), bridged to Cys-32 of CB6. CB11...

Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

Science.gov (United States)

Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

2015-07-01

In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

THE ROLE OF PEBBLE FRAGMENTATION IN PLANETESIMAL FORMATION. II. NUMERICAL SIMULATIONS

Energy Technology Data Exchange (ETDEWEB)

Jansson, Karl Wahlberg; Johansen, Anders [Lund Observatory, Department of Astronomy and Theoretical Physics, Lund University, Box 43, SE-221 00 Lund (Sweden); Syed, Mohtashim Bukhari; Blum, Jürgen [Technische Universität Braunschweig, Institut für Geophysik und extraterrestrische Physik, Mendelssohnstraße 3, D-38106 Braunschweig (Germany)

2017-01-20

Some scenarios for planetesimal formation go through a phase of collapse of gravitationally bound clouds of millimeter- to centimeter-size pebbles. Such clouds can form, for example, through the streaming instability in protoplanetary disks. We model the collapse process with a statistical model to obtain the internal structure of planetesimals with solid radii between 10 and 1000 km. During the collapse, pebbles collide, and depending on their relative speeds, collisions have different outcomes. A mixture of particle sizes inside a planetesimal leads to better packing capabilities and higher densities. In this paper we apply results from new laboratory experiments of dust aggregate collisions (presented in a companion paper) to model collision outcomes. We find that the internal structure of a planetesimal is strongly dependent on both its mass and the applied fragmentation model. Low-mass planetesimals have no/few fragmenting pebble collisions in the collapse phase and end up as porous pebble piles. The number of fragmenting collisions increases with increasing cloud mass, resulting in wider particle size distributions and higher density. The collapse is nevertheless “cold” in the sense that collision speeds are damped by the high collision frequency. This ensures that a significant fraction of large pebbles survive the collapse in all but the most massive clouds. Our results are in broad agreement with the observed increase in density of Kuiper Belt objects with increasing size, as exemplified by the recent characterization of the highly porous comet 67P/Churyumov–Gerasimenko.

Fission and fragmentation of silver and bromine nuclei by 1-6 GeV energy photons

International Nuclear Information System (INIS)

Pinheiro Filho, J. de D.

1983-01-01

Fission and fragmentation of silver and bromine nuclei induced by bremsstrahlung photons in the maximum energy range of 1-6 GeV are studied. A special technique of nuclear emulsion for the highly ionizing nuclear fragment detection is used in the discrimination between nuclear fission and fragmentation events. Films of Ilford-KO nuclear emulsion (approximatelly 10 20 atoms/cm 2 of Ag, Br) which had been exposed to bremsstrahlung beams in 'Deutsches Elektronen Synchrotron' (DESY, Hamburg) with total doses of approximatelly 10 11 equivalent photons are used. Through a detailed analysis of range, angular and angle between fragment distributions, and empirical relations which permit to estimate nuclear fragment energy, range and velocity, the discrimination between fission and fragmentation events is made. Results related to fragment range distribution, angular distribution, distribution of angle between fragments, distribution of ratio between ranges, velocity distributions, forward/backward ratio, fission and fragmentation cross sections, nuclear fissionability and ternary fission frequency are presented and discussed. The results show that the mean photofragmentation cross section in the internal 1-6 GeV (0,09+-0,02mb) is significant when compared to the photofission (0,29+-0,05mb). It is also shown that the mean photofission cross section between 1 and 6 GeV is great by a factor of approximatelly 10 when compared to the foreseen by the cascade-evaporation nuclear model for monoenergetic photons of 0,6 GeV. (L.C.) [pt

Photoconversion changes bilin chromophore conjugation and protein secondary structure in the violet/orange cyanobacteriochrome NpF2164g3' [corrected].

Science.gov (United States)

Lim, Sunghyuk; Rockwell, Nathan C; Martin, Shelley S; Dallas, Jerry L; Lagarias, J Clark; Ames, James B

2014-06-01

Cyanobacteriochromes (CBCRs) are cyanobacterial photoreceptors distantly related to phytochromes. All CBCRs examined to date utilize a conserved Cys residue to form a covalent thioether linkage to the bilin chromophore. In the insert-Cys CBCR subfamily, a second conserved Cys can covalently link to the bilin C10 methine bridge, allowing detection of near-UV to blue light. The best understood insert-Cys CBCR is the violet/orange CBCR NpF2164g3 from Nostoc punctiforme, which has a stable second linkage in the violet-absorbing dark state. Photoconversion of NpF2164g3 leads to elimination of the second linkage and formation of an orange-absorbing photoproduct. We recently reported NMR chemical shift assignments for the orange-absorbing photoproduct state of NpF2164g3. We here present equivalent information for its violet-absorbing dark state. In both photostates, NpF2164g3 is monomeric in solution and regions containing the two conserved Cys residues essential for photoconversion are structurally disordered. In contrast to blue light receptors such as phototropin, NpF2164g3 is less structurally ordered in the dark state than in the photoproduct. The insert-Cys insertion loop and C-terminal helix exhibit light-dependent structural changes. Moreover, a motif containing an Asp residue also found in other CBCRs and in phytochromes adopts a random-coil structure in the dark state but a stable α-helix structure in the photoproduct. NMR analysis of the chromophore is consistent with a less ordered dark state, with A-ring resonances only resolved in the photoproduct. The C10 atom of the bilin chromophore exhibits a drastic change in chemical shift upon photoconversion, changing from 34.5 ppm (methylene) in the dark state to 115 ppm (methine) in the light-activated state. Our results provide structural insight into the two-Cys photocycle of NpF2164g3 and the structurally diverse mechanisms used for light perception by the larger phytochrome superfamily.

Synthesis and photochemical properties of a novel iron-sulfur-nitrosyl cluster derivatized with the pendant chromophore protoporphyrin IX.

Science.gov (United States)

Conrado, Christa L; Wecksler, Stephen; Egler, Christian; Magde, Douglas; Ford, Peter C

2004-09-06

The novel Roussin red-salt ester (PPIX-RSE) with a pendant porphyrin chromophore was prepared and investigated as a precursor for the photochemical generation of nitric oxide. PPIX-RSE has the general formula Fe(2)(NO)(4)[(mu-S,mu-S')P] (where (S,S')P is the bis(2-thiolatoethyl) diester of protoporphyrin IX. The photoexcitation of PPIX-RSE with 436- or 546-nm light in an aerated chloroform solution led to the photodecomposition of the cluster with the respective quantum yields (5.2 +/- 0.7) x 10(-4) and (2.5 +/- 0.5 x 10(-4)) and the concomitant release of NO. PPIX-RSE is a significantly more effective NO generator at longer wavelength excitation than are other Fe(2)(mu-SR)(2)(NO)(4) esters for which R is a simple alkyl group such as CH(3)CH(2)- because of the much higher absorptivity of the pendant PPIX chromophore at these wavelengths and a modestly higher quantum yield. Fluorescence intensity and lifetime data indicate that the photoexcited porphyrin of PPIX-RSE is largely quenched by the energy transfer to the Fe(2)S(2)(NO)(4) cluster's core. However, a small fraction of this emission is not quenched, and it is proposed that PPIX-RSE may exist in solution as two conformers.

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Tracing global biogeochemical cycles and meridional overturning circulation using chromophoric dissolved organic matter

Science.gov (United States)

Nelson, Norman B.; Siegel, David A.; Carlson, Craig A.; Swan, Chantal M.

2010-02-01

Basin-scale distributions of light absorption by chromophoric dissolved organic matter (CDOM) are positively correlated (R2 > 0.8) with apparent oxygen utilization (AOU) within the top kilometer of the Pacific and Indian Oceans. However, a much weaker correspondence is found for the Atlantic (R2 organic matter from sinking particles. The observed meridional-depth sections of CDOM result from a balance between biogeochemical processes (autochthonous production and solar bleaching) and the meridional overturning circulation. Rapid mixing in the Atlantic dilutes CDOM in the interior and implies that the time scale for CDOM accumulation is greater than ˜50 years. CDOM emerges as a unique tracer for diagnosing changes in biogeochemistry and the overturning circulation, similar to dissolved oxygen, with the additional feature that it can be quantified from satellite observation.

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

Absorption features of chromophoric dissolved organic matter (CDOM) and tracing implication for dissolved organic carbon (DOC) in Changjiang Estuary, China

OpenAIRE

Zhang, X. Y.; Chen, X.; Deng, H.; Du, Y.; Jin, H. Y.

2013-01-01

Chromophoric dissolved organic matter (CDOM) represents the light absorbing fraction of dissolved organic carbon (DOC). Studies have shown that the optical properties of CDOM can be used to infer the distribution and diffusion characteristics of DOC in the estuary and coastal zone. The inversion of DOC concentrations from remote sensing has been implemented in certain regions. In this study we investigate the potential of tracing DOC from CDOM by the measure...

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

Evaluation of light scattering properties and chromophore concentrations in skin tissue based on diffuse reflectance signals at isosbestic wavelengths of hemoglobin

Science.gov (United States)

Yokokawa, Takumi; Nishidate, Izumi

2016-04-01

We investigate a method to evaluate light-scattering properties and chromophore concentrations in human skin tissue through diffuse reflectance spectroscopy using the reflectance signals acquired at isosbestic wavelengths of hemoglobin (420, 450, 500, and 585 nm). In the proposed method, Monte Carlo simulation-based empirical formulas are used to specify the scattering parameters of skin tissue, such as the scattering amplitude a and the scattering power b, as well as the concentration of melanin C m and the total blood concentration C tb. The use of isosbestic wavelengths of hemoglobin enables the values of C m, C tb, a, and b to be estimated independently of the oxygenation of hemoglobin. The spectrum of the reduced scattering coefficient is reconstructed from the scattering parameters. Experiments using in vivo human skin tissues were performed to confirm the feasibility of the proposed method for evaluating the changes in scattering properties and chromophore concentrations in skin tissue. The experimental results revealed that light scattering is significantly reduced by the application of a glycerol solution, which indicates an optical clearing effect due to osmotic dehydration and the matching of the refractive indices of scatterers in the epidermis.

Synthesis of Dendrimer Containing Dialkylated-fluorene Unit as a Core Chromophore via Click Chemistry

International Nuclear Information System (INIS)

Han, Seung Choul; Lee, Jae Wook; Jin, Sung Ho

2012-01-01

The convergent synthetic strategy for the emissive dendrimers having the chromophore at core via the coppercatalyzed 1,3-dipolar cycloaddition reaction between alkyne and azide was described. 2,7-Diazido-9,9-dioctyl- 9H-fluorene, designed to serve as the core in dendrimer, was stitched with the alkyne-functionalized Frechettype and PAMAM dendrons by the click chemistry leading to the formation of the corresponding fluorescent dendrimers in high yields. The preliminary photoluminescence studies indicated that 2,7-diazido-9,9-dioctyl- 9H-fluorene showed no fluorescence due to the quenching effect from the electron-rich α-nitrogen of the azido group but the dendrimers fluoresced due to the elimination of the quenching through the formation of the triazole ring

Generation of high-affinity, internalizing anti-FGFR2 single-chain variable antibody fragment fused with Fc for targeting gastrointestinal cancers.

Science.gov (United States)

Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek

2018-01-01

Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

Coincidence measurements of intermediate mass fragments produced in /sup 32/S-induced reactions on Ag at E/A = 22.5 MeV

International Nuclear Information System (INIS)

Fields, D.J.; Lynch, W.G.; Nayak, T.K.

1986-01-01

Single- and two-particle inclusive cross sections for the production of light nuclei and intermediate mass fragments, 3< or =Z< or =24, were measured at angles well beyond the grazing angle for /sup 32/S-induced reactions on Ag at 720 MeV. Information about fragment multiplicities and reaction dynamics was extracted from measurements of light particles, intermediate mass fragments, and targetlike residues in coincidence with intermediate mass fragments. Incomplete linear momentum transfer and non-compound-particle emission are important features of collisions producing intermediate mass fragments. About half of the incident kinetic energy in these collisions is converted into internal excitation. The mean multiplicity of intermediate mass fragments is of the order of 1. Particle correlations are strongly enhanced in the plane which contains the intermediate mass fragment and the beam axis

Historicizing Chicago’s Resurrection of the Film Musical, or, Thinking in Fragments, from Vaudeville to MTV

Directory of Open Access Journals (Sweden)

Vagelis Siropoulos

2009-10-01

Full Text Available

Abstract:
With its 2003 Oscar triumph and its success in the international box office, Chicago
managed to resurrect the film musical. One of the reasons for the film’s success is its
dynamic visual vocabulary, which exhibits the influence of a postmodern mode of
fragmentation, best exemplified in MTV videos. Chicago uses this video aesthetic in
order to communicate the dynamism of the vaudeville act, which, interestingly, was
the first form of mass entertainment that systematically explored the dynamics of the
fragment as an aesthetic device. In this way, Chicago creates a sense of diachrony that
invites us to reconstitute a history of the fragment from the “primitive” popular
culture of the early-twentieth century to the digitalized one of the twenty-first.

Résumé:
Le triomphe de Chicago aux Oscars 2003 et son succès commercial international ont
signifié la résurrection du film musical. Une des raisons du succès du film est le
dynamisme de ses images, qui trahit l’influence de la mode postmoderne de la
fragmentation déjà illustrée par les clips de MTV. Chicago se sert de l’esthétique
vidéo pour communiquer la vivacité des numéros de vaudeville, sans doute la
première forme de divertissement populaire à explorer le dynamisme du fragment
comme technique esthétique. Chicago fait naître ainsi une conscience de la diachronie
du genre qui nous invite à reconstituer l’histoire du fragment depuis les formes
« primitives » de la culture populaire au début du XXe siècle aux formes numériques
du début du XXIe.

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Comparing forest fragmentation and its drivers in China and the USA with Globcover v2.2

Science.gov (United States)

Chen, Mingshi; Mao, Lijun; Zhou, Chunguo; Vogelmann, James E.; Zhu, Zhiliang

2010-01-01

Forest loss and fragmentation are of major concern to the international community, in large part because they impact so many important environmental processes. The main objective of this study was to assess the differences in forest fragmentation patterns and drivers between China and the conterminous United States (USA). Using the latest 300-m resolution global land cover product, Globcover v2.2, a comparative analysis of forest fragmentation patterns and drivers was made. The fragmentation patterns were characterized by using a forest fragmentation model built on the sliding window analysis technique in association with landscape indices. Results showed that China’s forests were substantially more fragmented than those of the USA. This was evidenced by a large difference in the amount of interior forest area share, with China having 48% interior forest versus the 66% for the USA. China’s forest fragmentation was primarily attributed to anthropogenic disturbances, driven particularly by agricultural expansion from an increasing and large population, as well as poor forest management practices. In contrast, USA forests were principally fragmented by natural land cover types. However, USA urban sprawl contributed more to forest fragmentation than in China. This is closely tied to the USA’s economy, lifestyle and institutional processes. Fragmentation maps were generated from this study, which provide valuable insights and implications regarding habitat planning for rare and endangered species. Such maps enable development of strategic plans for sustainable forest management by identifying areas with high amounts of human-induced fragmentation, which improve risk assessments and enable better targeting for protection and remediation efforts. Because forest fragmentation is a long-term, complex process that is highly related to political, institutional, economic and philosophical arenas, both nations need to take effective and comprehensive measures to mitigate

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

In Vitro Magnetic Resonance Imaging Evaluation of Fragmented, Open-Coil, Percutaneous Peripheral Nerve Stimulation Leads.

Science.gov (United States)

Shellock, Frank G; Zare, Armaan; Ilfeld, Brian M; Chae, John; Strother, Robert B

2018-04-01

Percutaneous peripheral nerve stimulation (PNS) is an FDA-cleared pain treatment. Occasionally, fragments of the lead (MicroLead, SPR Therapeutics, LLC, Cleveland, OH, USA) may be retained following lead removal. Since the lead is metallic, there are associated magnetic resonance imaging (MRI) risks. Therefore, the objective of this investigation was to evaluate MRI-related issues (i.e., magnetic field interactions, heating, and artifacts) for various lead fragments. Testing was conducted using standardized techniques on lead fragments of different lengths (i.e., 50, 75, and 100% of maximum possible fragment length of 12.7 cm) to determine MRI-related problems. Magnetic field interactions (i.e., translational attraction and torque) and artifacts were tested for the longest lead fragment at 3 Tesla. MRI-related heating was evaluated at 1.5 Tesla/64 MHz and 3 Tesla/128 MHz with each lead fragment placed in a gelled-saline filled phantom. Temperatures were recorded on the lead fragments while using relatively high RF power levels. Artifacts were evaluated using T1-weighted, spin echo, and gradient echo (GRE) pulse sequences. The longest lead fragment produced only minor magnetic field interactions. For the lead fragments evaluated, physiologically inconsequential MRI-related heating occurred at 1.5 Tesla/64 MHz while under certain 3 Tesla/128 MHz conditions, excessive temperature elevations may occur. Artifacts extended approximately 7 mm from the lead fragment on the GRE pulse sequence, suggesting that anatomy located at a position greater than this distance may be visualized on MRI. MRI may be performed safely in patients with retained lead fragments at 1.5 Tesla using the specific conditions of this study (i.e., MR Conditional). Due to possible excessive temperature rises at 3 Tesla, performing MRI at that field strength is currently inadvisable. © 2017 International Neuromodulation Society.

Fragment properties at the catastrophic disruption threshold: The effect of the parent body’s internal structure

Science.gov (United States)

Jutzi, Martin; Michel, Patrick; Benz, Willy; Richardson, Derek C.

2010-05-01

Numerical simulations of asteroid breakups, including both the fragmentation of the parent body and the gravitational interactions between the fragments, have allowed us to reproduce successfully the main properties of asteroid families formed in different regimes of impact energy, starting from a non-porous parent body. In this paper, using the same approach, we concentrate on a single regime of impact energy, the so-called catastrophic threshold usually designated by QD*, which results in the escape of half of the target's mass. Thanks to our recent implementation of a model of fragmentation of porous materials, we can characterize QD* for both porous and non-porous targets with a wide range of diameters. We can then analyze the potential influence of porosity on the value of QD*, and by computing the gravitational phase of the collision in the gravity regime, we can characterize the collisional outcome in terms of the fragment size and ejection speed distributions, which are the main outcome properties used by collisional models to study the evolutions of the different populations of small bodies. We also check the dependency of QD* on the impact speed of the projectile. In the strength regime, which corresponds to target sizes below a few hundreds of meters, we find that porous targets are more difficult to disrupt than non-porous ones. In the gravity regime, the outcome is controlled purely by gravity and porosity in the case of porous targets. In the case of non-porous targets, the outcome also depends on strength. Indeed, decreasing the strength of non-porous targets make them easier to disrupt in this regime, while increasing the strength of porous targets has much less influence on the value of QD*. Therefore, one cannot say that non-porous targets are systematically easier or more difficult to disrupt than porous ones, as the outcome highly depends on the assumed strength values. In the gravity regime, we also confirm that the process of gravitational

Evolution of dissolved and particulate chromophoric materials during the VAHINE mesocosm experiment in the New Caledonian coral lagoon (South West Pacific)

Science.gov (United States)

Tedetti, M.; Marie, L.; Röttgers, R.; Rodier, M.; Van Wambeke, F.; Helias, S.; Caffin, M.; Cornet-Barthaux, V.; Dupouy, C.

2015-10-01

In the framework of the VAHINE project, we investigated the spectral characteristics and the variability of dissolved and particulate chromophoric materials throughout a 23 day mesocosm experiment conducted in the South West Pacific at the exit of the New Caledonian coral lagoon (22°29.073 S-166°26.905 E) from 13 January to 4 February 2013. Samples were collected in a mesocosm fertilized with phosphorus at 1, 6 and 12 m depth and in the surrounding waters. Light absorption coefficients of chromophoric dissolved organic matter (CDOM) (ag(λ)), particulate matter (ap(λ)) and CDOM + particulate matter (ag+p(λ)) were measured using a point-source integrating-cavity absorption meter (PSICAM), while fluorescent DOM (FDOM) components were determined from excitation-emission matrices (EEMs) combined with parallel factor analysis (PARAFAC). The evolutions of ag(λ), ap(λ) and ag+p(λ) in the mesocosm were similar to those of total chlorophyll a concentration, Synechococcus spp. and picoeukaryote abundances, bacterial production, particulate organic nitrogen and total organic carbon concentrations, with roughly a decrease from the beginning of the experiment to days 9-10, and an increase from days 9-10 to the end of the experiment. In the surrounding waters, the same trend was observed but the increase was much less pronounced, emphasizing the effect of the phosphorus fertilization on the mesocosm's plankton community. Correlations suggested that both Synechococcus cyanobacteria and heterotrophic bacteria were strongly involved in the production of CDOM and absorption of particulate matter. The increase in phytoplankton activities during the second part of the experiment led to a higher contribution of particulate material in the absorption budget at 442 nm. The three FDOM components identified (tryptophan-, tyrosine- and UVC humic-like fluorophores) did not follow the evolution of CDOM and particulate matter, proving that these were driven by different production

Synthetic study on prion protein fragments using a SPPS and native chemical ligation

Czech Academy of Sciences Publication Activity Database

Zawada, Z.; Šebestík, Jaroslav; Bednárová, Lucie; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan

2009-01-01

Roč. 37, Suppl. 1 (2009), s. 44-44 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /11./. 03.08.2009-07.08.2009, Vienna] Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * SPPS * native chemical ligation * fragments Subject RIV: CC - Organic Chemistry

Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

Science.gov (United States)

Harvey, David J

2005-01-01

Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

Depth profiling of laser-heated chromophores in biological tissues by pulsed photothermal radiometry

International Nuclear Information System (INIS)

Milner, T.E.; Goodman, D.M.; Tanenbaum, B.S.; Nelson, J.S.

1995-01-01

A solution method is proposed to the inverse problem of determining the unknown initial temperature distribution in a laser-exposed test material from measurements provided by infrared radiometry. A Fredholm integral equation of the first kind is derived that relates the temporal evolution of the infrared signal amplitude to the unknown initial temperature distribution in the exposed test material. The singular-value decomposition is used to demonstrate the severely ill-posed nature of the derived inverse problem. Three inversion methods are used to estimate solutions for the initial temperature distribution. A nonnegatively constrained conjugate-gradient algorithm using early termination is found superior to unconstrained inversion methods and is applied to image the depth of laser-heated chromophores in human skin. Key words: constrained conjugate gradients, ill-posed problem, infrared radiometry, laser surgery, nonnegative, singular-value decomposition

DFT calculations on spectroscopic and structural properties of a NLO chromophore

Science.gov (United States)

Altürk, Sümeyye; Avci, Davut; Tamer, Ömer; Atalay, Yusuf

2016-03-01

The molecular geometry optimization, vibrational frequencies and gauge including atomic orbital (GIAO) 1H and 13C NMR chemical shift values of 2-(1'-(4'''-Methoxyphenyl)-5'-(thien-2″-yl)pyrrol-2'-yl)-1,3-benzothiazole as potential nonlinear optical (NLO) material were calculated using density functional theory (DFT) HSEh1PBE method with 6-311G(d,p) basis set. The best of our knowledge, this study have not been reported to date. Additionally, a detailed vibrational study was performed on the basis of potential energy distribution (PED) using VEDA program. It is noteworthy that NMR chemical shifts are quite useful for understanding the relationship between the molecular structure and electronic properties of molecules. The computed IR and NMR spectra were used to determine the types of the experimental bands observed. Predicted values of structural and spectroscopic parameters of the chromophore were compared with each other so as to display the effects of the different substituents on the spectroscopic and structural properties. Obtained data showed that there is an agreement between the predicted and experimental data.

Characterization of chromophoric dissolved organic matter (CDOM) in rainwater using fluorescence spectrophotometry.

Science.gov (United States)

Salve, P R; Lohkare, H; Gobre, T; Bodhe, G; Krupadam, R J; Ramteke, D S; Wate, S R

2012-02-01

The fluorescence excitation-emission matrix of Chromophoric dissolved organic matter (CDOM) samples from rainwater collected at Rameswaram, Tamilnadu, India are analysed. Total five peaks were observed for humic/marine and protein likes substances respectively. The peak A and C intensities varies form 1.98 ± 0.28 and 0.97 ± 0.11 QSU respectively represents humic like substances. The peak B and T intensities varies from 3.94 ± 0.75 and 7.42 ± 1.43 QSU showed association of protein like substances whereas peak M intensities varies from 1.92 ± 0.37 QSU indicates marine contribution. Among the fluorophores, the following sequence were observed as T > B > A > M > C which indicates dominance of Tryptophan like substances in rainwater. The average peak T/C ratios was observed as 7.88 ± 2.2 indicates microbial contamination by Tryptophan-like substances with the high biological activity and low volatility.

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

Recent progress on perturbative QCD fragmentation functions

International Nuclear Information System (INIS)

Cheung, K.

1995-05-01

The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

Fragmentation and flow in central collisions

International Nuclear Information System (INIS)

Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

1987-01-01

Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

Science.gov (United States)

David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

2010-01-01

Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

Physics of projectile fragments

International Nuclear Information System (INIS)

Minamisono, Tadanori

1982-01-01

This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Dimensional crossover in fragmentation

Science.gov (United States)

Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

2000-11-01

Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS.

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H(2)O, NH(3), CH(2)O (from serine), C2H4O (from threonine), and H(3)PO(4), whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H](+) and [M + H - H](-) within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H2O, NH3, CH2O (from serine), C2H4O (from threonine), and H3PO4, whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H]+ and [M + H - H]- within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Dependence creating properties of lipotropin C-fragment (β-endorphin): Evidence for its internal control of behavior

NARCIS (Netherlands)

Ree, J.M. van; Smyth, D.G.; Colpaert, F.C.

1979-01-01

The C-fragment of lipotropin (β-endorphin) possesses reinforcing properties, in that this peptide, like heroin, induced intraventricular self-administering behavior in drug naive rats. Only mild behavioral signs reminiscent of physical dependence were present. After injection into the nucleus raphé

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

Energy Technology Data Exchange (ETDEWEB)

Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

2013-09-21

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

International Nuclear Information System (INIS)

Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

2013-01-01

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

Fragment-based quantitative structure-activity relationship (FB-QSAR) for fragment-based drug design.

Science.gov (United States)

Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen

2009-01-30

In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.

Influence of magma fragmentation on the plume dynamics of Vulcanian explosions

Science.gov (United States)

Scheu, B.; Alatorre-Ibarguengoitia, M.; Dingwell, D. B.

2013-12-01

Mach disk at the vent. During this phase few or no particles are ejected, depending on the position of the sample in the experimental conduit. Ejection of particles usually starts when the Mach disk collapsed or is collapsing and the flow expands at subsonic velocities. Here experiments with and without sample fragmentation show different characteristics. The ejection of unconsolidated particles exhibits a near-homogeneous pattern typical of the expansion of granular material with uniformly decaying ejection velocities of individual particles. In contrast, the ejection of fragmenting samples results heterogeneous patterns, most pronounced in the later stage of ejection. Here individual pulses can be traced with significantly varying ejection velocities. We demonstrate here that this pulsation can be traced back to discrete fragmentation events. Our results yield insights into the internal structure of plumes from short-lived, Vulcanian explosions and should contribute to a better understanding of the plume dynamics with respect to the transition from buoyant to collapsing plumes and their associated hazards.

Study of the shape of fragmentation events in central collisions

International Nuclear Information System (INIS)

Nguyen, A.D.; Durand, D.; Bocage, F.; Bougault, R.; Brou, R.; Colin, J; Cussol, D.; Genouin-Duhamel, E.; Gulminelli, F.; Lecolley, J.F.; Lefort, T.; Le Neindre, N.; Lopez, O.; Louvel, M.; Peter, J.; Steckmeyer, J.C.; Tamain, B.; Vient, E.

1997-01-01

The study of the most central collisions resulting in the fragmentation of nuclear systems requires a precise as highly possible knowledge of the space-time configuration of matter. Particularly, it is important to be able to define the event shapes in order to estimate the equilibrium degree reached by the system in the moment of its breakup. To do that, an tensor analysis was developed end applied to data from INDRA for the system Xe + Sn at 50 MeV/u. The obtained results were compared with the predictions of the SIMON generator. The analysis indicates a quasi-sphericity of the fragmentation source. This result is a convincing evidence in favor of formation of a highly excited system in equilibrium the life-time of which is long enough to relax the shape degrees of freedom as well as the internal freedom degrees. A comparison between the experimental results corresponding to the Xe + Sn central collisions at 50 MeV/u and the predictions of a SIMON calculation for different shapes of the fragmenting source is presented as a function of the variables D and C, which are linear combinations of the eigenvalues of the tensor of the moments used for characterisation of the event shape

Reframing landscape fragmentation's effects on ecosystem services.

Science.gov (United States)

Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

2015-04-01

Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fragment Size Distribution of Blasted Rock Mass

Science.gov (United States)

Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

2017-12-01

Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

Analysis of the fragmentation properties of quark and gluon jets at the CERN SPS panti p collider

International Nuclear Information System (INIS)

Arnison, G.; Albrow, M.G.; Denby, B.; Flynn, P.; Grayer, G.; Haynes, W.; Roberts, C.; Scott, W.; Shah, T.P.; Allkofer, O.C.; Dau, D.; Leuchs, R.; Levegrun, S.; Astbury, A.; Fincke Keeler, M.; Keeler, R.; Sobie, R.; Zanello, L.; Aubert, B.; Catz, P.; Della Negra, M.; Ghez, P.; Gonidec, A.; Linglin, D.; Minard, M.N.; Mours, B.; Perault, C.; Vialle, J.P.; Wingerter, I.; Yvert, M.; Bacci, C.; Ceradini, F.; Ciapetti, G.; Diaccio, A.; Lacava, F.; Moricca, M.; Paoluzi, L.; Piano Mortari, G.; Salvini, G.; Batley, J.R.; Buckley, E.; Eisenhandler, E.; Gibson, W.R.; Honma, A.; Kalmus, P.I.P.; Kyberd, P.; Nandi, A.; Thompson, G.; Bauer, G.; Geer, S.; Goodman, M.; Rohlf, J.; Sumorok, K.; Centro, S.; Bezaguet, A.; Bock, R.K.; Cennini, P.; Cittolin, S.; Demoulin, M.; Hofmann, H.; Jank, W.; Jorat, G.; Levi, M.; Maurin, G.; Meyer, O.; Meyer, T.; Muller, T.; Naumann, L.; Norton, A.; Pauss, F.; Placci, A.; Porte, J.P.; Rich, J.; Rijssenbeek, M.; Rubbia, C.; Sass, J.; Sadoulet, B.; Schinzel, D.; Vuillemin, V.; Wilke, R.; Wyatt, T.; Leveque, A.; Dorenbosch, J.; Holthuizen, D.J.; Eijk, B. van; Cline, D.; Markiewicz, T.; Mohammadi, M.; Cochet, C.; Debeer, M.; Denegri, D.; Givernaud, A.; Laugier, J.P.; Locci, E.; Savoy-Navarro, A.; Verecchia, P.; Corden, M.; Dowell, J.D.; Edgecock, R.; Ellis, N.; Garvey, J.; Homer, R.J.; Kenyon, I.; McMahon, T.; Streets, J.; Watkins, P.; Wilson, J.; Dallman, D.; Fruehwirth, R.; Markytan, M.; Strauss, J.; Szonczo, F.; Wahl, H.D.; Wulz, C.E.; Dobrzynski, L.; Fontaine, G.; Giraud-Heraud, Y.; Kryn, D.; Martin, T.; Mendiburu, J.P.; Sajot, G.; Tao, C.; Vrana, J.; Eggert, K.; Erhard, P.; Faissner, H.; Hansl-Kozanecka, T.; Radermacher, E.; Redelberger, T.; Reithler, H.; Tscheslog, E.; Frey, R.; Guryn, W.; Kernan, A.; Kozanecki, W.; Morgan, K.; Pitman, D.; Ransdell, J.; Sheer, I.; Smith, D.; Karimaeki, V.; Kinnunen, R.; Pietarinen, E.; Pimiae, M.; Tuominiemi, J.; Revol, J.P.; Calvetti, M.; Dibitonto, D.; Ghesquiere, C.; Giboni, K.L.; Hertzberger, L.O.; Hoffmann, D.; Lees, J.P.; Lehmann, H.; Rossi, P.; Stenzler, M.; Timmer, J.; Colas, J.; Kinnunen, R.

1986-01-01

A sample of two-jet events from the UA1 experiment at the CERN panti p Collider has been used to study the fragmentation of high-energy quark and gluon jets into charged hadrons. Compared with lower-energy jets observed in e + e - and pp collisions, the fragmentation function measured in the present experiment is softer (i.e. peaked to smaller values of z) and the mean internal transverse momentum is larger, mainly because of the effects of the QCD scaling violations. Using our knowledge of the quark and gluon structure functions in the proton, together with the QCD matrix elements, a statistical separation of quark and gluon jets is achieved within the present experiment. The fragmentation function for the gluon jets is found to be softer, and the angular spread of the fragmentation products larger, than is the case for quark jets. (orig.)

Cyclometalated N-heterocyclic carbene iridium(iii) complexes with naphthalimide chromophores: a novel class of phosphorescent heteroleptic compounds.

Science.gov (United States)

Lanoë, Pierre-Henri; Chan, Jonny; Groué, Antoine; Gontard, Geoffrey; Jutand, Anny; Rager, Marie-Noelle; Armaroli, Nicola; Monti, Filippo; Barbieri, Andrea; Amouri, Hani

2018-03-06

A series of cyclometalated N-heterocyclic carbene complexes of the general formula [Ir(C^N) 2 (C^C:)] has been prepared. Two sets of compounds were designed, those where (C^C:) represents a bidentate naphthalimide-substituted imidazolylidene ligand and (C^N) = ppy (3a), F2ppy (4a), bzq (5a) and those where (C^C:) represents a naphthalimide-substituted benzimidazolylidene ligand and (C^N) = ppy (3b), F2ppy (4b), bzq (5b). The naphthalimide-imidazole and naphthalimide-benzimidazole ligands 1a,b and the related imidazolium and benzimidazolium salts 2a,b were also prepared and fully characterized. The N-heterocyclic carbene Ir(iii) complexes have been characterized by NMR spectroscopy, cyclic voltammetry and elemental analysis. Moreover, the molecular structures of one imidazolium salt and four Ir(iii) complexes were determined by single-crystal X-ray diffraction. The structures provide us with valuable information, most notably the orientation of the naphthalimide chromophore with respect to the N-heterocyclic carbene moiety. All compounds are luminescent at room temperature and in a frozen solvent at 77 K, exhibiting a broad emission band that extends beyond 700 nm. The presence of the naphthalimide moiety changes the character of the lowest excited state from 3 MLCT to 3 LC, as corroborated by DFT and TD-DFT calculations. Remarkably, replacing imidazole with a benzimidazole unit improves the quantum yields of these compounds by decreasing the k nr values which is an important feature for optimized emission performance. These studies provide valuable insights about a novel class of N-heterocyclic carbene-based luminescent complexes containing organic chromophores and affording metal complexes emitting across the red-NIR range.

Medium-scale melt-sodium fragmentation experiments

International Nuclear Information System (INIS)

Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.

1979-01-01

The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments

An International Relations perspective on the global politics of carbon dioxide capture and storage

Energy Technology Data Exchange (ETDEWEB)

De Coninck, H. [Energy research Centre of the Netherlands ECN, Unit Policy Studies, Radarweg 60, 1043 NT Amsterdam (Netherlands); Baeckstrand, K. [Department of Political Science, Lund University, P.O. Box 52, 221 00 Lund (Sweden)

2011-05-15

With the publication of the IPCC Special Report on Carbon dioxide Capture and Storage (CCS), CCS has emerged as a focal issue in international climate diplomacy and energy collaboration. This paper has two goals. The first goal is to map CCS activities in and among various types of intergovernmental organisations; the second goal is to apply International Relations (IR) theories to explain the growing diversity, overlap and fragmentation of international organisations dealing with CCS. Which international organisations embrace CCS, and which refrain from discussing it at all? What role do these institutions play in bringing CCS forward? Why is international collaboration on CCS so fragmented and weak? We utilise realism, liberal institutionalism and constructivism to provide three different interpretations of the complex global landscape of CCS governance in the context of the similarly complicated architecture of global climate policy. A realist account of CCS's fragmented international politics is power driven. International fossil fuel and energy organisations, dominated by major emitter states, take an active role in CCS. An interest-based approach, such as liberal institutionalism, claims that CCS is part of a 'regime complex' rather than an integrated, hierarchical, comprehensive and international regime. Such a regime complex is exemplified by the plethora of international organisations with a role in CCS. Finally, constructivism moves beyond material and interest-based interpretations of the evolution of the institutionally fragmented architecture of global CCS governance. The 2005 IPCC Special Report on CCS demonstrates the pivotal role that ideas, norms and scientific knowledge have played in transforming the preferences of the international climate-change policy community.

Dual Fragment Impact of PBX Charges

Science.gov (United States)

Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

2017-06-01

Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

International Nuclear Information System (INIS)

Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

2014-01-01

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

Energy Technology Data Exchange (ETDEWEB)

Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

2014-04-10

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Kinetics of anti-carcinoembryonic antigen antibody internalization: effects of affinity, bivalency, and stability

Science.gov (United States)

Schmidt, Michael M.; Thurber, Greg M.

2010-01-01

Theoretical analyses suggest that the cellular internalization and catabolism of bound antibodies contribute significantly to poor penetration into tumors. Here we quantitatively assess the internalization of antibodies and antibody fragments against the commonly targeted antigen carcinoembryonic antigen (CEA). Although CEA is often referred to as a non-internalizing or shed antigen, anti-CEA antibodies and antibody fragments are shown to be slowly endocytosed by LS174T cells with a half-time of 10–16 h, a time scale consistent with the metabolic turnover rate of CEA in the absence of antibody. Anti-CEA single chain variable fragments (scFvs) with significant differences in affinity, stability against protease digestion, and valency exhibit similar uptake rates of bound antibody. In contrast, one anti-CEA IgG exhibits unique binding and trafficking properties with twice as many molecules bound per cell at saturation and significantly faster cellular internalization after binding. The internalization rates measured herein can be used in simple computational models to predict the microdistribution of these antibodies in tumor spheroids. PMID:18408925

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

When and how to operate the posterior malleolus fragment in trimalleolar fractures: a systematic literature review.

Science.gov (United States)

Verhage, Samuel Marinus; Hoogendoorn, Jochem Maarten; Krijnen, Pieta; Schipper, Inger Birgitta

2018-05-12

Whether or not and how to fixate the posterior malleolus fracture seems to depend on the fracture fragment size and its amount of dislocation, but clear guidelines for daily practice are lacking. In this review, we summarize the literature on preferred treatment of the posterior fragment in trimalleolar fractures. A systematic review of publications between January 1995 and April 30 2017 on this topic in the PubMed, Embase, and Cochrane databases was performed according to the PRISMA statement. Seventeen (2 prospective and 15 retrospective) of the 180 identified studies were included. Six studies report on indications for fixation of posterior malleolus fracture fragments. Eleven studies compare different fixation approaches and techniques for the posterior fragment. Meta-analysis was not possible due to varying fixation criteria and outcomes. There was no clear association between posterior fragment size and functional outcome or development of osteoarthritis. The non-anatomical reduction of the fragment was of more influence on outcome. Radiological and functional outcome was better after open reduction and internal fixation via the posterolateral approach than after percutaneous anterior-to-posterior screw fixation. The posterior fragment size is not a clear indication for its fixation. A step-off, however, seems an important indicator for developing posttraumatic osteoarthritis and worse functional outcome. Posterior fragments involving the intra-articular surface need to be reduced and fixated to prevent postoperative persisting step-off. Furthermore, fixation of the posterior malleolus via an open posterolateral approach seems superior to percutaneous anterior-to-posterior fixation. However, these results need to be confirmed in a prospective comparative trial. Therapeutic level II.

Fragmentation functions approach in pQCD fragmentation phenomena

International Nuclear Information System (INIS)

Rolli, S.

1996-07-01

Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

Fragmentation of neck-like structures

International Nuclear Information System (INIS)

Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

1994-01-01

Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

Directory of Open Access Journals (Sweden)

Paula Eveline Ribeiro D’Anunciação

2013-01-01

Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

Fragmentation of Ceramics in Rapid Expansion Mode

Science.gov (United States)

Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

Percolation versus microcanonical fragmentation - comparison of fragment size distribution: Where is the liquid-gas transition in nuclei?

International Nuclear Information System (INIS)

Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin

1990-01-01

The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)

Experimental study on the fragmentation of Adenine and Porphyrin molecules induced by low energy multicharged ion impact

International Nuclear Information System (INIS)

Li, B.

2010-01-01

Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H 5 C 5 N 5 ) and porphyrin chloride FeTPPCl (C 44 H 28 N 4 FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl + and Ade at 3 keV, the fragmentation pattern of Ade 2+ is dominated by the loss of H 2 CN + and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H 2 CN + followed by the emission of HC 2 N 2 . The measured mean excitation energies of this channel and other competitive channels are compared. In Kr 8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL 1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl 0 independent of the initial charge state of FeTPPCl r+ . For the resulted dication FeTPP 2+ , the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the

The formation of planets by disc fragmentation

Directory of Open Access Journals (Sweden)

Stamatellos Dimitris

2013-04-01

Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

Science.gov (United States)

Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

2017-02-01

A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

Resonance Raman spectra of the copper-sulfur chromophores in Achromobacter cycloclastes nitrite reductase.

Science.gov (United States)

Dooley, D M; Moog, R S; Liu, M Y; Payne, W J; LeGall, J

1988-10-15

Resonance Raman spectroscopy at ambient temperature and 77 K has been used to probe the structures of the copper sites in Achromobacter cycloclastes nitrite reductase. This enzyme contains three copper ions per protein molecule and has two principal electronic absorption bands with lambda max values of 458 and 585 nm. Comparisons between the resonance Raman spectra of nitrite reductase and blue copper proteins establish that both the 458 and 585 nm bands are associated with Cu(II)-S(Cys) chromophores. A histidine ligand probably is also present. Different sets of vibrational frequencies are observed with 457.9 nm (ambient) or 476.1 nm (77 K) excitation as compared with 590 nm (ambient) or 593 nm (77 K) excitation. Excitation profiles indicate that the 458 and 585 nm absorption bands are associated with separate [Cu(II)-S(Cys)N(His)] sites or with inequivalent and uncoupled cysteine ligands in the same site. The former possibility is considered to be more likely.

Fluctuations in the fragmentation process

International Nuclear Information System (INIS)

Botet, R.; Ploszajczak, M.

1993-01-01

Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

The spectroscopy of fission fragments

International Nuclear Information System (INIS)

Phillips, W.R.

1998-01-01

High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

[Fragment-based drug discovery: concept and aim].

Science.gov (United States)

Tanaka, Daisuke

2010-03-01

Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

Velocity distribution of fragments of catastrophic impacts

Science.gov (United States)

Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

1992-01-01

Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

Fragmentation in DNA double-strand breaks

International Nuclear Information System (INIS)

Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

2005-01-01

DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

Fragment properties in the fission of 237Np with fast neutrons - an experimental investigation of fission dynamics

International Nuclear Information System (INIS)

Naqvi, A.A.

1980-03-01

Fission fragment properties such as mass distribution, kinetic energy distribution or number of prompt emitted neutrons as a function of fragment mass can be used to characterize the scission point configuration. The present experiment allows for the first time to investigate these quantities for neutron induced fission in the MeV range. In this way the influence of excitation energy of the saddle point deformation of the fissioning system ( 237 Np + n) can be studied. Neutrons with energies of 0.8 and 5.5 MeV were produced by the Karlsruhe pulsed 3MV Van de Graaff accelerator. Kinetic energies and velocities of correlated fragments were determined by solid state detectors using the time-of-flight technique. The experimentally determined distributions of fragment properties were compared to a recent model suggested by Wilkins et al. which assumes only relatively weak coupling between internal and collective degrees of freedom. At least qualitative agreement is found for most of the results. (orig.) [de

Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

Science.gov (United States)

Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

2018-04-01

The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

Current fragmentation in deep inelastic scattering

International Nuclear Information System (INIS)

Hamer, C.J.

1975-04-01

It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

Geographical Journals in Spain : from Tradition to Fragmentation Les revues géographiques en Espagne : de la tradition à la fragmentation

Directory of Open Access Journals (Sweden)

Aurora Garcia Ballesteros

2012-12-01

Full Text Available This article reviews the short and diversified history of the Spanish Geographical journals, within the framework of the general Spanish geographic tradition. During the second half of the 20th Century, a fragmentation of the university Geography groups took place with a multiplication of journals. This fragmentation appears as a big difficulty to reinforce and internationally disseminate the main results of Spanish geographical research. Through the most popular journals database it is possible to evaluate the impact of these Spanish journals, which is always very little. Some conclusions related to language and content problems are advanced in order to improve the knowledge of the great and diversified Spanish geography all around the world.Cet article analyse l’évolution brève et diversifiée des revues de géographie espagnoles, dans le contexte général de la tradition géographique. À partir de la deuxième moitié du XXème siècle il y eu une fragmentation des groupes de géographes universitaires ce qui a produit une multiplication des revues. Cette fragmentation devient la difficulté majeure pour l’internationalisation et la diffusion des principaux résultats de la recherche géographique espagnole. À travers des bases de données de revues les plus connues on a pu évaluer l’impact des revues espagnoles, qui est toujours très réduit. On avance finalement quelques conclusions relatives aux problèmes de la langue et des contenus de la majorité des articles des revues espagnoles comme explication de la méconnaissance de l’importance et de la diversité de la géographie espagnole dans le monde actuel.

Fragment emission from modestly excited nuclear systems

Energy Technology Data Exchange (ETDEWEB)

Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

1996-07-08

Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

The spectroscopy of fission fragments

Energy Technology Data Exchange (ETDEWEB)

Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

1998-12-31

High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

Endovascular Removal of Fractured Inferior Vena Cava Filter Fragments: 5-Year Registry Data with Prospective Outcomes on Retained Fragments.

Science.gov (United States)

Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T

2018-06-01

To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically

Fragment Length of Circulating Tumor DNA.

Science.gov (United States)

Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

2016-07-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Kaon fragmentation function from NJL-jet model

International Nuclear Information System (INIS)

Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

2010-01-01

The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

Fragmentation of rotating protostellar clouds

International Nuclear Information System (INIS)

Tohline, J.E.

1980-01-01

We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

Fragment-based approaches to TB drugs.

Science.gov (United States)

Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

2018-02-01

Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

The Zero-Degree Detector system for fragmentation studies

International Nuclear Information System (INIS)

Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.

2007-01-01

The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan

Introduction to fragment-based drug discovery.

Science.gov (United States)

Erlanson, Daniel A

2012-01-01

Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.

Mechanisms Affecting Population Density in Fragmented Habitat

Directory of Open Access Journals (Sweden)

Lutz Tischendorf

2005-06-01

Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

Rhenium complexes of chromophore-appended dipicolylamine ligands: syntheses, spectroscopic properties, DNA binding and X-ray crystal structure

International Nuclear Information System (INIS)

Mullice, L.A.; Buurma, N.J.; Pope, S.J.A.; Laye, R.H.; Harding, L.P.

2008-01-01

The syntheses of two chromophore-appended dipicolylamine-derived ligands and their reactivity with penta-carbonyl-chloro-rhenium have been studied. The resultant complexes each possess the fac-Re(CO) 3 core. The ligands L 1 1-[bis(pyridine-2-yl-methyl)amino]methyl-pyrene and L 2 2-[bis(pyridine-2-yl-methyl)amino]methyl-quinoxaline were isolated via a one-pot reductive amination in moderate yield. The corresponding rhenium complexes were isolated in good yields and characterised by 1 H NMR, MS, IR and UV-Vis studies. X-Ray crystallographic data were obtained for fac-{Re(CO) 3 (L 1 )}(BF 4 ), C 34 H 26 BF 4 N 4 O 3 Re: monoclinic, P2(1)/c, a 18.327(2) Angstroms, α = 90.00 degrees, b 14.1537(14) Angstroms, β96.263(6) degrees, c = 23.511(3) Angstroms, γ 90.00 Angstroms, 6062.4(11) (Angstroms) 3 , Z=8. The luminescence properties of the ligands and complexes were also investigated, with the emission attributed to the appended chromophore in each case. Isothermal titration calorimetry suggests that fac-{Re(CO) 3 (L 1 )}(BF 4 ) self-aggregates cooperatively in aqueous solution, probably forming micelle-like aggregates with a cmc of 0.18 mM. Investigations into the DNA-binding properties of fac-{Re(CO) 3 (L 1 )}(BF 4 ) were undertaken and revealed that fac-{Re(CO) 3 (L 1 )}(BF 4 ) binding to fish sperm DNA (binding constant 1.5 ± 0.2 * 10 5 M -1 , binding site size 3.2 ± 0.3 base pairs) is accompanied by changes in the UV-Vis spectrum as typically observed for pyrene-based intercalators while the calorimetrically determined binding enthalpy (-14 ± 2 kcal mol -1 ) also agrees favourably with values as typically found for intercalators. (authors)

Removal of Chromophore-proximal Polar Atoms Decreases Water Content and Increases Fluorescence in a Near Infrared Phytofluor

Directory of Open Access Journals (Sweden)

Heli eLehtivuori

2015-11-01

Full Text Available Genetically encoded fluorescent markers have revolutionized cell and molecular biology due to their biological compatibility, controllable spatiotemporal expression, and photostability. To achieve in vivo imaging in whole animals, longer excitation wavelength probes are needed due to the superior ability of near infrared light to penetrate tissues unimpeded by absorbance from biomolecules or autofluorescence of water. Derived from near infrared-absorbing bacteriophytochromes, phytofluors are engineered to fluoresce in this region of the electromagnetic spectrum, although high quantum yield remains an elusive goal. An invariant aspartate residue is of utmost importance for photoconversion in native phytochromes, presumably due to the proximity of its backbone carbonyl to the pyrrole ring nitrogens of the biliverdin (BV chromophore as well as the size and charge of the side chain. We hypothesized that the polar interaction network formed by the charged side chain may contribute to the decay of the excited state via proton transfer. Thus, we chose to further probe the role of this amino acid by removing all possibility for polar interactions with its carboxylate side chain by incorporating leucine instead. The resultant fluorescent protein, WiPhy2, maintains BV binding, monomeric status, and long maximum excitation wavelength while minimizing undesirable protoporphyrin IXα binding in cells. A crystal structure and time-resolved fluorescence spectroscopy reveal that water near the BV chromophore is excluded and thus validate our hypothesis that removal of polar interactions leads to enhanced fluorescence by increasing the lifetime of the excited state. This new phytofluor maintains its fluorescent properties over a broad pH range and does not suffer from photobleaching. WiPhy2 achieves the best compromise to date between high fluorescence quantum yield and long illumination wavelength in this class of fluorescent proteins.

Genetic analysis reveals demographic fragmentation of grizzly bears yielding vulnerably small populations.

Science.gov (United States)

Proctor, Michael F; McLellan, Bruce N; Strobeck, Curtis; Barclay, Robert M R

2005-11-22

Ecosystem conservation requires the presence of native carnivores, yet in North America, the distributions of many larger carnivores have contracted. Large carnivores live at low densities and require large areas to thrive at the population level. Therefore, if human-dominated landscapes fragment remaining carnivore populations, small and demographically vulnerable populations may result. Grizzly bear range contraction in the conterminous USA has left four fragmented populations, three of which remain along the Canada-USA border. A tenet of grizzly bear conservation is that the viability of these populations requires demographic linkage (i.e. inter-population movement of both sexes) to Canadian bears. Using individual-based genetic analysis, our results suggest this demographic connection has been severed across their entire range in southern Canada by a highway and associated settlements, limiting female and reducing male movement. Two resulting populations are vulnerably small (bear populations may be more threatened than previously thought and that conservation efforts must expand to include international connectivity management. They also demonstrate the ability of genetic analysis to detect gender-specific demographic population fragmentation in recently disturbed systems, a traditionally intractable yet increasingly important ecological measurement worldwide.

Quark fragmentation in e+e- collisions

International Nuclear Information System (INIS)

Oddone, P.

1984-12-01

This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

International Nuclear Information System (INIS)

Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

1993-10-01

Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

Ternary-fragmentation-driving potential energies of 252Cf

Science.gov (United States)

Karthikraj, C.; Ren, Zhongzhou

2017-12-01

Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

Architectural fragments

DEFF Research Database (Denmark)

Bang, Jacob Sebastian

2018-01-01

I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

The global distribution and dynamics of chromophoric dissolved organic matter.

Science.gov (United States)

Nelson, Norman B; Siegel, David A

2013-01-01

Chromophoric dissolved organic matter (CDOM) is a ubiquitous component of the open ocean dissolved matter pool, and is important owing to its influence on the optical properties of the water column, its role in photochemistry and photobiology, and its utility as a tracer of deep ocean biogeochemical processes and circulation. In this review, we discuss the global distribution and dynamics of CDOM in the ocean, concentrating on developments in the past 10 years and restricting our discussion to open ocean and deep ocean (below the main thermocline) environments. CDOM has been demonstrated to exert primary control on ocean color by its absorption of light energy, which matches or exceeds that of phytoplankton pigments in most cases. This has important implications for assessing the ocean biosphere via ocean color-based remote sensing and the evaluation of ocean photochemical and photobiological processes. The general distribution of CDOM in the global ocean is controlled by a balance between production (primarily microbial remineralization of organic matter) and photolysis, with vertical ventilation circulation playing an important role in transporting CDOM to and from intermediate water masses. Significant decadal-scale fluctuations in the abundance of global surface ocean CDOM have been observed using remote sensing, indicating a potentially important role for CDOM in ocean-climate connections through its impact on photochemistry and photobiology.

Mechanical energy release and fuel fragmentation in high energy deposition into fuel under a reactivity initiated accident condition

International Nuclear Information System (INIS)

Tsuruta, Takaharu; Saito, Shinzo; Ochiai, Masaaki

1985-01-01

The fuel fragmentation is one of important subjects to be studied, since it is one of basic processes of molten fuel-coolant interaction (MFCI) and it has not yet been made clear enough. Accordingly, UO 2 fuel fragmentation was studied in the NSRR experiments simulating a reactivity initiated accident (RIA). As results of the experiments, the distribution of the size of fuel fragments was obtained and the mechanism of fuel fragmentation was discussed as described below. It was revealed that the distribution was well displayed in the form of logarithmic Rosin-Rammler's distribution law. It was shown that the conversion ratio from thermal energy to mechanical in the experiment was in inverse propotion to the volume-surface mean diameter defined as a ratio of the total volume of fragments to the total surface. Consequently, it was confirmed that the mean diameter was proper as an index for the degree of the fuel fragmentation. It was also pointed out that the Weber-type hydraulic instability model for fragmentation was consistent with the experimental results. The mechanism of the fuel fragmentation is understood as follows. Cladding tube is ruptured due to the increase in rod pressure when fuel is molten, and then molten fuel spouts through the openings in the form of jet. As a result of molten fuel spouting, fuel is fragmented by the Weber-type of hydraulic instability. The model well explains the effects of experimental parameters as heat deposition, subcooling of cooling water and capsule diameter, on the fuel fragmentation. According to the model, fuel fragments have to be spherical. There were many spherical particles which had hollow and burst crack. This may be due to internal burst during solidification process. The items which should be studied further are also described in the end of this report. (author)

The dynamics of fragment formation

International Nuclear Information System (INIS)

Keane, D.

1994-09-01

We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

An Unprecedented Blue Chromophore Found in Nature using a "Chemistry First" and Molecular Networking Approach: Discovery of Dactylocyanines A-H.

Science.gov (United States)

Bonneau, Natacha; Chen, Guanming; Lachkar, David; Boufridi, Asmaa; Gallard, Jean-François; Retailleau, Pascal; Petek, Sylvain; Debitus, Cécile; Evanno, Laurent; Beniddir, Mehdi A; Poupon, Erwan

2017-10-17

Guided by a "chemistry first" approach using molecular networking, eight new bright-blue colored natural compounds, namely dactylocyanines A-H (3-10), were isolated from the Polynesian marine sponge Dactylospongia metachromia. Starting from ilimaquinone (1), an hemisynthetic phishing probe (2) was prepared for annotating and matching structurally related natural substances in D. metachromia crude extract network. This strategy allowed characterizing for the first time in Nature the blue zwitterionic quinonoid chromophore. The solvatochromic properties of the latter are reported. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Probing ultrafast ππ*/nπ* internal conversion in organic chromophores via K-edge resonant absorption

DEFF Research Database (Denmark)

Wolf, T. J. A.; Myhre, Rolf H.; Cryan, J. P.

2017-01-01

-edge soft X-ray absorption spectroscopy. As a hole forms in the n orbital during ππ*/nπ* internal conversion, the absorption spectrum at the heteroatom K-edge exhibits an additional resonance. We demonstrate the concept using the nucleobase thymine at the oxygen K-edge, and unambiguously show that ππ...

Observation of the dynamic movement of fragmentations by high-speed camera and high-speed video

Science.gov (United States)

Suk, Chul-Gi; Ogata, Yuji; Wada, Yuji; Katsuyama, Kunihisa

1995-05-01

The experiments of blastings using mortal concrete blocks and model concrete columns were carried out in order to obtain technical information on fragmentation caused by the blasting demolition. The dimensions of mortal concrete blocks were 1,000 X 1,000 X 1,000 mm. Six kinds of experimental blastings were carried out using mortal concrete blocks. In these experiments precision detonators and No. 6 electric detonators with 10 cm detonating fuse were used and discussed the control of fragmentation. As the results of experiment it was clear that the flying distance of fragmentation can be controlled using a precise blasting system. The reinforced concrete model columns for typical apartment houses in Japan were applied to the experiments. The dimension of concrete test column was 800 X 800 X 2400 mm and buried 400 mm in the ground. The specified design strength of the concrete was 210 kgf/cm2. These columns were exploded by the blasting with internal loading of dynamite. The fragmentation were observed by two kinds of high speed camera with 500 and 2000 FPS and a high speed video with 400 FPS. As one of the results in the experiments, the velocity of fragmentation, blasted 330 g of explosive with the minimum resisting length of 0.32 m, was measured as much as about 40 m/s.

Human Albumin Fragments Nanoparticles as PTX Carrier for Improved Anti-cancer Efficacy

Directory of Open Access Journals (Sweden)

Liang Ge

2018-06-01

Full Text Available For enhanced anti-cancer performance, human serum albumin fragments (HSAFs nanoparticles (NPs were developed as paclitaxel (PTX carrier in this paper. Human albumins were broken into fragments via degradation and crosslinked by genipin to form HSAF NPs for better biocompatibility, improved PTX drug loading and sustained drug release. Compared with crosslinked human serum albumin NPs, the HSAF-NPs showed relative smaller particle size, higher drug loading, and improved sustained release. Cellular and animal results both indicated that the PTX encapsulated HSAF-NPs have shown good anti-cancer performance. And the anticancer results confirmed that NPs with fast cellular internalization showed better tumor inhibition. These findings will not only provide a safe and robust drug delivery NP platform for cancer therapy, but also offer fundamental information for the optimal design of albumin based NPs.

Heavy fragment radioactivity

International Nuclear Information System (INIS)

Silisteanu, I.

1991-06-01

The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

An Algebra for Program Fragments

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

1985-01-01

Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

Fragment Impact Toolkit (FIT)

Energy Technology Data Exchange (ETDEWEB)

Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-09-05

The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

A model for projectile fragmentation

International Nuclear Information System (INIS)

Chaudhuri, G; Mallik, S; Gupta, S Das

2013-01-01

A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

Gamma Radiation from Fission Fragments

International Nuclear Information System (INIS)

Higbie, Jack

1969-10-01

The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

Gamma Radiation from Fission Fragments

Energy Technology Data Exchange (ETDEWEB)

Higbie, Jack

1969-10-15

The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

Anisotropy in highly charged ion induced molecule fragmentation

International Nuclear Information System (INIS)

Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

2006-01-01

Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

Absolute fragmentation cross sections in atom-molecule collisions: Scaling laws for non-statistical fragmentation of polycyclic aromatic hydrocarbon molecules

Energy Technology Data Exchange (ETDEWEB)

Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)

2014-06-14

We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.

Remarks about the hypothesis of limiting fragmentation

International Nuclear Information System (INIS)

Chou, T.T.; Yang, C.N.

1987-01-01

Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

Polarization and alignment of nucleus fission fragments

International Nuclear Information System (INIS)

Barabanov, A.L.; Grechukhin, D.P.

1987-01-01

Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

Nuclear energy release from fragmentation

Energy Technology Data Exchange (ETDEWEB)

Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

2016-08-15

It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

Adhesion of axolemmal fragments to Schwann cells: a signal- and target-specific process closely linked to axolemmal induction of Schwann cell mitosis

International Nuclear Information System (INIS)

Sobue, G.; Pleasure, D.

1985-01-01

Radioiodinated rat CNS axolemmal fragments adhered to cultured rat Schwann cells by a time-, temperature-, and concentration-dependent process independent of extracellular ionized calcium. Adhesion showed target and signal specificity; axolemmal fragments adhered to endoneurial or dermal fibroblasts to a much lesser extent than to Schwann cells, and plasma membrane fragments from skeletal muscle, erythrocytes, or PNS myelin adhered to Schwann cells to a lesser extent than did axolemmal fragments. Brief trypsinization removed 94 to 97% of bound radioactivity from Schwann cells previously incubated with 125 I-axolemmal fragments for up to 24 hr, indicating that adhesion was largely a surface phenomenon rather than the result of rapid internalization of axolemmal fragments by the Schwann cells. When adhesion was compared to the axolemmal mitogenic response of Schwann cells, the concentration of axolemmal fragments yielding half-maximal adhesion was the same as the concentration producing half-maximal stimulation of Schwann cell mitosis. Trypsin digestion, homogenization, or heating of axolemmal fragments before application to cultured Schwann cells diminished adhesion and axolemmal fragment-induced stimulation of Schwann cell mitosis in a parallel fashion. Whereas adhesion of axolemmal fragments to the surfaces of the cultured Schwann cells reached completion within 4 hr in this assay system, induction of Schwann cell mitosis by the fragments required contact with Schwann cells for a minimum of 6 to 8 hr and reached a maximum when the axolemmal fragments had adhered to the Schwann cells for 24 hr or more

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Dihadron fragmentation function and its evolution

International Nuclear Information System (INIS)

Majumder, A.; Wang Xinnian

2004-01-01

Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest

SCEDS: protein fragments for molecular replacement in Phaser

Energy Technology Data Exchange (ETDEWEB)

McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

2013-11-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

SCEDS: protein fragments for molecular replacement in Phaser

International Nuclear Information System (INIS)

McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

2013-01-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

Fluorescence and absorption properties of chromophoric dissolved organic matter (CDOM) in coastal surface waters of the Northwestern Mediterranean Sea (Bay of Marseilles, France)

OpenAIRE

J. Para; P. G. Coble; B. Charrière; M. Tedetti; C. Fontana; R. Sempéré

2010-01-01

Seawater samples were collected in surface waters (2 and 5 m depths) of the Bay of Marseilles (Northwestern Mediterranean Sea; 5°17′30′′ E, 43°14′30′′ N) during one year from November 2007 to December 2008 and studied for total organic carbon (TOC) as well as chromophoric dissolved organic matter (CDOM) optical properties (absorbance and fluorescence). The annual mean value of surface CDOM absorption coefficient ...

Evolution equations for extended dihadron fragmentation functions

International Nuclear Information System (INIS)

Ceccopieri, F.A.; Bacchetta, A.

2007-03-01

We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

Quantitative experimental modelling of fragmentation during explosive volcanism

Science.gov (United States)

Thordén Haug, Ø.; Galland, O.; Gisler, G.

2012-04-01

Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of

Impact failure and fragmentation properties of metals

Energy Technology Data Exchange (ETDEWEB)

Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

1998-03-01

In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

Predicting "Hot" and "Warm" Spots for Fragment Binding.

Science.gov (United States)

Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

2017-05-11

Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

Scaling and critical behaviour in nuclear fragmentation

International Nuclear Information System (INIS)

Campi, X.

1990-09-01

These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

The politics of municipal fragmentation in Ghana

Directory of Open Access Journals (Sweden)

Abdulai Kuyini Mohammed

2015-06-01

Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

Computational design and elaboration of a de novo heterotetrameric alpha-helical protein that selectively binds an emissive abiological (porphinato)zinc chromophore.

Science.gov (United States)

Fry, H Christopher; Lehmann, Andreas; Saven, Jeffery G; DeGrado, William F; Therien, Michael J

2010-03-24

The first example of a computationally de novo designed protein that binds an emissive abiological chromophore is presented, in which a sophisticated level of cofactor discrimination is pre-engineered. This heterotetrameric, C(2)-symmetric bundle, A(His):B(Thr), uniquely binds (5,15-di[(4-carboxymethyleneoxy)phenyl]porphinato)zinc [(DPP)Zn] via histidine coordination and complementary noncovalent interactions. The A(2)B(2) heterotetrameric protein reflects ligand-directed elements of both positive and negative design, including hydrogen bonds to second-shell ligands. Experimental support for the appropriate formulation of [(DPP)Zn:A(His):B(Thr)](2) is provided by UV/visible and circular dichroism spectroscopies, size exclusion chromatography, and analytical ultracentrifugation. Time-resolved transient absorption and fluorescence spectroscopic data reveal classic excited-state singlet and triplet PZn photophysics for the A(His):B(Thr):(DPP)Zn protein (k(fluorescence) = 4 x 10(8) s(-1); tau(triplet) = 5 ms). The A(2)B(2) apoprotein has immeasurably low binding affinities for related [porphinato]metal chromophores that include a (DPP)Fe(III) cofactor and the zinc metal ion hemin derivative [(PPIX)Zn], underscoring the exquisite active-site binding discrimination realized in this computationally designed protein. Importantly, elements of design in the A(His):B(Thr) protein ensure that interactions within the tetra-alpha-helical bundle are such that only the heterotetramer is stable in solution; corresponding homomeric bundles present unfavorable ligand-binding environments and thus preclude protein structural rearrangements that could lead to binding of (porphinato)iron cofactors.

Heart Rate Fragmentation: A Symbolic Dynamical Approach

Directory of Open Access Journals (Sweden)

Madalena D. Costa

2017-11-01

Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

Baculovirus display of functional antibody Fab fragments.

Science.gov (United States)

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

Molten aluminum alloy fuel fragmentation experiments

International Nuclear Information System (INIS)

Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

1992-01-01

Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

Simulations of High Speed Fragment Trajectories

Science.gov (United States)

Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

2017-11-01

Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission

Energy Technology Data Exchange (ETDEWEB)

Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)

1998-12-01

Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}

Image analysis of skin color heterogeneity focusing on skin chromophores and the age-related changes in facial skin.

Science.gov (United States)

Kikuchi, Kumiko; Masuda, Yuji; Yamashita, Toyonobu; Kawai, Eriko; Hirao, Tetsuji

2015-05-01

Heterogeneity with respect to skin color tone is one of the key factors in visual perception of facial attractiveness and age. However, there have been few studies on quantitative analyses of the color heterogeneity of facial skin. The purpose of this study was to develop image evaluation methods for skin color heterogeneity focusing on skin chromophores and then characterize ethnic differences and age-related changes. A facial imaging system equipped with an illumination unit and a high-resolution digital camera was used to develop image evaluation methods for skin color heterogeneity. First, melanin and/or hemoglobin images were obtained using pigment-specific image-processing techniques, which involved conversion from Commission Internationale de l'Eclairage XYZ color values to melanin and/or hemoglobin indexes as measures of their contents. Second, a spatial frequency analysis with threshold settings was applied to the individual images. Cheek skin images of 194 healthy Asian and Caucasian female subjects were acquired using the imaging system. Applying this methodology, the skin color heterogeneity of Asian and Caucasian faces was characterized. The proposed pigment-specific image-processing techniques allowed visual discrimination of skin redness from skin pigmentation. In the heterogeneity analyses of cheek skin color, age-related changes in melanin were clearly detected in Asian and Caucasian skin. Furthermore, it was found that the heterogeneity indexes of hemoglobin were significantly higher in Caucasian skin than in Asian skin. We have developed evaluation methods for skin color heterogeneity by image analyses based on the major chromophores, melanin and hemoglobin, with special reference to their size. This methodology focusing on skin color heterogeneity should be useful for better understanding of aging and ethnic differences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Fragment-Specific Fixation Versus Volar Locking Plates in Primarily Nonreducible or Secondarily Redisplaced Distal Radius Fractures: A Randomized Controlled Study.

Science.gov (United States)

Landgren, Marcus; Abramo, Antonio; Geijer, Mats; Kopylov, Philippe; Tägil, Magnus

2017-03-01

To compare the patient-reported, clinical, and radiographic outcome of 2 methods of internal fixation in distal radius fractures. Fifty patients, mean age 56 years (range, 21-69 years) with primarily nonreducible or secondarily redisplaced distal radius fractures were randomized to open reduction internal fixation using volar locking plates (n = 25) or fragment-specific fixation (n = 25). The patients were assessed on grip strength, range of motion, patient-reported outcome (Quick Disabilities of the Arm, Shoulder, and Hand), pain (visual analog scale), health-related quality of life (Short Form-12 [SF-12]), and radiographic evaluation. Grip strength at 12 months was the primary outcome measure. At 12 months, no difference was found in grip strength, which was 90% of the uninjured side in the volar plate group and 87% in the fragment-specific fixation group. No differences were found in range of motion and the median Quick Disabilities of the Arm, Shoulder, and Hand score was 5 in both groups. The overall complication rate was significant, 21% in the volar locking plate group, compared with 52% in the fragment-specific group. In treatment of primarily nonreducible or secondarily redisplaced distal radius fractures, volar locking plates and fragment-specific fixation both achieve good and similar patient-reported outcomes, although more complications were recorded in the fragment-specific group. Therapeutic II. Copyright © 2017 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

Microstructural characterization of pipe bomb fragments

International Nuclear Information System (INIS)

Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

2010-01-01

Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

[Study on optical characteristics of chromophoric dissolved organic matter (CDOM) in rainwater by fluorescence excitation-emission matrix and absorbance spectroscopy].

Science.gov (United States)

Cheng, Yuan-yue; Guo, Wei-dong; Long, Ai-min; Chen, Shao-yong

2010-09-01

The optical characteristics of chromophoric dissolved organic matter (CDOM) were determined in rain samples collected in Xiamen Island, during a rainy season in 2007, using fluorescence excitation-emission matrix spectroscopy associated with UV-Vis absorbance spectra. Results showed that the absorbance spectra of CDOM in rain samples decreased exponentially with wavelength. The absorbance coefficient at 300 nm [a(300)] ranged from 0.27 to 3.45 m(-1), which would be used as an index of CDOM abundance, and the mean value was 1.08 m(-1). The content of earlier stage of precipitation events was higher than that of later stage of precipitation events, which implied that anthropogenic sources or atmospheric pollution or air mass types were important contributors to CDOM levels in precipitation. EEMs spectra showed 4 types of fluorescence signals (2 humic-like fluorescence peaks and 2 protein-like fluorescence peaks) in rainwater samples, and there were significant positive correlations of peak A with C and peak B with S, showing their same sources or some relationship of the two humic-like substance and the two protein-like substance. The strong positive correlations of the two humic-like fluorescence peaks with a(300), suggested that the chromophores responsible for absorbance might be the same as fluorophores responsible for fluorescence. Results showed that the presence of highly absorbing and fluorescing CDOM in rainwater is of significant importance in atmospheric chemistry and might play a previously unrecognized role in the wavelength dependent spectral attenuation of solar radiation by atmospheric waters.

Cryobiology of coral fragments.

Science.gov (United States)

Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

2013-02-01

Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.

Science.gov (United States)

The, Matthew; Käll, Lukas

2016-03-04

Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).

Fragment approaches in structure-based drug discovery

International Nuclear Information System (INIS)

Hubbard, Roderick E.

2008-01-01

Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets

A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.

Science.gov (United States)

Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T

1999-02-01

Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.

Fragmentation properties of 6Li

International Nuclear Information System (INIS)

Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

1987-01-01

The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

Geometrical scaling of jet fragmentation photons

Energy Technology Data Exchange (ETDEWEB)

Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

2016-12-15

We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

Bespoke Fragments

DEFF Research Database (Denmark)

Kruse Aagaard, Anders

2017-01-01

The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

Fracture mechanics model of fragmentation

International Nuclear Information System (INIS)

Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

1986-01-01

A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

Polymer fragmentation in extensional flow

Energy Technology Data Exchange (ETDEWEB)

Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

2001-06-01

In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

Heavy-Quark Production in the Target Fragmentation Region

CERN Document Server

Graudenz, Dirk

1997-01-01

Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin : Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry

NARCIS (Netherlands)

Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.

2016-01-01

Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for

Experimental modelling of fragmentation applied to volcanic explosions

Science.gov (United States)

Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.

2013-12-01

Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.

Neighbouring charge fragmentations in low energy fission

International Nuclear Information System (INIS)

Montoya, M.

1986-10-01

Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

Aspect Ratio Dependence of Impact Fragmentation

International Nuclear Information System (INIS)

Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

1997-01-01

A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

Fragment-assisted hit investigation involving integrated HTS and fragment screening: Application to the identification of phosphodiesterase 10A (PDE10A) inhibitors.

Science.gov (United States)

Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S

2016-01-01

Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gluon fragmentation in T(1S) decays

International Nuclear Information System (INIS)

Bienlein, J.K.

1983-05-01

In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

Fragmentation of Relativistic 56Fe Nuclei in Emulsion

International Nuclear Information System (INIS)

Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.

1983-03-01

Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)

Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

International Nuclear Information System (INIS)

Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

1983-01-01

Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

The role of fragmentation mechanism in large-scale vapor explosions

International Nuclear Information System (INIS)

Liu, Jie

2003-01-01

A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)

Memory effects in nuclear fragmentation?

International Nuclear Information System (INIS)

Colonna, M.; Di Toro, M.; Guarnera, A.

1994-01-01

A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

Origin of fragments in multifragmentation reactions

International Nuclear Information System (INIS)

Zbiri, K.; Aichelin, J.

2003-01-01

Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

Gluon fragmentation into 3 PJ quarkonium

International Nuclear Information System (INIS)

Ma, J.P.

1995-01-01

The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

Origin of fragments in multifragmentation reactions

International Nuclear Information System (INIS)

Zbiri, K.; Aichelin, J.

2005-01-01

Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

Fuel fragmentation data review and separate effects testing

International Nuclear Information System (INIS)

Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

2014-01-01

A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

High-throughput fragment screening by affinity LC-MS.

Science.gov (United States)

Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten

2013-02-01

Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.

Biological effectiveness of high-energy protons - Target fragmentation

International Nuclear Information System (INIS)

Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.

1991-01-01

High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs

Fragmentation of molten core material by sodium

International Nuclear Information System (INIS)

Chu, T.Y.

1982-01-01

A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

Quark fragmentation functions in NJL-jet model

Science.gov (United States)

Bentz, Wolfgang; Matevosyan, Hrayr; Thomas, Anthony

2014-09-01

We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. Supported by Grant in Aid for Scientific Research, Japanese Ministry of Education, Culture, Sports, Science and Technology, Project No. 20168769.

Fragment-based drug discovery using rational design.

Science.gov (United States)

Jhoti, H

2007-01-01

Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

The Potential Applications of Real-Time Monitoring of Water Quality in a Large Shallow Lake (Lake Taihu, China) Using a Chromophoric Dissolved Organic Matter Fluorescence Sensor

OpenAIRE

Niu, Cheng; Zhang, Yunlin; Zhou, Yongqiang; Shi, Kun; Liu, Xiaohan; Qin, Boqiang

2014-01-01

This study presents results from field surveys performed over various seasons in a large, eutrophic, shallow lake (Lake Taihu, China) using an in situ chromophoric dissolved organic matter (CDOM) fluorescence sensor as a surrogate for other water quality parameters. These measurements identified highly significant empirical relationships between CDOM concentration measured using the in situ fluorescence sensor and CDOM absorption, fluorescence, dissolved organic carbon (DOC), chemical oxygen ...

Critical Features of Fragment Libraries for Protein Structure Prediction.

Science.gov (United States)

Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

2017-01-01

The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

Developments in SPR Fragment Screening.

Science.gov (United States)

Chavanieu, Alain; Pugnière, Martine

2016-01-01

Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

The VERDI fission fragment spectrometer

Directory of Open Access Journals (Sweden)

Frégeau M.O.

2013-12-01

Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

A linear relationship between crystal size and fragment binding time observed crystallographically: implications for fragment library screening using acoustic droplet ejection.

Directory of Open Access Journals (Sweden)

Krystal Cole

Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.

Fractures Due to Gunshot Wounds: Do Retained Bullet Fragments Affect Union?

Science.gov (United States)

Riehl, John T; Connolly, Keith; Haidukewych, George; Koval, Ken

2015-01-01

Many types of projectiles, including modern hollow point bullets, fragment into smaller pieces upon impact, particularly when striking bone. This study was performed to examine the effect on time to union with retained bullet material near a fracture site in cases of gunshot injury. All gunshot injuries operatively treated with internal fixation at a Level 1 Trauma Center between March 2008 and August 2011 were retrospectively reviewed. Retained bullet load near the fracture site was calculated based on percentage of material retained compared to the cortical diameter of the involved bone. Analyses were performed to assess the effect of the lead-cortical ratio and amount of comminution on time to fracture union. Thirty-two patients (34 fractures) met the inclusion criteria, with an equal number of comminuted (17) and non-comminuted fractures (17). Seventeen of 34 fractures (50%) united within 4 months, 16/34 (47%) developed a delayed union, and 1/34 (3%) developed a nonunion requiring revision surgery. Sixteen of 17 fractures (94%) that united by 4 months had a cumulative amount of bullet fragmentation retained near the fracture site of less than 20% of the cortical diameter. Nine out of 10 fractures (90%) with retained fragments near the fracture site was equal to or exceeding 20% of the cortical diameter had delayed or nonunion. Fracture comminution had no effect on time to union. The quantity of retained bullet material near the fracture site was more predictive of the rate of fracture union than was comminution. Fractures with bullet fragmentation equal to or exceeding 20% of the cortical width demonstrated a significantly higher rate of delayed union/nonunion compared to those fractures with less retained bullet material, which may indicate a local cytotoxic effect from lead on bone healing. These findings may influence decisions on timing of secondary surgeries. Level III.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

Science.gov (United States)

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

Effective Fragmentation and Flyrock Control Strategies at Quarries

Directory of Open Access Journals (Sweden)

Sedat Esen

2017-01-01

Full Text Available This paper presents the effective fragmentation and flyrock control strategies that could be applied at quarries to improve the productivity and safety. Fragmentation measurement and modelling as well as a comprehensive drill and blast audit are essential for improving the fragmentation. Face profiling and bore tracking are good tools to manage the ―as-designed‖ and ―as-drilled‖ conditions to get reasonable fragmentation from face burden zone and minimise the flyrock risk. In general, a large scatter in fragmentation data was observed at sites and the causes should be analysed by a detailed root-cause analysis technique. Two case studies were presented in this paper showing some of the effective fragmentation strategies. Finally, a flyrock model was shown to determine the safe blast exclusion zone for the mining equipment and personnel. Some key guidelines were suggested to minimise the occurrence of the flyrock.

Analysis of the fragmentation of hot drops with film boiling in a water flow

International Nuclear Information System (INIS)

Malmazet, Erik de

2009-01-01

The goal of this work is to study different aspects of the fragmentation of very hot drops placed in a uniform flow, a phenomenon related to vapor explosion studies. First, a theoretical study of the isothermal hydrodynamic fragmentation of drops by the Boundary Layer Stripping (BLS) mechanism is done by developing two models. The first model, contrary to past studies which dismissed the BLS, includes deformation and acceleration effects and this is shown to greatly enhance the mass loss by BLS, which enables this mechanism to become a much more effective mechanism when the external flow is gaseous. But it is still ineffective in the liquid case. The second model describes transient aspects of the BLS, and by coupling it with a stripping criteria for the internal boundary layer, it is possible to predict the time of the initiation of fragmentation. Then, a model for film boiling over horizontal cylinders and axisymmetric bodies which is able to properly describe the inertial and convection terms in the vapor flow is presented. This has never been done before, although these terms cannot be neglected in physical conditions close to vapor explosions. The model is able to predict all the experimental results of TREPAM, the only existing forced convection film boiling experiment in conditions close to a vapor explosion, and which results could not be predicted by other models. In the last part, an experimental study of the fragmentation of hot tin drops in a water flow which uses digital fast camera and flash X ray imagery is presented. This study has allowed the observation of several new features of the drop fragmentation mechanism. (author) [fr

Release and characteristics of fungal fragments in various conditions

Energy Technology Data Exchange (ETDEWEB)

Mensah-Attipoe, Jacob [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Saari, Sampo [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Veijalainen, Anna-Maria; Pasanen, Pertti [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Keskinen, Jorma [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Leskinen, Jari T.T. [SIB Labs, University of Eastern Finland, Yliopistonranta 1E, P. O. Box 1627, FI-70211, Kuopio (Finland); Reponen, Tiina, E-mail: reponeta@ucmail.uc.edu [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056 (United States)

2016-03-15

Intact spores and submicrometer size fragments are released from moldy building materials during growth and sporulation. It is unclear whether all fragments originate from fungal growth or if small pieces of building materials are also aerosolized as a result of microbial decomposition. In addition, particles may be formed through nucleation from secondary metabolites of fungi, such as microbial volatile organic compounds (MVOCs). In this study, we used the elemental composition of particles to characterize the origin of submicrometer fragments released from materials contaminated by fungi. Particles from three fungal species (Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum), grown on agar, wood and gypsum board were aerosolized using the Fungal Spore Source Strength Tester (FSSST) at three air velocities (5, 16 and 27 m/s). Released spores (optical size, d{sub p} ≥ 0.8 μm) and fragments (d{sub p} ≤ 0.8 μm) were counted using direct-reading optical aerosol instruments. Particles were also collected on filters, and their morphology and elemental composition analyzed using scanning electron microscopes (SEMs) coupled with an Energy-Dispersive X-ray spectroscopy (EDX). Among the studied factors, air velocity resulted in the most consistent trends in the release of fungal particles. Total concentrations of both fragments and spores increased with an increase in air velocity for all species whereas fragment–spore (F/S) ratios decreased. EDX analysis showed common elements, such as C, O, Mg and Ca, for blank material samples and fungal growth. However, N and P were exclusive to the fungal growth, and therefore were used to differentiate biological fragments from non-biological ones. Our results indicated that majority of fragments contained N and P. Because we observed increased release of fragments with increased air velocities, nucleation of MVOCs was likely not a relevant process in the formation of fungal fragments. Based

Photobleaching of chromophoric dissolved organic matter (CDOM) in the Yangtze River estuary: kinetics and effects of temperature, pH, and salinity.

Science.gov (United States)

Song, Guisheng; Li, Yijie; Hu, Suzheng; Li, Guiju; Zhao, Ruihua; Sun, Xin; Xie, Huixiang

2017-06-21

The kinetics and temperature-, pH- and salinity-dependences of photobleaching of chromophoric dissolved organic matter (CDOM) in the Yangtze River estuary (YRE) were evaluated using laboratory solar-simulated irradiation and compared to those of Suwannee River humic substances (SRHSs). Nearly all CDOM in water at the head of the estuary (headwater herein) was photobleachable in both summer and winter, while significant fractions of CDOM (13-29%) were resistant to photobleaching in saltier waters. The photobleaching rate constant in the headwater was 25% higher in summer than that in winter. The absorbed photon-based photobleaching efficiency (PE) increased with temperature following the linear Arrhenius equation. For a 20 °C increase in temperature, PE increased by ∼45% in the headwater and by 70-81% in the saltier waters. PE for YRE samples exhibited minima at pH from 6 to 7 and increased with both lower and higher pH values, contrasting the consistent increase in PE with pH shown by SRHSs. No consistent effect of salinity on PE was observed for both SRHSs and YRE samples. Photobleaching increased the spectral slope coefficient between 275 nm and 295 nm in summer, consistent with the behavior of SRHSs, but decreased it in winter, implying a difference in the molecular composition of chromophores between the two seasons. Temperature, salinity, and pH modified the photoalteration of the spectral shape but their effects varied spatially and seasonally. This study demonstrates that CDOM quality, temperature, and pH should be incorporated into models involving quantification of photobleaching.

Graph Theory. 1. Fragmentation of Structural Graphs

Directory of Open Access Journals (Sweden)

Lorentz JÄNTSCHI

2002-12-01

Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

Route to three-dimensional fragments using diversity-oriented synthesis.

Science.gov (United States)

Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W

2011-04-26

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.

Fragment-based discovery of a potent NAMPT inhibitor.

Science.gov (United States)

Korepanova, Alla; Longenecker, Kenton L; Pratt, Steve D; Panchal, Sanjay C; Clark, Richard F; Lake, Marc; Gopalakrishnan, Sujatha M; Raich, Diana; Sun, Chaohong; Petros, Andrew M

2017-12-12

NAMPT expression is elevated in many cancers, making this protein a potential target for anticancer therapy. We have carried out both NMR based and TR-FRET based fragment screens against human NAMPT and identified six novel binders with a range of potencies. Co-crystal structures were obtained for two of the fragments bound to NAMPT while for the other four fragments force-field driven docking was employed to generate a bound pose. Based on structural insights arising from comparison of the bound fragment poses to that of bound FK866 we were able to synthetically elaborate one of the fragments into a potent NAMPT inhibitor. Copyright © 2017 Elsevier Ltd. All rights reserved.

Light fragment formation at intermediate energies

International Nuclear Information System (INIS)

Boal, D.H.

1982-03-01

This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

Molecular Polygons Probe the Role of Intramolecular Strain in the Photophysics of π-Conjugated Chromophores.

Science.gov (United States)

Wilhelm, Philipp; Vogelsang, Jan; Poluektov, Georgiy; Schönfelder, Nina; Keller, Tristan J; Jester, Stefan-Sven; Höger, Sigurd; Lupton, John M

2017-01-24

π-Conjugated segments, chromophores, are the electronically active units of polymer materials used in organic electronics. To elucidate the effect of the bending of these linear moieties on elementary electronic properties, such as luminescence color and radiative rate, we introduce a series of molecular polygons. The π-system in these molecules becomes so distorted in bichromophores (digons) that these absorb and emit light of arbitrary polarization: any part of the chain absorbs and emits radiation with equal probability. Bending leads to a cancellation of transition dipole moment (TDM), increasing excited-state lifetime. Simultaneously, fluorescence shifts to the red as radiative transitions require mixing of the excited state with vibrational modes. However, strain can become so large that excited-state localization on shorter units of the chain occurs, compensating TDM cancellation. The underlying correlations between shape and photophysics can only be resolved in single molecules. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Geospatial analysis of forest fragmentation in Uttara Kannada District, India

Directory of Open Access Journals (Sweden)

Ramachandra T V

2016-04-01

Full Text Available Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological, economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species. Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators, i.e., Pf (the ratio of pixels that are forested to the total non-water pixels in the window and Pff (the proportion of all adjacent (cardinal directions only pixel pairs that include at least one forest pixel, for which both pixels are forested. Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen - semi evergreen forest cover from 57.31 % (1979 to 32.08 % (2013 Forest fragmentation at the landscape level shows a decline of interior forests 64.42 % (1979 to 25.62 % (2013 and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels. Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central

Measuring the temperature of hot nuclear fragments

International Nuclear Information System (INIS)

Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

2010-01-01

A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

QGP and Modified Jet Fragmentation

International Nuclear Information System (INIS)

Wang, Xin-Nian

2005-01-01

Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry.

Science.gov (United States)

Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K H

2016-08-01

Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X-ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis-acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240-fold improvement in potency compared to the parent hits. Subsequent X-ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit-identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit-to-lead optimization. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Fragmentation of dimethyl ether in femtosecond intense field

Science.gov (United States)

Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li

2006-08-01

The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.

Identification and characterization of a thermally cleaved fragment of monoclonal antibody-A detected by sodium dodecyl sulfate-capillary gel electrophoresis.

Science.gov (United States)

Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji

2017-06-05

This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

Fragmented sleep: an unrevealed problem in peritoneal dialysis patients.

Science.gov (United States)

Yngman-Uhlin, Pia; Johansson, Anna; Fernström, Anders; Börjeson, Sussanne; Edéll-Gustafsson, Ulla

2011-04-01

The aim of this study was to describe the sleep-wake cycle, sleep quality, fatigue and Health Related Quality of Life (HRQoL) measured with questionnaires, actigraphy and a sleep diary during a one-week period in patients undergoing peritoneal dialysis (PD) treatment at home. A further aim was to explore differences compared with patients with coronary artery disease (CAD) and individuals from the general population. In this study one-week actigraphy registration, four questionnaires (Uppsala Sleep Inventory, SF-36, FACIT-fatigue, International Restless Legs Study Groups' form) and a sleep diary were used. Data from 68 participants and 470 nights were collected. PD patients (n = 28) had more fragmented sleep (p fatigue (89%) were prevalent in PD patients. Pruritus correlated with fragmented sleep (r = -0.45, p = 0.01) and SE (r = -0.49, p = 0.01). In HRQoL, the physical component score was decreased in the PD and CAD groups (p practice is highly recommended since PD patients are vulnerable individuals with extended self-care responsibilities and at risk for comorbidity secondary to insufficient sleep. Future research on whether PD patients' sleep problems and fatigue can be improved by an individual non-pharmacological intervention programme is required.

Mixing behavior of chromophoric dissolved organic matter in the Pearl River Estuary in spring

Science.gov (United States)

Lei, Xia; Pan, Jiayi; Devlin, Adam T.

2018-02-01

Mixing behavior of chromophoric dissolved organic matter (CDOM) in the Pearl River Estuary (PRE) and relevant hydrodynamic parameters such as horizontal transport and vertical mixing are identified and discussed based on a set of sampling data obtained during a cruise in May 2014. Using a theoretical conservative mixing model, the surface CDOM in the PRE in spring is classified into two groups by the CDOM absorption-spectral slope relationship (a(300) vs S(275-295)): First, terrigenous CDOM under a non-conservative mixing condition, and removal processes such as photobleaching are suggested to happen; second, marine CDOM behaves conservatively during mixing. The mixing of CDOM at the bottom is shown to be conservative. Controlled by the two-layer gravitational circulation in the PRE, the northern and western estuary shows higher CDOM absorption and lower spectral slope than the southern and eastern estuary, and the surface CDOM presents higher absorption and lower spectral slope than the bottom. Horizontal transport is hypothesized to be the dominant hydrodynamic mechanism affecting CDOM variation and mixing behavior in the PRE, while the vertical mixing has less influence.

Determination of the absorption coefficient of chromophoric dissolved organic matter from underway spectrophotometry.

Science.gov (United States)

Dall'Olmo, Giorgio; Brewin, Robert J W; Nencioli, Francesco; Organelli, Emanuele; Lefering, Ina; McKee, David; Röttgers, Rüdiger; Mitchell, Catherine; Boss, Emmanuel; Bricaud, Annick; Tilstone, Gavin

2017-11-27

Measurements of the absorption coefficient of chromophoric dissolved organic matter (ay) are needed to validate existing ocean-color algorithms. In the surface open ocean, these measurements are challenging because of low ay values. Yet, existing global datasets demonstrate that ay could contribute between 30% to 50% of the total absorption budget in the 400-450 nm spectral range, thus making accurate measurement of ay essential to constrain these uncertainties. In this study, we present a simple way of determining ay using a commercially-available in-situ spectrophotometer operated in underway mode. The obtained ay values were validated using independent collocated measurements. The method is simple to implement, can provide measurements with very high spatio-temporal resolution, and has an accuracy of about 0.0004 m -1 and a precision of about 0.0025 m -1 when compared to independent data (at 440 nm). The only limitation for using this method at sea is that it relies on the availability of relatively large volumes of ultrapure water. Despite this limitation, the method can deliver the ay data needed for validating and assessing uncertainties in ocean-colour algorithms.

Molecular hyperpolarizabilities of push–pull chromophores: A comparison between theoretical and experimental results

Energy Technology Data Exchange (ETDEWEB)

Capobianco, A. [Dipartimento di Fisica E.R. Caianiello, Università di Salerno, via ponte don Melillo, I-84084 Fisciano (Italy); Centore, R. [Dipartimento di Chimica P. Corradini, Università di Napoli, via Cintia, I-80126 Napoli (Italy); Noce, C. [Dipartimento di Fisica E.R. Caianiello, Università di Salerno, via ponte don Melillo, I-84084 Fisciano (Italy); Peluso, A., E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, via ponte don Melillo, I-84084 Fisciano (Italy)

2013-01-16

Highlights: ► Electro-optical determined and MP2/DFT computed NLO properties have been compared. ► Significant dependence of dipole moments of elongated NLO chromophores on conformations has been found. ► A thorough comparison between MP2 and DFT/TD-DFT computational approaches has been carried out. ► The two-state model overestimates hyperpolarizability. - Abstract: Electric dipole moments and static first order hyperpolarizabilities of two push–pull molecules with an extended π electron systems have been evaluated at different computational levels and compared with the results of electro-optical absorption measurements, based on the two state model. Calculations show that: (i) the dipole moments of such elongated systems depend significantly on conformation, a thorough conformational search is necessary for a meaningful comparison between theoretical and experimental results; (ii) DFT methods, in particular CAM-B3LYP and M05-2X, yield dipole moments which compare well with those obtained by post Hartree–Fock methods (MP2) and by EOA measurements; (iii) theoretical first order hyperpolarizabilities are largely underestimated, both by MP2 and DFT methods, possibly because of the failure of two state model used in electro-optical measurements.

Fragments of Time

DEFF Research Database (Denmark)

Christiansen, Steen Ledet

Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

Science.gov (United States)

Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

2016-05-12

Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

Tooth fragment reattachment techniques-A systematic review.

Science.gov (United States)

Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L

2018-03-07

Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Fragmentation Main Model

Data.gov (United States)

Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

Habitat Fragmentation and Native Bees: a Premature Verdict?

Directory of Open Access Journals (Sweden)

James H. Cane

2001-06-01

Full Text Available Few studies directly address the consequences of habitat fragmentation for communities of pollinating insects, particularly for the key pollinator group, bees (Hymenoptera: Apiformes. Bees typically live in habitats where nesting substrates and bloom are patchily distributed and spatially dissociated. Bee studies have all defined habitat fragments as remnant patches of floral hosts or forests, overlooking the nesting needs of bees. Several authors conclude that habitat fragmentation is broadly deleterious, but their own data show that some native species proliferate in sampled fragments. Other studies report greater densities and comparable diversities of native bees at flowers in some fragment size classes relative to undisrupted habitats, but find dramatic shifts in species composition. Insightful studies of habitat fragmentation and bees will consider fragmentation, alteration, and loss of nesting habitats, not just patches of forage plants, as well as the permeability of the surrounding matrix to interpatch movement. Inasmuch as the floral associations and nesting habits of bees are often attributes of species or subgenera, ecological interpretations hinge on authoritative identifications. Study designs must accommodate statistical problems associated with bee community samples, especially non-normal data and frequent zero values. The spatial scale of fragmentation must be appreciated: bees of medium body size can regularly fly 1-2 km from nest site to forage patch. Overall, evidence for prolonged persistence of substantial diversity and abundances of native bee communities in habitat fragments of modest size promises practical solutions for maintaining bee populations. Provided that reserve selection, design, and management can address the foraging and nesting needs of bees, networks of even small reserves may hold hope for sustaining considerable pollinator diversity and the ecological services pollinators provide.

Fragmentation Point Detection of JPEG Images at DHT Using Validator

Science.gov (United States)

Mohamad, Kamaruddin Malik; Deris, Mustafa Mat

File carving is an important, practical technique for data recovery in digital forensics investigation and is particularly useful when filesystem metadata is unavailable or damaged. The research on reassembly of JPEG files with RST markers, fragmented within the scan area have been done before. However, fragmentation within Define Huffman Table (DHT) segment is yet to be resolved. This paper analyzes the fragmentation within the DHT area and list out all the fragmentation possibilities. Two main contributions are made in this paper. Firstly, three fragmentation points within DHT area are listed. Secondly, few novel validators are proposed to detect these fragmentations. The result obtained from tests done on manually fragmented JPEG files, showed that all three fragmentation points within DHT are successfully detected using validators.

Dynamical effects in the Colomb expansion following nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.; Donangelo, R.J.; Schechter, H.

1987-01-01

The effects of the Colomb expansion on the fragment Kinetic energy spectrum for a fragmentating hot nuclear system is investigated. In particular, 12 C fragment spectra are calculated and compared with those predicted by the uniform expansion approximation. The results indicate that energy spectra of fragments are quite sensitive to the details of the Coulomb expansion treatment. (Author) [pt

Bone fragments a body can make

Energy Technology Data Exchange (ETDEWEB)

Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

1991-05-01

Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

HETC-3STEP included fragmentation process

Energy Technology Data Exchange (ETDEWEB)

Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering

1997-03-01

High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)

Integration of fragment screening and library design.

Science.gov (United States)

Siegal, Gregg; Ab, Eiso; Schultz, Jan

2007-12-01

With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.

Rock fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

1976-01-01

Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

Light particles emitted with the fission fragments of thorium

Energy Technology Data Exchange (ETDEWEB)

San-Tsiang, T; Faraggi, H

1947-01-01

The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.

Complex fragment emission from hot compound nuclei

International Nuclear Information System (INIS)

Moretto, L.G.

1986-03-01

The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs

Advancement of magma fragmentation by inhomogeneous bubble distribution.

Science.gov (United States)

Kameda, M; Ichihara, M; Maruyama, S; Kurokawa, N; Aoki, Y; Okumura, S; Uesugi, K

2017-12-01

Decompression times reported in previous studies suggest that thoroughly brittle fragmentation is unlikely in actual explosive volcanic eruptions. What occurs in practice is brittle-like fragmentation, which is defined as the solid-like fracture of a material whose bulk rheological properties are close to those of a fluid. Through laboratory experiments and numerical simulation, the link between the inhomogeneous structure of bubbles and the development of cracks that may lead to brittle-like fragmentation was clearly demonstrated here. A rapid decompression test was conducted to simulate the fragmentation of a specimen whose pore morphology was revealed by X-ray microtomography. The dynamic response during decompression was observed by high-speed photography. Large variation was observed in the responses of the specimens even among specimens with equal bulk rheological properties. The stress fields of the specimens under decompression computed by finite element analysis shows that the presence of satellite bubbles beneath a large bubble induced the stress concentration. On the basis of the obtained results, a new mechanism for brittle-like fragmentation is proposed. In the proposed scenario, the second nucleation of bubbles near the fragmentation surface is an essential process for the advancement of fragmentation in an upward magma flow in a volcanic conduit.

Global-Scale Patterns of Forest Fragmentation

Directory of Open Access Journals (Sweden)

Kurt Riitters

2000-12-01

Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.

Global-scale patterns of forest fragmentation

Science.gov (United States)

Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.

2000-01-01

We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

Advances in fragment-based drug discovery platforms.

Science.gov (United States)

Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya

2009-11-01

Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.

Temperatures of fragment kinetic energy spectra

International Nuclear Information System (INIS)

Bauer, W.

1995-01-01

Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework

The ways and means of fragment-based drug design.

Science.gov (United States)

Doak, Bradley C; Norton, Raymond S; Scanlon, Martin J

2016-11-01

Fragment-based drug design (FBDD) has emerged as a mainstream approach for the rapid and efficient identification of building blocks that can be used to develop high-affinity ligands against protein targets. One of the strengths of FBDD is the relative ease and low cost of the primary screen to identify fragments that bind. However, the fragments that emerge from primary screens often have low affinities, with K D values in the high μM to mM range, and a significant challenge for FBDD is to develop the initial fragments into more potent ligands. Successful fragment elaboration often requires co-structures of the fragments bound to their target proteins, as well as a range of biophysical and biochemical assays to track potency and efficacy. These challenges have led to the development of specific chemical strategies for the elaboration of weakly-binding fragments into more potent "hits" and lead compounds. In this article we review different approaches that have been employed to meet these challenges and describe some of the strategies that have resulted in several fragment-derived compounds entering clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.

Temporal change in fragmentation of continental US forests

Science.gov (United States)

James D. Wickham; Kurt H. Riitters; Timothy G. Wade; Collin Homer

2008-01-01

Changes in forest ecosystem function and condition arise from changes in forest fragmentation. Previous studies estimated forest fragmentation for the continental United States (US). In this study, new temporal land-cover data from the National Land Cover Database (NLCD) were used to estimate changes in forest fragmentation at multiple scales for the continental US....

Inclusive breakup of three-fragment weakly bound nuclei

International Nuclear Information System (INIS)

Carlson, B.V.; Frederico, T.; Hussein, M.S.

2017-01-01

The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.

Inclusive breakup of three-fragment weakly bound nuclei

Energy Technology Data Exchange (ETDEWEB)

Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)

2017-04-10

The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Directory of Open Access Journals (Sweden)

Diego Santana Assis

Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Science.gov (United States)

Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira

2018-01-01

The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Geospatial analysis of forest fragmentation in Uttara Kannada District, India

Institute of Scientific and Technical Information of China (English)

Ramachandra T V; Bharath Setturu; Subash Chandran

2016-01-01

Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological,economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species.Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators,i.e., Pf(the ratio of pixels that are forested to the total non-water pixels in the window) and Pff(the proportion of all adjacent(cardinal directions only) pixel pairs that include at least one forest pixel, for which both pixels are forested).Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen-semi evergreen forest cover from 57.31 %(1979) to 32.08 %(2013) Forest fragmentation at the landscape level shows a decline of interior forests 64.42 %(1979) to 25.62 %(2013) and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels.Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central Western Ghats have been

Recent Advances in Stimuli-Responsive Photofunctional Materials Based on Accommodation of Chromophore into Layered Double Hydroxide Nanogallery

Directory of Open Access Journals (Sweden)

Wu Li

2013-01-01

Full Text Available The assembly of photofunctional molecules into host matrices has become an important strategy to achieve tunable fluorescence and to develop intelligent materials. The stimuli-responsive photofunctional materials based on chromophores-assembled layered double hydroxides (LDHs have received much attention from both academic and industry fields as a result of their advantages, such as high photo/thermal stability, easy processing, and well reversibility, which can construct new types of smart luminescent nanomaterials (e.g., ultrathin film and nanocomposite for sensor and switch applications. In this paper, external environmental stimuli have mainly involved physical (such as temperature, pressure, light, and electricity and chemical factors (such as pH and metal ion; recent progress on the LDH-based organic-inorganic stimuli-responsive materials has been summarized. Moreover, perspectives on further development of these materials are also discussed.

Fragmentation and structure of silicon microclusters

International Nuclear Information System (INIS)

Feuston, B.P.; Kalia, R.K.; Vashishta, P.

1987-01-01

It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature

Modelling of the PELE fragmentation dynamics

Science.gov (United States)

Verreault, J.

2014-05-01

The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

Modelling of the PELE fragmentation dynamics

International Nuclear Information System (INIS)

Verreault, J

2014-01-01

The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

The role of many-body effects in describing low-lying excited states of pi-conjugated chromophores: high-level equation-of-motion coupled-cluster studies of fused porphyrin systems

Energy Technology Data Exchange (ETDEWEB)

Kowalski, Karol [Pacific Northwest National Laboratory (PNNL); Olson, Ryan M [Cray, Inc.; Krishnamoorthy, Sriram [Pacific Northwest National Laboratory (PNNL); Tipparaju, Vinod [ORNL; Apra, Edoardo [ORNL

2011-01-01

The unusual photophysical properties of the {pi}-conjugated chromophores make them potential building blocks of various molecular devices. In particular, significant narrowing of the HOMO-LUMO gaps can be observed as an effect of functionalization chromophores with polycyclic aromatic hydrocarbons (PAHs). In this paper we present equation-of-motion coupled cluster (EOMCC) calculations for vertical excitation energies of several functionalized forms of porphyrins. The results for free-base porphyrin (FBP) clearly demonstrate significant differences between functionalization of FBP with one- (anthracene) and two-dimensional (coronene) structures. We also compare the EOMCC results with the experimentally available results for anthracene fused zinc-porphyrin. The impact of various types of correlation effects is illustrated on several benchmark models, where the comparison with the experiment is possible. In particular, we demonstrate that for all excited states considered in this paper, all of them being dominated by single excitations, the inclusion of triply excited configurations is crucial for attaining qualitative agreement with experiment. We also demonstrate the parallel performance of the most computationally intensive part of the completely renormalized EOMCCSD(T) approach (CR-EOMCCSD(T)) across 120000 cores.

Projectile rapidity dependence in target fragmentation

International Nuclear Information System (INIS)

Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

1979-01-01

The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references