WorldWideScience

Sample records for intermolecular base pairing

  1. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  2. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  3. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  4. Observation of aggregation triggered by Resonance Energy Transfer (RET) induced intermolecular pairing force.

    Science.gov (United States)

    Pan, Xiaoyong; Wang, Weizhi; Ke, Lin; Zhang, Nan

    2017-07-20

    In this report, we showed the existence of RET induced intermolecular pairing force by comparing their fluorescence behaviors under room illumination vs standing in dark area for either PFluAnt solution or PFluAnt&PFOBT mixture. Their prominent emission attenuation under room illumination brought out the critical role of photo, i.e. RET induced intermolecular pairing force in induction of polymer aggregation. Constant UV-Vis absorption and fluorescence spectra in terms of both peak shapes and maximum wavelengths implied no chemical decomposition was involved. Recoverable fluorescence intensity, fluorescence lifetime as well as NMR spectra further exclude photo induced decomposition. The controllable on/off state of RET induced intermolecular pairing force was verified by the masking effect of outside PFluAnt solution which function as filter to block the excitation of inside PFluAnt and thus off the RET induced intermolecular pairing force. Theoretical calculation suggest that magnitude of RET induced intermolecular pairing force is on the same scale as that of van der Waals interaction. Although the absolute magnitude of RET induced intermolecular pairing force was not tunable, its effect can be magnified by intentionally turn it "on", which was achieved by irradiance with 5 W desk lamp in this report.

  5. Investigating the role of ion-pair strategy in regulating nicotine release from patch: Mechanistic insights based on intermolecular interaction and mobility of pressure sensitive adhesive.

    Science.gov (United States)

    Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang

    2018-07-01

    The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Effects of pair correlation functions on intermolecular nuclear relaxation by translational and rotational diffusion in liquids

    International Nuclear Information System (INIS)

    Fries, P.

    1978-01-01

    In order to study the intermolecular relaxation due to magnetic dipolar interactions, we calculate the spectral densities resulting from random translational and rotational motions of spherical molecules carrying off-centre spins. The relative translational motion is treated in the frame-work of a general diffusion equation (the Smoluchowski equation) which takes into account the existence of effective forces between the molecules. This model implies a pair correlation function. i.e. a non unifom relative distribution of the molecules. The analytical calculations are carried out by taking correctly into account the hard sphere boundary conditions for the molecules. Explicit numerical calculations of the spectral densities are performed using finite difference methods and the pair correlation function of Verlet and Weiss obtained by computer experiments. The resulting calculations allow one to interpret the relaxation exhibited by benzene and some of its monohalogen derivatives which has been measured by Jonas et al. at various pressures. The effects of pair correlation and eccentricity contribute to a noticeable enhancement of the spectral densities, especially as the frequency increases. The translational correlation times calculated from the Stokes formula and those deduced from intermolecular relaxation studies are compared. It is shown that in order to distinguish which of the dynamical models is appropriate, measurements must be made as a function of frequency [fr

  7. Resonance energy transfer (RET)-Induced intermolecular pairing force: a tunable weak interaction and its application in SWNT separation.

    Science.gov (United States)

    Pan, Xiaoyong; Chen, Hui; Wang, Wei Zhi; Ng, Siu Choon; Chan-Park, Mary B

    2011-07-21

    This paper explores evidence of an optically mediated interaction that is active in the separation mechanism of certain selective agents through consideration of the contrasting selective behaviors of two conjugated polymers with distinct optical properties. The involvement of a RET-induced intermolecular pairing force is implied by the different illumination response behaviors. The magnitude of this interaction scales with the external stimulus parameter, the illumination irradiance (I), and thus is tunable. This suggests a facile technique to modify the selectivity of polymers toward specific SWNT species by altering the polymer structure to adjust the corresponding intermolecular interaction. This is the first experimental verification and application of a RET-induced intermolecular pairing force to SWNT separation. With this kind of interaction taken into account, reasonable interpretation of some conflicting data, especially PLE maps, can be easily made. The above conclusion can be applied to other substances as long as they are electrically neutral and there is photon-induced RET between them. The significant magnitude of this interaction makes direct manipulation of molecules/particles possible and is expected to have applications in molecular engineering. © 2011 American Chemical Society

  8. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

    Science.gov (United States)

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

  9. A chemical approach for site-specific identification of NMR signals from protein side-chain NH{sub 3}{sup +} groups forming intermolecular ion pairs in protein–nucleic acid complexes

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Kurtis M. [University of Texas Health Science Center at Houston, Department of NanoMedicine and Biomedical Engineering and Institute of Molecular Medicine (United States); Nguyen, Dan; Esadze, Alexandre; Zandrashvili, Levani [University of Texas Medical Branch, Department of Biochemistry and Molecular Biology, Sealy Center for Structural Biology and Molecular Biophysics (United States); Gorenstein, David G. [University of Texas Health Science Center at Houston, Department of NanoMedicine and Biomedical Engineering and Institute of Molecular Medicine (United States); Iwahara, Junji, E-mail: juiwahar@utmb.edu, E-mail: j.iwahara@utmb.edu [University of Texas Medical Branch, Department of Biochemistry and Molecular Biology, Sealy Center for Structural Biology and Molecular Biophysics (United States)

    2015-05-15

    Protein–nucleic acid interactions involve intermolecular ion pairs of protein side-chain and DNA or RNA phosphate groups. Using three protein–DNA complexes, we demonstrate that site-specific oxygen-to-sulfur substitution in phosphate groups allows for identification of NMR signals from the protein side-chain NH{sub 3}{sup +} groups forming the intermolecular ion pairs. A characteristic change in their {sup 1}H and {sup 15}N resonances upon this modification (i.e., substitution of phosphate to phosphorodithioate) can represent a signature of an intermolecular ion pair. Hydrogen-bond scalar coupling between protein side-chain {sup 15}N and DNA phosphorodithiaote {sup 31}P nuclei provides direct confirmation of the intermolecular ion pair. The same approach is likely applicable to protein–RNA complexes as well.

  10. A chemical approach for site-specific identification of NMR signals from protein side-chain NH3+ groups forming intermolecular ion pairs in protein–nucleic acid complexes

    International Nuclear Information System (INIS)

    Anderson, Kurtis M.; Nguyen, Dan; Esadze, Alexandre; Zandrashvili, Levani; Gorenstein, David G.; Iwahara, Junji

    2015-01-01

    Protein–nucleic acid interactions involve intermolecular ion pairs of protein side-chain and DNA or RNA phosphate groups. Using three protein–DNA complexes, we demonstrate that site-specific oxygen-to-sulfur substitution in phosphate groups allows for identification of NMR signals from the protein side-chain NH 3 + groups forming the intermolecular ion pairs. A characteristic change in their 1 H and 15 N resonances upon this modification (i.e., substitution of phosphate to phosphorodithioate) can represent a signature of an intermolecular ion pair. Hydrogen-bond scalar coupling between protein side-chain 15 N and DNA phosphorodithiaote 31 P nuclei provides direct confirmation of the intermolecular ion pair. The same approach is likely applicable to protein–RNA complexes as well

  11. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. A general intermolecular force field based on tight-binding quantum chemical calculations

    Science.gov (United States)

    Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

    2017-10-01

    A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

  13. Intermolecular potential for Ar + D2O from differential scattering cross sections, and its implications for the water pair potential

    International Nuclear Information System (INIS)

    Brooks, R.; Porter, R.A.R.; Kalos, F.; Grosser, A.E.

    1975-01-01

    A velocity selected molecular beam of D 2 O was crossed with a nozzle beam of Ar and the angular distribution of the scattered D 2 O was measured mass spectrometrically. By varying the velocity of the D 2 O beam, the differential cross section was measured at two collision energies. The experimental results were compared with synthetic differential cross sections calculated from Lennard-Jones and Kihara-Stockmayer trial potentials to determine potential parameters. Implications for the H 2 O pair potential are discussed

  14. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  15. Intermolecular interactions

    International Nuclear Information System (INIS)

    Kaplan, I.G.; Rodimova, O.B.; AN SSSR, Tomsk. Inst. Optiki Atmosfery)

    1978-01-01

    The present state of the intermolecular interaction theory is described. The general physical picture of the molecular interactions is given, the relative contributions of interactions of different types are analyzed (electrostatic, resonance, induction, dispersion, relativistic, magnetostatic and exchange), and the main ones in each range of separations are picked out. The methods of the potential curve calculations are considered, specific for definite separations between the interacting systems. The special attention is paid to the analysis of approximations used in different theoretical calculation methods

  16. Intermolecular spectroscopy

    International Nuclear Information System (INIS)

    Gelbart, W.M.

    1980-01-01

    In this article some of the theoretical background is presented for the following papers on 'Intermolecular Spectroscopy and Dynamical Properties of Dense Systems'. In Section 1 we outline a simple semi-classical description of the interaction between optical radiation and matter. The motion of a many-body polarizability is introduced; limiting forms of this complicated quantity lead to the familiar cases of light scattering spectra. In Section 2 we consider the linear response approximation, and the equation of motion for the many-body density matrix is solved to first order in the matter-radiation interaction. The often quoted fluctuation-dissipation theorem and the time-dependent, equilibrium correlation functions are discussed. Section 3 treats the problem of the local field. In Section 4 we consider the special case of collision-induced light scattering by atomic fluids in the low-density limit. This allows us to focus on determining the interaction polarizability for simple gases. Finally, in Section 5 we distinguish between collision-induced and multiple light scattering, and discuss the double-light-scattering analyses which provide new information about critical and thermodynamically unstable fluids. (KBE)

  17. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  18. Pharmaceutical cocrystals, salts and multicomponent systems; intermolecular interactions and property based design.

    Science.gov (United States)

    Berry, David J; Steed, Jonathan W

    2017-08-01

    As small molecule drugs become harder to develop and less cost effective for patient use, efficient strategies for their property improvement become increasingly important to global health initiatives. Improvements in the physical properties of Active Pharmaceutical Ingredients (APIs), without changes in the covalent chemistry, have long been possible through the application of binary component solids. This was first achieved through the use of pharmaceutical salts, within the last 10-15years with cocrystals and more recently coamorphous systems have also been consciously applied to this problem. In order to rationally discover the best multicomponent phase for drug development, intermolecular interactions need to be considered at all stages of the process. This review highlights the current thinking in this area and the state of the art in: pharmaceutical multicomponent phase design, the intermolecular interactions in these phases, the implications of these interactions on the material properties and the pharmacokinetics in a patient. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  20. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  1. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  2. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  3. Long-stem shaped multifunctional molecular beacon for highly sensitive nucleic acids determination via intramolecular and intermolecular interactions based strand displacement amplification.

    Science.gov (United States)

    Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee

    2017-11-20

    Occurrence and application of oligonucleotide probes have promoted great progress in the biochemical analysis field due to their unique biological and chemical properties. In this work, a long-stem shaped multifunctional molecular beacon (LS-MMB) that is responsive to a cancer-related gene, p53, is well-prepared. By designing the probe with long-paired bases at its two ends and short-paired bases between the middle region and the 3' end, the LS-MMB is intelligently endowed with the ability to recognize the target analyte, serve as the polymerization primer/template, and signal the hybridization event synchronously, which is distinctly advantageous over the traditional molecular beacons (MBs). Moreover, it is excitingly found that the LS-MMB can be employed to exert intramolecular and intermolecular interactions for strand displacement amplification (SDA) without the involvement of any assistant probes; this therapy results in a really easy and rapid sensing system that provides an extremely low background noise and high target output signal. In this case, an excellent sensitivity and specificity to detect target gene down to picomolar level and resolution to even one nucleotide variation are achieved, respectively. In addition, the application potential for real genomic DNA analysis is realized. We envision that the probe of LS-MMB can act as a universal platform for biosensing and biomedical research.

  4. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  5. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  6. DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions

    NARCIS (Netherlands)

    Megens, Rik P.; Roelfes, Gerard

    2012-01-01

    Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as

  7. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  8. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  9. Determination of intermolecular transfer integrals from DFT calculations

    Energy Technology Data Exchange (ETDEWEB)

    Baumeier, Bjoern; Andrienko, Denis [Max-Planck Institute for Polymer Research, Mainz (Germany)

    2010-07-01

    Theoretical studies of charge transport in organic conducting systems pose a unique challenge since they require multiscale schemes that combine quantum-chemical, molecular dynamics and kinetic Monte-Carlo calculations. The description of the mobility of electrons and holes in the hopping regime relies on the determination of intermolecular hopping rates in large scale morphologies. Using Marcus theory these rates can be calculated from intermolecular transfer integrals and on-site energies. Here we present a detailed computational study on the accuracy and efficiency of density-functional theory based approaches to the determination of intermolecular transfer integrals. First, it is demonstrated how these can be obtained from quantum-chemistry calculations by forming the expectation value of a dimer Fock operator with frontier orbitals of two neighboring monomers based on a projective approach. We then consider the prototypical example of one pair out of a larger morphology of Tris(8-hydroxyquinolinato)aluminium (Alq3) and study the influence of computational parameters, e.g. the choice of basis sets, exchange-correlation functional, and convergence criteria, on the calculated transfer integrals. The respective accuracies and efficiencies are compared in order to derive an optimal strategy for future simulations based on the full morphology.

  10. Intermolecular and surface forces

    CERN Document Server

    Israelachvili, Jacob N

    2011-01-01

    This reference describes the role of various intermolecular and interparticle forces in determining the properties of simple systems such as gases, liquids and solids, with a special focus on more complex colloidal, polymeric and biological systems. The book provides a thorough foundation in theories and concepts of intermolecular forces, allowing researchers and students to recognize which forces are important in any particular system, as well as how to control these forces. This third edition is expanded into three sections and contains five new chapters over the previous edition.· starts fr

  11. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  12. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  13. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  14. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  16. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  17. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  18. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  19. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  20. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  1. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  2. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  3. Desensitization of metastable intermolecular composites

    Science.gov (United States)

    Busse, James R [South Fork, CO; Dye, Robert C [Los Alamos, NM; Foley, Timothy J [Los Alamos, NM; Higa, Kelvin T [Ridgecrest, CA; Jorgensen, Betty S [Jemez Springs, NM; Sanders, Victor E [White Rock, NM; Son, Steven F [Los Alamos, NM

    2011-04-26

    A method to substantially desensitize a metastable intermolecular composite material to electrostatic discharge and friction comprising mixing the composite material with an organic diluent and removing enough organic diluent from the mixture to form a mixture with a substantially putty-like consistency, as well as a concomitant method of recovering the metastable intermolecular composite material.

  4. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  5. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  6. Quantifying intermolecular interactions of ionic liquids using cohesive energy densities

    Science.gov (United States)

    2017-01-01

    For ionic liquids (ILs), both the large number of possible cation + anion combinations and their ionic nature provide a unique challenge for understanding intermolecular interactions. Cohesive energy density, ced, is used to quantify the strength of intermolecular interactions for molecular liquids, and is determined using the enthalpy of vaporization. A critical analysis of the experimental challenges and data to obtain ced for ILs is provided. For ILs there are two methods to judge the strength of intermolecular interactions, due to the presence of multiple constituents in the vapour phase of ILs. Firstly, cedIP, where the ionic vapour constituent is neutral ion pairs, the major constituent of the IL vapour. Secondly, cedC+A, where the ionic vapour constituents are isolated ions. A cedIP dataset is presented for 64 ILs. For the first time an experimental cedC+A, a measure of the strength of the total intermolecular interaction for an IL, is presented. cedC+A is significantly larger for ILs than ced for most molecular liquids, reflecting the need to break all of the relatively strong electrostatic interactions present in ILs. However, the van der Waals interactions contribute significantly to IL volatility due to the very strong electrostatic interaction in the neutral ion pair ionic vapour. An excellent linear correlation is found between cedIP and the inverse of the molecular volume. A good linear correlation is found between IL cedIP and IL Gordon parameter (which are dependent primarily on surface tension). ced values obtained through indirect methods gave similar magnitude values to cedIP. These findings show that cedIP is very important for understanding IL intermolecular interactions, in spite of cedIP not being a measure of the total intermolecular interactions of an IL. In the outlook section, remaining challenges for understanding IL intermolecular interactions are outlined. PMID:29308254

  7. Quantifying intermolecular interactions of ionic liquids using cohesive energy densities.

    Science.gov (United States)

    Lovelock, Kevin R J

    2017-12-01

    For ionic liquids (ILs), both the large number of possible cation + anion combinations and their ionic nature provide a unique challenge for understanding intermolecular interactions. Cohesive energy density, ced , is used to quantify the strength of intermolecular interactions for molecular liquids, and is determined using the enthalpy of vaporization. A critical analysis of the experimental challenges and data to obtain ced for ILs is provided. For ILs there are two methods to judge the strength of intermolecular interactions, due to the presence of multiple constituents in the vapour phase of ILs. Firstly, ced IP , where the ionic vapour constituent is neutral ion pairs, the major constituent of the IL vapour. Secondly, ced C+A , where the ionic vapour constituents are isolated ions. A ced IP dataset is presented for 64 ILs. For the first time an experimental ced C+A , a measure of the strength of the total intermolecular interaction for an IL, is presented. ced C+A is significantly larger for ILs than ced for most molecular liquids, reflecting the need to break all of the relatively strong electrostatic interactions present in ILs. However, the van der Waals interactions contribute significantly to IL volatility due to the very strong electrostatic interaction in the neutral ion pair ionic vapour. An excellent linear correlation is found between ced IP and the inverse of the molecular volume. A good linear correlation is found between IL ced IP and IL Gordon parameter (which are dependent primarily on surface tension). ced values obtained through indirect methods gave similar magnitude values to ced IP . These findings show that ced IP is very important for understanding IL intermolecular interactions, in spite of ced IP not being a measure of the total intermolecular interactions of an IL. In the outlook section, remaining challenges for understanding IL intermolecular interactions are outlined.

  8. Nitroxide stable radicals interacting as Lewis bases in hydrogen bonds: A search in the Cambridge structural data base for intermolecular contacts

    Science.gov (United States)

    Alkorta, Ibon; Elguero, José; Elguero, Eric

    2017-11-01

    1125 X-ray structures of nitroxide free radicals presenting intermolecular hydrogen bonds have been reported in the Cambridge Structural Database. We will report in this paper a qualitative and quantitative analysis of these bonds. The observation in some plots of an excluded region was statistically analyzed using convex hull and kernel smooting methodologies. A theoretical study at the MP2 level with different basis has been carried out indicating that the nitronyl nitroxide radicals (five electrons) lie just in between nitroso compounds (four electrons) and amine N-oxides (six electrons) as far as hydrogen-bond basicity is concerned.

  9. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  10. A Closer Look at Trends in Boiling Points of Hydrides: Using an Inquiry-Based Approach to Teach Intermolecular Forces of Attraction

    Science.gov (United States)

    Glazier, Samantha; Marano, Nadia; Eisen, Laura

    2010-01-01

    We describe how we use boiling-point trends of group IV-VII hydrides to introduce intermolecular forces in our first-year general chemistry classes. Starting with the idea that molecules in the liquid state are held together by some kind of force that must be overcome for boiling to take place, students use data analysis and critical reasoning to…

  11. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  12. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  13. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    Science.gov (United States)

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

    2015-01-01

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  14. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  15. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  16. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  17. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  18. Electronic transitions and intermolecular forces

    International Nuclear Information System (INIS)

    Hemert, M.C. van.

    1981-01-01

    This thesis describes two different subjects - electronic transitions and intermolecular forces - that are related mainly by the following observation: The wavenumber at which an electronic transition in an atom or molecule occurs, depends on the environment of that atom or molecule. This implies, for instance, that when a molecule becomes solvated its absorption spectrum may be shifted either to the blue or to the red side of the original gasphase spectrum. In part I attention is paid to the experimental aspects of VUV spectroscopy, both in the gasphase and in the condensed phase. In part II a series of papers are presented, dealing with the calculation of intermolecular forces (and some related topics) both for the ground state and for the excited state interactions, using different non-empirical methods. The calculations provide, among other results, a semiquantitative interpretation of the spectral blue shifts encountered in our experiments. (Auth.)

  19. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  20. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  1. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  2. Intermolecular interactions in the condensed phase

    DEFF Research Database (Denmark)

    Christensen, Anders S.; Kromann, Jimmy Charnley; Jensen, Jan Halborg

    2017-01-01

    To facilitate further development of approximate quantum mechanical methods for condensed phase applications, we present a new benchmark dataset of intermolecular interaction energies in the solution phase for a set of 15 dimers, each containing one charged monomer. The reference interaction energy...... and solution phases. As most approximate QM methods are parametrized and evaluated using data measured or calculated in the gas phase, the dataset represents an important first step toward calibrating QM based methods for application in the condensed phase where polarization and exchange repulsion need...

  3. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  4. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  5. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  7. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  8. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  9. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  10. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  11. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  12. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  13. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  14. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  15. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  16. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  17. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  18. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  19. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  20. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  1. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    Science.gov (United States)

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  2. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  3. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  4. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  5. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  6. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  7. Desensitization and recovery of metastable intermolecular composites

    Science.gov (United States)

    Busse, James R [South Fork, CO; Dye, Robert C [Los Alamos, NM; Foley, Timothy J [Los Alamos, NM; Higa, Kelvin T [Ridgecrest, CA; Jorgensen, Betty S [Jemez Springs, NM; Sanders, Victor E [White Rock, NM; Son, Steven F [Los Alamos, NM

    2010-09-07

    A method to substantially desensitize a metastable intermolecular composite material to electrostatic discharge and friction comprising mixing the composite material with an organic diluent and removing enough organic diluent from the mixture to form a mixture with a substantially putty-like consistency, as well as a concomitant method of recovering the metastable intermolecular composite material.

  8. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  9. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  10. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.

    2011-01-01

    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  11. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  12. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  13. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  16. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  17. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  18. Crystal structure of the anti-(carcinoembryonic antigen) single-chain Fv antibody MFE-23 and a model for antigen binding based on intermolecular contacts.

    Science.gov (United States)

    Boehm, M K; Corper, A L; Wan, T; Sohi, M K; Sutton, B J; Thornton, J D; Keep, P A; Chester, K A; Begent, R H; Perkins, S J

    2000-03-01

    MFE-23 is the first single-chain Fv antibody molecule to be used in patients and is used to target colorectal cancer through its high affinity for carcinoembryonic antigen (CEA), a cell-surface member of the immunoglobulin superfamily. MFE-23 contains an N-terminal variable heavy-chain domain joined by a (Gly(4)Ser)(3) linker to a variable light-chain (V(L)) domain (kappa chain) with an 11-residue C-terminal Myc-tag. Its crystal structure was determined at 2.4 A resolution by molecular replacement with an R(cryst) of 19.0%. Five of the six antigen-binding loops, L1, L2, L3, H1 and H2, conformed to known canonical structures. The sixth loop, H3, displayed a unique structure, with a beta-hairpin loop and a bifurcated apex characterized by a buried Thr residue. In the crystal lattice, two MFE-23 molecules were associated back-to-back in a manner not seen before. The antigen-binding site displayed a large acidic region located mainly within the H2 loop and a large hydrophobic region within the H3 loop. Even though this structure is unliganded within the crystal, there is an unusually large region of contact between the H1, H2 and H3 loops and the beta-sheet of the V(L) domain of an adjacent molecule (strands DEBA) as a result of intermolecular packing. These interactions exhibited remarkably high surface and electrostatic complementarity. Of seven MFE-23 residues predicted to make contact with antigen, five participated in these lattice contacts, and this model for antigen binding is consistent with previously reported site-specific mutagenesis of MFE-23 and its effect on CEA binding.

  19. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  20. The iodine molecule insights into intra- and intermolecular perturbation in diatomic molecules

    CERN Document Server

    Lukashov, Sergey; Pravilov, Anatoly

    2018-01-01

    This book presents experimental and theoretical spectroscopic studies performed over the last 25 years on the iodine molecule’s excited states and their perturbations. It is going to be of interest to researchers who study intra- and intermolecular perturbations in diatomic molecules and more complex systems. The book offers a detailed treatment of the nonadiabatic perturbations of valence, ion pair and Rydberg states induced by intramolecular as well as intermolecular interactions in collisions or in weakly-bound complexes. It also provides an overview of current instrumentation and techniques as well as theoretical approaches describing intra- and intermolecular perturbations. The authors are experts in the use of spectroscopy for the study of intrinsic and collision-induced perturbations in diatomic iodine. They introduced new methods of two- and three-step optical population of the iodine ion-pair states. The iodine molecule has 23 valence states correlating with three dissociation limits, 20 so-called ...

  1. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    Science.gov (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  2. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  3. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  4. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  5. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  6. Characterizing the Polymer:Fullerene Intermolecular Interactions

    KAUST Repository

    Sweetnam, Sean; Vandewal, Koen; Cho, Eunkyung; Risko, Chad; Coropceanu, Veaceslav; Salleo, Alberto; Bredas, Jean-Luc; McGehee, Michael D.

    2016-01-01

    the polymer and fullerene, there is not a consensus on the nature of these interactions. In this work, we use a combination of Raman spectroscopy, charge transfer state absorption, and density functional theory calculations to show that the intermolecular

  7. Characterizing the Polymer:Fullerene Intermolecular Interactions

    KAUST Repository

    Sweetnam, Sean

    2016-02-02

    Polymer:fullerene solar cells depend heavily on the electronic coupling of the polymer and fullerene molecular species from which they are composed. The intermolecular interaction between the polymer and fullerene tends to be strong in efficient photovoltaic systems, as evidenced by efficient charge transfer processes and by large changes in the energetics of the polymer and fullerene when they are molecularly mixed. Despite the clear presence of these strong intermolecular interactions between the polymer and fullerene, there is not a consensus on the nature of these interactions. In this work, we use a combination of Raman spectroscopy, charge transfer state absorption, and density functional theory calculations to show that the intermolecular interactions do not appear to be caused by ground state charge transfer between the polymer and fullerene. We conclude that these intermolecular interactions are primarily van der Waals in nature. © 2016 American Chemical Society.

  8. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  9. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  10. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  11. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  12. Gold-catalyzed intermolecular coupling of sulfonylacetylene with allyl ethers: [3,3]- and [1,3]-rearrangements

    Directory of Open Access Journals (Sweden)

    Jungho Jun

    2013-08-01

    Full Text Available Gold-catalyzed intermolecular couplings of sulfonylacetylenes with allyl ethers are reported. A cooperative polarization of alkynes both by a gold catalyst and a sulfonyl substituent resulted in an efficient intermolecular tandem carboalkoxylation. Reactions of linear allyl ethers are consistent with the [3,3]-sigmatropic rearrangement mechanism, while those of branched allyl ethers provided [3,3]- and [1,3]-rearrangement products through the formation of a tight ion–dipole pair.

  13. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  14. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  15. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  16. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  17. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  18. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  19. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  20. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  1. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  2. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  3. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  4. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  5. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  6. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Competing Intramolecular vs. Intermolecular Hydrogen Bonds in Solution

    Directory of Open Access Journals (Sweden)

    Peter I. Nagy

    2014-10-01

    Full Text Available A hydrogen bond for a local-minimum-energy structure can be identified according to the definition of the International Union of Pure and Applied Chemistry (IUPAC recommendation 2011 or by finding a special bond critical point on the density map of the structure in the framework of the atoms-in-molecules theory. Nonetheless, a given structural conformation may be simply favored by electrostatic interactions. The present review surveys the in-solution competition of the conformations with intramolecular vs. intermolecular hydrogen bonds for different types of small organic molecules. In their most stable gas-phase structure, an intramolecular hydrogen bond is possible. In a protic solution, the intramolecular hydrogen bond may disrupt in favor of two solute-solvent intermolecular hydrogen bonds. The balance of the increased internal energy and the stabilizing effect of the solute-solvent interactions regulates the new conformer composition in the liquid phase. The review additionally considers the solvent effects on the stability of simple dimeric systems as revealed from molecular dynamics simulations or on the basis of the calculated potential of mean force curves. Finally, studies of the solvent effects on the type of the intermolecular hydrogen bond (neutral or ionic in acid-base complexes have been surveyed.

  8. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  9. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  10. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  12. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  13. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  14. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    OpenAIRE

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  15. New bases for the evaluation of interaction energies: An ab initio study of the CO-Ne van der Waals complex intermolecular potential and ro-vibrational spectrum

    International Nuclear Information System (INIS)

    Bouzon Capelo, Silvia; Baranowska-Laczkowska, Angelika; Fernandez, Berta

    2011-01-01

    Graphical abstract: CO-Ne IPES. Highlights: → From the LPol, MLPol, and aug-pc-2 bases we obtained new bases for the evaluation of CO-Ne interaction energies. → We checked the bases on the evaluation of the rovibrational spectrum. → The results were satisfactory, being the new bases more efficient than those previously available. - Abstract: Recently we have derived new efficient basis sets for the evaluation of interaction energies in the X-Y (X, Y = He, Ne, Ar) van der Waals complexes. Here we extend the study to the CO-Ne complex. For this, we start with a systematic basis set study, where the LPol, MLPol and Jensen's aug-pc-2 basis sets are considered as starting point (for the Ne atom LPol bases are developed). As reference we take interaction energy results obtained with Dunning's augmented correlation consistent polarized valence basis sets. In all cases we test extensions with different sets of midbond functions. With the selected bases we evaluate CCSD(T) interaction potentials, and to check the potentials further, we obtain the ro-vibrational spectrum of the complex. The results are compared to the available experimental data.

  16. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  17. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  18. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  19. Cohesion: a scientific history of intermolecular forces

    National Research Council Canada - National Science Library

    Rowlinson, J. S

    2002-01-01

    .... The final section gives an account of the successful use in the 20th century of quantum mechanics and statistical mechanics to resolve most of the remaining problems. Throughout the last 300 years there have been periods of tremendous growth in our understanding of intermolecular forces but such interest proved to be unsustainable, and long periods of...

  20. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  1. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  2. New models for intermolecular repulsion and their application to Van Der Waals complexes and crystals of organic molecules

    International Nuclear Information System (INIS)

    Tsui, H.H.Y.

    2001-01-01

    Model intermolecular potentials are required for simulations of molecules in the gas, liquid, or solid phase. The widely used isotropic atom-atom model potentials are empirically fitted and based on the assumptions of transferability, combining rules and that atoms in molecules are spherical. This thesis develops a non-empirical method of modelling repulsion by applying the overlap model, which we show as a general non-empirical method of deriving repulsion potentials for a specific molecule. In this thesis, the repulsion parameters for an exponential atom-atom model potential are obtained from the ab initio charge density of a small organic molecule by making the assumption that the repulsion is proportional to the overlap of a pair of molecules. The proportionality constant is fixed by a limited number of intermolecular perturbation theory (IMPT) calculations. To complete the model potential, the electrostatic interaction is represented by a distributed multipole analysis, and the Slater-Kirkwood formula is used for the dispersion. These non-empirical potentials can reproduce experimental crystal structure when applied to crystal structure prediction of an oxyboryl derivative. A detailed study on further improving the overlap model was carried out for phenol-water, by including other minor intermolecular contributions of charge-transfer and penetration. High quality ab initio calculations on the complex were performed for use in comparison. To compare with experimental data, diffusion Monte Carlo simulations were performed with the potential, so that the effects of anharmonic zero-point motion on structure and energy of the system are included. When the system is too large for an IMPT calculation, the proportionality constant can be determined empirically by fitting the cell volume as shown in our study of crystal structures of chlorothalonil. This is used with an anisotropic repulsion model that has been derived for Cl and N atoms in chlorothalonil. This model

  3. The Raman and vibronic activity of intermolecular vibrations in aromatic-containing complexes and clusters

    International Nuclear Information System (INIS)

    Maxton, P.M.; Schaeffer, M.W.; Ohline, S.M.; Kim, W.; Venturo, V.A.; Felker, P.M.

    1994-01-01

    Theoretical and experimental results pertaining to the excitation of intermolecular vibrations in the Raman and vibronic spectra of aromatic-containing, weakly bound complexes and clusters are reported. The theoretical analysis of intermolecular Raman activity is based on the assumption that the polarizability tensor of a weakly bound species is given by the sum of the polarizability tensors of its constituent monomers. The analysis shows that the van der Waals bending fundamentals in aromatic--rare gas complexes may be expected to be strongly Raman active. More generally, it predicts strong Raman activity for intermolecular vibrations that involve the libration or internal rotation of monomer moieties having appreciable permanent polarizability anisotropies. The vibronic activity of intermolecular vibrations in aromatic-rare gas complexes is analyzed under the assumption that every vibronic band gains its strength from an aromatic-localized transition. It is found that intermolecular vibrational excitations can accompany aromatic-localized vibronic excitations by the usual Franck--Condon mechanism or by a mechanism dependent on the librational amplitude of the aromatic moiety during the course of the pertinent intermolecular vibration. The latter mechanism can impart appreciable intensity to bands that are forbidden by rigid-molecule symmetry selection rules. The applicability of such rules is therefore called into question. Finally, experimental spectra of intermolecular transitions, obtained by mass-selective, ionization-detected stimulated Raman spectroscopies, are reported for benzene--X (X=Ar, --Ar 2 , N 2 , HCl, CO 2 , and --fluorene), fluorobenzene--Ar and --Kr, aniline--Ar, and fluorene--Ar and --Ar 2 . The results support the conclusions of the theoretical analyses and provide further evidence for the value of Raman methods in characterizing intermolecular vibrational level structures

  4. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  5. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  6. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  7. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  8. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  9. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  10. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  11. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  12. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  13. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  14. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  15. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  16. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  17. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  18. Digital communication through intermolecular fluorescence modulation.

    Science.gov (United States)

    Raymo, F M; Giordani, S

    2001-06-14

    [see reaction]. Ultraminiaturized processors incorporating molecular components can be developed only after devising efficient strategies to communicate signals at the molecular level. We have demonstrated that a three-state molecular switch responds to ultraviolet light, visible light, and H+, attenuating the emission intensity of a fluorescent probe. Intermolecular communication is responsible for the transduction of three input signals into a single optical output. The behavior of the communicating ensemble of molecules corresponds to that of a logic circuit incorporating seven gates.

  19. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  20. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  1. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  2. Single-molecule magnets ``without'' intermolecular interactions

    Science.gov (United States)

    Wernsdorfer, W.; Vergnani, L.; Rodriguez-Douton, M. J.; Cornia, A.; Neugebauer, P.; Barra, A. L.; Sorace, L.; Sessoli, R.

    2012-02-01

    Intermolecular magnetic interactions (dipole-dipole and exchange) affect strongly the magnetic relaxation of crystals of single-molecule magnets (SMMs), especially at low temperature, where quantum tunneling of the magnetization (QTM) dominates. This leads to complex many-body problems [l]. Measurements on magnetically diluted samples are desirable to clearly sort out the behaviour of magnetically-isolated SMMs and to reveal, by comparison, the effect of intermolecular interactions. Here, we diluted a Fe4 SMM into a diamagnetic crystal lattice, affording arrays of independent and iso-oriented magnetic units. We found that the resonant tunnel transitions are much sharper, the tunneling efficiency changes significantly, and two-body QTM transitions disappear. These changes have been rationalized on the basis of a dipolar shuffling mechanism and of transverse dipolar fields, whose effect has been analyzed using a multispin model. Our findings directly prove the impact of intermolecular magnetic couplings on the SMM behaviour and disclose the magnetic response of truly-isolated giant spins in a diamagnetic crystalline environment.[4pt] [1] W. Wernsdorfer, at al, PRL 82, 3903 (1999); PRL 89, 197201 (2002); Nature 416, 406 (2002); IS Tupitsyn, PCE Stamp, NV Prokof'ev, PRB 69, 132406 (2004).

  3. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  4. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  5. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    Science.gov (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  7. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  8. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  11. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  12. Structural modeling and intermolecular correlation of liquid chlorine dioxide

    International Nuclear Information System (INIS)

    Ogata, Norio; Hironori, Shimakura; Kawakita, Yukinobu; Ohara, Yukoji; Kohara, Shinji; Takeda, Shinichi

    2009-01-01

    Chlorine dioxide (ClO 2 ) is water-soluble yellow gas at room temperature. It has long been used as a disinfectant of tap water and various commodities owing to its strong oxidizing activity against various microbial proteins. The oxidizing activity is believed to be due to the presence of unpaired electron in its molecular orbital. Despite wealth of physicochemical studies of gaseous ClO 2 , little is known about liquid ClO 2 , especially about fine molecular structure and intermolecular interactions of liquid ClO 2 . The purpose of this study is to elucidate the fine structure and intermolecular orientations of ClO 2 molecules in its liquid state using a high-energy X-ray diffraction technique. The measurements of liquid ClO 2 were carried out at -50 to 0 degree Celsius using a two-axis diffractometer installed at the BL04B2 beamline in the third-generation synchrotron radiation facility SPring-8 (Hyogo, Japan). The incident X-ray beamline was 113.4 keV in energy and 0.1093 Armstrong in wavelength from a Si(111) monochromator with the third harmonic reflection. Liquid ClO 2 held in a quartz capillary tube was placed in a temperature-controlled vacuum chamber. We obtained a structure factor S(Q) to a range of Q = 0.3-30 Amstrong -1 and a pair distribution function g(r) upon Fourier transform of the S(Q). The total g(r) showed peaks at 1.46, 2.08, 2.48, 3.16 and 4.24 Armstrong. From intramolecular bond lengths of 1.46 Armstrong for Cl-O and 2.48 Armstrong for O-O, O-Cl-O bond angle was estimated to be 116.1 degrees. Peaks at 3.16 and 4.24 Armstrong in the total g(r) strongly indicate presence of specific intermolecular orientations of ClO 2 molecules that are distinct from those observed as a dimer in the solid phase ClO 2 . This view was further supported by molecular simulation using a reverse Monte Carlo method (RMC). (author)

  13. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  14. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  15. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  16. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  17. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  18. Rubrene: The interplay between intramolecular and intermolecular interactions determines the planarization of its tetracene core in the solid state

    KAUST Repository

    Sutton, Christopher; Marshall, Michael S.; Sherrill, C. David; Risko, Chad; Bredas, Jean-Luc

    2015-01-01

    exchange-repulsion interactions among the phenyl side groups. Calculations based on available crystallographic structures reveal that planar conformations of the tetracene core in the solid state result from intermolecular interactions that can be tuned

  19. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  20. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  2. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  3. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  4. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  5. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  6. Graph-based surface reconstruction from stereo pairs using image segmentation

    Science.gov (United States)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  7. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  8. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  9. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  10. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-01-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  11. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  12. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    Science.gov (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  13. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  14. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  15. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  16. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  17. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  18. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  19. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    Science.gov (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  20. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    Science.gov (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  1. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  2. Direct measurements of intermolecular forces by chemical force microscopy

    Science.gov (United States)

    Vezenov, Dmitri Vitalievich

    1999-12-01

    Detailed description of intermolecular forces is key to understanding a wide range of phenomena from molecular recognition to materials failure. The unique features of atomic force microscopy (AFM) to make point contact force measurements with ultra high sensitivity and to generate spatial maps of surface topography and forces have been extended to include measurements between well-defined organic molecular groups. Chemical modification of AFM probes with self-assembled monolayers (SAMs) was used to make them sensitive to specific molecular interactions. This novel chemical force microscopy (CFM) technique was used to probe forces between different molecular groups in a range of environments (vacuum, organic liquids and aqueous solutions); measure surface energetics on a nanometer scale; determine pK values of the surface acid and base groups; measure forces to stretch and unbind a short synthetic DNA duplex and map the spatial distribution of specific functional groups and their ionization state. Studies of adhesion forces demonstrated the important contribution of hydrogen bonding to interactions between simple organic functionalities. The chemical identity of the tip and substrate surfaces as well as the medium had a dramatic effect on adhesion between model monolayers. A direct correlation between surface free energy and adhesion forces was established. The adhesion between epoxy polymer and model mixed SAMs varied with the amount of hydrogen bonding component in the monolayers. A consistent interpretation of CFM measurements in polar solvents was provided by contact mechanics models and intermolecular force components theory. Forces between tips and surfaces functionalized with SAMs terminating in acid or base groups depended on their ionization state. A novel method of force titration was introduced for highly local characterization of the pK's of surface functional groups. The pH-dependent changes in friction forces were exploited to map spatially the

  3. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  4. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  5. Studying Intermolecular Forces with a Dual Gas Chromatography and Boiling Point Investigation

    Science.gov (United States)

    Cunningham, William Patrick; Xia, Ian; Wickline, Kaitlyn; Huitron, Eric Ivan Garcia; Heo, Jun

    2018-01-01

    A procedure for the study of structural differences and intermolecular attraction between ethanol and 1-butanol based in laboratory work is described. This study provides comparisons of data retrieved from both a determination of boiling point and gas chromatography traces for the mixture. The methodology reported here should provide instructors…

  6. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  7. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  8. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  9. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  10. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  11. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  12. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  15. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  16. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Mechanism of Intermolecular Electron Transfer in Bionanostructures

    Science.gov (United States)

    Gruodis, A.; Galikova, N.; Šarka, K.; Saulė, R.; Batiuškaitė, D.; Saulis, G.

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Most patients are inoperable and hepatoma cells are resistant to conventional chemotherapies. Thus, the development of novel therapies for HCC treatment is of paramount importance. Amongst different alimentary factors, vitamin C and vitamin K3 In the present work, it has been shown that the treatment of mouse hepatoma MH-22A cells by vitamin C and vitamin K3 at the ratio of 100:1 greatly enhanced their cytotoxicity. When cells were subjected to vitamin C at 200 μM or to vitamin K3 at 2 μM separately, their viability reduced by only about 10%. However, when vitamins C and K3 were combined at the same concentrations, they killed more than 90% of cells. To elucidate the mechanism of the synergistic cytotoxicity of the C&K3 mixture, theoretical quantum-chemical analysis of the dynamics of intermolecular electron transfer (IET) processes within the complexes containing C (five forms) and K3 (one form) has been carried out. Optimization of the ground state complex geometry has been provided by means of GAUSSIAN03 package. Simulation of the IET has been carried out using NUVOLA package, in the framework of molecular orbitals (MO). The rate of IET has been calculated using Fermi Golden rule. The results of simulations allow us to create the preliminary model of the reaction pathway.

  18. Intermolecular interaction studies of glyphosate with water

    Science.gov (United States)

    Manon, Priti; Juglan, K. C.; Kaur, Kirandeep; Sethi, Nidhi; Kaur, J. P.

    2017-07-01

    The density (ρ), viscosity (η) and ultrasonic velocity (U) of glyphosate with water have been measured on different ultrasonic frequency ranges from 1MHz, 2MHz, 3MHz & 5MHz by varying concentrations (0.05%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, & 0.40%) at 30°C. The specific gravity bottle, Ostwald's viscometer and quartz crystal interferometer were used to determine density (ρ), viscosity (η) and ultrasonic velocity (U). These three factors contribute in evaluating the other parameters as acoustic impedance (Z), adiabatic compressibility (β), relaxation time (τ), intermolecular free length (Lf), free volume (Vf), ultrasonic attenuation (α/f2), Rao's constant (R), Wada's constant (W) and relative strength (R). Solute-solvent interaction is confirmed by ultrasonic velocity and viscosity values, which increases with increase in concentration indicates stronger association between solute and solvent molecules. With rise in ultrasonic frequency the interaction between the solute and solvent particles decreases. The linear variations in Rao's constant and Wada's constant suggest the absence of complex formation.

  19. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  20. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  1. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  2. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  3. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  4. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    Science.gov (United States)

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  6. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  7. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  8. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt

    2018-05-01

    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  9. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  10. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  12. Measuring Intermolecular Binding Energies by Laser Spectroscopy.

    Science.gov (United States)

    Knochenmuss, Richard; Maity, Surajit; Féraud, Géraldine; Leutwyler, Samuel

    2017-02-22

    The ground-state dissociation energy, D0(S0), of isolated intermolecular complexes in the gas phase is a fundamental measure of the interaction strength between the molecules. We have developed a three-laser, triply resonant pump-dump-probe technique to measure dissociation energies of jet-cooled M•S complexes, where M is an aromatic chromophore and S is a closed-shell 'solvent' molecule. Stimulated emission pumping (SEP) via the S0→S1 electronic transition is used to precisely 'warm' the complex by populating high vibrational levels v" of the S0 state. If the deposited energy E(v") is less than D0(S0), the complex remains intact, and is then mass- and isomer-selectively detected by resonant two-photon ionization (R2PI) with a third (probe) laser. If the pumped level is above D0(S0), the hot complex dissociates and the probe signal disappears. Combining the fluorescence or SEP spectrum of the cold complex with the SEP breakoff of the hot complex brackets D0(S0). The UV chromophores 1-naphthol and carbazole were employed; these bind either dispersively via the aromatic rings, or form a hydrogen bond via the -OH or -NH group. Dissociation energies have been measured for dispersively bound complexes with noble gases (Ne, Kr, Ar, Xe), diatomics (N2, CO), alkanes (methane to n-butane), cycloalkanes (cyclopropane to cycloheptane), and unsaturated compounds (ethene, benzene). Hydrogen-bond dissociation energies have been measured for H2O, D2O, methanol, ethanol, ethers (oxirane, oxetane), NH3 and ND3.

  13. Analysis of intermolecular RNA-RNA recombination by rubella virus

    International Nuclear Information System (INIS)

    Adams, Sandra D.; Tzeng, W.-P.; Chen, M.-H.; Frey, Teryl K.

    2003-01-01

    To investigate whether rubella virus (RUB) undergoes intermolecular RNA-RNA recombination, cells were cotransfected with pairs of in vitro transcripts from genomic cDNA plasmid vectors engineered to contain nonoverlapping deletions: the replicative transcript maintained the 5'-proximal nonstructural (NS) ORF (which contained the replicase, making it RNA replication competent), had a deletion in the 3'-proximal structural protein (SP) ORF, and maintained the 3' end of the genome, including the putative 3' cis-acting elements (CSE), while the nonreplicative transcript consisted of the 3' half of the genome including the SP-ORF and 3' CSE. Cotransfection yielded plaque-forming virus that synthesized the standard genomic and subgenomic RNAs and thus was generated by RNA-RNA recombination. Using transcripts tagged with a 3'-terminal deletion, it was found that recombinants contained the 3' end derived from the replicative strand, indicating a cis-preference for initiation of negative-strand synthesis. In cotransfections in which the replicative transcript lacked the 3' CSE, recombination occurred, albeit at lower efficiency, indicating that initiation in trans from the NS-ORF can occur. The 3' CSE was sufficient as a nonreplicative transcript, showing that it can serve as a promoter for negative-strand RNA synthesis. While deletion mutagenesis showed that the presence of the junction untranslated region (J-UTR) between the ORFs appeared to be necessary on both transcripts for recombination in this region of the genome, analysis with transcripts tagged with restriction sites showed that the J-UTR was not a hot spot for recombination compared to neighboring regions in both ORFs. Sequence analysis of recombinants revealed that both precise (homologous) and imprecise recombination (aberrant, homologous resulting in duplications) occurred; however, imprecise recombination only involved the J-UTR or the 3' end of the NS-ORF and the J-UTR (maintaining the NS-ORF), indicating

  14. Molecular electrostatics for probing lone pair-π interactions.

    Science.gov (United States)

    Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R

    2013-11-14

    An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.

  15. All rights reserved Intermolecular Model Potentials and Virial ...

    African Journals Online (AJOL)

    ADOWIE PERE

    Intermolecular Model Potentials and Virial Coefficients from Acoustic Data. 1* ... method of cluster expansion. Its merit is that, ... their determination is by the analyses of isothermal p- ρ-y data ... Carlo simulation method to calculate volumetric.

  16. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  17. He-, Ne-, and Ar-phosgene intermolecular potential energy surfaces

    DEFF Research Database (Denmark)

    Munteanu, Cristian R.; Henriksen, Christian; Felker, Peter M.

    2013-01-01

    Using the CCSD(T) model, we evaluated the intermolecular potential energy surfaces of the He-, Ne-, and Ar-phosgene complexes. We considered a representative number of intermolecular geometries for which we calculated the corresponding interaction energies with the augmented (He complex) and doub...... of the complexes, providing valuable results for future experimental investigations. Comparing our results to those previously available for other phosgene complexes, we suggest that the results for Cl2-phosgene should be revised....

  18. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  20. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  1. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  2. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  3. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  4. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  5. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  6. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  7. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  8. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  9. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  10. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  11. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  12. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  14. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    Science.gov (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  15. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia

    2016-03-01

    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  16. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    Science.gov (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  17. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  18. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  19. Localized-overlap approach to calculations of intermolecular interactions

    Science.gov (United States)

    Rob, Fazle

    Symmetry-adapted perturbation theory (SAPT) based on the density functional theory (DFT) description of the monomers [SAPT(DFT)] is one of the most robust tools for computing intermolecular interaction energies. Currently, one can use the SAPT(DFT) method to calculate interaction energies of dimers consisting of about a hundred atoms. To remove the methodological and technical limits and extend the size of the systems that can be calculated with the method, a novel approach has been proposed that redefines the electron densities and polarizabilities in a localized way. In the new method, accurate but computationally expensive quantum-chemical calculations are only applied for the regions where it is necessary and for other regions, where overlap effects of the wave functions are negligible, inexpensive asymptotic techniques are used. Unlike other hybrid methods, this new approach is mathematically rigorous. The main benefit of this method is that with the increasing size of the system the calculation scales linearly and, therefore, this approach will be denoted as local-overlap SAPT(DFT) or LSAPT(DFT). As a byproduct of developing LSAPT(DFT), some important problems concerning distributed molecular response, in particular, the unphysical charge-flow terms were eliminated. Additionally, to illustrate the capabilities of SAPT(DFT), a potential energy function has been developed for an energetic molecular crystal of 1,1-diamino-2,2-dinitroethylene (FOX-7), where an excellent agreement with the experimental data has been found.

  20. The origins of the directionality of noncovalent intermolecular interactions.

    Science.gov (United States)

    Wang, Changwei; Guan, Liangyu; Danovich, David; Shaik, Sason; Mo, Yirong

    2016-01-05

    The recent σ-hole concept emphasizes the contribution of electrostatic attraction to noncovalent bonds, and implies that the electrostatic force has an angular dependency. Here a set of clusters, which includes hydrogen bonding, halogen bonding, chalcogen bonding, and pnicogen bonding systems, is investigated to probe the magnitude of covalency and its contribution to the directionality in noncovalent bonding. The study is based on the block-localized wavefunction (BLW) method that decomposes the binding energy into the steric and the charge transfer (CT) (hyperconjugation) contributions. One unique feature of the BLW method is its capability to derive optimal geometries with only steric effect taken into account, while excluding the CT interaction. The results reveal that the overall steric energy exhibits angular dependency notably in halogen bonding, chalcogen bonding, and pnicogen bonding systems. Turning on the CT interactions further shortens the intermolecular distances. This bond shortening enhances the Pauli repulsion, which in turn offsets the electrostatic attraction, such that in the final sum, the contribution of the steric effect to bonding is diminished, leaving the CT to dominate the binding energy. In several other systems particularly hydrogen bonding systems, the steric effect nevertheless still plays the major role whereas the CT interaction is minor. However, in all cases, the CT exhibits strong directionality, suggesting that the linearity or near linearity of noncovalent bonds is largely governed by the charge-transfer interaction whose magnitude determines the covalency in noncovalent bonds. © 2015 Wiley Periodicals, Inc.

  1. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  3. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  4. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  5. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  6. Intermolecular ion pairs maintain the toroidal structure of Pyrococcus furiosus PCNA

    OpenAIRE

    Matsumiya, Shigeki; Ishino, Sonoko; Ishino, Yoshizumi; Morikawa, Kosuke

    2003-01-01

    Two mutant proliferating cell nuclear antigens from the hyperthermophilic archaeon Pyrococcus furiosus, PfuPCNA(D143A) and PfuPCNA(D143A/D147A), were prepared by site-specific mutagenesis. The results from gel filtration showed that mutations at D143 and D147 drastically affect the stability of the trimeric structure of PfuPCNA. The PfuPCNA(D143A) still retained the activity to stimulate the DNA polymerase reaction, but PfuPCNA(D143A/D147A) lost the activity. Crystal structures of the mutant ...

  7. Morse-Morse-Spline-Van der Waals intermolecular potential suitable for hexafluoride gases

    International Nuclear Information System (INIS)

    Coroiu, Ilioara

    2004-01-01

    Several effective isotopic pair potential functions have been proposed to characterize the bulk properties of quasispherical molecules, in particular the hexafluorides, but none got a success. Unfortunately, these potentials have repulsive walls steeper than those which describe the hexafluorides. That these intermolecular potentials are not quite adequate is shown by the lack of complete agreement between theory and experiment even for the rare gases. Not long ago, R. A. Aziz et al. have constructed a Morse-Morse-Spline-Van der Waals (MMSV) potential. The MMSV potential incorporates the determination of C 6 dispersion coefficient and it reasonably correlates second virial coefficients and viscosity data of sulphur hexafluoride at the same time. None of the potential functions previously proposed in literature could predict these properties simultaneously. We calculated the second virial coefficients and a large number of Chapman-Cowling collision integrals for this improved intermolecular potential, the MMSV potential. The results were tabulated for a large reduced temperature range, kT/ε from 0.1 to 100. The treatment was entirely classical and no corrections for quantum effects were made. The higher approximations to the transport coefficients and the isotopic thermal diffusion factor were also calculated and tabulated for the same range. In this paper we present the evaluation of the uranium hexafluoride potential parameters for the MMSV intermolecular potential. To find a single set of potential parameters which could predict all the transport properties (viscosity, thermal conductivity, self diffusion, etc.), as well as the second virial coefficients, simultaneously, the method suggested by Morizot and a large assortment of literature data were used. Our results emphasized that the Morse-Morse-Spline-Van der Waals potential have the best overall predictive ability for gaseous hexafluoride data, certain for uranium hexafluoride. (author)

  8. Intermolecular interactions between σ- and π-holes of bromopentafluorobenzene and pyridine: computational and experimental investigations.

    Science.gov (United States)

    Yang, Fang-Ling; Yang, Xing; Wu, Rui-Zhi; Yan, Chao-Xian; Yang, Fan; Ye, Weichun; Zhang, Liang-Wei; Zhou, Pan-Pan

    2018-04-25

    The characters of σ- and π-holes of bromopentafluorobenzene (C6F5Br) enable it to interact with an electron-rich atom or group like pyridine which possesses an electron lone-pair N atom and a π ring. Theoretical studies of intermolecular interactions between C6F5Br and C5H5N have been carried out at the M06-2X/aug-cc-pVDZ level without and with the counterpoise method, together with single point calculations at M06-2X/TZVP, wB97-XD/aug-cc-pVDZ and CCSD(T)/aug-cc-pVDZ levels. The σ- and π-holes of C6F5Br exhibiting positive electrostatic potentials make these sites favorably interact with the N atom and the π ring of C5H5N with negative electrostatic potentials, leading to five different dimers connected by a σ-holen bond, a σ-holeπ bond or a π-holeπ bond. Their geometrical structures, characteristics, nature and spectroscopy behaviors were systematically investigated. EDA analyses reveal that the driving forces in these dimers are different. NCI, QTAIM and NBO analyses confirm the existence of intermolecular interactions formed via σ- and π-holes of C6F5Br and the N atom and the π ring of C5H5N. The experimental IR and Raman spectra gave us important information about the formation of molecular complexes between C6F5Br and C5H5N. We expect that the results could provide valuable insights into the investigation of intermolecular interactions involving σ- and π-holes.

  9. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  10. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

    Science.gov (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

    2018-05-01

    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  11. Exciplex: An Intermolecular Charge-Transfer Approach for TADF.

    Science.gov (United States)

    Sarma, Monima; Wong, Ken-Tsung

    2018-04-03

    Organic materials that display thermally activated delayed fluorescence (TADF) are a striking class of functional materials that have witnessed a booming progress in recent years. In addition to pure TADF emitters achieved by the subtle manipulations of intramolecular charge transfer processes with sophisticated molecular structures, a new class of efficient TADF-based OLEDs with emitting layer formed by blending electron donor and acceptor molecules that involve intermolecular charge transfer have also been fabricated. In contrast to pure TADF materials, the exciplex-based systems can realize small ΔEST (0-0.05 eV) much more easily since the electron and hole are positioned on two different molecules, thereby giving small exchange energy. Consequently, exciplex-based OLEDs have the prospective to maximize the TADF contribution and achieve theoretical 100% internal quantum efficiency. Therefore, the challenging issue of achieving small ΔEST in organic systems could be solved. In this article, we summarize and discuss the latest and most significant developments regarding these rapidly evolving functional materials, wherein the majority of the reported exciplex forming systems are categorized into two sub-groups, viz. (a) exciplex as TADF emitters and (b) those as hosts for fluorescent, phosphorescent and TADF dopants according to their structural features and applications. The working mechanisms of the direct electroluminescence from the donor/acceptor interface and the exciplex-forming systems as co-host for the realization of high efficiency OLEDs are reviewed and discussed. This article delivers a summary of the current progresses and achievements of exciplex-based researches and points out the future challenges to trigger more research endeavors to this growing field.

  12. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  13. Similarities between intra- and intermolecular hydrogen bonds in RNA kissing complexes found by means of cross-correlated relaxation

    International Nuclear Information System (INIS)

    Dittmer, Jens; Kim, Chul-Hyun; Bodenhausen, Geoffrey

    2003-01-01

    The bond lengths and dynamics of intra- and intermolecular hydrogen bonds in an RNA kissing complex have been characterized by determining the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitrogen-15 nuclei belonging to opposite bases. New experiments allow one to determine the chemical shift anisotropy of the imino protons. The bond lengths derived from dipolar relaxation and the lack of modulations of the nitrogen chemical shifts indicate that the intermolecular hydrogen bonds which hold the kissing complex together are very similar to the intramolecular hydrogen bonds in the double-stranded stem of the RNA

  14. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

    2015-12-15

    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  15. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    Science.gov (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  18. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  19. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  20. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  1. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  2. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  3. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  4. Boiling points of halogenated ethanes: an explanatory model implicating weak intermolecular hydrogen-halogen bonding.

    Science.gov (United States)

    Beauchamp, Guy

    2008-10-23

    This study explores via structural clues the influence of weak intermolecular hydrogen-halogen bonds on the boiling point of halogenated ethanes. The plot of boiling points of 86 halogenated ethanes versus the molar refraction (linked to polarizability) reveals a series of straight lines, each corresponding to one of nine possible arrangements of hydrogen and halogen atoms on the two-carbon skeleton. A multiple linear regression model of the boiling points could be designed based on molar refraction and subgroup structure as independent variables (R(2) = 0.995, standard error of boiling point 4.2 degrees C). The model is discussed in view of the fact that molar refraction can account for approximately 83.0% of the observed variation in boiling point, while 16.5% could be ascribed to weak C-X...H-C intermolecular interactions. The difference in the observed boiling point of molecules having similar molar refraction values but differing in hydrogen-halogen intermolecular bonds can reach as much as 90 degrees C.

  5. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  6. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  7. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  8. Probing intermolecular protein-protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET)

    DEFF Research Database (Denmark)

    Jensen, Anders A.; Hansen, Jakob L; Sheikh, Søren P

    2002-01-01

    -induced intermolecular movements in the CaR homodimer using the new bioluminescence resonance energy transfer technique, BRET2, which is based on the transference of energy from Renilla luciferase (Rluc) to the green fluorescent protein mutant GFP2. We tagged CaR with Rluc and GFP2 at different intracellular locations...

  9. Synthesis of benzimidazoles by potassium tert-butoxide-promoted intermolecular cyclization reaction of 2-iodoanilines with nitriles.

    Science.gov (United States)

    Xiang, Shi-Kai; Tan, Wen; Zhang, Dong-Xue; Tian, Xian-Li; Feng, Chun; Wang, Bi-Qin; Zhao, Ke-Qing; Hu, Ping; Yang, Hua

    2013-11-14

    The synthesis of benzimidazoles by intermolecular cyclization reaction of 2-iodoanilines with nitriles has been developed. These reactions proceeded without the aid of any transition metals or ligands and just using KOBu(t) as the base. A variety of substituted benzimidazole derivatives can be synthesized by the approach.

  10. Intermolecular Interactions and Cooperative Effects from Electronic Structure Calculations: An Effective Means for Developing Interaction Potentials for Condensed Phase Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Xantheas, Sotiris S.

    2004-05-01

    The modeling of the macroscopic properties of homogeneous and inhomogeneous systems via atomistic simulations such as molecular dynamics (MD) or Monte Carlo (MC) techniques is based on the accurate description of the relevant solvent-solute and solvent-solvent intermolecular interactions. The total energy (U) of an n-body molecular system can be formally written as [1,2,3

  11. Connecting Protein Structure to Intermolecular Interactions: A Computer Modeling Laboratory

    Science.gov (United States)

    Abualia, Mohammed; Schroeder, Lianne; Garcia, Megan; Daubenmire, Patrick L.; Wink, Donald J.; Clark, Ginevra A.

    2016-01-01

    An understanding of protein folding relies on a solid foundation of a number of critical chemical concepts, such as molecular structure, intra-/intermolecular interactions, and relating structure to function. Recent reports show that students struggle on all levels to achieve these understandings and use them in meaningful ways. Further, several…

  12. Phase transitions in liquids with directed intermolecular bonding

    OpenAIRE

    Son, L.; Ryltcev, R.

    2005-01-01

    Liquids with quasi - chemical bonding between molecules are described in terms of vertex model. It is shown that this bonding results in liquid - liquid phase transition, which occurs between phases with different mean density of intermolecular bonds. The transition may be suggested to be a universal phenomena for those liquids.

  13. Dancing Crystals: A Dramatic Illustration of Intermolecular Forces

    Science.gov (United States)

    Mundell, Donald W.

    2007-01-01

    Crystals of naphthalene form on the surface of an acetone solution and dance about in an animated fashion illustrating surface tension, crystallization, and intermolecular forces. Additional experiments reveal the properties of the solution. Flows within the solutions can be visualized by various means. Previous demonstrations of surface motion…

  14. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  15. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  16. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  17. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  18. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  19. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  20. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  1. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  2. Ab initio intermolecular potential energy surface and thermophysical properties of nitrous oxide.

    Science.gov (United States)

    Crusius, Johann-Philipp; Hellmann, Robert; Hassel, Egon; Bich, Eckard

    2015-06-28

    We present an analytical intermolecular potential energy surface (PES) for two rigid nitrous oxide (N2O) molecules derived from high-level quantum-chemical ab initio calculations. Interaction energies for 2018 N2O-N2O configurations were computed utilizing the counterpoise-corrected supermolecular approach at the CCSD(T) level of theory using basis sets up to aug-cc-pVQZ supplemented with bond functions. A site-site potential function with seven sites per N2O molecule was fitted to the pair interaction energies. We validated our PES by computing the second virial coefficient as well as shear viscosity and thermal conductivity in the dilute-gas limit. The values of these properties are substantiated by the best experimental data.

  3. Heteroleptic and Homoleptic Iron(III Spin-Crossover Complexes; Effects of Ligand Substituents and Intermolecular Interactions between Co-Cation/Anion and the Complex

    Directory of Open Access Journals (Sweden)

    Wasinee Phonsri

    2017-08-01

    Full Text Available The structural and magnetic properties of a range of new iron(III bis-tridentate Schiff base complexes are described with emphasis on how intermolecular structural interactions influence spin states and spin crossover (SCO in these d5 materials. Three pairs of complexes were investigated. The first pair are the neutral, heteroleptic complexes [Fe(3-OMe-SalEen(thsa] 1 and [Fe(3-MeOSalEen(3-EtOthsa] 2, where 3-R-HSalEen = (E-2-(((2-(ethylaminoethyliminomethyl-6-R-phenol and 3-R-H2thsa = thiosemicarbazone-3-R-salicylaldimine. They display spin transitions above room temperature. However, 2 shows incomplete and gradual change, while SCO in 1 is complete and more abrupt. Lower cooperativity in 2 is ascribed to the lack of π–π interactions, compared to 1. The second pair, cationic species [Fe(3-EtOSalEen2]NO3 3 and [Fe(3-EtOSalEen2]Cl 4 differ only in the counter-anion. They show partial SCO above room temperature with 3 displaying a sharp transition at 343 K. Weak hydrogen bonds from cation to Cl− probably lead to weaker cooperativity in 4. The last pair, CsH2O[Fe(3-MeO-thsa2] 5 and Cs(H2O2[Fe(5-NO2-thsa2] 6, are anionic homoleptic chelates that have different substituents on the salicylaldiminate rings of thsa2−. The Cs cations bond to O atoms of water and the ligands, in unusual ways thus forming attractive 1D and 3D networks in 5 and 6, respectively, and 5 remains HS (high spin at all temperatures while 6 remains LS (low spin. Comparisons are made to other literature examples of Cs salts of [Fe(5-R-thsa2]− (R = H and Br.

  4. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  5. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  6. Enhanced fullerene–Au(111 coupling in (2√3 × 2√3R30° superstructures with intermolecular interactions

    Directory of Open Access Journals (Sweden)

    Michael Paßens

    2015-06-01

    Full Text Available Disordered and uniform (2√3 × 2√3R30° superstructures of fullerenes on the Au(111 surface have been studied using scanning tunneling microscopy and spectroscopy. It is shown that the deposition and growth process of a fullerene monolayer on the Au(111 surface determine the resulting superstructure. The supply of thermal energy is of importance for the activation of a Au vacancy forming process and thus, one criterion for the selection of the respective superstructure. However, here it is depicted that a vacancy–adatom pair can be formed even at room temperature. This latter process results in C60 molecules that appear slightly more bright in scanning tunnelling microscopy images and are identified in disordered (2√3 x 2√3R30° superstructures based on a detailed structure analysis. In addition, these slightly more bright C60 molecules form uniform (2√3 x 2√3R30° superstructures, which exhibit intermolecular interactions, likely mediated by Au adatoms. Thus, vacancy–adatom pairs forming at room temperature directly affect the resulting C60 superstructure. Differential conductivity spectra reveal a lifting of the degeneracy of the LUMO and LUMO+1 orbitals in the uniform (2√3 x 2√3R30° superstructure and in addition, hybrid fullerene–Au(111 surface states suggest partly covalent interactions.

  7. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  8. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park

    2017-06-01

    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  9. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  10. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    OpenAIRE

    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

    2005-01-01

    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  12. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  14. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  15. Intermolecular cleavage by UmuD-like mutagenesis proteins

    Science.gov (United States)

    McDonald, John P.; Frank, Ekaterina G.; Levine, Arthur S.; Woodgate, Roger

    1998-01-01

    The activity of a number of proteins is regulated by self-processing reactions. Elegant examples are the cleavage of the prokaryotic LexA and λCI transcriptional repressors and the UmuD-like mutagenesis proteins. Various studies support the hypothesis that LexA and λCI cleavage reactions are predominantly intramolecular in nature. The recently described crystal structure of the Escherichia coli UmuD′ protein (the posttranslational cleavage product of the UmuD protein) suggests, however, that the region of the protein corresponding to the cleavage site is at least 50 Å away from the catalytic active site. We considered the possibility, therefore, that the UmuD-like proteins might undergo self-processing that, in contrast to LexA and λCI, occurs via an intermolecular rather than intramolecular reaction. To test this hypothesis, we introduced into E. coli compatible plasmids with mutations at either the cleavage or the catalytic site of three UmuD-like proteins. Cleavage of these proteins only occurs in the presence of both plasmids, indicating that the reaction is indeed intermolecular in nature. Furthermore, this intermolecular reaction is completely dependent upon the multifunctional RecA protein and leads to the restoration of cellular mutagenesis in nonmutable E. coli strains. Intermolecular cleavage of a biotinylated UmuD active site mutant was also observed in vitro in the presence of the wild-type UmuD′ protein, indicating that in addition to the intact UmuD protein, the normal cleavage product (UmuD′) can also act as a classical enzyme. PMID:9465040

  16. Highly Stereoselective Intermolecular Haloetherification and Haloesterification of Allyl Amides

    Science.gov (United States)

    Soltanzadeh, Bardia; Jaganathan, Arvind; Staples, Richard J.

    2016-01-01

    An organocatalytic and highly regio-, diastereo-, and enantioselective intermolecular haloetherification and haloesterification reaction of allyl amides is reported. A variety of alkene substituents and substitution patterns are compatible with this chemistry. Notably, electronically unbiased alkene substrates exhibit exquisite regio- and diastereoselectivity for the title transformation. We also demonstrate that the same catalytic system can be used in both chlorination and bromination reactions of allyl amides with a variety of nucleophiles with little or no modification. PMID:26110812

  17. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  19. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing

    2010-01-01

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  20. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at http://protein.cau.edu.cn/pbPUP/.

  1. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2010-04-15

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  2. Using corresponding state theory to obtain intermolecular potentials to calculate pure liquid shock Hugoniots

    Energy Technology Data Exchange (ETDEWEB)

    Hobbs, M.L.

    1997-12-01

    Determination of product species, equations-of-state (EOS) and thermochemical properties of high explosives and pyrotechnics remains a major unsolved problem. Although, empirical EOS models may be calibrated to replicate detonation conditions within experimental variability (5--10%), different states, e.g. expansion, may produce significant discrepancy with data if the basic form of the EOS model is incorrect. A more physically realistic EOS model based on intermolecular potentials, such as the Jacobs Cowperthwaite Zwisler (JCZ3) EOS, is needed to predict detonation states as well as expanded states. Predictive capability for any EOS requires a large species data base composed of a wide variety of elements. Unfortunately, only 20 species have known JCZ3 molecular force constants. Of these 20 species, only 10 have been adequately compared to experimental data such as molecular scattering or shock Hugoniot data. Since data in the strongly repulsive region of the molecular potential is limited, alternative methods must be found to deduce force constants for a larger number of species. The objective of the present study is to determine JCZ3 product species force constants by using a corresponding states theory. Intermolecular potential parameters were obtained for a variety of gas species using a simple corresponding states technique with critical volume and critical temperature. A more complex, four parameter corresponding state method with shape and polarity corrections was also used to obtain intermolecular potential parameters. Both corresponding state methods were used to predict shock Hugoniot data obtained from pure liquids. The simple corresponding state method is shown to give adequate agreement with shock Hugoniot data.

  3. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  5. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    Science.gov (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  6. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  7. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    Science.gov (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  8. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

    Science.gov (United States)

    Schmitz, Gunnar; Hättig, Christof

    2016-12-21

    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  9. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory

    Science.gov (United States)

    Frank, Marius S.; Hättig, Christof

    2018-04-01

    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  10. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  11. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  12. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  13. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  14. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  15. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  16. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  17. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  18. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Modeling Adsorption-Desorption Processes at the Intermolecular Interactions Level

    Science.gov (United States)

    Varfolomeeva, Vera V.; Terentev, Alexey V.

    2018-01-01

    Modeling of the surface adsorption and desorption processes, as well as the diffusion, are of considerable interest for the physical phenomenon under study in ground tests conditions. When imitating physical processes and phenomena, it is important to choose the correct parameters to describe the adsorption of gases and the formation of films on the structural materials surface. In the present research the adsorption-desorption processes on the gas-solid interface are modeled with allowance for diffusion. Approaches are proposed to describe the adsorbate distribution on the solid body surface at the intermolecular interactions level. The potentials of the intermolecular interaction of water-water, water-methane and methane-methane were used to adequately modeling the real physical and chemical processes. The energies calculated by the B3LYP/aug-cc-pVDZ method. Computational algorithms for determining the average molecule area in a dense monolayer, are considered here. Differences in modeling approaches are also given: that of the proposed in this work and the previously approved probabilistic cellular automaton (PCA) method. It has been shown that the main difference is due to certain limitations of the PCA method. The importance of accounting the intermolecular interactions via hydrogen bonding has been indicated. Further development of the adsorption-desorption processes modeling will allow to find the conditions for of surface processes regulation by means of quantity adsorbed molecules control. The proposed approach to representing the molecular system significantly shortens the calculation time in comparison with the use of atom-atom potentials. In the future, this will allow to modeling the multilayer adsorption at a reasonable computational cost.

  20. An approach to the intermolecular energy in pure liquids

    Directory of Open Access Journals (Sweden)

    GAbriel Hernández de la Torre

    2010-07-01

    Full Text Available Se propone un método para: estimar la energía potencial de repulsión de cualquier molécula central como una función de las densidades ortobáricas en líquidos puros no auto asociados; estimar los parámetros necesarios para calcular la energía de dispersión de London; calcular los números de coordinación promedio, distancias intermoleculares de interacción, diámetros moleculares y de grupos; en moléculas globulares, moléculas planas y parafinas normales.

  1. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  2. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  4. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  5. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  6. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  8. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  9. Effect of intermolecular hydrogen bonding, vibrational analysis and molecular structure of 4-chlorobenzothioamide

    Science.gov (United States)

    Çırak, Çağrı; Sert, Yusuf; Ucun, Fatih

    2013-09-01

    In the present work, the experimental and theoretical vibrational spectra of 4-chlorobenzothioamide were investigated. The FT-IR (400-4000 cm-1) and μ-Raman spectra (100-4000 cm-1) of 4-chlorobenzothioamide in the solid phase were recorded. The geometric parameters (bond lengths and bond angles), vibrational frequencies, Infrared and Raman intensities of the title molecule in the ground state were calculated using ab initio Hartree-Fock and density functional theory (B3LYP) methods with the 6-311++G(d,p) basis set for the first time. The optimized geometric parameters and the theoretical vibrational frequencies were found to be in good agreement with the corresponding experimental data and with the results found in the literature. The vibrational frequencies were assigned based on the potential energy distribution using the VEDA 4 program. The dimeric form of 4-chlorobenzothioamide was also simulated to evaluate the effect of intermolecular hydrogen bonding on the vibrational frequencies. It was observed that the Nsbnd H stretching modes shifted to lower frequencies, while the in-plane and out-of-plane bending modes shifted to higher frequencies due to the intermolecular Nsbnd H⋯S hydrogen bond. Also, the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies and diagrams were presented.

  10. Effect of intermolecular hydrogen bonding, vibrational analysis and molecular structure of a biomolecule: 5-Hydroxymethyluracil

    Science.gov (United States)

    Çırak, Çağrı; Sert, Yusuf; Ucun, Fatih

    2014-06-01

    In the present work, the experimental and theoretical vibrational spectra of 5-hydroxymethyluracil were investigated. The FT-IR (4000-400 cm-1) spectrum of the molecule in the solid phase was recorded. The geometric parameters (bond lengths and bond angles), vibrational frequencies, Infrared intensities of the title molecule in the ground state were calculated using density functional B3LYP and M06-2X methods with the 6-311++G(d,p) basis set for the first time. The optimized geometric parameters and theoretical vibrational frequencies were found to be in good agreement with the corresponding experimental data, and with the results found in the literature. The vibrational frequencies were assigned based on the potential energy distribution using the VEDA 4 program. The dimeric form of 5-hydroxymethyluracil molecule was also simulated to evaluate the effect of intermolecular hydrogen bonding on its vibrational frequencies. It was observed that the Nsbnd H stretching modes shifted to lower frequencies, while its in-plane and out-of-plane bending modes shifted to higher frequencies due to the intermolecular Nsbnd H⋯O hydrogen bond. Also, the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies and diagrams were presented.

  11. Thz Spectroscopy and DFT Modeling of Intermolecular Vibrations in Hydrophobic Amino Acids

    Science.gov (United States)

    Williams, michael R. C.; Aschaffenburg, Daniel J.; Schmuttenmaer, Charles A.

    2013-06-01

    Vibrations that involve intermolecular displacements occur in molecular crystals at frequencies in the 0.5-5 THz range (˜15-165 cm^{-1}), and these motions are direct indicators of the interaction potential between the molecules. The intermolecular potential energy surface of crystalline hydrophobic amino acids is inherently interesting simply because of the wide variety of forces (electrostatic, dipole-dipole, hydrogen-bonding, van der Waals) that are present. Furthermore, an understanding of these particular interactions is immediately relevant to important topics like protein conformation and pharmaceutical polymorphism. We measured the low-frequency absorption spectra of several polycrystalline hydrophobic amino acids using THz time-domain spectroscopy, and in addition we carried out DFT calculations using periodic boundary conditions and an exchange-correlation functional that accounts for van der Waals dispersion forces. We chose to investigate a series of similar amino acids with closely analogous unit cells (leucine, isoleucine, and allo-isoleucine, in racemic or pseudo-racemic mixtures). This allows us to consider trends in the vibrational spectra as a function of small changes in molecular arrangement and/or crystal geometry. In this way, we gain confidence that peak assignments are not based on serendipitous similarities between calculated and observed features.

  12. Binding Cellulose and Chitosan via Intermolecular Inclusion Interaction: Synthesis and Characterisation of Gel

    Directory of Open Access Journals (Sweden)

    Jiufang Duan

    2015-01-01

    Full Text Available A novel cellulose-chitosan gel was successfully prepared in three steps: (1 ferrocene- (Fc- cellulose with degrees of substitution (DS of 0.5 wt% was synthesised by ferrocenecarboxylic acid and cellulose within dimethylacetamide/lithium chloride (DMAc/LiCl; (2 the β-cyclodextrin (β-CD groups were introduced onto the chitosan chains by reacting chitosan with epichlorohydrin in dimethyl sulphoxide and a DS of 0.35 wt%; (3 thus, the cellulose-chitosan gel was obtained via an intermolecular inclusion interaction of Fc-cellulose and β-CD-chitosan in DMA/LiCl, that is, by an intermolecular inclusion interaction, between the Fc groups of cellulose and the β-CD groups on the chitosan backbone at room temperature. The successful synthesis of Fc-cellulose and β-CD-chitosan was characterised by 13C-NMR spectroscopy. The gel based on β-CD-chitosan and Fc-cellulose was formed under mild conditions which can engender autonomous healing between cut surfaces after 24 hours: the gel cannot self-heal while the cut surfaces were coated with a solution of a competitive guest (adamantane acid. The cellulose-chitosan complex made by this method underwent self-healing. Therefore, this study provided a novel method of expanding the application of chitosan by binding it with another polymer.

  13. Quantitative analysis of intermolecular interactions in orthorhombic rubrene

    Directory of Open Access Journals (Sweden)

    Venkatesha R. Hathwar

    2015-09-01

    Full Text Available Rubrene is one of the most studied organic semiconductors to date due to its high charge carrier mobility which makes it a potentially applicable compound in modern electronic devices. Previous electronic device characterizations and first principles theoretical calculations assigned the semiconducting properties of rubrene to the presence of a large overlap of the extended π-conjugated core between molecules. We present here the electron density distribution in rubrene at 20 K and at 100 K obtained using a combination of high-resolution X-ray and neutron diffraction data. The topology of the electron density and energies of intermolecular interactions are studied quantitatively. Specifically, the presence of Cπ...Cπ interactions between neighbouring tetracene backbones of the rubrene molecules is experimentally confirmed from a topological analysis of the electron density, Non-Covalent Interaction (NCI analysis and the calculated interaction energy of molecular dimers. A significant contribution to the lattice energy of the crystal is provided by H—H interactions. The electron density features of H—H bonding, and the interaction energy of molecular dimers connected by H—H interaction clearly demonstrate an importance of these weak interactions in the stabilization of the crystal structure. The quantitative nature of the intermolecular interactions is virtually unchanged between 20 K and 100 K suggesting that any changes in carrier transport at these low temperatures would have a different origin. The obtained experimental results are further supported by theoretical calculations.

  14. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    Science.gov (United States)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  15. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  16. The study of intermolecular interactions in NLO crystal melaminium chloride hemihydrate using DFT simulation and Hirshfeld surface analysis

    Science.gov (United States)

    Sangeetha, K.; Kumar, V. R. Suresh; Marchewka, M. K.; Binoy, J.

    2018-05-01

    Since, the intermolecular interactions play a crucial role in the formation of crystalline network, its analysis throws light on structure dependent crystalline properties. In the present study, DFT based vibrational spectral investigation has been performed in the stretching region (3500 cm-1 - 2800 cm-1) of IR and Raman spectra of melaminium chloride hemihydrates. The intermolecular interaction has been investigated by analyzing the half width of the OH and NH stretching profile of the deconvoluted spectra. Correlation of vibrational spectra with Hirshfeld surface analysis and finger print plot has been contemplated and molecular docking studies has been performed on melaminium chloride hemihydrate to assess its role in the drug transport mechanism and toxicity to human body.

  17. Similarity-transformed perturbation theory on top of truncated local coupled cluster solutions: Theory and applications to intermolecular interactions

    Energy Technology Data Exchange (ETDEWEB)

    Azar, Richard Julian, E-mail: julianazar2323@berkeley.edu; Head-Gordon, Martin, E-mail: mhg@cchem.berkeley.edu [Kenneth S. Pitzer Center for Theoretical Chemistry, Department of Chemistry, University of California and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2015-05-28

    Your correspondents develop and apply fully nonorthogonal, local-reference perturbation theories describing non-covalent interactions. Our formulations are based on a Löwdin partitioning of the similarity-transformed Hamiltonian into a zeroth-order intramonomer piece (taking local CCSD solutions as its zeroth-order eigenfunction) plus a first-order piece coupling the fragments. If considerations are limited to a single molecule, the proposed intermolecular similarity-transformed perturbation theory represents a frozen-orbital variant of the “(2)”-type theories shown to be competitive with CCSD(T) and of similar cost if all terms are retained. Different restrictions on the zeroth- and first-order amplitudes are explored in the context of large-computation tractability and elucidation of non-local effects in the space of singles and doubles. To accurately approximate CCSD intermolecular interaction energies, a quadratically growing number of variables must be included at zeroth-order.

  18. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  19. Role of pn-pairs in nuclear structure

    International Nuclear Information System (INIS)

    Nie, G.K.

    2003-01-01

    An α-cluster model of nuclear structure based on power of proton + neutron (pn)-pairs to bind themselves to α-clusters is proposed. The α-cluster is taken as the perfect condition of coupling of 2 pn- pairs, reminding complete electron shell in atomic physics. Pn-pairs create 2 other types of coupling of considerably less power between pn-pairs of nearby α-clusters ε α c and between pn-pair not bound into α-cluster with pn-pairs of nearby cluster ε pn c . Last two types of coupling are called covalent because of reminding similar electron coupling in chemistry. According the model nucleus is a liquid drop consisting of molecules, which are α-clusters, tied by covalent coupling with those ones which are in close vicinity. Then in case of even-even nuclei spin of the nucleus has to be zero I=0 + as sum of spinless particles. In case of nucleus has some nucleons (i) in intermolecular space, I=Σj i ; with taking into account that there is coupling of p and n in pn-pair. Therefore for 6 Li (1=0)I=2·1/2=1 + . The values ε α c , ε pn c and binding energy of the pn-pair itself ε pn have been estimated from analysis of binding energy of nuclei 6 Li, 10 B and 12 C. With the values the binding energy of the other nuclei with N=Z up to 58 Cu have been described with difference between experimental values and model ones in average less than 0.4 MeV. The structure reveals some regular forms, in which every cluster has reduced amount of covalent coupling, 3 or 4, and free pn-pair has 6 covalent coupling with 3 nearby clusters pn-pairs. Then the magic numbers are supposed to be the matter of geometry, when total amount of covalent couplings is optimal (minimal for the amount of clusters), α- clusters are placed in the same fixed distant from center of mass. It means that protons of the clusters can be considered as belonging to one shell. In the cluster model single particle effects have to be considered as single particle binding in one of the surface

  20. An Efficient Method to Evaluate Intermolecular Interaction Energies in Large Systems Using Overlapping Multicenter ONIOM and the Fragment Molecular Orbital Method

    Science.gov (United States)

    Asada, Naoya; Fedorov, Dmitri G.; Kitaura, Kazuo; Nakanishi, Isao; Merz, Kenneth M.

    2012-01-01

    We propose an approach based on the overlapping multicenter ONIOM to evaluate intermolecular interaction energies in large systems and demonstrate its accuracy on several representative systems in the complete basis set limit at the MP2 and CCSD(T) level of theory. In the application to the intermolecular interaction energy between insulin dimer and 4′-hydroxyacetanilide at the MP2/CBS level, we use the fragment molecular orbital method for the calculation of the entire complex assigned to the lowest layer in three-layer ONIOM. The developed method is shown to be efficient and accurate in the evaluation of the protein-ligand interaction energies. PMID:23050059

  1. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  2. Symmetry in the polarization expansion for intermolecular forces

    International Nuclear Information System (INIS)

    Chipman, D.M.; Hirschfelder, J.O.

    1980-01-01

    In the usual polarization expansion for intermolecular forces, exchange effects that determine the separations of energy levels within the manifold of interacting states are ignored. Previous low order calculations on simple physical systems have indicated that these exchange terms can be described reasonably well by an appropriate ad hoc symmetrization of the polarization wave function (the SYM-P method). But theoretical considerations suggest that the SYM-P method should be good for only one of the interacting states and not for the others in the manifold. Here this long standing apparent conflict between theoretical expectations and actual results is explained by consideration of a simple model system in which the relevant equations can be solved exactly. It is concluded that while the SYM-P method is potentially exact for only one of the interacting states, it may provide good approximations to the other states of the manifold in the case of large separations of the interacting subsystems

  3. Testing intermolecular potential functions using transport property data

    International Nuclear Information System (INIS)

    Clifford, A.A.; Dickinson, E.; Gray, P.; Scott, A.C.

    1975-01-01

    The viscosity of hydrogen has been measured at eight temperatures from 273 to 1060K, using a capillary-flow viscometer. The results have been used to test the repulsive part of a recently formulated H 2 /H 2 intermolecular potential function, obtained from molecular-beam measurements. Agreement between the experimental and predicted values for viscosity is within 3.5%, which corresponds approximately to the combined quoted uncertainties in the two sets of data. However, if the value of the distance parameter of the potential is reduced by about 1.5%, the agreement obtained is within 0.75% over the whole temperature range. This modified potential function gives better agreement with the available higher temperature viscosities and second virial coefficients. (author)

  4. Quantum electrodynamics with nonrelativistic sources. V. Electromagnetic field correlations and intermolecular interactions between molecules in either ground or excited states

    International Nuclear Information System (INIS)

    Power, E.A.; Thirunamachandran, T.

    1993-01-01

    Spatial correlations between electromagnetic fields arising from neutral sources with electric-dipole transition moments are calculated using nonrelativistic quantum electrodynamics in the multipolar formalism. Expressions for electric-electric, magnetic-magnetic, and electric-magnetic correlation functions at two points r and r' are given for a source molecule in either a ground or an excited state. In contrast to the electric-electric and magnetic-magnetic cases there are no electric-magnetic correlations for a ground-state molecule. For an excited molecule the downward transitions contribute additional terms which have modulating factors depending on (r-r')/λ. From these correlation functions electric and magnetic energy densities are found by setting r=r'. These energy densities are then used in a response formalism to calculate intermolecular energy shifts. In the case of two ground-state molecules this leads to the Casimir-Polder potential. However, for a pair of molecules, one or both excited, there are additional terms arising from downward transitions. An important feature of these energies is that they exhibit an R -2 dependence for large intermolecular separations R. This dependence is interpreted in terms of the Poynting vector, which itself can be obtained by setting r=r' in the electric-magnetic correlation function

  5. Influence of intermolecular amide hydrogen bonding on the geometry, atomic charges, and spectral modes of acetanilide: An ab initio study

    Science.gov (United States)

    Binoy, J.; Prathima, N. B.; Murali Krishna, C.; Santhosh, C.; Hubert Joe, I.; Jayakumar, V. S.

    2006-08-01

    Acetanilide, a compound of pharmaceutical importance possessing pain-relieving properties due to its blocking the pulse dissipating along the nerve fiber, is subjected to vibrational spectral investigation using NIR FT Raman, FT-IR, and SERS. The geometry, Mulliken charges, and vibrational spectrum of acetanilide have been computed using the Hartree-Fock theory and density functional theory employing the 6-31G (d) basis set. To investigate the influence of intermolecular amide hydrogen bonding, the geometry, charge distribution, and vibrational spectrum of the acetanilide dimer have been computed at the HF/6-31G (d) level. The computed geometries reveal that the acetanilide molecule is planar, while twisting of the secondary amide group with respect to the phenyl ring is found upon hydrogen bonding. The trans isomerism and “amido” form of the secondary amide, hyperconjugation of the C=O group with the adjacent C-C bond, and donor-acceptor interaction have been investigated using computed geometry. The carbonyl stretching band position is found to be influenced by the tendency of the phenyl ring to withdraw nitrogen lone pair, intermolecular hydrogen bonding, conjugation, and hyperconjugation. A decrease in the NH and C=O bond orders and increase in the C-N bond orders due to donor-acceptor interaction can be observed in the vibrational spectra. The SERS spectral analysis reveals that the flat orientation of the molecule on the adsorption plane is preferred.

  6. Rubrene: The interplay between intramolecular and intermolecular interactions determines the planarization of its tetracene core in the solid state

    KAUST Repository

    Sutton, Christopher

    2015-06-15

    Rubrene is one of the most studied molecular semiconductors; its chemical structure consists of a tetracene backbone with four phenyl rings appended to the two central fused rings. Derivatization of these phenyl rings can lead to two very different solid-state molecular conformations and packings: One in which the tetracene core is planar and there exists substantive overlap among neighboring π-conjugated backbones; and another where the tetracene core is twisted and the overlap of neighboring π-conjugated backbones is completely disrupted. State-of-the-art electronic-structure calculations show for all isolated rubrene derivatives that the twisted conformation is more favorable (by -1.7 to -4.1 kcal mol-1), which is a consequence of energetically unfavorable exchange-repulsion interactions among the phenyl side groups. Calculations based on available crystallographic structures reveal that planar conformations of the tetracene core in the solid state result from intermolecular interactions that can be tuned through well-chosen functionalization of the phenyl side groups, and lead to improved intermolecular electronic couplings. Understanding the interplay of these intramolecular and intermolecular interactions provides insight into how to chemically modify rubrene and similar molecular semiconductors to improve the intrinsic materials electronic properties.

  7. Intermolecular detergent-membrane protein noes for the characterization of the dynamics of membrane protein-detergent complexes.

    Science.gov (United States)

    Eichmann, Cédric; Orts, Julien; Tzitzilonis, Christos; Vögeli, Beat; Smrt, Sean; Lorieau, Justin; Riek, Roland

    2014-12-11

    The interaction between membrane proteins and lipids or lipid mimetics such as detergents is key for the three-dimensional structure and dynamics of membrane proteins. In NMR-based structural studies of membrane proteins, qualitative analysis of intermolecular nuclear Overhauser enhancements (NOEs) or paramagnetic resonance enhancement are used in general to identify the transmembrane segments of a membrane protein. Here, we employed a quantitative characterization of intermolecular NOEs between (1)H of the detergent and (1)H(N) of (2)H-perdeuterated, (15)N-labeled α-helical membrane protein-detergent complexes following the exact NOE (eNOE) approach. Structural considerations suggest that these intermolecular NOEs should show a helical-wheel-type behavior along a transmembrane helix or a membrane-attached helix within a membrane protein as experimentally demonstrated for the complete influenza hemagglutinin fusion domain HAfp23. The partial absence of such a NOE pattern along the amino acid sequence as shown for a truncated variant of HAfp23 and for the Escherichia coli inner membrane protein YidH indicates the presence of large tertiary structure fluctuations such as an opening between helices or the presence of large rotational dynamics of the helices. Detergent-protein NOEs thus appear to be a straightforward probe for a qualitative characterization of structural and dynamical properties of membrane proteins embedded in detergent micelles.

  8. Modulation of intermolecular interactions in single-molecule magnets

    Science.gov (United States)

    Heroux, Katie Jeanne

    Polynuclear manganese clusters exhibiting interesting magnetic and quantum properties have been an area of intense research since the discovery of the first single-molecule magnet (SMM) in 1993. These molecules, below their blocking temperature, function as single-domain magnetic particles which exhibit classical macroscale magnetic properties as well as quantum mechanical phenomena such as quantum tunnelling of magnetization (QTM) and quantum phase interference. The union of classical and quantum behavior in these nanomaterials makes SMMs ideal candidates for high-density information storage and quantum computing. However, environmental coupling factors (nuclear spins, phonons, neighboring molecules) must be minimized if such applications are ever to be fully realized. The focus of this work is making small structural changes in well-known manganese SMMs in order to drastically enhance the overall magnetic and quantum properties of the system. Well-isolated molecules of high crystalline quality should lead to well-defined energetic and spectral properties as well. An advantage of SMMs over bulk magnetic materials is that they can be chemically altered from a "bottom-up" approach providing a synthetic tool for tuning magnetic properties. This systematic approach is utilized in the work presented herein by incorporating bulky ligands and/or counterions to "isolate" the magnetic core of [Mn4] dicubane SMMs. Reducing intermolecular interactions in the crystal lattice (neighboring molecules, solvate molecules, dipolar interactions) is an important step toward developing viable quantum computing devices. Detailed bulk magnetic studies as well as single crystal magnetization hysteresis and high-frequency EPR studies on these sterically-isolated complexes show enhanced, and sometimes even unexpected, quantum dynamics. The importance of intra- and intermolecular interactions remains a common theme throughout this work, extending to other SMMs of various topology including

  9. MAu2GeS4-Chalcogel (M = Co, Ni): Heterogeneous Intra- and Intermolecular Hydroamination Catalysts

    KAUST Repository

    Davaasuren, Bambar

    2017-08-08

    High surface area macroporous chalcogenide aerogels (chalcogels) MAu2GeS4 (M = Co, Ni) were prepared from K2Au2GeS4 precursor and Co(OAc)2 or NiCl2 by one-pot sol-gel metathesis reactions in aqueous media. The MAu2GeS4-chalcogels were screened for catalytic intramolecular hydroamination of 4-pentyn-1-amine substrate at different temperatures. 87% and 58% conversion was achieved at 100 °C, using CoAu2GeS4- and NiAu2GeS4-chalcogels respectively, and the reaction kinetics follows the first order. It was established that the catalytic performance of the aerogels is associated with the M(2+) centers present in the structure. Intermolecular hydroamination of aniline with 1-R-4-ethynylbenzene (R = -H, -OCH3, -Br, -F) was carried out at 100 °C using CoAu2GeS4-chalcogel catalyst, due to its promising catalytic performance. The CoAu2GeS4-chalcogel regioselectively converted the pair of substrates to respective Markovnikov products, (E)-1-(4-R-phenyl)-N-phenylethan-1-imine, with 38% to 60% conversion.

  10. MAu2GeS4-Chalcogel (M = Co, Ni): Heterogeneous Intra- and Intermolecular Hydroamination Catalysts

    KAUST Repository

    Davaasuren, Bambar; Emwas, Abdul-Hamid M.; Rothenberger, Alexander

    2017-01-01

    High surface area macroporous chalcogenide aerogels (chalcogels) MAu2GeS4 (M = Co, Ni) were prepared from K2Au2GeS4 precursor and Co(OAc)2 or NiCl2 by one-pot sol-gel metathesis reactions in aqueous media. The MAu2GeS4-chalcogels were screened for catalytic intramolecular hydroamination of 4-pentyn-1-amine substrate at different temperatures. 87% and 58% conversion was achieved at 100 °C, using CoAu2GeS4- and NiAu2GeS4-chalcogels respectively, and the reaction kinetics follows the first order. It was established that the catalytic performance of the aerogels is associated with the M(2+) centers present in the structure. Intermolecular hydroamination of aniline with 1-R-4-ethynylbenzene (R = -H, -OCH3, -Br, -F) was carried out at 100 °C using CoAu2GeS4-chalcogel catalyst, due to its promising catalytic performance. The CoAu2GeS4-chalcogel regioselectively converted the pair of substrates to respective Markovnikov products, (E)-1-(4-R-phenyl)-N-phenylethan-1-imine, with 38% to 60% conversion.

  11. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    Science.gov (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  12. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  13. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    Science.gov (United States)

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  15. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    Science.gov (United States)

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  16. Systematic study on intermolecular valence-band dispersion in molecular crystalline films

    International Nuclear Information System (INIS)

    Yamane, Hiroyuki; Kosugi, Nobuhiro

    2015-01-01

    Highlights: • Intermolecular valence-band dispersion of crystalline films of phthalocyanines. • Intermolecular transfer integral versus lattice constant. • Site-specific intermolecular interaction and resultant valence-band dispersion. • Band narrowing effect induced by elevated temperature. - Abstract: Functionalities of organic semiconductors are governed not only by individual properties of constituent molecules but also by solid-state electronic states near the Fermi level such as frontier molecular orbitals, depending on weak intermolecular interactions in various conformations. The individual molecular property has been widely investigated in detail; on the other hand, the weak intermolecular interaction is difficult to investigate precisely due to the presence of the structural and thermal energy broadenings in organic solids. Here we show quite small but essential intermolecular valence band dispersions and their temperature dependence of sub-0.1-eV scale in crystalline films of metal phthalocyanines (H_2Pc, ZnPc, CoPc, MnPc, and F_1_6ZnPc) by using angle-resolved photoemission spectroscopy (ARPES) with synchrotron radiation. The observed bands show intermolecular and site dependent dispersion widths, phases, and periodicities, for different chemical substitution of terminal groups and central metals in the phthalocyanine molecule. The precise and systematic band-dispersion measurement would be a credible approach toward the comprehensive understanding of intermolecular interactions and resultant charge transport properties as well as their tuning by substituents in organic molecular systems.

  17. A trans-Complementing Recombination Trap Demonstrates a Low Propensity of Flaviviruses for Intermolecular Recombination▿

    Science.gov (United States)

    Taucher, Christian; Berger, Angelika; Mandl, Christian W.

    2010-01-01

    Intermolecular recombination between the genomes of closely related RNA viruses can result in the emergence of novel strains with altered pathogenic potential and antigenicity. Although recombination between flavivirus genomes has never been demonstrated experimentally, the potential risk of generating undesirable recombinants has nevertheless been a matter of concern and controversy with respect to the development of live flavivirus vaccines. As an experimental system for investigating the ability of flavivirus genomes to recombine, we developed a “recombination trap,” which was designed to allow the products of rare recombination events to be selected and amplified. To do this, we established reciprocal packaging systems consisting of pairs of self-replicating subgenomic RNAs (replicons) derived from tick-borne encephalitis virus (TBEV), West Nile virus (WNV), and Japanese encephalitis virus (JEV) that could complement each other in trans and thus be propagated together in cell culture over multiple passages. Any infectious viruses with intact, full-length genomes that were generated by recombination of the two replicons would be selected and enriched by end point dilution passage, as was demonstrated in a spiking experiment in which a small amount of wild-type virus was mixed with the packaged replicons. Using the recombination trap and the JEV system, we detected two aberrant recombination events, both of which yielded unnatural genomes containing duplications. Infectious clones of both of these genomes yielded viruses with impaired growth properties. Despite the fact that the replicon pairs shared approximately 600 nucleotides of identical sequence where a precise homologous crossover event would have yielded a wild-type genome, this was not observed in any of these systems, and the TBEV and WNV systems did not yield any viable recombinant genomes at all. Our results show that intergenomic recombination can occur in the structural region of flaviviruses

  18. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  19. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  20. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  1. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  2. Protein-ligand interfaces are polarized: discovery of a strong trend for intermolecular hydrogen bonds to favor donors on the protein side with implications for predicting and designing ligand complexes.

    Science.gov (United States)

    Raschka, Sebastian; Wolf, Alex J; Bemister-Buffington, Joseph; Kuhn, Leslie A

    2018-04-01

    Understanding how proteins encode ligand specificity is fascinating and similar in importance to deciphering the genetic code. For protein-ligand recognition, the combination of an almost infinite variety of interfacial shapes and patterns of chemical groups makes the problem especially challenging. Here we analyze data across non-homologous proteins in complex with small biological ligands to address observations made in our inhibitor discovery projects: that proteins favor donating H-bonds to ligands and avoid using groups with both H-bond donor and acceptor capacity. The resulting clear and significant chemical group matching preferences elucidate the code for protein-native ligand binding, similar to the dominant patterns found in nucleic acid base-pairing. On average, 90% of the keto and carboxylate oxygens occurring in the biological ligands formed direct H-bonds to the protein. A two-fold preference was found for protein atoms to act as H-bond donors and ligand atoms to act as acceptors, and 76% of all intermolecular H-bonds involved an amine donor. Together, the tight chemical and geometric constraints associated with satisfying donor groups generate a hydrogen-bonding lock that can be matched only by ligands bearing the right acceptor-rich key. Measuring an index of H-bond preference based on the observed chemical trends proved sufficient to predict other protein-ligand complexes and can be used to guide molecular design. The resulting Hbind and Protein Recognition Index software packages are being made available for rigorously defining intermolecular H-bonds and measuring the extent to which H-bonding patterns in a given complex match the preference key.

  3. Protein-ligand interfaces are polarized: discovery of a strong trend for intermolecular hydrogen bonds to favor donors on the protein side with implications for predicting and designing ligand complexes

    Science.gov (United States)

    Raschka, Sebastian; Wolf, Alex J.; Bemister-Buffington, Joseph; Kuhn, Leslie A.

    2018-02-01

    Understanding how proteins encode ligand specificity is fascinating and similar in importance to deciphering the genetic code. For protein-ligand recognition, the combination of an almost infinite variety of interfacial shapes and patterns of chemical groups makes the problem especially challenging. Here we analyze data across non-homologous proteins in complex with small biological ligands to address observations made in our inhibitor discovery projects: that proteins favor donating H-bonds to ligands and avoid using groups with both H-bond donor and acceptor capacity. The resulting clear and significant chemical group matching preferences elucidate the code for protein-native ligand binding, similar to the dominant patterns found in nucleic acid base-pairing. On average, 90% of the keto and carboxylate oxygens occurring in the biological ligands formed direct H-bonds to the protein. A two-fold preference was found for protein atoms to act as H-bond donors and ligand atoms to act as acceptors, and 76% of all intermolecular H-bonds involved an amine donor. Together, the tight chemical and geometric constraints associated with satisfying donor groups generate a hydrogen-bonding lock that can be matched only by ligands bearing the right acceptor-rich key. Measuring an index of H-bond preference based on the observed chemical trends proved sufficient to predict other protein-ligand complexes and can be used to guide molecular design. The resulting Hbind and Protein Recognition Index software packages are being made available for rigorously defining intermolecular H-bonds and measuring the extent to which H-bonding patterns in a given complex match the preference key.

  4. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    Science.gov (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  5. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.

    1990-01-01

    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  6. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  7. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar

    2017-07-01

    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  8. Graphene-enhanced intermolecular interaction at interface between copper- and cobalt-phthalocyanines

    Energy Technology Data Exchange (ETDEWEB)

    Dou, Wei-Dong [Department of Physics, Shaoxing University, Shaoxing 312000 (China); Center of Super-Diamond and Advanced Films (COSDAF) and Department of Physics and Material Science, City University of Hong Kong, Hong Kong (China); Huang, Shu-Ping [Department of Chemistry, University of South Dakota, Vermillion, South Dakota 57069 (United States); Lee, Chun-Sing, E-mail: apcslee@cityu.edu.hk [Center of Super-Diamond and Advanced Films (COSDAF) and Department of Physics and Material Science, City University of Hong Kong, Hong Kong (China)

    2015-10-07

    Interfacial electronic structures of copper-phthalocyanine (CuPc), cobalt-phthalocyanine (CoPc), and graphene were investigated experimentally by using photoelectron spectroscopy. While the CuPc/graphene interface shows flat band structure and negligible interfacial dipole indicating quite weak molecule-substrate interaction, the CuPc/CoPc/graphene interface shows a large interfacial dipole and obvious energy level bending. Controlled experiments ruled out possible influences from the change in film structure of CuPc and pure π–π interaction between CoPc and CuPc. Analysis based on X-ray photoelectron spectroscopy and density functional theory reveals that the decrease in the work function for the CuPc/CoPc/graphene system is induced by the intermolecular interaction between CuPc and CoPc which is enhanced owning to the peculiar electronic properties at the CoPc-graphene interface.

  9. Influence of pressure on the crystallization of systems characterized by different intermolecular attraction

    Science.gov (United States)

    Koperwas, K.; Affouard, F.; Gerges, J.; Valdes, L.-C.; Adrjanowicz, K.; Paluch, M.

    2017-12-01

    In this paper, we examine, in terms of the classical nucleation theory, how the strengthening of the attractive intermolecular interactions influences the crystallization process for systems like Lennard-Jones at different isobaric conditions. For this purpose, we modify the standard Lennard-Jones potential, and as a result, we obtain three different systems characterized by various strengths of attractive potentials occurring between molecules, which are in direct relationship to the physical quantities describing molecules, e.g., its polarizability or dipole moment. Based on performed analysis, we demonstrate that the molecular attraction primarily impacts the thermodynamics of the interface between liquid and crystal. This is reflected in the behavior of nucleation and overall crystallization rates during compression of the system.

  10. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  11. Effect of donor orientation on ultrafast intermolecular electron transfer in coumarin-amine systems

    International Nuclear Information System (INIS)

    Singh, P. K.; Nath, S.; Bhasikuttan, A. C.; Kumbhakar, M.; Mohanty, J.; Sarkar, S. K.; Mukherjee, T.; Pal, H.

    2008-01-01

    Effect of donor amine orientation on nondiffusive ultrafast intermolecular electron transfer (ET) reactions in coumarin-amine systems has been investigated using femtosecond fluorescence upconversion measurements. Intermolecular ET from different aromatic and aliphatic amines used as donor solvents to the excited coumarin-151 (C151) acceptor occurs with ultrafast rates such that the shortest fluorescence lifetime component (τ 1 ) is the measure of the fastest ET rate (τ 1 =τ ET fast =(k ET fast ) -1 ), assigned to the C151-amine contact pairs in which amine donors are properly oriented with respect to C151 to maximize the acceptor-donor electronic coupling (V el ). It is interestingly observed that as the amine solvents are diluted by suitable diluents (either keeping solvent dielectric constant similar or with increasing dielectric constant), the τ 1 remains almost in the similar range as long as the amine dilution does not cross a certain critical limit, which in terms of the amine mole fraction (x A ) is found to be ∼0.4 for aromatic amines and ∼0.8 for aliphatic amines. Beyond these dilutions in the two respective cases of the amine systems, the τ 1 values are seen to increase very sharply. The large difference in the critical x A values involving aromatic and aliphatic amine donors has been rationalized in terms of the largely different orientational restrictions for the ET reactions as imposed by the aliphatic (n-type) and aromatic (π-type) nature of the amine donors [A. K. Satpati et al., J. Mol. Struct. 878, 84 (2008)]. Since the highest occupied molecular orbital (HOMO) of the n-type aliphatic amines is mostly centralized at the amino nitrogen, only some specific orientations of these amines with respect to the close-contact acceptor dye [also of π-character; A. K. Satpati et al., J. Mol. Struct. 878, 84 (2008) and E. W. Castner et al., J. Phys. Chem. A 104, 2869 (2000)] can give suitable V el and thus ultrafast ET reaction. In contrary, the

  12. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian

    2016-01-01

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  13. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  14. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    Science.gov (United States)

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  16. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  17. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  18. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    Science.gov (United States)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  19. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach].

    Science.gov (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei

    2017-06-01

    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  20. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  1. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  2. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  3. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  4. Polyelectrolyte brushes in mixed ionic medium studied via intermolecular forces

    Science.gov (United States)

    Farina, Robert; Laugel, Nicolas; Pincus, Philip; Tirrell, Matthew

    2011-03-01

    The vast uses and applications of polyelectrolyte brushes make them an attractive field of research especially with the growing interest in responsive materials. Polymers which respond via changes in temperature, pH, and ionic strength are increasingly being used for applications in drug delivery, chemical gating, etc. When polyelectrolyte brushes are found in either nature (e.g., surfaces of cartilage and mammalian lung interiors) or commercially (e.g., skin care products, shampoo, and surfaces of medical devices) they are always surrounded by mixed ionic medium. This makes the study of these brushes in varying ionic environments extremely relevant for both current and future potential applications. The polyelectrolyte brushes in this work are diblock co-polymers of poly-styrene sulfonate (N=420) and poly-t-butyl styrene (N=20) which tethers to a hydrophobic surface allowing for a purely thermodynamic study of the polyelectrolyte chains. Intermolecular forces between two brushes are measured using the SFA. As multi-valent concentrations are increased, the brushes collapse internally and form strong adhesion between one another after contact (properties not seen in a purely mono-valent environment).

  5. Intermolecular Interactions in Ternary Glycerol–Sample–H2O

    DEFF Research Database (Denmark)

    Westh, Peter; Rasmussen, Erik Lumby; Koga, Yoshikata

    2011-01-01

    We studied the intermolecular interactions in ternary glycerol (Gly)–sample (S)–H2O systems at 25 °C. By measuring the excess partial molar enthalpy of Gly, HGlyEHEGly, we evaluated the Gly–Gly enthalpic interaction, HGly-GlyEHEGly--Gly, in the presence of various samples (S). For S, tert...... little effect on HGly-GlyEHEGly--Gly. This contrasts with our earlier studies on 1P–S–H2O in that Na+, F− and Cl− are found as hydration centers from the induced changes on HIP-IPEHEIP--IP in the presence of S, while Br−, I−, and SCN− are found to act as hydrophiles. In comparison with the Hofmeister...... ranking of these ions, the kosmotropes are hydration centers and the more kosmotropic the higher the hydration number, consistent with the original Hofmeister’s concept of “H2O withdrawing power.” Br−, I− and SCN−, on the other hand, acted as hydrophiles and the more chaotropic they are the more...

  6. Orientation correlation and intermolecular structure of GeCl4, VCl4 and other tetrachloride liquids

    International Nuclear Information System (INIS)

    Nath, P.P.; Sarkar, S.; Joarder, R.N.

    2007-01-01

    The intermolecular structure and correlation of GeCl 4 , VCl 4 and other tetrachloride liquids can be well described by Misawa's orientation correlation model originally applied to liquid CCl 4 . The model supports on average a specific 'corner' to 'face' correlation, but evidently very different from 'Apollo' type model. The Misawa model appears to work, in some respect, even better than reference interaction site model (RISM) used for long to describe intermolecular structure of such molecular systems. The test and comparison are made through the calculation of small asymmetric part of the intermolecular structure and evaluation of partial atom-atom distribution functions

  7. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  8. In vivo dynamics of enterovirus protease revealed by fluorescence resonance emission transfer (FRET) based on a novel FRET pair

    International Nuclear Information System (INIS)

    Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.

    2007-01-01

    An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research

  9. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

    Science.gov (United States)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-01

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  10. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  11. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  12. Transfer of energy between a pair of molecules near a plasmonic core-shell nanoparticle: Tunability and sensing

    Energy Technology Data Exchange (ETDEWEB)

    Daneshfar, Nader, E-mail: ndaneshfar@gmail.com, E-mail: ndaneshfar@razi.ac.ir; Yavari, Asghar [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)

    2016-05-15

    Our model is applied to the calculation of interaction energy between a pair of dipolar molecules (point dipoles) in the vicinity of a nanoshell monomer with core-shell structure, based on the dipole quasi-electrostatic theory of classical electrodynamics and using the Drude and Maxwell-Garnett model. In other words, this work discusses the intermolecular energy transfer from a donor molecule to an acceptor molecule near a spherical nanoparticle that is important for practical applications like sensing. It is shown that the proximity of plasmonic nanoparticles can have a strong effect on the energy transfer between molecules. In addition to the influence of the size, composition, embedding medium, and the filling fraction of doped particles on the interaction energy, the contribution of the dipolar, quadrupolar, octupolar, hexadecapolar, triakontadipolar, and higher order multipole interactions is presented and analyzed. Briefly, we will show that it is possible to achieve enhanced energy transfer by manipulation of different parameters as mentioned above.

  13. An automated method for the analysis of phenolic acids in plasma based on ion-pairing micro-extraction coupled on-line to gas chromatography/mass spectrometry with in-liner derivatisation

    NARCIS (Netherlands)

    Peters, S.; Kaal, E.; Horsting, I.; Janssen, H.-G.

    2012-01-01

    A new method is presented for the analysis of phenolic acids in plasma based on ion-pairing ‘Micro-extraction in packed sorbent’ (MEPS) coupled on-line to in-liner derivatisation-gas chromatography-mass spectrometry (GC-MS). The ion-pairing reagent served a dual purpose. It was used both to improve

  14. Catalytic Intermolecular Cross-Couplings of Azides and LUMO-Activated Unsaturated Acyl Azoliums

    KAUST Repository

    Li, Wenjun; Ajitha, Manjaly John; Lang, Ming; Huang, Kuo-Wei; Wang, Jian

    2017-01-01

    An example for the catalytic synthesis of densely functionalized 1,2,3-triazoles through a LUMO activation mode has been developed. The protocol is enabled by intermolecular cross coupling reactions of azides with in situ-generated alpha

  15. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  16. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

    Science.gov (United States)

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

    2012-12-01

    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  17. Tube Stent-Grafts for Infrarenal Aortic Aneurysm: A Matched-Paired Analysis Based on EUROSTAR Data

    International Nuclear Information System (INIS)

    Ruppert, Volker; Leurs, Lina J.; Hobo, Roel; Buth, Jacob; Rieger, Johannes; Umscheid, Thomas

    2007-01-01

    Objective. Tube stent-grafts for treatment of infrarenal aortic aneurysms (AAAs) are a nearly forgotten concept. For focal aortic pathologies tube stent-grafts may be a treatment option. We have performed a retrospective matched-paired analysis of the EUROSTAR registry regarding the outcome of tube vs. bifurcated stent-grafts for AAA. Tapered aortomonoiliac stent-grafts were not the objective of this study. Materials and methods. From July 1997 to June 2006, 7581 patients who underwent an endovascular AAA repair were entered in the EUROSTAR registry by 164 centers. One hundred fifty-three patients were treated with tube stent-grafts. For each of these 153 patients we selected one patient from a bifurcated stent-graft group (BGG-original, 7428 patients) matched according to gender, ASA, age, AAA diameter, and type of anesthesia. Differences in preoperative details between the two study groups were analyzed using chi-square test for discrete variables and Wilcoxon rank-sum test for continuous variables. Multivariate logistic regression analysis was performed on early complications. Midterm outcomes (>30 days) were analyzed by Kaplan-Meier and multivariate Cox proportional hazard model. Results. The duration of the procedure was shorter in the tube stent-graft group (TGG; 102.3 ± 52.2) than in BGG (128.3 ± 55.0; p 0.0002). Type II endoleak was less frequent in TGG (4.0%; mean follow-up, 23.12 ± 23.9 months) than in BGG (14.3%; mean follow-up, 20.77 ± 20.0 months; p = 0.0394). Type I endoleaks and migration were distributed equally, without significant differences between the groups. Combined 30-day and late mortality was higher for TGG (p = 0.0346) and was obviously not aneurysm related. Conclusions. We conclude that after selection of patients, tube stent-grafts for infrarenal aortic repair can be performed with great safety regarding endoleaks and migration. The combined higher 30-day mortality and non-aneurysm-related mortality during follow-up were mainly

  18. Matched molecular pair-based data sets for computer-aided medicinal chemistry [v1; ref status: indexed, http://f1000r.es/2w9

    Directory of Open Access Journals (Sweden)

    Ye Hu

    2014-02-01

    Full Text Available Matched molecular pairs (MMPs are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the latest release of the ChEMBL database for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  19. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  20. Intermolecular failure of L-type Ca2+ channel and ryanodine receptor signaling in hypertrophy.

    Directory of Open Access Journals (Sweden)

    Ming Xu

    2007-02-01

    Full Text Available Pressure overload-induced hypertrophy is a key step leading to heart failure. The Ca(2+-induced Ca(2+ release (CICR process that governs cardiac contractility is defective in hypertrophy/heart failure, but the molecular mechanisms remain elusive. To examine the intermolecular aspects of CICR during hypertrophy, we utilized loose-patch confocal imaging to visualize the signaling between a single L-type Ca(2+ channel (LCC and ryanodine receptors (RyRs in aortic stenosis rat models of compensated (CHT and decompensated (DHT hypertrophy. We found that the LCC-RyR intermolecular coupling showed a 49% prolongation in coupling latency, a 47% decrease in chance of hit, and a 72% increase in chance of miss in DHT, demonstrating a state of "intermolecular failure." Unexpectedly, these modifications also occurred robustly in CHT due at least partially to decreased expression of junctophilin, indicating that intermolecular failure occurs prior to cellular manifestations. As a result, cell-wide Ca(2+ release, visualized as "Ca(2+ spikes," became desynchronized, which contrasted sharply with unaltered spike integrals and whole-cell Ca(2+ transients in CHT. These data suggested that, within a certain limit, termed the "stability margin," mild intermolecular failure does not damage the cellular integrity of excitation-contraction coupling. Only when the modification steps beyond the stability margin does global failure occur. The discovery of "hidden" intermolecular failure in CHT has important clinical implications.

  1. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization

    Science.gov (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously.

  2. Variations in screening outcome among pairs of screening radiologists at non-blinded double reading of screening mammograms: a population-based study

    NARCIS (Netherlands)

    Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.

    2014-01-01

    Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at

  3. Phosphorus As a Simultaneous Electron-Pair Acceptor in Intermolecular P center dot center dot center dot N Pnicogen Bonds and Electron-Pair Donor to Lewis Acids

    Czech Academy of Sciences Publication Activity Database

    Del Bene, J. E.; Alkorta, I.; Sanchez-Sanz, Goar; Elguero, J.

    2013-01-01

    Roč. 117, č. 14 (2013), s. 3133-3141 ISSN 1089-5639 Institutional support: RVO:61388963 Keywords : spin coupling-constants * Gaussian-basis sets * correlated molecular calculations * noncovalent interaction Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.775, year: 2013

  4. Argon intermolecular potential from a measurement of the total scattering cross-section

    International Nuclear Information System (INIS)

    Wong, Y.W.

    1975-01-01

    An inversion method to obtain accurate intermolecular potentials from experimental total cross section measurements is presented. This method is based on the high energy Massey--Smith approximation. The attractive portion of the potential is represented by a multi-parameter spline function and the repulsive part by a Morse function. The best fit potential is obtained by a least squares minimization based on comparison of experimental cross sections with those obtained by a Fourier transform of the reduced Massey--Smith phase shift curve. An experimental method was developed to obtain the total cross sections needed for the above inversion procedure. In this technique, integral cross sections are measured at various resolutions and the total cross section is obtained by extrapolating to infinite resolution. Experimental results obtained for the Ar--Ar system are in excellent agreement with total cross sections calculated using the Barker-Fisher-Watts potential. Inversion of the data to obtain a potential distinguishable from the BFW-potential requires an extension of the method based on the Massey--Smith approximation to permit use of JWKB phase shifts and was not attempted

  5. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  6. Intermolecular proton transfer in anionic complexes of uracil with alcohols

    International Nuclear Information System (INIS)

    Haranczyk, Maciej; Rak, Janusz; Gutowski, Maciej S.; Radisic, Dunja; Stokes, Sarah T.; Bowen, Kit H.

    2005-01-01

    A series of eighteen alcohols (ROH) has been designed with an enthalpy of deprotonation (H DP ) in a range of 13.8-16.3 eV. The effects of excess electron attachment to the binary alcohol-uracil (ROH...U) complexes have been studied at the density functional level with a B3LYP exchange-correlation functional and at the second order Moeller-Plesset perturbation theory level. The photoelectron spectra of anionic complexes of uracil with three alcohols (ethanol, 2,2,3,3,3-pentafluoroethanol and 1,1,1,3,3,3-hexafluoro-2-propanol) have been measured with 2.54 eV photons. For ROHs with deprotonation enthalpies larger than 14.8 eV only the ROH...U - minimum exists on the potential energy surface of the anionic complex. For alcohols with deprotonation enthalpies in a range of 14.3-14.8 eV two minima might exist on the anionic potential energy surface, which correspond to the RO - ...HU . and ROH...U - structures. For ROHs with deprotonation enthalpies smaller than 14.3 eV, the excess electron attachment to the ROH...U complex always induces a barrier-free proton transfer from the hydroxyl group of ROH to the O8 atom of U, with the product being RO - ...HU . . A driving force for the intermolecular proton transfer is to stabilize the excess negative charge localized on a orbital of uracil. Therefore, these complexes with proton transferred to the anionic uracil are characterized by larger values of electron vertical detachment energy (VDE). The values of VDE for anionic complexes span a range from 1.0 to 2.3 eV and roughly correlate with the acidity of alcohols. However, there is a gap of ∼0.5 eV in the values of VDE, which separates the two families, ROH...U - and RO - ...HU . , of anionic complexes. The energy of stabilization for the anionic complexes spans a range from 0.6 to 1.7 eV and roughly correlates with the acidity of alcohols. The measured photoelectron spectra are in good agreement with the theoretical predictions

  7. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  8. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)

    2016-06-15

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  9. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2016-01-01

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  10. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  11. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  12. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  13. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

    2010-08-17

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  14. Unique TTC repeat base pair loss mutation in cases of pure neural leprosy: A survival strategy of Mycobacterium leprae?

    Directory of Open Access Journals (Sweden)

    Abhishek De

    2015-01-01

    Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.

  15. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  16. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  17. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  18. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  19. Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis.

    Science.gov (United States)

    Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando

    2012-12-07

    This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

  20. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  1. Highly Efficient One-Pot Synthesis of COS-Based Block Copolymers by Using Organic Lewis Pairs.

    Science.gov (United States)

    Yang, Jia-Liang; Cao, Xiao-Han; Zhang, Cheng-Jian; Wu, Hai-Lin; Zhang, Xing-Hong

    2018-01-31

    A one-pot synthesis of block copolymer with regioregular poly(monothiocarbonate) block is described via metal-free catalysis. Lewis bases such as guanidine, quaternary onium salts, and Lewis acid triethyl borane (TEB) were equivalently combined and used as the catalysts. By using polyethylene glycol (PEG) as the macromolecular chain transfer agent (CTA), narrow polydispersity block copolymers were obtained from the copolymerization of carbonyl sulfide (COS) and propylene oxide (PO). The block copolymers had a poly(monothiocarbonate) block with perfect alternating degree and regioregularity. Unexpectedly, the addition of CTA to COS/PO copolymerization system could dramatically improve the turnover frequency (TOF) of PO (up to 240 h -1 ), higher than that of the copolymerization without CTA. In addition, the conversion of CTA could be up to 100% in most cases, as revealed by ¹H NMR spectra. Of consequence, the number-average molecular weights ( M n s) of the resultant block copolymers could be regulated by varying the feed ratio of CTA to PO. Oxygen-sulfur exchange reaction (O/S ER), which can generate randomly distributed thiocarbonate and carbonate units, was effectively suppressed in all of the cases in the presence of CTA, even at 80 °C. This work presents a versatile method for synthesizing sulfur-containing block copolymers through a metal-free route, providing an array of new block copolymers.

  2. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  3. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  4. Growing Right Onto Wellness (GROW): a family-centered, community-based obesity prevention randomized controlled trial for preschool child-parent pairs.

    Science.gov (United States)

    Po'e, Eli K; Heerman, William J; Mistry, Rishi S; Barkin, Shari L

    2013-11-01

    Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood body mass index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. © 2013.

  5. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  6. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    Science.gov (United States)

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  7. Effects of Intermolecular Coupling on Excimer Formation and Singlet Fission

    Science.gov (United States)

    Mauck, Catherine McKay

    compelling strategy for improving organic photovoltaic device efficiencies. The formation of triplet states through singlet fission can be characterized using femtosecond visible transient absorption spectroscopy (fsTA). However, in PDI, the triplet-triplet absorption spectrum is strongly overlapped with the ground state bleach absorption. Here, a dyad molecule where PDI is covalently attached to an apocarotene triplet acceptor is synthesized, and studied in solution aggregates and thin films with fsTA, to demonstrate that apocarotene can be used as a sensitive spectral tag for triplet formation in PDI due to triplet-triplet energy transfer from PDI to the carotenoid. The efficiency of singlet fission in DPP can be tuned by modulating the crystal packing in the solid state. By synthesizing 3,6-bis(thiophene) derivatives of DPP with a series of different sidechains, thin film DPP singlet fission is related to the crystal structure intermolecular geometries, to more precisely determine the relationship between interchromophore coupling and singlet fission rate, which will inform the design of more robust chromophores for singlet fission. Finally, the role of the dielectric environment and stabilization of charge transfer configurations and charge transfer states is explored in DPP singlet fission, through aqueous nanoparticles of 3,6-bis(phenylthiophene) with different surface area-to-volume ratios, and a covalently linked dimer of DPP in solvents of varying polarity which can undergo symmetry-breaking charge separation.

  8. Use of a line-pair resolution phantom for comprehensive quality assurance of electronic portal imaging devices based on fundamental imaging metrics

    International Nuclear Information System (INIS)

    Gopal, Arun; Samant, Sanjiv S.

    2009-01-01

    Image guided radiation therapy solutions based on megavoltage computed tomography (MVCT) involve the extension of electronic portal imaging devices (EPIDs) from their traditional role of weekly localization imaging and planar dose mapping to volumetric imaging for 3D setup and dose verification. To sustain the potential advantages of MVCT, EPIDs are required to provide improved levels of portal image quality. Therefore, it is vital that the performance of EPIDs in clinical use is maintained at an optimal level through regular and rigorous quality assurance (QA). Traditionally, portal imaging QA has been carried out by imaging calibrated line-pair and contrast resolution phantoms and obtaining arbitrarily defined QA indices that are usually dependent on imaging conditions and merely indicate relative trends in imaging performance. They are not adequately sensitive to all aspects of image quality unlike fundamental imaging metrics such as the modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE) that are widely used to characterize detector performance in radiographic imaging and would be ideal for QA purposes. However, due to the difficulty of performing conventional MTF measurements, they have not been used for routine clinical QA. The authors present a simple and quick QA methodology based on obtaining the MTF, NPS, and DQE of a megavoltage imager by imaging standard open fields and a bar-pattern QA phantom containing 2 mm thick tungsten line-pair bar resolution targets. Our bar-pattern based MTF measurement features a novel zero-frequency normalization scheme that eliminates normalization errors typically associated with traditional bar-pattern measurements at megavoltage x-ray energies. The bar-pattern QA phantom and open-field images are used in conjunction with an automated image analysis algorithm that quickly computes the MTF, NPS, and DQE of an EPID system. Our approach combines the fundamental advantages of

  9. Intermolecular Interactions in the TMEM16A Dimer Controlling Channel Activity.

    Science.gov (United States)

    Scudieri, Paolo; Musante, Ilaria; Gianotti, Ambra; Moran, Oscar; Galietta, Luis J V

    2016-12-08

    TMEM16A and TMEM16B are plasma membrane proteins with Ca 2+ -dependent Cl - channel function. By replacing the carboxy-terminus of TMEM16A with the equivalent region of TMEM16B, we obtained channels with potentiation of channel activity. Progressive shortening of the chimeric region restricted the "activating domain" to a short sequence close to the last transmembrane domain and led to TMEM16A channels with high activity at very low intracellular Ca 2+ concentrations. To elucidate the molecular mechanism underlying this effect, we carried out experiments based on double chimeras, Forster resonance energy transfer, and intermolecular cross-linking. We also modeled TMEM16A structure using the Nectria haematococca TMEM16 protein as template. Our results indicate that the enhanced activity in chimeric channels is due to altered interaction between the carboxy-terminus and the first intracellular loop in the TMEM16A homo-dimer. Mimicking this perturbation with a small molecule could be the basis for a pharmacological stimulation of TMEM16A-dependent Cl - transport.

  10. Intermolecular and very strong intramolecular C-SeO/N chalcogen bonds in nitrophenyl selenocyanate crystals.

    Science.gov (United States)

    Wang, Hui; Liu, Ju; Wang, Weizhou

    2018-02-14

    Single-crystal X-ray diffraction reveals that polymorphic ortho-nitrophenyl selenocyanate (o-NSC, crystals 1a and 1b) and monomorphic para-nitrophenyl selenocyanate (p-NSC, crystal 2) crystals are all stabilized mainly by intermolecular and very strong intramolecular C-SeO/N chalcogen bonds, as well as by other different interactions. Thermogravimetric (TG) and differential scanning calorimetry thermogram (DSC) analyses show that the starting decomposition temperatures and melting points of the three crystals are different, following the order 1b > 1a > 2, which is consistent with the structural characteristics of the crystals. In addition, atoms in molecules (AIM) and natural bond orbital (NBO) analyses indicate that the total strengths of the C-SeO and C-SeN chalcogen bonds decrease in the order 1b > 1a > 2. This study could be significant for engineering functional crystals based on robust C-SeO and C-SeN chalcogen bonds, and for designing drugs containing selenium as well as understanding their interaction in biosystems.

  11. Competition between intermolecular interaction and configuration entropy as the structure-determining factor for inclusion compounds

    Energy Technology Data Exchange (ETDEWEB)

    Subbotin, O.; Belosludov, V.; Adamova, T. [Russian Academy of Science, Novosibirsk (Russian Federation). Nikolaev Inst. of Inorganic Chemistry; Belosludov, R.; Kawazoe, Y. [Tohoku Univ., Aoba-ku, Sendai (Japan). Inst. for Materials Research; Kudoh, J.I. [Tohoku Univ., Aoba-ku, Sendai (Japan). Center for Northeast Asia Studies

    2008-07-01

    This paper presented a newly developed method to accurately predict the thermodynamic properties of clathrate hydrates, particularly their structural phase transitions under pressure. The method is based on the theory of Van-der-Waals and Platteeuw with some modifications that include the influence of guest molecules on the host lattice. The model was used to explain the exception from the established rule that small guest molecules form structure s1 and large molecules form structure s2 hydrates. In this study, the thermodynamic properties of argon (Ar) hydrate and methane hydrate, each in both cubic structure s1 and s2 were modelled. The model showed that two competing factors play a role in the formation of inclusions, notably the intermolecular interaction of guest molecules with water molecules, and the configuration entropy. Competition of these 2 factors determines the structure of hydrate formed at different pressures. The model provides an accurate description of the thermodynamic properties of gas hydrates and how they behave under pressure. For the argon hydrates, the structural phase transition from structure s2 to s1 at high pressure was predicted, while methane hydrates were predicted to be metastable in the s2 structure. The model can be used for other inclusion compounds with the same type of composition such as clathrate silicon, zeolites, and inclusion compounds of semiconductor elements. 17 refs., 5 figs.

  12. Towards interpretation of intermolecular paramagnetic relaxation enhancement outside the fast exchange limit.

    Science.gov (United States)

    Ceccon, Alberto; Marius Clore, G; Tugarinov, Vitali

    2016-09-01

    In an exchanging system between major and minor species, the transverse paramagnetic relaxation enhancement rate observed on the resonances of the major species (Γ 2 (app) ) is dependent upon the exchange regime between the species. Quantitative analysis of PRE data in such systems typically assumes that the overall exchange rate k ex between the species is fast on the PRE time scale (k ex ≫ Γ2). Recently, we have characterized the kinetics of binding of the model protein ubiquitin to large (LUV) and small (SUV) unilamellar lipid-based nanoparticles or liposomes (Ceccon A, Tugarinov V, Bax A, Clore GM (2016). J Am Chem Soc 138:5789-5792). Building upon these results and taking advantage of a strong paramagnetic agent with an isotropic g-tensor, Gd(3+), we were able to measure intermolecular methyl carbon and proton PREs between paramagnetically-tagged liposomes and ubiquitin. In the limit of fast exchange (k ex ≫ Γ2) the ratio of the apparent proton to carbon methyl PREs, ((1)Hm-Γ 2 (app) )/((13)Cm-Γ 2 (app) ), is equal to the square of the ratio of the gyromagnetic ratios of the two nuclei, (γΗ/γC)(2). However, outside the fast exchange regime, under intermediate exchange conditions (e.g. when Γ2 is comparable in magnitude to k ex) the ((1)Hm-Γ 2 (app) )/((13)Cm-Γ 2 (app) ) ratio provides a reliable measure of the 'true' methyl PREs.

  13. First comparative approach to touchscreen-based visual object-location paired-associates learning in humans (Homo sapiens) and a nonhuman primate (Microcebus murinus).

    Science.gov (United States)

    Schmidtke, Daniel; Ammersdörfer, Sandra; Joly, Marine; Zimmermann, Elke

    2018-05-10

    A recent study suggests that a specific, touchscreen-based task on visual object-location paired-associates learning (PAL), the so-called Different PAL (dPAL) task, allows effective translation from animal models to humans. Here, we adapted the task to a nonhuman primate (NHP), the gray mouse lemur, and provide first evidence for the successful comparative application of the task to humans and NHPs. Young human adults reach the learning criterion after considerably less sessions (one order of magnitude) than young, adult NHPs, which is likely due to faster and voluntary rejection of ineffective learning strategies in humans and almost immediate rule generalization. At criterion, however, all human subjects solved the task by either applying a visuospatial rule or, more rarely, by memorizing all possible stimulus combinations and responding correctly based on global visual information. An error-profile analysis in humans and NHPs suggests that successful learning in NHPs is comparably based either on the formation of visuospatial associative links or on more reflexive, visually guided stimulus-response learning. The classification in the NHPs is further supported by an analysis of the individual response latencies, which are considerably higher in NHPs classified as spatial learners. Our results, therefore, support the high translational potential of the standardized, touchscreen-based dPAL task by providing first empirical and comparable evidence for two different cognitive processes underlying dPAL performance in primates. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  14. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory

    Science.gov (United States)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank

    2016-09-01

    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the

  15. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  16. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A.; Neese, Frank

    2017-01-01

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  17. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  18. Chemical origin of blue- and redshifted hydrogen bonds: intramolecular hyperconjugation and its coupling with intermolecular hyperconjugation.

    Science.gov (United States)

    Li, An Yong

    2007-04-21

    Upon formation of a H bond Y...H-XZ, intramolecular hyperconjugation n(Z)-->sigma*(X-H) of the proton donor plays a key role in red- and blueshift characters of H bonds and must be introduced in the concepts of hyperconjugation and rehybridization. Intermolecular hyperconjugation transfers electron density from Y to sigma*(X-H) and causes elongation and stretch frequency redshift of the X-H bond; intramolecular hyperconjugation couples with intermolecular hyperconjugation and can adjust electron density in sigma*(X-H); rehybridization causes contraction and stretch frequency blueshift of the X-H bond on complexation. The three factors--intra- and intermolecular hyperconjugations and rehybridization--determine commonly red- or blueshift of the formed H bond. A proton donor that has strong intramolecular hyperconjugation often forms blueshifted H bonds.

  19. Calculation of intermolecular potentials for H2−H2 and H2−O2 dimers ab initio and prediction of second virial coefficients

    International Nuclear Information System (INIS)

    Pham Van, Tat; Deiters, Ulrich K.

    2015-01-01

    Highlights: • We construct the angular orientations of dimers H 2 −H 2 and H 2 −O 2 . • We calculate the ab initio intermolecular interaction energies for all built orientations. • Extrapolating the interaction energies to the complete basis set limit aug-cc-pV23Z. • We develop two 5-site ab initio intermolecular potentials of dimers H 2 −H 2 , H 2 −O 2 . • Calculating the virial coefficients of dimer H 2 −H 2 and H 2 −O 2 . - Abstract: The intermolecular interaction potentials of the dimers H 2 −H 2 and H 2 −O 2 were calculated from quantum mechanics, using coupled-cluster theory CCSD(T) and correlation-consistent basis sets aug-cc-pVmZ (m = 2, 3); the results were extrapolated to the basis set limit aug-cc-pV23Z. The interaction energies were corrected for the basis set superposition error with the counterpoise scheme. For comparison also Møller–Plesset perturbation theory (at levels 2–4) with the basis sets aug-cc-pVTZ were considered, but the results proved inferior. The quantum mechanical results were used to construct analytical pair potential functions. From these functions the second virial coefficients of hydrogen and the cross virial coefficients of the hydrogen–oxygen system were obtained by integration; in both cases corrections for quantum effects were included. The results agree well with experimental data, if available, or with empirical correlations

  20. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  1. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  2. Application of Powell's analogy for the prediction of vortex-pairing sound in a low-Mach number jet based on time-resolved planar and tomographic PIV

    NARCIS (Netherlands)

    Violato, D.; Bryon, K.; Moore, P.; Scarano, F.

    2010-01-01

    This paper describes an experimental investigation by time-resolved planar and tomographic PIV on the sound production mechanism of vortex pairing of a transitional water-jet flow at Re=5000. The shear layer is characterized by axisymmetric vortex rings which undergo pairing with a varicose mode.

  3. Intermolecular interaction potentials of the methane dimer from the local density approximation

    International Nuclear Information System (INIS)

    Chen Xiangrong; Bai Yulin; Zhu Jun; Yang Xiangdong

    2004-01-01

    The intermolecular interaction potentials of methane (CH 4 ) dimer are calculated within the density functional theory in the local density approximation (LDA). It is found that the calculated potentials have minima when the intermolecular distance of CH 4 dimer is about 7.0 a.u., which is in good agreement with the experiment. The depth of the potential is 0.017 eV. The results obtained by our LDA calculations seem to agree well with those obtained by MP2, MP3, and CCSD from the Moeller-Plesset and coupled cluster methods by Tsuzuki et al. and with the experimental data

  4. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  5. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  6. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo

    2014-01-01

    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  7. Propagator formalism and computer simulation of restricted diffusion behaviors of inter-molecular multiple-quantum coherences

    International Nuclear Information System (INIS)

    Cai Congbo; Chen Zhong; Cai Shuhui; Zhong Jianhui

    2005-01-01

    In this paper, behaviors of single-quantum coherences and inter-molecular multiple-quantum coherences under restricted diffusion in nuclear magnetic resonance experiments were investigated. The propagator formalism based on the loss of spin phase memory during random motion was applied to describe the diffusion-induced signal attenuation. The exact expression of the signal attenuation under the short gradient pulse approximation for restricted diffusion between two parallel plates was obtained using this propagator method. For long gradient pulses, a modified formalism was proposed. The simulated signal attenuation under the effects of gradient pulses of different width based on the Monte Carlo method agrees with the theoretical predictions. The propagator formalism and computer simulation can provide convenient, intuitive and precise methods for the study of the diffusion behaviors

  8. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  9. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ibanez, Maria; Sancho, Juan V. [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain); Hernandez, Felix, E-mail: felix.hernandez@qfa.uji.es [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain)

    2009-09-01

    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg{sup -1}. Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg{sup -1}. In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg{sup -1}, were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  10. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Ibanez, Maria; Sancho, Juan V.; Hernandez, Felix

    2009-01-01

    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg -1 . Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg -1 . In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg -1 , were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  11. The effect of the intermolecular potential formulation on the state-selected energy exchange rate coefficients in N2-N2 collisions.

    Science.gov (United States)

    Kurnosov, Alexander; Cacciatore, Mario; Laganà, Antonio; Pirani, Fernando; Bartolomei, Massimiliano; Garcia, Ernesto

    2014-04-05

    The rate coefficients for N2-N2 collision-induced vibrational energy exchange (important for the enhancement of several modern innovative technologies) have been computed over a wide range of temperature. Potential energy surfaces based on different formulations of the intramolecular and intermolecular components of the interaction have been used to compute quasiclassically and semiclassically some vibrational to vibrational energy transfer rate coefficients. Related outcomes have been rationalized in terms of state-to-state probabilities and cross sections for quasi-resonant transitions and deexcitations from the first excited vibrational level (for which experimental information are available). On this ground, it has been possible to spot critical differences on the vibrational energy exchange mechanisms supported by the different surfaces (mainly by their intermolecular components) in the low collision energy regime, though still effective for temperatures as high as 10,000 K. It was found, in particular, that the most recently proposed intermolecular potential becomes the most effective in promoting vibrational energy exchange near threshold temperatures and has a behavior opposite to the previously proposed one when varying the coupling of vibration with the other degrees of freedom. Copyright © 2014 Wiley Periodicals, Inc.

  12. Ab initio calculation of intermolecular potentials for dimer Cl_2-Cl_2 and prediction of second virial coefficients

    International Nuclear Information System (INIS)

    Nguyen Thanh Duoc; Nguyen Thi Ai Nhung; Tran Duong; Pham Van Tat

    2015-01-01

    The results presented in this paper are the ab initio intermolecular potentials and the second virial coefficient, B_2 (T) of the dimer Cl_2-Cl_2. These ab initio potentials were proposed by the quantum chemical calculations at high level of theory CCSD(T) with basis sets of Dunning valence correlation-consistent aug-cc-pVmZ (m = 2, 3); these results were extrapolated to complete basis set limit aug-cc-pV23Z. The ab initio energies of complete basis set limit aug-cc-pV23Z resulted from the exponential extrapolation were used to construct the 5-site pair potential functions. The second virial coefficients for this dimer were predicted from those with four-dimensional integration. The second virial coefficients were also corrected to first-order quantum effects. The results turn out to be in good agreement with experimental data, if available, or with those from empirical correlation. The quality of ab initio 5-site potentials proved the reliability for prediction of molecular thermodynamic properties. (author)

  13. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  14. Catalytic Intermolecular Cross-Couplings of Azides and LUMO-Activated Unsaturated Acyl Azoliums

    KAUST Repository

    Li, Wenjun

    2017-02-15

    An example for the catalytic synthesis of densely functionalized 1,2,3-triazoles through a LUMO activation mode has been developed. The protocol is enabled by intermolecular cross coupling reactions of azides with in situ-generated alpha,beta-unsaturated acyl azoliums. High yields and broad scope as well as the investigation of reaction mechanism are reported.

  15. Ab initio and Gordon--Kim intermolecular potentials for two nitrogen molecules

    International Nuclear Information System (INIS)

    Ree, F.H.; Winter, N.W.

    1980-01-01

    Both ab initio MO--LCAO--SCF and the electron-gas (or Gordon--Kim) methods have been used to compute the intermolecular potential (Phi) of N 2 molecules for seven different N 2 --N 2 orientations. The ab initio calculations were carried out using a [4s3p] contracted Gaussian basis set with and without 3d polarization functions. The larger basis set provides adequate results for Phi>0.002 hartree or intermolecular separations less than 6.5--7 bohr. We use a convenient analytic expression to represent the ab initio data in terms of the intermolecular distance and three angles defining the orientations of the two N 2 molecules. The Gordon--Kim method with Rae's self-exchange correction yields Phi, which agrees reasonably well over a large repulsive range. However, a detailed comparison of the electron kinetic energy contributions shows a large difference between the ab initio and the Gordon--Kim calculations. Using the ab initio data we derive an atom--atom potential of the two N 2 molecules. Although this expression does not accurately fit the data at some orientations, its spherical average agrees with the corresponding average of the ab initio Phi remarkably well. The spherically averaged ab initio Phi is also compared with the corresponding quantities derived from experimental considerations. The approach of the ab initio Phi to the classical quadrupole--quadrupole interaction at large intermolecular separation is also discussed

  16. Strong Intermolecular Exciton Couplings in Solid-State Circular Dichroism of Aryl Benzyl Sulfoxides

    Czech Academy of Sciences Publication Activity Database

    Padula, Daniele; Di Pietro, S.; Capozzi, M. A. M.; Cardellicchio, C.; Pescitelli, G.

    2014-01-01

    Roč. 26, č. 9 (2014), s. 462-470 ISSN 0899-0042 Institutional support: RVO:61388963 Keywords : organic crystals * TDDFT CD calculations * pairwise additive approximation * two-body effects * intermolecular forces in crystal lattices Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.886, year: 2014

  17. Salting Effects as an Illustration of the Relative Strength of Intermolecular Forces

    Science.gov (United States)

    Person, Eric C.; Golden, Donnie R.; Royce, Brenda R.

    2010-01-01

    This quick and inexpensive demonstration of the salting of an alcohol out of an aqueous solution illustrates the impact of intermolecular forces on solubility using materials familiar to many students. Ammonium sulfate (fertilizer) is added to an aqueous 35% solution of isopropyl alcohol (rubbing alcohol and water) containing food coloring as a…

  18. Instantaneous normal mode analysis for intermolecular and intramolecular vibrations of water from atomic point of view.

    Science.gov (United States)

    Chen, Yu-Chun; Tang, Ping-Han; Wu, Ten-Ming

    2013-11-28

    By exploiting the instantaneous normal mode (INM) analysis for models of flexible molecules, we investigate intermolecular and intramolecular vibrations of water from the atomic point of view. With two flexible SPC/E models, our investigations include three aspects about their INM spectra, which are separated into the unstable, intermolecular, bending, and stretching bands. First, the O- and H-atom contributions in the four INM bands are calculated and their stable INM spectra are compared with the power spectra of the atomic velocity autocorrelation functions. The unstable and intermolecular bands of the flexible models are also compared with those of the SPC/E model of rigid molecules. Second, we formulate the inverse participation ratio (IPR) of the INMs, respectively, for the O- and H-atom and molecule. With the IPRs, the numbers of the three species participated in the INMs are estimated so that the localization characters of the INMs in each band are studied. Further, by the ratio of the IPR of the H atom to that of the O atom, we explore the number of involved OH bond per molecule participated in the INMs. Third, by classifying simulated molecules into subensembles according to the geometry of their local environments or their H-bond configurations, we examine the local-structure effects on the bending and stretching INM bands. All of our results are verified to be insensible to the definition of H-bond. Our conclusions about the intermolecular and intramolecular vibrations in water are given.

  19. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    Science.gov (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  20. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  1. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  2. A FRET-based probe for epidermal growth factor receptor bound non-covalently to a pair of synthetic amphipathic helixes

    International Nuclear Information System (INIS)

    Itoh, Reina E.; Kurokawa, Kazuo; Fujioka, Aki; Sharma, Alok; Mayer, Bruce J.; Matsuda, Michiyuki

    2005-01-01

    Epidermal growth factor (EGF) receptor plays a pivotal role in a variety of cellular functions, such as proliferation, differentiation, and migration. To monitor the EGF receptor (EGFR) activity in living cells, we developed a probe for EGFR activity based on the principle of fluorescence resonance energy transfer (FRET). Previously, we developed a probe designated as Picchu (Phosphorylation indicator of the CrkII chimeric unit), which detects the tyrosine phosphorylation of the CrkII adaptor protein. We used a pair of synthetic amphipathic helixes, WinZipA2 and WinZipB1, to bind Picchu non-covalently to the carboxyl-terminus of the EGFR. Using this modified probe named Picchu-Z, the activity of EGFR was followed in EGF-stimulated Cos7 cells. We found that a high level of tyrosine phosphorylation of Picchu-Z probe remained after endocytosis until the point when the EGFR was translocated to the perinuclear region. These findings are in agreement with the previously reported 'signaling endosome' model. Furthermore, by pulse stimulation with EGF and by acute ablation of EGFR activity with AG1478, it was suggested that the phosphorylation of Picchu-Z probe, and probably the phosphorylation of EGFR also, underwent a rapid equilibrium (τ 1/2 < 2 min) between the phosphorylated and dephosphorylated states in the presence of EGF

  3. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  4. Assessment of the Coordination Ability of Sustainable Social-Ecological Systems Development Based on a Set Pair Analysis: A Case Study in Yanchi County, China

    Directory of Open Access Journals (Sweden)

    Ya Wang

    2016-08-01

    Full Text Available Sandy desertification is one of the most severe ecological problems in the world. Essentially, it is land degradation caused by discordance in the Social-Ecological Systems (SES. The ability to coordinate SES is a principal characteristic of regional sustainable development and a key factor in desertification control. This paper directly and comprehensively evaluates the ability to coordinate SES in the desertification reversal process. Assessment indicators and standards for SES have been established using statistical data and materials from government agencies. We applied a coordinated development model based on Identical-Discrepancy-Contrary (IDC situational ranking of a Set Pair Analysis (SPA to analyze the change in Yanchi County’s coordination ability since it implemented the grazing prohibition policy. The results indicated that Yanchi County was basically in the secondary grade of the national sustainable development level, and the subsystems’ development trend was relatively stable. Coordinate ability increased from 0.686 in 2003 to 0.957 in 2014 and experienced “weak coordination to basic coordination to high coordination” development processes. We concluded that drought, the grazing prohibition dilemma and the ecological footprint were key factors impeding the coordination of SES development in this area. These findings should provide information about desertification control and ecological policy implementation to guarantee sustainable rehabilitation.

  5. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  6. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  7. Novel Validated RP-HPLC Method for Bendamustine Hydrochloride Based on Ion-pair Chromatography: Application in Determining Infusion Stability and Pharmacokinetics.

    Science.gov (United States)

    Singh, Yuvraj; Chandrashekar, Anumandla; Pawar, Vivek K; Saravanakumar, Veeramuthu; Meher, Jayagopal; Raval, Kavit; Singh, Pankaj; Kumar, R Dinesh; Chourasia, Manish K

    2017-01-01

    Ion pair chromatography was used for quantifying bendamustine hydrochloride (BH) in its marketed vial. The permissive objective was to investigate time duration for which highly susceptible drug content of the marketed vial remained stable after reconstitution. However, the method could also be used to measure extremely low levels of drug in rat plasma and a pharmacokinetic study was accordingly conducted to further showcase method's applicability. Optimized separation was achieved on C-18 Purospher ® STAR (250 mm × 4.6 mm, 5 μm particle size) column. Mobile phase flowing at 1.5 mL/min consisted of 5 mM sodium salt of octane sulfonic acid dissolved in methanol, water and glacial acetic acid (55:45:0.075) maintained at pH 6. Detection was carried out at 233 nm with BH eluting after 7.8 min. Validation parameters were determined as per ICH guidelines. Limit of detection and limit of quantification were found to be 0.1 µg/mL and 0.33 µg/mL, respectively. The recoveries were 98-102% in bulk and 85-91% in plasma. The developed method was specific for BH, and utilized for assessing its short-term stability in physiologic solvents and forced degradation products in acid, base, oxidative, light and temperature induced stress environments. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  9. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  10. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  11. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  12. Uptake and predictors of early postnatal follow-up care amongst mother-baby pairs in South Africa: Results from three population-based surveys, 2010-2013.

    Science.gov (United States)

    Larsen, Anna; Cheyip, Mireille; Aynalem, Getahun; Dinh, Thu-Ha; Jackson, Debra; Ngandu, Nobubelo; Chirinda, Witness; Mogashoa, Mary; Kindra, Gupreet; Lombard, Carl; Goga, Ameena

    2017-12-01

    Achieving World Health Organization (WHO) recommendations for postnatal care (PNC) within the first few weeks of life is vital to eliminating early mother-to-child transmission of HIV (MTCT) and improving infant health. Almost half of the annual global deaths among children under five occur during the first six weeks of life. This study aims to identify uptake of three PNC visits within the first six weeks of life as recommended by WHO among South African mother-infant pairs, and factors associated with uptake. We analyzed data from three facility-based, nationally representative surveys (2010, 2011/12 and 2012/13) primarily designed to determine the effectiveness of the South African program to prevent MTCT. This analysis describes the proportion of infants achieving the WHO recommendation of at least 3 PNC visits. Interviews from 27 699 HIV-negative and HIV-positive mothers of infants aged 4-8 weeks receiving their six week immunization were included in analysis. Data were analyzed using STATA 13.0 and weighted for sample ascertainment and South African live births. We fitted a multivariable logistic regression model to estimate factors associated with early PNC uptake. Over half (59.6%, 95% confidence interval (CI) = 59.0-60.3) of mother-infant pairs received the recommended three PNC visits during the first 6 weeks; uptake was 63.1% (95% CI = 61.9-64.3) amongst HIV exposed infants and 58.1% (95% CI = 57.3-58.9) amongst HIV unexposed infants. Uptake of early PNC improved significantly with each survey, but varied significantly by province. Multivariable analysis of the pooled data, controlling for survey year, demonstrated that number of antenatal visits (4+ vs 12 weeks, aOR = 1.13, 95% CI = 1.04-1.23), place of delivery (clinic vs hospital aOR = 1.5, 1.3-1.6), and infant HIV exposure (exposed vs unexposed aOR = 1.2, 95% CI = 1.1-1.2) were the key factors associated with receiving recommended PNC visits. Approximately 40% of

  13. Combinatorial DNA Damage Pairing Model Based on X-Ray-Induced Foci Predicts the Dose and LET Dependence of Cell Death in Human Breast Cells

    Energy Technology Data Exchange (ETDEWEB)

    Vadhavkar, Nikhil [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Pham, Christopher [University of Texas, Houston, TX (United States). MD Anderson Cancer Center; Georgescu, Walter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Deschamps, Thomas [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Heuskin, Anne-Catherine [Univ. of Namur (Belgium). Namur Research inst. for Life Sciences (NARILIS), Research Center for the Physics of Matter and Radiation (PMR); Tang, Jonathan [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Costes, Sylvain V. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.

    2014-09-01

    are based on experimental RIF and are three times larger than the hypothetical LEM voxel used to fit survival curves. Our model is therefore an alternative to previous approaches that provides a testable biological mechanism (i.e., RIF). In addition, we propose that DSB pairing will help develop more accurate alternatives to the linear cancer risk model (LNT) currently used for regulating exposure to very low levels of ionizing radiation.

  14. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  15. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  16. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    OpenAIRE

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2014-01-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  17. Intermolecular hydrogen transfer catalyzed by a flavodehydrogenase, bakers' yeast flavocytochrome b2

    International Nuclear Information System (INIS)

    Urban, P.; Lederer, F.

    1985-01-01

    Bakers yeast flavocytochrome b2 is a flavin-dependent L-2-hydroxy acid dehydrogenase which also exhibits transhydrogenase activity. When a reaction takes place between [2- 3 H]lactate and a halogenopyruvate, tritium is found in water and at the halogenolactate C2 position. When the halogenopyruvate undergoes halide ion elimination, tritium is also found at the C3 position of the resulting pyruvate. The amount tau of this intermolecular tritium transfer depends on the initial keto acid-acceptor concentration. At infinite acceptor concentration, extrapolation yields a maximal transfer of 97 +/- 11%. This indicates that the hydroxy acid-derived hydrogen resides transiently on enzyme monoprotic heteroatoms and that exchange with bulk solvent occurs only at the level of free reduced enzyme. Using a minimal kinetic scheme, the rate constant for hydrogen exchange between Ered and solvent is calculated to be on the order of 10(2) M-1 S-1, which leads to an estimated pK approximately equal to 15 for the ionization of the substrate-derived proton while on the enzyme. It is suggested that this hydrogen could be shared between the active site base and Flred N5 anion. It is furthermore shown that some tritium is incorporated into the products when the transhydrogenation is carried out in tritiated water. Finally, with [2-2H]lactate-reduced enzyme, a deuterium isotope effect is observed on the rate of bromopyruvate disappearance. Extrapolation to infinite bromopyruvate concentration yields DV = 4.4. An apparent inverse isotope effect is determined for bromide ion elimination. These results strengthen the idea that oxidoreduction and elimination pathways involve a common carbanionic intermediate

  18. Towards interpretation of intermolecular paramagnetic relaxation enhancement outside the fast exchange limit

    Energy Technology Data Exchange (ETDEWEB)

    Ceccon, Alberto; Marius Clore, G., E-mail: mariusc@mail.nih.gov; Tugarinov, Vitali, E-mail: vitali.tugarinov@nih.gov [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    2016-09-15

    In an exchanging system between major and minor species, the transverse paramagnetic relaxation enhancement rate observed on the resonances of the major species (Γ{sub 2}{sup app}) is dependent upon the exchange regime between the species. Quantitative analysis of PRE data in such systems typically assumes that the overall exchange rate k{sub ex} between the species is fast on the PRE time scale (k{sub ex} ≫ Γ{sub 2}). Recently, we have characterized the kinetics of binding of the model protein ubiquitin to large (LUV) and small (SUV) unilamellar lipid-based nanoparticles or liposomes (Ceccon A, Tugarinov V, Bax A, Clore GM (2016). J Am Chem Soc 138:5789–5792). Building upon these results and taking advantage of a strong paramagnetic agent with an isotropic g-tensor, Gd{sup 3+}, we were able to measure intermolecular methyl carbon and proton PREs between paramagnetically-tagged liposomes and ubiquitin. In the limit of fast exchange (k{sub ex} ≫ Γ{sub 2}) the ratio of the apparent proton to carbon methyl PREs, ({sup 1}H{sub m}–Γ{sub 2}{sup app})/({sup 13}C{sub m}–Γ{sub 2}{sup app}), is equal to the square of the ratio of the gyromagnetic ratios of the two nuclei, (γ{sub Η}/γ{sub C}){sup 2}. However, outside the fast exchange regime, under intermediate exchange conditions (e.g. when Γ{sub 2} is comparable in magnitude to k{sub ex}) the ({sup 1}H{sub m}–Γ{sub 2}{sup app})/({sup 13}C{sub m}–Γ{sub 2}{sup app}) ratio provides a reliable measure of the ‘true’ methyl PREs.

  19. Intermolecular interactions in the condensed phase: Evaluation of semi-empirical quantum mechanical methods.

    Science.gov (United States)

    Christensen, Anders S; Kromann, Jimmy C; Jensen, Jan H; Cui, Qiang

    2017-10-28

    To facilitate further development of approximate quantum mechanical methods for condensed phase applications, we present a new benchmark dataset of intermolecular interaction energies in the solution phase for a set of 15 dimers, each containing one charged monomer. The reference interaction energy in solution is computed via a thermodynamic cycle that integrates dimer binding energy in the gas phase at the coupled cluster level and solute-solvent interaction with density functional theory; the estimated uncertainty of such calculated interaction energy is ±1.5 kcal/mol. The dataset is used to benchmark the performance of a set of semi-empirical quantum mechanical (SQM) methods that include DFTB3-D3, DFTB3/CPE-D3, OM2-D3, PM6-D3, PM6-D3H+, and PM7 as well as the HF-3c method. We find that while all tested SQM methods tend to underestimate binding energies in the gas phase with a root-mean-squared error (RMSE) of 2-5 kcal/mol, they overestimate binding energies in the solution phase with an RMSE of 3-4 kcal/mol, with the exception of DFTB3/CPE-D3 and OM2-D3, for which the systematic deviation is less pronounced. In addition, we find that HF-3c systematically overestimates binding energies in both gas and solution phases. As most approximate QM methods are parametrized and evaluated using data measured or calculated in the gas phase, the dataset represents an important first step toward calibrating QM based methods for application in the condensed phase where polarization and exchange repulsion need to be treated in a balanced fashion.

  20. Intermolecular interactions in the condensed phase: Evaluation of semi-empirical quantum mechanical methods

    Science.gov (United States)

    Christensen, Anders S.; Kromann, Jimmy C.; Jensen, Jan H.; Cui, Qiang

    2017-10-01

    To facilitate further development of approximate quantum mechanical methods for condensed phase applications, we present a new benchmark dataset of intermolecular interaction energies in the solution phase for a set of 15 dimers, each containing one charged monomer. The reference interaction energy in solution is computed via a thermodynamic cycle that integrates dimer binding energy in the gas phase at the coupled cluster level and solute-solvent interaction with density functional theory; the estimated uncertainty of such calculated interaction energy is ±1.5 kcal/mol. The dataset is used to benchmark the performance of a set of semi-empirical quantum mechanical (SQM) methods that include DFTB3-D3, DFTB3/CPE-D3, OM2-D3, PM6-D3, PM6-D3H+, and PM7 as well as the HF-3c method. We find that while all tested SQM methods tend to underestimate binding energies in the gas phase with a root-mean-squared error (RMSE) of 2-5 kcal/mol, they overestimate binding energies in the solution phase with an RMSE of 3-4 kcal/mol, with the exception of DFTB3/CPE-D3 and OM2-D3, for which the systematic deviation is less pronounced. In addition, we find that HF-3c systematically overestimates binding energies in both gas and solution phases. As most approximate QM methods are parametrized and evaluated using data measured or calculated in the gas phase, the dataset represents an important first step toward calibrating QM based methods for application in the condensed phase where polarization and exchange repulsion need to be treated in a balanced fashion.