Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Pan, Xiaoyong; Wang, Weizhi; Ke, Lin; Zhang, Nan
2017-07-20
In this report, we showed the existence of RET induced intermolecular pairing force by comparing their fluorescence behaviors under room illumination vs standing in dark area for either PFluAnt solution or PFluAnt&PFOBT mixture. Their prominent emission attenuation under room illumination brought out the critical role of photo, i.e. RET induced intermolecular pairing force in induction of polymer aggregation. Constant UV-Vis absorption and fluorescence spectra in terms of both peak shapes and maximum wavelengths implied no chemical decomposition was involved. Recoverable fluorescence intensity, fluorescence lifetime as well as NMR spectra further exclude photo induced decomposition. The controllable on/off state of RET induced intermolecular pairing force was verified by the masking effect of outside PFluAnt solution which function as filter to block the excitation of inside PFluAnt and thus off the RET induced intermolecular pairing force. Theoretical calculation suggest that magnitude of RET induced intermolecular pairing force is on the same scale as that of van der Waals interaction. Although the absolute magnitude of RET induced intermolecular pairing force was not tunable, its effect can be magnified by intentionally turn it "on", which was achieved by irradiance with 5 W desk lamp in this report.
International Nuclear Information System (INIS)
Anderson, Kurtis M.; Nguyen, Dan; Esadze, Alexandre; Zandrashvili, Levani; Gorenstein, David G.; Iwahara, Junji
2015-01-01
Protein–nucleic acid interactions involve intermolecular ion pairs of protein side-chain and DNA or RNA phosphate groups. Using three protein–DNA complexes, we demonstrate that site-specific oxygen-to-sulfur substitution in phosphate groups allows for identification of NMR signals from the protein side-chain NH 3 + groups forming the intermolecular ion pairs. A characteristic change in their 1 H and 15 N resonances upon this modification (i.e., substitution of phosphate to phosphorodithioate) can represent a signature of an intermolecular ion pair. Hydrogen-bond scalar coupling between protein side-chain 15 N and DNA phosphorodithiaote 31 P nuclei provides direct confirmation of the intermolecular ion pair. The same approach is likely applicable to protein–RNA complexes as well
Energy Technology Data Exchange (ETDEWEB)
Anderson, Kurtis M. [University of Texas Health Science Center at Houston, Department of NanoMedicine and Biomedical Engineering and Institute of Molecular Medicine (United States); Nguyen, Dan; Esadze, Alexandre; Zandrashvili, Levani [University of Texas Medical Branch, Department of Biochemistry and Molecular Biology, Sealy Center for Structural Biology and Molecular Biophysics (United States); Gorenstein, David G. [University of Texas Health Science Center at Houston, Department of NanoMedicine and Biomedical Engineering and Institute of Molecular Medicine (United States); Iwahara, Junji, E-mail: juiwahar@utmb.edu, E-mail: j.iwahara@utmb.edu [University of Texas Medical Branch, Department of Biochemistry and Molecular Biology, Sealy Center for Structural Biology and Molecular Biophysics (United States)
2015-05-15
Protein–nucleic acid interactions involve intermolecular ion pairs of protein side-chain and DNA or RNA phosphate groups. Using three protein–DNA complexes, we demonstrate that site-specific oxygen-to-sulfur substitution in phosphate groups allows for identification of NMR signals from the protein side-chain NH{sub 3}{sup +} groups forming the intermolecular ion pairs. A characteristic change in their {sup 1}H and {sup 15}N resonances upon this modification (i.e., substitution of phosphate to phosphorodithioate) can represent a signature of an intermolecular ion pair. Hydrogen-bond scalar coupling between protein side-chain {sup 15}N and DNA phosphorodithiaote {sup 31}P nuclei provides direct confirmation of the intermolecular ion pair. The same approach is likely applicable to protein–RNA complexes as well.
Pan, Xiaoyong; Chen, Hui; Wang, Wei Zhi; Ng, Siu Choon; Chan-Park, Mary B
2011-07-21
This paper explores evidence of an optically mediated interaction that is active in the separation mechanism of certain selective agents through consideration of the contrasting selective behaviors of two conjugated polymers with distinct optical properties. The involvement of a RET-induced intermolecular pairing force is implied by the different illumination response behaviors. The magnitude of this interaction scales with the external stimulus parameter, the illumination irradiance (I), and thus is tunable. This suggests a facile technique to modify the selectivity of polymers toward specific SWNT species by altering the polymer structure to adjust the corresponding intermolecular interaction. This is the first experimental verification and application of a RET-induced intermolecular pairing force to SWNT separation. With this kind of interaction taken into account, reasonable interpretation of some conflicting data, especially PLE maps, can be easily made. The above conclusion can be applied to other substances as long as they are electrically neutral and there is photon-induced RET between them. The significant magnitude of this interaction makes direct manipulation of molecules/particles possible and is expected to have applications in molecular engineering. © 2011 American Chemical Society
International Nuclear Information System (INIS)
Fries, P.
1978-01-01
In order to study the intermolecular relaxation due to magnetic dipolar interactions, we calculate the spectral densities resulting from random translational and rotational motions of spherical molecules carrying off-centre spins. The relative translational motion is treated in the frame-work of a general diffusion equation (the Smoluchowski equation) which takes into account the existence of effective forces between the molecules. This model implies a pair correlation function. i.e. a non unifom relative distribution of the molecules. The analytical calculations are carried out by taking correctly into account the hard sphere boundary conditions for the molecules. Explicit numerical calculations of the spectral densities are performed using finite difference methods and the pair correlation function of Verlet and Weiss obtained by computer experiments. The resulting calculations allow one to interpret the relaxation exhibited by benzene and some of its monohalogen derivatives which has been measured by Jonas et al. at various pressures. The effects of pair correlation and eccentricity contribute to a noticeable enhancement of the spectral densities, especially as the frequency increases. The translational correlation times calculated from the Stokes formula and those deduced from intermolecular relaxation studies are compared. It is shown that in order to distinguish which of the dynamical models is appropriate, measurements must be made as a function of frequency [fr
Determination of intermolecular transfer integrals from DFT calculations
Energy Technology Data Exchange (ETDEWEB)
Baumeier, Bjoern; Andrienko, Denis [Max-Planck Institute for Polymer Research, Mainz (Germany)
2010-07-01
Theoretical studies of charge transport in organic conducting systems pose a unique challenge since they require multiscale schemes that combine quantum-chemical, molecular dynamics and kinetic Monte-Carlo calculations. The description of the mobility of electrons and holes in the hopping regime relies on the determination of intermolecular hopping rates in large scale morphologies. Using Marcus theory these rates can be calculated from intermolecular transfer integrals and on-site energies. Here we present a detailed computational study on the accuracy and efficiency of density-functional theory based approaches to the determination of intermolecular transfer integrals. First, it is demonstrated how these can be obtained from quantum-chemistry calculations by forming the expectation value of a dimer Fock operator with frontier orbitals of two neighboring monomers based on a projective approach. We then consider the prototypical example of one pair out of a larger morphology of Tris(8-hydroxyquinolinato)aluminium (Alq3) and study the influence of computational parameters, e.g. the choice of basis sets, exchange-correlation functional, and convergence criteria, on the calculated transfer integrals. The respective accuracies and efficiencies are compared in order to derive an optimal strategy for future simulations based on the full morphology.
Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D
2014-10-07
We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.
2010-01-01
Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010
Quantifying intermolecular interactions of ionic liquids using cohesive energy densities
2017-01-01
For ionic liquids (ILs), both the large number of possible cation + anion combinations and their ionic nature provide a unique challenge for understanding intermolecular interactions. Cohesive energy density, ced, is used to quantify the strength of intermolecular interactions for molecular liquids, and is determined using the enthalpy of vaporization. A critical analysis of the experimental challenges and data to obtain ced for ILs is provided. For ILs there are two methods to judge the strength of intermolecular interactions, due to the presence of multiple constituents in the vapour phase of ILs. Firstly, cedIP, where the ionic vapour constituent is neutral ion pairs, the major constituent of the IL vapour. Secondly, cedC+A, where the ionic vapour constituents are isolated ions. A cedIP dataset is presented for 64 ILs. For the first time an experimental cedC+A, a measure of the strength of the total intermolecular interaction for an IL, is presented. cedC+A is significantly larger for ILs than ced for most molecular liquids, reflecting the need to break all of the relatively strong electrostatic interactions present in ILs. However, the van der Waals interactions contribute significantly to IL volatility due to the very strong electrostatic interaction in the neutral ion pair ionic vapour. An excellent linear correlation is found between cedIP and the inverse of the molecular volume. A good linear correlation is found between IL cedIP and IL Gordon parameter (which are dependent primarily on surface tension). ced values obtained through indirect methods gave similar magnitude values to cedIP. These findings show that cedIP is very important for understanding IL intermolecular interactions, in spite of cedIP not being a measure of the total intermolecular interactions of an IL. In the outlook section, remaining challenges for understanding IL intermolecular interactions are outlined. PMID:29308254
Quantifying intermolecular interactions of ionic liquids using cohesive energy densities.
Lovelock, Kevin R J
2017-12-01
For ionic liquids (ILs), both the large number of possible cation + anion combinations and their ionic nature provide a unique challenge for understanding intermolecular interactions. Cohesive energy density, ced , is used to quantify the strength of intermolecular interactions for molecular liquids, and is determined using the enthalpy of vaporization. A critical analysis of the experimental challenges and data to obtain ced for ILs is provided. For ILs there are two methods to judge the strength of intermolecular interactions, due to the presence of multiple constituents in the vapour phase of ILs. Firstly, ced IP , where the ionic vapour constituent is neutral ion pairs, the major constituent of the IL vapour. Secondly, ced C+A , where the ionic vapour constituents are isolated ions. A ced IP dataset is presented for 64 ILs. For the first time an experimental ced C+A , a measure of the strength of the total intermolecular interaction for an IL, is presented. ced C+A is significantly larger for ILs than ced for most molecular liquids, reflecting the need to break all of the relatively strong electrostatic interactions present in ILs. However, the van der Waals interactions contribute significantly to IL volatility due to the very strong electrostatic interaction in the neutral ion pair ionic vapour. An excellent linear correlation is found between ced IP and the inverse of the molecular volume. A good linear correlation is found between IL ced IP and IL Gordon parameter (which are dependent primarily on surface tension). ced values obtained through indirect methods gave similar magnitude values to ced IP . These findings show that ced IP is very important for understanding IL intermolecular interactions, in spite of ced IP not being a measure of the total intermolecular interactions of an IL. In the outlook section, remaining challenges for understanding IL intermolecular interactions are outlined.
The iodine molecule insights into intra- and intermolecular perturbation in diatomic molecules
Lukashov, Sergey; Pravilov, Anatoly
2018-01-01
This book presents experimental and theoretical spectroscopic studies performed over the last 25 years on the iodine molecule’s excited states and their perturbations. It is going to be of interest to researchers who study intra- and intermolecular perturbations in diatomic molecules and more complex systems. The book offers a detailed treatment of the nonadiabatic perturbations of valence, ion pair and Rydberg states induced by intramolecular as well as intermolecular interactions in collisions or in weakly-bound complexes. It also provides an overview of current instrumentation and techniques as well as theoretical approaches describing intra- and intermolecular perturbations. The authors are experts in the use of spectroscopy for the study of intrinsic and collision-induced perturbations in diatomic iodine. They introduced new methods of two- and three-step optical population of the iodine ion-pair states. The iodine molecule has 23 valence states correlating with three dissociation limits, 20 so-called ...
A general intermolecular force field based on tight-binding quantum chemical calculations
Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas
2017-10-01
A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Jungho Jun
2013-08-01
Full Text Available Gold-catalyzed intermolecular couplings of sulfonylacetylenes with allyl ethers are reported. A cooperative polarization of alkynes both by a gold catalyst and a sulfonyl substituent resulted in an efficient intermolecular tandem carboalkoxylation. Reactions of linear allyl ethers are consistent with the [3,3]-sigmatropic rearrangement mechanism, while those of branched allyl ethers provided [3,3]- and [1,3]-rearrangement products through the formation of a tight ion–dipole pair.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong
2013-04-08
Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom
2015-01-01
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
International Nuclear Information System (INIS)
Gao, X.; Patel, D.J.
1988-01-01
The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution
Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee
2017-11-20
Occurrence and application of oligonucleotide probes have promoted great progress in the biochemical analysis field due to their unique biological and chemical properties. In this work, a long-stem shaped multifunctional molecular beacon (LS-MMB) that is responsive to a cancer-related gene, p53, is well-prepared. By designing the probe with long-paired bases at its two ends and short-paired bases between the middle region and the 3' end, the LS-MMB is intelligently endowed with the ability to recognize the target analyte, serve as the polymerization primer/template, and signal the hybridization event synchronously, which is distinctly advantageous over the traditional molecular beacons (MBs). Moreover, it is excitingly found that the LS-MMB can be employed to exert intramolecular and intermolecular interactions for strand displacement amplification (SDA) without the involvement of any assistant probes; this therapy results in a really easy and rapid sensing system that provides an extremely low background noise and high target output signal. In this case, an excellent sensitivity and specificity to detect target gene down to picomolar level and resolution to even one nucleotide variation are achieved, respectively. In addition, the application potential for real genomic DNA analysis is realized. We envision that the probe of LS-MMB can act as a universal platform for biosensing and biomedical research.
Desensitization of metastable intermolecular composites
Busse, James R [South Fork, CO; Dye, Robert C [Los Alamos, NM; Foley, Timothy J [Los Alamos, NM; Higa, Kelvin T [Ridgecrest, CA; Jorgensen, Betty S [Jemez Springs, NM; Sanders, Victor E [White Rock, NM; Son, Steven F [Los Alamos, NM
2011-04-26
A method to substantially desensitize a metastable intermolecular composite material to electrostatic discharge and friction comprising mixing the composite material with an organic diluent and removing enough organic diluent from the mixture to form a mixture with a substantially putty-like consistency, as well as a concomitant method of recovering the metastable intermolecular composite material.
Romero, Eduardo E; Hernandez, Florencio E
2018-01-03
Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.
Molecular electrostatics for probing lone pair-π interactions.
Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R
2013-11-14
An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.
Characterizing the Polymer:Fullerene Intermolecular Interactions
Sweetnam, Sean
2016-02-02
Polymer:fullerene solar cells depend heavily on the electronic coupling of the polymer and fullerene molecular species from which they are composed. The intermolecular interaction between the polymer and fullerene tends to be strong in efficient photovoltaic systems, as evidenced by efficient charge transfer processes and by large changes in the energetics of the polymer and fullerene when they are molecularly mixed. Despite the clear presence of these strong intermolecular interactions between the polymer and fullerene, there is not a consensus on the nature of these interactions. In this work, we use a combination of Raman spectroscopy, charge transfer state absorption, and density functional theory calculations to show that the intermolecular interactions do not appear to be caused by ground state charge transfer between the polymer and fullerene. We conclude that these intermolecular interactions are primarily van der Waals in nature. © 2016 American Chemical Society.
Intermolecular and surface forces
Israelachvili, Jacob N
2011-01-01
This reference describes the role of various intermolecular and interparticle forces in determining the properties of simple systems such as gases, liquids and solids, with a special focus on more complex colloidal, polymeric and biological systems. The book provides a thorough foundation in theories and concepts of intermolecular forces, allowing researchers and students to recognize which forces are important in any particular system, as well as how to control these forces. This third edition is expanded into three sections and contains five new chapters over the previous edition.· starts fr
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
Desensitization and recovery of metastable intermolecular composites
Busse, James R [South Fork, CO; Dye, Robert C [Los Alamos, NM; Foley, Timothy J [Los Alamos, NM; Higa, Kelvin T [Ridgecrest, CA; Jorgensen, Betty S [Jemez Springs, NM; Sanders, Victor E [White Rock, NM; Son, Steven F [Los Alamos, NM
2010-09-07
A method to substantially desensitize a metastable intermolecular composite material to electrostatic discharge and friction comprising mixing the composite material with an organic diluent and removing enough organic diluent from the mixture to form a mixture with a substantially putty-like consistency, as well as a concomitant method of recovering the metastable intermolecular composite material.
Structural modeling and intermolecular correlation of liquid chlorine dioxide
International Nuclear Information System (INIS)
Ogata, Norio; Hironori, Shimakura; Kawakita, Yukinobu; Ohara, Yukoji; Kohara, Shinji; Takeda, Shinichi
2009-01-01
Chlorine dioxide (ClO 2 ) is water-soluble yellow gas at room temperature. It has long been used as a disinfectant of tap water and various commodities owing to its strong oxidizing activity against various microbial proteins. The oxidizing activity is believed to be due to the presence of unpaired electron in its molecular orbital. Despite wealth of physicochemical studies of gaseous ClO 2 , little is known about liquid ClO 2 , especially about fine molecular structure and intermolecular interactions of liquid ClO 2 . The purpose of this study is to elucidate the fine structure and intermolecular orientations of ClO 2 molecules in its liquid state using a high-energy X-ray diffraction technique. The measurements of liquid ClO 2 were carried out at -50 to 0 degree Celsius using a two-axis diffractometer installed at the BL04B2 beamline in the third-generation synchrotron radiation facility SPring-8 (Hyogo, Japan). The incident X-ray beamline was 113.4 keV in energy and 0.1093 Armstrong in wavelength from a Si(111) monochromator with the third harmonic reflection. Liquid ClO 2 held in a quartz capillary tube was placed in a temperature-controlled vacuum chamber. We obtained a structure factor S(Q) to a range of Q = 0.3-30 Amstrong -1 and a pair distribution function g(r) upon Fourier transform of the S(Q). The total g(r) showed peaks at 1.46, 2.08, 2.48, 3.16 and 4.24 Armstrong. From intramolecular bond lengths of 1.46 Armstrong for Cl-O and 2.48 Armstrong for O-O, O-Cl-O bond angle was estimated to be 116.1 degrees. Peaks at 3.16 and 4.24 Armstrong in the total g(r) strongly indicate presence of specific intermolecular orientations of ClO 2 molecules that are distinct from those observed as a dimer in the solid phase ClO 2 . This view was further supported by molecular simulation using a reverse Monte Carlo method (RMC). (author)
Competing Intramolecular vs. Intermolecular Hydrogen Bonds in Solution
Directory of Open Access Journals (Sweden)
Peter I. Nagy
2014-10-01
Full Text Available A hydrogen bond for a local-minimum-energy structure can be identified according to the definition of the International Union of Pure and Applied Chemistry (IUPAC recommendation 2011 or by finding a special bond critical point on the density map of the structure in the framework of the atoms-in-molecules theory. Nonetheless, a given structural conformation may be simply favored by electrostatic interactions. The present review surveys the in-solution competition of the conformations with intramolecular vs. intermolecular hydrogen bonds for different types of small organic molecules. In their most stable gas-phase structure, an intramolecular hydrogen bond is possible. In a protic solution, the intramolecular hydrogen bond may disrupt in favor of two solute-solvent intermolecular hydrogen bonds. The balance of the increased internal energy and the stabilizing effect of the solute-solvent interactions regulates the new conformer composition in the liquid phase. The review additionally considers the solvent effects on the stability of simple dimeric systems as revealed from molecular dynamics simulations or on the basis of the calculated potential of mean force curves. Finally, studies of the solvent effects on the type of the intermolecular hydrogen bond (neutral or ionic in acid-base complexes have been surveyed.
International Nuclear Information System (INIS)
Maxton, P.M.; Schaeffer, M.W.; Ohline, S.M.; Kim, W.; Venturo, V.A.; Felker, P.M.
1994-01-01
Theoretical and experimental results pertaining to the excitation of intermolecular vibrations in the Raman and vibronic spectra of aromatic-containing, weakly bound complexes and clusters are reported. The theoretical analysis of intermolecular Raman activity is based on the assumption that the polarizability tensor of a weakly bound species is given by the sum of the polarizability tensors of its constituent monomers. The analysis shows that the van der Waals bending fundamentals in aromatic--rare gas complexes may be expected to be strongly Raman active. More generally, it predicts strong Raman activity for intermolecular vibrations that involve the libration or internal rotation of monomer moieties having appreciable permanent polarizability anisotropies. The vibronic activity of intermolecular vibrations in aromatic-rare gas complexes is analyzed under the assumption that every vibronic band gains its strength from an aromatic-localized transition. It is found that intermolecular vibrational excitations can accompany aromatic-localized vibronic excitations by the usual Franck--Condon mechanism or by a mechanism dependent on the librational amplitude of the aromatic moiety during the course of the pertinent intermolecular vibration. The latter mechanism can impart appreciable intensity to bands that are forbidden by rigid-molecule symmetry selection rules. The applicability of such rules is therefore called into question. Finally, experimental spectra of intermolecular transitions, obtained by mass-selective, ionization-detected stimulated Raman spectroscopies, are reported for benzene--X (X=Ar, --Ar 2 , N 2 , HCl, CO 2 , and --fluorene), fluorobenzene--Ar and --Kr, aniline--Ar, and fluorene--Ar and --Ar 2 . The results support the conclusions of the theoretical analyses and provide further evidence for the value of Raman methods in characterizing intermolecular vibrational level structures
Berry, David J; Steed, Jonathan W
2017-08-01
As small molecule drugs become harder to develop and less cost effective for patient use, efficient strategies for their property improvement become increasingly important to global health initiatives. Improvements in the physical properties of Active Pharmaceutical Ingredients (APIs), without changes in the covalent chemistry, have long been possible through the application of binary component solids. This was first achieved through the use of pharmaceutical salts, within the last 10-15years with cocrystals and more recently coamorphous systems have also been consciously applied to this problem. In order to rationally discover the best multicomponent phase for drug development, intermolecular interactions need to be considered at all stages of the process. This review highlights the current thinking in this area and the state of the art in: pharmaceutical multicomponent phase design, the intermolecular interactions in these phases, the implications of these interactions on the material properties and the pharmacokinetics in a patient. Copyright © 2017 Elsevier B.V. All rights reserved.
Pley, H W; Flaherty, K M; McKay, D B
1994-11-03
In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.
Systematic study on intermolecular valence-band dispersion in molecular crystalline films
International Nuclear Information System (INIS)
Yamane, Hiroyuki; Kosugi, Nobuhiro
2015-01-01
Highlights: • Intermolecular valence-band dispersion of crystalline films of phthalocyanines. • Intermolecular transfer integral versus lattice constant. • Site-specific intermolecular interaction and resultant valence-band dispersion. • Band narrowing effect induced by elevated temperature. - Abstract: Functionalities of organic semiconductors are governed not only by individual properties of constituent molecules but also by solid-state electronic states near the Fermi level such as frontier molecular orbitals, depending on weak intermolecular interactions in various conformations. The individual molecular property has been widely investigated in detail; on the other hand, the weak intermolecular interaction is difficult to investigate precisely due to the presence of the structural and thermal energy broadenings in organic solids. Here we show quite small but essential intermolecular valence band dispersions and their temperature dependence of sub-0.1-eV scale in crystalline films of metal phthalocyanines (H_2Pc, ZnPc, CoPc, MnPc, and F_1_6ZnPc) by using angle-resolved photoemission spectroscopy (ARPES) with synchrotron radiation. The observed bands show intermolecular and site dependent dispersion widths, phases, and periodicities, for different chemical substitution of terminal groups and central metals in the phthalocyanine molecule. The precise and systematic band-dispersion measurement would be a credible approach toward the comprehensive understanding of intermolecular interactions and resultant charge transport properties as well as their tuning by substituents in organic molecular systems.
International Nuclear Information System (INIS)
Kaplan, I.G.; Rodimova, O.B.; AN SSSR, Tomsk. Inst. Optiki Atmosfery)
1978-01-01
The present state of the intermolecular interaction theory is described. The general physical picture of the molecular interactions is given, the relative contributions of interactions of different types are analyzed (electrostatic, resonance, induction, dispersion, relativistic, magnetostatic and exchange), and the main ones in each range of separations are picked out. The methods of the potential curve calculations are considered, specific for definite separations between the interacting systems. The special attention is paid to the analysis of approximations used in different theoretical calculation methods
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Intermolecular interactions in the condensed phase
DEFF Research Database (Denmark)
Christensen, Anders S.; Kromann, Jimmy Charnley; Jensen, Jan Halborg
2017-01-01
To facilitate further development of approximate quantum mechanical methods for condensed phase applications, we present a new benchmark dataset of intermolecular interaction energies in the solution phase for a set of 15 dimers, each containing one charged monomer. The reference interaction energy...... and solution phases. As most approximate QM methods are parametrized and evaluated using data measured or calculated in the gas phase, the dataset represents an important first step toward calibrating QM based methods for application in the condensed phase where polarization and exchange repulsion need...
Morse-Morse-Spline-Van der Waals intermolecular potential suitable for hexafluoride gases
International Nuclear Information System (INIS)
Coroiu, Ilioara
2004-01-01
Several effective isotopic pair potential functions have been proposed to characterize the bulk properties of quasispherical molecules, in particular the hexafluorides, but none got a success. Unfortunately, these potentials have repulsive walls steeper than those which describe the hexafluorides. That these intermolecular potentials are not quite adequate is shown by the lack of complete agreement between theory and experiment even for the rare gases. Not long ago, R. A. Aziz et al. have constructed a Morse-Morse-Spline-Van der Waals (MMSV) potential. The MMSV potential incorporates the determination of C 6 dispersion coefficient and it reasonably correlates second virial coefficients and viscosity data of sulphur hexafluoride at the same time. None of the potential functions previously proposed in literature could predict these properties simultaneously. We calculated the second virial coefficients and a large number of Chapman-Cowling collision integrals for this improved intermolecular potential, the MMSV potential. The results were tabulated for a large reduced temperature range, kT/ε from 0.1 to 100. The treatment was entirely classical and no corrections for quantum effects were made. The higher approximations to the transport coefficients and the isotopic thermal diffusion factor were also calculated and tabulated for the same range. In this paper we present the evaluation of the uranium hexafluoride potential parameters for the MMSV intermolecular potential. To find a single set of potential parameters which could predict all the transport properties (viscosity, thermal conductivity, self diffusion, etc.), as well as the second virial coefficients, simultaneously, the method suggested by Morizot and a large assortment of literature data were used. Our results emphasized that the Morse-Morse-Spline-Van der Waals potential have the best overall predictive ability for gaseous hexafluoride data, certain for uranium hexafluoride. (author)
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Single-molecule magnets ``without'' intermolecular interactions
Wernsdorfer, W.; Vergnani, L.; Rodriguez-Douton, M. J.; Cornia, A.; Neugebauer, P.; Barra, A. L.; Sorace, L.; Sessoli, R.
2012-02-01
Intermolecular magnetic interactions (dipole-dipole and exchange) affect strongly the magnetic relaxation of crystals of single-molecule magnets (SMMs), especially at low temperature, where quantum tunneling of the magnetization (QTM) dominates. This leads to complex many-body problems [l]. Measurements on magnetically diluted samples are desirable to clearly sort out the behaviour of magnetically-isolated SMMs and to reveal, by comparison, the effect of intermolecular interactions. Here, we diluted a Fe4 SMM into a diamagnetic crystal lattice, affording arrays of independent and iso-oriented magnetic units. We found that the resonant tunnel transitions are much sharper, the tunneling efficiency changes significantly, and two-body QTM transitions disappear. These changes have been rationalized on the basis of a dipolar shuffling mechanism and of transverse dipolar fields, whose effect has been analyzed using a multispin model. Our findings directly prove the impact of intermolecular magnetic couplings on the SMM behaviour and disclose the magnetic response of truly-isolated giant spins in a diamagnetic crystalline environment.[4pt] [1] W. Wernsdorfer, at al, PRL 82, 3903 (1999); PRL 89, 197201 (2002); Nature 416, 406 (2002); IS Tupitsyn, PCE Stamp, NV Prokof'ev, PRB 69, 132406 (2004).
Ab initio intermolecular potential energy surface and thermophysical properties of nitrous oxide.
Crusius, Johann-Philipp; Hellmann, Robert; Hassel, Egon; Bich, Eckard
2015-06-28
We present an analytical intermolecular potential energy surface (PES) for two rigid nitrous oxide (N2O) molecules derived from high-level quantum-chemical ab initio calculations. Interaction energies for 2018 N2O-N2O configurations were computed utilizing the counterpoise-corrected supermolecular approach at the CCSD(T) level of theory using basis sets up to aug-cc-pVQZ supplemented with bond functions. A site-site potential function with seven sites per N2O molecule was fitted to the pair interaction energies. We validated our PES by computing the second virial coefficient as well as shear viscosity and thermal conductivity in the dilute-gas limit. The values of these properties are substantiated by the best experimental data.
Electronic transitions and intermolecular forces
International Nuclear Information System (INIS)
Hemert, M.C. van.
1981-01-01
This thesis describes two different subjects - electronic transitions and intermolecular forces - that are related mainly by the following observation: The wavenumber at which an electronic transition in an atom or molecule occurs, depends on the environment of that atom or molecule. This implies, for instance, that when a molecule becomes solvated its absorption spectrum may be shifted either to the blue or to the red side of the original gasphase spectrum. In part I attention is paid to the experimental aspects of VUV spectroscopy, both in the gasphase and in the condensed phase. In part II a series of papers are presented, dealing with the calculation of intermolecular forces (and some related topics) both for the ground state and for the excited state interactions, using different non-empirical methods. The calculations provide, among other results, a semiquantitative interpretation of the spectral blue shifts encountered in our experiments. (Auth.)
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yang, Fang-Ling; Yang, Xing; Wu, Rui-Zhi; Yan, Chao-Xian; Yang, Fan; Ye, Weichun; Zhang, Liang-Wei; Zhou, Pan-Pan
2018-04-25
The characters of σ- and π-holes of bromopentafluorobenzene (C6F5Br) enable it to interact with an electron-rich atom or group like pyridine which possesses an electron lone-pair N atom and a π ring. Theoretical studies of intermolecular interactions between C6F5Br and C5H5N have been carried out at the M06-2X/aug-cc-pVDZ level without and with the counterpoise method, together with single point calculations at M06-2X/TZVP, wB97-XD/aug-cc-pVDZ and CCSD(T)/aug-cc-pVDZ levels. The σ- and π-holes of C6F5Br exhibiting positive electrostatic potentials make these sites favorably interact with the N atom and the π ring of C5H5N with negative electrostatic potentials, leading to five different dimers connected by a σ-holen bond, a σ-holeπ bond or a π-holeπ bond. Their geometrical structures, characteristics, nature and spectroscopy behaviors were systematically investigated. EDA analyses reveal that the driving forces in these dimers are different. NCI, QTAIM and NBO analyses confirm the existence of intermolecular interactions formed via σ- and π-holes of C6F5Br and the N atom and the π ring of C5H5N. The experimental IR and Raman spectra gave us important information about the formation of molecular complexes between C6F5Br and C5H5N. We expect that the results could provide valuable insights into the investigation of intermolecular interactions involving σ- and π-holes.
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Beauchamp, Guy
2008-10-23
This study explores via structural clues the influence of weak intermolecular hydrogen-halogen bonds on the boiling point of halogenated ethanes. The plot of boiling points of 86 halogenated ethanes versus the molar refraction (linked to polarizability) reveals a series of straight lines, each corresponding to one of nine possible arrangements of hydrogen and halogen atoms on the two-carbon skeleton. A multiple linear regression model of the boiling points could be designed based on molar refraction and subgroup structure as independent variables (R(2) = 0.995, standard error of boiling point 4.2 degrees C). The model is discussed in view of the fact that molar refraction can account for approximately 83.0% of the observed variation in boiling point, while 16.5% could be ascribed to weak C-X...H-C intermolecular interactions. The difference in the observed boiling point of molecules having similar molar refraction values but differing in hydrogen-halogen intermolecular bonds can reach as much as 90 degrees C.
Characterizing the Polymer:Fullerene Intermolecular Interactions
Sweetnam, Sean; Vandewal, Koen; Cho, Eunkyung; Risko, Chad; Coropceanu, Veaceslav; Salleo, Alberto; Bredas, Jean-Luc; McGehee, Michael D.
2016-01-01
the polymer and fullerene, there is not a consensus on the nature of these interactions. In this work, we use a combination of Raman spectroscopy, charge transfer state absorption, and density functional theory calculations to show that the intermolecular
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
He-, Ne-, and Ar-phosgene intermolecular potential energy surfaces
DEFF Research Database (Denmark)
Munteanu, Cristian R.; Henriksen, Christian; Felker, Peter M.
2013-01-01
Using the CCSD(T) model, we evaluated the intermolecular potential energy surfaces of the He-, Ne-, and Ar-phosgene complexes. We considered a representative number of intermolecular geometries for which we calculated the corresponding interaction energies with the augmented (He complex) and doub...... of the complexes, providing valuable results for future experimental investigations. Comparing our results to those previously available for other phosgene complexes, we suggest that the results for Cl2-phosgene should be revised....
Intermolecular cleavage by UmuD-like mutagenesis proteins
McDonald, John P.; Frank, Ekaterina G.; Levine, Arthur S.; Woodgate, Roger
1998-01-01
The activity of a number of proteins is regulated by self-processing reactions. Elegant examples are the cleavage of the prokaryotic LexA and λCI transcriptional repressors and the UmuD-like mutagenesis proteins. Various studies support the hypothesis that LexA and λCI cleavage reactions are predominantly intramolecular in nature. The recently described crystal structure of the Escherichia coli UmuD′ protein (the posttranslational cleavage product of the UmuD protein) suggests, however, that the region of the protein corresponding to the cleavage site is at least 50 Å away from the catalytic active site. We considered the possibility, therefore, that the UmuD-like proteins might undergo self-processing that, in contrast to LexA and λCI, occurs via an intermolecular rather than intramolecular reaction. To test this hypothesis, we introduced into E. coli compatible plasmids with mutations at either the cleavage or the catalytic site of three UmuD-like proteins. Cleavage of these proteins only occurs in the presence of both plasmids, indicating that the reaction is indeed intermolecular in nature. Furthermore, this intermolecular reaction is completely dependent upon the multifunctional RecA protein and leads to the restoration of cellular mutagenesis in nonmutable E. coli strains. Intermolecular cleavage of a biotinylated UmuD active site mutant was also observed in vitro in the presence of the wild-type UmuD′ protein, indicating that in addition to the intact UmuD protein, the normal cleavage product (UmuD′) can also act as a classical enzyme. PMID:9465040
International Nuclear Information System (INIS)
Tsui, H.H.Y.
2001-01-01
Model intermolecular potentials are required for simulations of molecules in the gas, liquid, or solid phase. The widely used isotropic atom-atom model potentials are empirically fitted and based on the assumptions of transferability, combining rules and that atoms in molecules are spherical. This thesis develops a non-empirical method of modelling repulsion by applying the overlap model, which we show as a general non-empirical method of deriving repulsion potentials for a specific molecule. In this thesis, the repulsion parameters for an exponential atom-atom model potential are obtained from the ab initio charge density of a small organic molecule by making the assumption that the repulsion is proportional to the overlap of a pair of molecules. The proportionality constant is fixed by a limited number of intermolecular perturbation theory (IMPT) calculations. To complete the model potential, the electrostatic interaction is represented by a distributed multipole analysis, and the Slater-Kirkwood formula is used for the dispersion. These non-empirical potentials can reproduce experimental crystal structure when applied to crystal structure prediction of an oxyboryl derivative. A detailed study on further improving the overlap model was carried out for phenol-water, by including other minor intermolecular contributions of charge-transfer and penetration. High quality ab initio calculations on the complex were performed for use in comparison. To compare with experimental data, diffusion Monte Carlo simulations were performed with the potential, so that the effects of anharmonic zero-point motion on structure and energy of the system are included. When the system is too large for an IMPT calculation, the proportionality constant can be determined empirically by fitting the cell volume as shown in our study of crystal structures of chlorothalonil. This is used with an anisotropic repulsion model that has been derived for Cl and N atoms in chlorothalonil. This model
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang
2018-07-01
The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.
Studying Intermolecular Forces with a Dual Gas Chromatography and Boiling Point Investigation
Cunningham, William Patrick; Xia, Ian; Wickline, Kaitlyn; Huitron, Eric Ivan Garcia; Heo, Jun
2018-01-01
A procedure for the study of structural differences and intermolecular attraction between ethanol and 1-butanol based in laboratory work is described. This study provides comparisons of data retrieved from both a determination of boiling point and gas chromatography traces for the mixture. The methodology reported here should provide instructors…
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Intermolecular failure of L-type Ca2+ channel and ryanodine receptor signaling in hypertrophy.
Directory of Open Access Journals (Sweden)
Ming Xu
2007-02-01
Full Text Available Pressure overload-induced hypertrophy is a key step leading to heart failure. The Ca(2+-induced Ca(2+ release (CICR process that governs cardiac contractility is defective in hypertrophy/heart failure, but the molecular mechanisms remain elusive. To examine the intermolecular aspects of CICR during hypertrophy, we utilized loose-patch confocal imaging to visualize the signaling between a single L-type Ca(2+ channel (LCC and ryanodine receptors (RyRs in aortic stenosis rat models of compensated (CHT and decompensated (DHT hypertrophy. We found that the LCC-RyR intermolecular coupling showed a 49% prolongation in coupling latency, a 47% decrease in chance of hit, and a 72% increase in chance of miss in DHT, demonstrating a state of "intermolecular failure." Unexpectedly, these modifications also occurred robustly in CHT due at least partially to decreased expression of junctophilin, indicating that intermolecular failure occurs prior to cellular manifestations. As a result, cell-wide Ca(2+ release, visualized as "Ca(2+ spikes," became desynchronized, which contrasted sharply with unaltered spike integrals and whole-cell Ca(2+ transients in CHT. These data suggested that, within a certain limit, termed the "stability margin," mild intermolecular failure does not damage the cellular integrity of excitation-contraction coupling. Only when the modification steps beyond the stability margin does global failure occur. The discovery of "hidden" intermolecular failure in CHT has important clinical implications.
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
All rights reserved Intermolecular Model Potentials and Virial ...
African Journals Online (AJOL)
ADOWIE PERE
Intermolecular Model Potentials and Virial Coefficients from Acoustic Data. 1* ... method of cluster expansion. Its merit is that, ... their determination is by the analyses of isothermal p- ρ-y data ... Carlo simulation method to calculate volumetric.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Energy Technology Data Exchange (ETDEWEB)
Hobbs, M.L.
1997-12-01
Determination of product species, equations-of-state (EOS) and thermochemical properties of high explosives and pyrotechnics remains a major unsolved problem. Although, empirical EOS models may be calibrated to replicate detonation conditions within experimental variability (5--10%), different states, e.g. expansion, may produce significant discrepancy with data if the basic form of the EOS model is incorrect. A more physically realistic EOS model based on intermolecular potentials, such as the Jacobs Cowperthwaite Zwisler (JCZ3) EOS, is needed to predict detonation states as well as expanded states. Predictive capability for any EOS requires a large species data base composed of a wide variety of elements. Unfortunately, only 20 species have known JCZ3 molecular force constants. Of these 20 species, only 10 have been adequately compared to experimental data such as molecular scattering or shock Hugoniot data. Since data in the strongly repulsive region of the molecular potential is limited, alternative methods must be found to deduce force constants for a larger number of species. The objective of the present study is to determine JCZ3 product species force constants by using a corresponding states theory. Intermolecular potential parameters were obtained for a variety of gas species using a simple corresponding states technique with critical volume and critical temperature. A more complex, four parameter corresponding state method with shape and polarity corrections was also used to obtain intermolecular potential parameters. Both corresponding state methods were used to predict shock Hugoniot data obtained from pure liquids. The simple corresponding state method is shown to give adequate agreement with shock Hugoniot data.
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
Direct measurements of intermolecular forces by chemical force microscopy
Vezenov, Dmitri Vitalievich
1999-12-01
Detailed description of intermolecular forces is key to understanding a wide range of phenomena from molecular recognition to materials failure. The unique features of atomic force microscopy (AFM) to make point contact force measurements with ultra high sensitivity and to generate spatial maps of surface topography and forces have been extended to include measurements between well-defined organic molecular groups. Chemical modification of AFM probes with self-assembled monolayers (SAMs) was used to make them sensitive to specific molecular interactions. This novel chemical force microscopy (CFM) technique was used to probe forces between different molecular groups in a range of environments (vacuum, organic liquids and aqueous solutions); measure surface energetics on a nanometer scale; determine pK values of the surface acid and base groups; measure forces to stretch and unbind a short synthetic DNA duplex and map the spatial distribution of specific functional groups and their ionization state. Studies of adhesion forces demonstrated the important contribution of hydrogen bonding to interactions between simple organic functionalities. The chemical identity of the tip and substrate surfaces as well as the medium had a dramatic effect on adhesion between model monolayers. A direct correlation between surface free energy and adhesion forces was established. The adhesion between epoxy polymer and model mixed SAMs varied with the amount of hydrogen bonding component in the monolayers. A consistent interpretation of CFM measurements in polar solvents was provided by contact mechanics models and intermolecular force components theory. Forces between tips and surfaces functionalized with SAMs terminating in acid or base groups depended on their ionization state. A novel method of force titration was introduced for highly local characterization of the pK's of surface functional groups. The pH-dependent changes in friction forces were exploited to map spatially the
Ab initio and Gordon--Kim intermolecular potentials for two nitrogen molecules
International Nuclear Information System (INIS)
Ree, F.H.; Winter, N.W.
1980-01-01
Both ab initio MO--LCAO--SCF and the electron-gas (or Gordon--Kim) methods have been used to compute the intermolecular potential (Phi) of N 2 molecules for seven different N 2 --N 2 orientations. The ab initio calculations were carried out using a [4s3p] contracted Gaussian basis set with and without 3d polarization functions. The larger basis set provides adequate results for Phi>0.002 hartree or intermolecular separations less than 6.5--7 bohr. We use a convenient analytic expression to represent the ab initio data in terms of the intermolecular distance and three angles defining the orientations of the two N 2 molecules. The Gordon--Kim method with Rae's self-exchange correction yields Phi, which agrees reasonably well over a large repulsive range. However, a detailed comparison of the electron kinetic energy contributions shows a large difference between the ab initio and the Gordon--Kim calculations. Using the ab initio data we derive an atom--atom potential of the two N 2 molecules. Although this expression does not accurately fit the data at some orientations, its spherical average agrees with the corresponding average of the ab initio Phi remarkably well. The spherically averaged ab initio Phi is also compared with the corresponding quantities derived from experimental considerations. The approach of the ab initio Phi to the classical quadrupole--quadrupole interaction at large intermolecular separation is also discussed
Directory of Open Access Journals (Sweden)
Michael Paßens
2015-06-01
Full Text Available Disordered and uniform (2√3 × 2√3R30° superstructures of fullerenes on the Au(111 surface have been studied using scanning tunneling microscopy and spectroscopy. It is shown that the deposition and growth process of a fullerene monolayer on the Au(111 surface determine the resulting superstructure. The supply of thermal energy is of importance for the activation of a Au vacancy forming process and thus, one criterion for the selection of the respective superstructure. However, here it is depicted that a vacancy–adatom pair can be formed even at room temperature. This latter process results in C60 molecules that appear slightly more bright in scanning tunnelling microscopy images and are identified in disordered (2√3 x 2√3R30° superstructures based on a detailed structure analysis. In addition, these slightly more bright C60 molecules form uniform (2√3 x 2√3R30° superstructures, which exhibit intermolecular interactions, likely mediated by Au adatoms. Thus, vacancy–adatom pairs forming at room temperature directly affect the resulting C60 superstructure. Differential conductivity spectra reveal a lifting of the degeneracy of the LUMO and LUMO+1 orbitals in the uniform (2√3 x 2√3R30° superstructure and in addition, hybrid fullerene–Au(111 surface states suggest partly covalent interactions.
Cohesion: a scientific history of intermolecular forces
National Research Council Canada - National Science Library
Rowlinson, J. S
2002-01-01
.... The final section gives an account of the successful use in the 20th century of quantum mechanics and statistical mechanics to resolve most of the remaining problems. Throughout the last 300 years there have been periods of tremendous growth in our understanding of intermolecular forces but such interest proved to be unsustainable, and long periods of...
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
International Nuclear Information System (INIS)
Power, E.A.; Thirunamachandran, T.
1993-01-01
Spatial correlations between electromagnetic fields arising from neutral sources with electric-dipole transition moments are calculated using nonrelativistic quantum electrodynamics in the multipolar formalism. Expressions for electric-electric, magnetic-magnetic, and electric-magnetic correlation functions at two points r and r' are given for a source molecule in either a ground or an excited state. In contrast to the electric-electric and magnetic-magnetic cases there are no electric-magnetic correlations for a ground-state molecule. For an excited molecule the downward transitions contribute additional terms which have modulating factors depending on (r-r')/λ. From these correlation functions electric and magnetic energy densities are found by setting r=r'. These energy densities are then used in a response formalism to calculate intermolecular energy shifts. In the case of two ground-state molecules this leads to the Casimir-Polder potential. However, for a pair of molecules, one or both excited, there are additional terms arising from downward transitions. An important feature of these energies is that they exhibit an R -2 dependence for large intermolecular separations R. This dependence is interpreted in terms of the Poynting vector, which itself can be obtained by setting r=r' in the electric-magnetic correlation function
International Nuclear Information System (INIS)
Dittmer, Jens; Kim, Chul-Hyun; Bodenhausen, Geoffrey
2003-01-01
The bond lengths and dynamics of intra- and intermolecular hydrogen bonds in an RNA kissing complex have been characterized by determining the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitrogen-15 nuclei belonging to opposite bases. New experiments allow one to determine the chemical shift anisotropy of the imino protons. The bond lengths derived from dipolar relaxation and the lack of modulations of the nitrogen chemical shifts indicate that the intermolecular hydrogen bonds which hold the kissing complex together are very similar to the intramolecular hydrogen bonds in the double-stranded stem of the RNA
Orientation correlation and intermolecular structure of GeCl4, VCl4 and other tetrachloride liquids
International Nuclear Information System (INIS)
Nath, P.P.; Sarkar, S.; Joarder, R.N.
2007-01-01
The intermolecular structure and correlation of GeCl 4 , VCl 4 and other tetrachloride liquids can be well described by Misawa's orientation correlation model originally applied to liquid CCl 4 . The model supports on average a specific 'corner' to 'face' correlation, but evidently very different from 'Apollo' type model. The Misawa model appears to work, in some respect, even better than reference interaction site model (RISM) used for long to describe intermolecular structure of such molecular systems. The test and comparison are made through the calculation of small asymmetric part of the intermolecular structure and evaluation of partial atom-atom distribution functions
Dancing Crystals: A Dramatic Illustration of Intermolecular Forces
Mundell, Donald W.
2007-01-01
Crystals of naphthalene form on the surface of an acetone solution and dance about in an animated fashion illustrating surface tension, crystallization, and intermolecular forces. Additional experiments reveal the properties of the solution. Flows within the solutions can be visualized by various means. Previous demonstrations of surface motion…
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
Xiang, Shi-Kai; Tan, Wen; Zhang, Dong-Xue; Tian, Xian-Li; Feng, Chun; Wang, Bi-Qin; Zhao, Ke-Qing; Hu, Ping; Yang, Hua
2013-11-14
The synthesis of benzimidazoles by intermolecular cyclization reaction of 2-iodoanilines with nitriles has been developed. These reactions proceeded without the aid of any transition metals or ligands and just using KOBu(t) as the base. A variety of substituted benzimidazole derivatives can be synthesized by the approach.
Phase transitions in liquids with directed intermolecular bonding
Son, L.; Ryltcev, R.
2005-01-01
Liquids with quasi - chemical bonding between molecules are described in terms of vertex model. It is shown that this bonding results in liquid - liquid phase transition, which occurs between phases with different mean density of intermolecular bonds. The transition may be suggested to be a universal phenomena for those liquids.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
International Nuclear Information System (INIS)
Gelbart, W.M.
1980-01-01
In this article some of the theoretical background is presented for the following papers on 'Intermolecular Spectroscopy and Dynamical Properties of Dense Systems'. In Section 1 we outline a simple semi-classical description of the interaction between optical radiation and matter. The motion of a many-body polarizability is introduced; limiting forms of this complicated quantity lead to the familiar cases of light scattering spectra. In Section 2 we consider the linear response approximation, and the equation of motion for the many-body density matrix is solved to first order in the matter-radiation interaction. The often quoted fluctuation-dissipation theorem and the time-dependent, equilibrium correlation functions are discussed. Section 3 treats the problem of the local field. In Section 4 we consider the special case of collision-induced light scattering by atomic fluids in the low-density limit. This allows us to focus on determining the interaction polarizability for simple gases. Finally, in Section 5 we distinguish between collision-induced and multiple light scattering, and discuss the double-light-scattering analyses which provide new information about critical and thermodynamically unstable fluids. (KBE)
Digital communication through intermolecular fluorescence modulation.
Raymo, F M; Giordani, S
2001-06-14
[see reaction]. Ultraminiaturized processors incorporating molecular components can be developed only after devising efficient strategies to communicate signals at the molecular level. We have demonstrated that a three-state molecular switch responds to ultraviolet light, visible light, and H+, attenuating the emission intensity of a fluorescent probe. Intermolecular communication is responsible for the transduction of three input signals into a single optical output. The behavior of the communicating ensemble of molecules corresponds to that of a logic circuit incorporating seven gates.
Directory of Open Access Journals (Sweden)
Wasinee Phonsri
2017-08-01
Full Text Available The structural and magnetic properties of a range of new iron(III bis-tridentate Schiff base complexes are described with emphasis on how intermolecular structural interactions influence spin states and spin crossover (SCO in these d5 materials. Three pairs of complexes were investigated. The first pair are the neutral, heteroleptic complexes [Fe(3-OMe-SalEen(thsa] 1 and [Fe(3-MeOSalEen(3-EtOthsa] 2, where 3-R-HSalEen = (E-2-(((2-(ethylaminoethyliminomethyl-6-R-phenol and 3-R-H2thsa = thiosemicarbazone-3-R-salicylaldimine. They display spin transitions above room temperature. However, 2 shows incomplete and gradual change, while SCO in 1 is complete and more abrupt. Lower cooperativity in 2 is ascribed to the lack of π–π interactions, compared to 1. The second pair, cationic species [Fe(3-EtOSalEen2]NO3 3 and [Fe(3-EtOSalEen2]Cl 4 differ only in the counter-anion. They show partial SCO above room temperature with 3 displaying a sharp transition at 343 K. Weak hydrogen bonds from cation to Cl− probably lead to weaker cooperativity in 4. The last pair, CsH2O[Fe(3-MeO-thsa2] 5 and Cs(H2O2[Fe(5-NO2-thsa2] 6, are anionic homoleptic chelates that have different substituents on the salicylaldiminate rings of thsa2−. The Cs cations bond to O atoms of water and the ligands, in unusual ways thus forming attractive 1D and 3D networks in 5 and 6, respectively, and 5 remains HS (high spin at all temperatures while 6 remains LS (low spin. Comparisons are made to other literature examples of Cs salts of [Fe(5-R-thsa2]− (R = H and Br.
Sutton, Christopher; Marshall, Michael S.; Sherrill, C. David; Risko, Chad; Bredas, Jean-Luc
2015-01-01
exchange-repulsion interactions among the phenyl side groups. Calculations based on available crystallographic structures reveal that planar conformations of the tetracene core in the solid state result from intermolecular interactions that can be tuned
Sangeetha, K.; Kumar, V. R. Suresh; Marchewka, M. K.; Binoy, J.
2018-05-01
Since, the intermolecular interactions play a crucial role in the formation of crystalline network, its analysis throws light on structure dependent crystalline properties. In the present study, DFT based vibrational spectral investigation has been performed in the stretching region (3500 cm-1 - 2800 cm-1) of IR and Raman spectra of melaminium chloride hemihydrates. The intermolecular interaction has been investigated by analyzing the half width of the OH and NH stretching profile of the deconvoluted spectra. Correlation of vibrational spectra with Hirshfeld surface analysis and finger print plot has been contemplated and molecular docking studies has been performed on melaminium chloride hemihydrate to assess its role in the drug transport mechanism and toxicity to human body.
Thz Spectroscopy and DFT Modeling of Intermolecular Vibrations in Hydrophobic Amino Acids
Williams, michael R. C.; Aschaffenburg, Daniel J.; Schmuttenmaer, Charles A.
2013-06-01
Vibrations that involve intermolecular displacements occur in molecular crystals at frequencies in the 0.5-5 THz range (˜15-165 cm^{-1}), and these motions are direct indicators of the interaction potential between the molecules. The intermolecular potential energy surface of crystalline hydrophobic amino acids is inherently interesting simply because of the wide variety of forces (electrostatic, dipole-dipole, hydrogen-bonding, van der Waals) that are present. Furthermore, an understanding of these particular interactions is immediately relevant to important topics like protein conformation and pharmaceutical polymorphism. We measured the low-frequency absorption spectra of several polycrystalline hydrophobic amino acids using THz time-domain spectroscopy, and in addition we carried out DFT calculations using periodic boundary conditions and an exchange-correlation functional that accounts for van der Waals dispersion forces. We chose to investigate a series of similar amino acids with closely analogous unit cells (leucine, isoleucine, and allo-isoleucine, in racemic or pseudo-racemic mixtures). This allows us to consider trends in the vibrational spectra as a function of small changes in molecular arrangement and/or crystal geometry. In this way, we gain confidence that peak assignments are not based on serendipitous similarities between calculated and observed features.
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Role of pn-pairs in nuclear structure
International Nuclear Information System (INIS)
Nie, G.K.
2003-01-01
An α-cluster model of nuclear structure based on power of proton + neutron (pn)-pairs to bind themselves to α-clusters is proposed. The α-cluster is taken as the perfect condition of coupling of 2 pn- pairs, reminding complete electron shell in atomic physics. Pn-pairs create 2 other types of coupling of considerably less power between pn-pairs of nearby α-clusters ε α c and between pn-pair not bound into α-cluster with pn-pairs of nearby cluster ε pn c . Last two types of coupling are called covalent because of reminding similar electron coupling in chemistry. According the model nucleus is a liquid drop consisting of molecules, which are α-clusters, tied by covalent coupling with those ones which are in close vicinity. Then in case of even-even nuclei spin of the nucleus has to be zero I=0 + as sum of spinless particles. In case of nucleus has some nucleons (i) in intermolecular space, I=Σj i ; with taking into account that there is coupling of p and n in pn-pair. Therefore for 6 Li (1=0)I=2·1/2=1 + . The values ε α c , ε pn c and binding energy of the pn-pair itself ε pn have been estimated from analysis of binding energy of nuclei 6 Li, 10 B and 12 C. With the values the binding energy of the other nuclei with N=Z up to 58 Cu have been described with difference between experimental values and model ones in average less than 0.4 MeV. The structure reveals some regular forms, in which every cluster has reduced amount of covalent coupling, 3 or 4, and free pn-pair has 6 covalent coupling with 3 nearby clusters pn-pairs. Then the magic numbers are supposed to be the matter of geometry, when total amount of covalent couplings is optimal (minimal for the amount of clusters), α- clusters are placed in the same fixed distant from center of mass. It means that protons of the clusters can be considered as belonging to one shell. In the cluster model single particle effects have to be considered as single particle binding in one of the surface
Intermolecular interaction potentials of the methane dimer from the local density approximation
International Nuclear Information System (INIS)
Chen Xiangrong; Bai Yulin; Zhu Jun; Yang Xiangdong
2004-01-01
The intermolecular interaction potentials of methane (CH 4 ) dimer are calculated within the density functional theory in the local density approximation (LDA). It is found that the calculated potentials have minima when the intermolecular distance of CH 4 dimer is about 7.0 a.u., which is in good agreement with the experiment. The depth of the potential is 0.017 eV. The results obtained by our LDA calculations seem to agree well with those obtained by MP2, MP3, and CCSD from the Moeller-Plesset and coupled cluster methods by Tsuzuki et al. and with the experimental data
Study of intermolecular interactions in binary mixtures of ethanol in methanol
Maharolkar, Aruna P.; Khirade, P. W.; Murugkar, A. G.
2016-05-01
Present paper deals with study of physicochemical properties like viscosity, density and refractive index for the binary mixtures of ethanol and methanol over the entire concentration range were measured at 298.15 K. The experimental data further used to determine the excess properties viz. excess molar volume, excess viscosity, excess molar refraction. The values of excess properties further fitted with Redlich-Kister (R-K Fit) equation to calculate the binary coefficients and standard deviation. The resulting excess parameters are used to indicate the presence of intermolecular interactions and strength of intermolecular interactions between the molecules in the binary mixtures. Excess parameters indicate structure making factor in the mixture predominates in the system.
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
Raschka, Sebastian; Wolf, Alex J; Bemister-Buffington, Joseph; Kuhn, Leslie A
2018-04-01
Understanding how proteins encode ligand specificity is fascinating and similar in importance to deciphering the genetic code. For protein-ligand recognition, the combination of an almost infinite variety of interfacial shapes and patterns of chemical groups makes the problem especially challenging. Here we analyze data across non-homologous proteins in complex with small biological ligands to address observations made in our inhibitor discovery projects: that proteins favor donating H-bonds to ligands and avoid using groups with both H-bond donor and acceptor capacity. The resulting clear and significant chemical group matching preferences elucidate the code for protein-native ligand binding, similar to the dominant patterns found in nucleic acid base-pairing. On average, 90% of the keto and carboxylate oxygens occurring in the biological ligands formed direct H-bonds to the protein. A two-fold preference was found for protein atoms to act as H-bond donors and ligand atoms to act as acceptors, and 76% of all intermolecular H-bonds involved an amine donor. Together, the tight chemical and geometric constraints associated with satisfying donor groups generate a hydrogen-bonding lock that can be matched only by ligands bearing the right acceptor-rich key. Measuring an index of H-bond preference based on the observed chemical trends proved sufficient to predict other protein-ligand complexes and can be used to guide molecular design. The resulting Hbind and Protein Recognition Index software packages are being made available for rigorously defining intermolecular H-bonds and measuring the extent to which H-bonding patterns in a given complex match the preference key.
Raschka, Sebastian; Wolf, Alex J.; Bemister-Buffington, Joseph; Kuhn, Leslie A.
2018-02-01
Understanding how proteins encode ligand specificity is fascinating and similar in importance to deciphering the genetic code. For protein-ligand recognition, the combination of an almost infinite variety of interfacial shapes and patterns of chemical groups makes the problem especially challenging. Here we analyze data across non-homologous proteins in complex with small biological ligands to address observations made in our inhibitor discovery projects: that proteins favor donating H-bonds to ligands and avoid using groups with both H-bond donor and acceptor capacity. The resulting clear and significant chemical group matching preferences elucidate the code for protein-native ligand binding, similar to the dominant patterns found in nucleic acid base-pairing. On average, 90% of the keto and carboxylate oxygens occurring in the biological ligands formed direct H-bonds to the protein. A two-fold preference was found for protein atoms to act as H-bond donors and ligand atoms to act as acceptors, and 76% of all intermolecular H-bonds involved an amine donor. Together, the tight chemical and geometric constraints associated with satisfying donor groups generate a hydrogen-bonding lock that can be matched only by ligands bearing the right acceptor-rich key. Measuring an index of H-bond preference based on the observed chemical trends proved sufficient to predict other protein-ligand complexes and can be used to guide molecular design. The resulting Hbind and Protein Recognition Index software packages are being made available for rigorously defining intermolecular H-bonds and measuring the extent to which H-bonding patterns in a given complex match the preference key.
Energy Technology Data Exchange (ETDEWEB)
Mokhtari, B.; Enayati, M. [Iranian Offshore Oil Co., Tehran (Iran, Islamic Republic of); Heidaryan, E. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Masjidosolayman Branch
2008-07-01
Theoretical methods show that crystalline hydrates can form from single-phase systems consisting of both vapor water with gaseous hydrate former and liquid water with dissolved hydrate former. Two phase systems consist of both liquid water with gaseous hydrate former and with liquid hydrate former on the surface. This paper presented a Langmuir constant related model for the prediction of equilibrium pressures and cage occupancies of pure component hydrates. Intermolecular potentials were fit to quantum mechanical energies to obtain the Langmuir constants, which differed from the procedure utilized with the vdWP model. The paper described the experimental method and model calculations. This included the Fugacity model and Van der Waals and Platteeuw model. The paper also discussed pair potential of non-spherical molecules, including the multicentre (site-site) potential; Gaussian overlap potential; Lennard-Jones potential; and Kihara generalized pair potential. It was concluded that fraction of occupied cavities is a function of pair potentials between hard core and empty hydrate lattice. These pair potentials could be calculated from some model as Kihara cell potential, Gaussian potential, Lennard-Jones potential and multicentre pair potential. 49 refs., 3 figs.
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
International Nuclear Information System (INIS)
Pham Van, Tat; Deiters, Ulrich K.
2015-01-01
Highlights: • We construct the angular orientations of dimers H 2 −H 2 and H 2 −O 2 . • We calculate the ab initio intermolecular interaction energies for all built orientations. • Extrapolating the interaction energies to the complete basis set limit aug-cc-pV23Z. • We develop two 5-site ab initio intermolecular potentials of dimers H 2 −H 2 , H 2 −O 2 . • Calculating the virial coefficients of dimer H 2 −H 2 and H 2 −O 2 . - Abstract: The intermolecular interaction potentials of the dimers H 2 −H 2 and H 2 −O 2 were calculated from quantum mechanics, using coupled-cluster theory CCSD(T) and correlation-consistent basis sets aug-cc-pVmZ (m = 2, 3); the results were extrapolated to the basis set limit aug-cc-pV23Z. The interaction energies were corrected for the basis set superposition error with the counterpoise scheme. For comparison also Møller–Plesset perturbation theory (at levels 2–4) with the basis sets aug-cc-pVTZ were considered, but the results proved inferior. The quantum mechanical results were used to construct analytical pair potential functions. From these functions the second virial coefficients of hydrogen and the cross virial coefficients of the hydrogen–oxygen system were obtained by integration; in both cases corrections for quantum effects were included. The results agree well with experimental data, if available, or with empirical correlations
DEFF Research Database (Denmark)
Jensen, Anders A.; Hansen, Jakob L; Sheikh, Søren P
2002-01-01
-induced intermolecular movements in the CaR homodimer using the new bioluminescence resonance energy transfer technique, BRET2, which is based on the transference of energy from Renilla luciferase (Rluc) to the green fluorescent protein mutant GFP2. We tagged CaR with Rluc and GFP2 at different intracellular locations...
Eichmann, Cédric; Orts, Julien; Tzitzilonis, Christos; Vögeli, Beat; Smrt, Sean; Lorieau, Justin; Riek, Roland
2014-12-11
The interaction between membrane proteins and lipids or lipid mimetics such as detergents is key for the three-dimensional structure and dynamics of membrane proteins. In NMR-based structural studies of membrane proteins, qualitative analysis of intermolecular nuclear Overhauser enhancements (NOEs) or paramagnetic resonance enhancement are used in general to identify the transmembrane segments of a membrane protein. Here, we employed a quantitative characterization of intermolecular NOEs between (1)H of the detergent and (1)H(N) of (2)H-perdeuterated, (15)N-labeled α-helical membrane protein-detergent complexes following the exact NOE (eNOE) approach. Structural considerations suggest that these intermolecular NOEs should show a helical-wheel-type behavior along a transmembrane helix or a membrane-attached helix within a membrane protein as experimentally demonstrated for the complete influenza hemagglutinin fusion domain HAfp23. The partial absence of such a NOE pattern along the amino acid sequence as shown for a truncated variant of HAfp23 and for the Escherichia coli inner membrane protein YidH indicates the presence of large tertiary structure fluctuations such as an opening between helices or the presence of large rotational dynamics of the helices. Detergent-protein NOEs thus appear to be a straightforward probe for a qualitative characterization of structural and dynamical properties of membrane proteins embedded in detergent micelles.
Modeling Adsorption-Desorption Processes at the Intermolecular Interactions Level
Varfolomeeva, Vera V.; Terentev, Alexey V.
2018-01-01
Modeling of the surface adsorption and desorption processes, as well as the diffusion, are of considerable interest for the physical phenomenon under study in ground tests conditions. When imitating physical processes and phenomena, it is important to choose the correct parameters to describe the adsorption of gases and the formation of films on the structural materials surface. In the present research the adsorption-desorption processes on the gas-solid interface are modeled with allowance for diffusion. Approaches are proposed to describe the adsorbate distribution on the solid body surface at the intermolecular interactions level. The potentials of the intermolecular interaction of water-water, water-methane and methane-methane were used to adequately modeling the real physical and chemical processes. The energies calculated by the B3LYP/aug-cc-pVDZ method. Computational algorithms for determining the average molecule area in a dense monolayer, are considered here. Differences in modeling approaches are also given: that of the proposed in this work and the previously approved probabilistic cellular automaton (PCA) method. It has been shown that the main difference is due to certain limitations of the PCA method. The importance of accounting the intermolecular interactions via hydrogen bonding has been indicated. Further development of the adsorption-desorption processes modeling will allow to find the conditions for of surface processes regulation by means of quantity adsorbed molecules control. The proposed approach to representing the molecular system significantly shortens the calculation time in comparison with the use of atom-atom potentials. In the future, this will allow to modeling the multilayer adsorption at a reasonable computational cost.
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
Sutton, Christopher
2015-06-15
Rubrene is one of the most studied molecular semiconductors; its chemical structure consists of a tetracene backbone with four phenyl rings appended to the two central fused rings. Derivatization of these phenyl rings can lead to two very different solid-state molecular conformations and packings: One in which the tetracene core is planar and there exists substantive overlap among neighboring π-conjugated backbones; and another where the tetracene core is twisted and the overlap of neighboring π-conjugated backbones is completely disrupted. State-of-the-art electronic-structure calculations show for all isolated rubrene derivatives that the twisted conformation is more favorable (by -1.7 to -4.1 kcal mol-1), which is a consequence of energetically unfavorable exchange-repulsion interactions among the phenyl side groups. Calculations based on available crystallographic structures reveal that planar conformations of the tetracene core in the solid state result from intermolecular interactions that can be tuned through well-chosen functionalization of the phenyl side groups, and lead to improved intermolecular electronic couplings. Understanding the interplay of these intramolecular and intermolecular interactions provides insight into how to chemically modify rubrene and similar molecular semiconductors to improve the intrinsic materials electronic properties.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
Asada, Naoya; Fedorov, Dmitri G.; Kitaura, Kazuo; Nakanishi, Isao; Merz, Kenneth M.
2012-01-01
We propose an approach based on the overlapping multicenter ONIOM to evaluate intermolecular interaction energies in large systems and demonstrate its accuracy on several representative systems in the complete basis set limit at the MP2 and CCSD(T) level of theory. In the application to the intermolecular interaction energy between insulin dimer and 4′-hydroxyacetanilide at the MP2/CBS level, we use the fragment molecular orbital method for the calculation of the entire complex assigned to the lowest layer in three-layer ONIOM. The developed method is shown to be efficient and accurate in the evaluation of the protein-ligand interaction energies. PMID:23050059
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Li, An Yong
2007-04-21
Upon formation of a H bond Y...H-XZ, intramolecular hyperconjugation n(Z)-->sigma*(X-H) of the proton donor plays a key role in red- and blueshift characters of H bonds and must be introduced in the concepts of hyperconjugation and rehybridization. Intermolecular hyperconjugation transfers electron density from Y to sigma*(X-H) and causes elongation and stretch frequency redshift of the X-H bond; intramolecular hyperconjugation couples with intermolecular hyperconjugation and can adjust electron density in sigma*(X-H); rehybridization causes contraction and stretch frequency blueshift of the X-H bond on complexation. The three factors--intra- and intermolecular hyperconjugations and rehybridization--determine commonly red- or blueshift of the formed H bond. A proton donor that has strong intramolecular hyperconjugation often forms blueshifted H bonds.
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Binoy, J.; Prathima, N. B.; Murali Krishna, C.; Santhosh, C.; Hubert Joe, I.; Jayakumar, V. S.
2006-08-01
Acetanilide, a compound of pharmaceutical importance possessing pain-relieving properties due to its blocking the pulse dissipating along the nerve fiber, is subjected to vibrational spectral investigation using NIR FT Raman, FT-IR, and SERS. The geometry, Mulliken charges, and vibrational spectrum of acetanilide have been computed using the Hartree-Fock theory and density functional theory employing the 6-31G (d) basis set. To investigate the influence of intermolecular amide hydrogen bonding, the geometry, charge distribution, and vibrational spectrum of the acetanilide dimer have been computed at the HF/6-31G (d) level. The computed geometries reveal that the acetanilide molecule is planar, while twisting of the secondary amide group with respect to the phenyl ring is found upon hydrogen bonding. The trans isomerism and “amido” form of the secondary amide, hyperconjugation of the C=O group with the adjacent C-C bond, and donor-acceptor interaction have been investigated using computed geometry. The carbonyl stretching band position is found to be influenced by the tendency of the phenyl ring to withdraw nitrogen lone pair, intermolecular hydrogen bonding, conjugation, and hyperconjugation. A decrease in the NH and C=O bond orders and increase in the C-N bond orders due to donor-acceptor interaction can be observed in the vibrational spectra. The SERS spectral analysis reveals that the flat orientation of the molecule on the adsorption plane is preferred.
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Zhang, Rui; Guo, Jing; Liu, Yuanfa; Chen, Shuang; Zhang, Sen; Yu, Yue
2018-06-01
Sodium alginate (SA) and antarctic krill protein (AKP) were blended to fabricate the SA/AKP composite fibers by the conventional wet spinning method using 5% CaCl 2 as coagulation solution. The sodium salt was added to the SA/AKP solution to adjust the ionization degree and intermolecular interaction of composite system. The main purpose of this study is to investigate the influences of sodium salt types (NaCl, CH 3 COONa, Na 2 SO 4 ) on the intermolecular interaction of SA/AKP composite fibers. The intermolecular interaction, morphology, crystallinity, thermal stability and mechanical properties of SA/AKP composite fibers were analyzed by fourier transform infrared spectroscopy (FT-IR), scanning electron microscope (SEM), x-ray diffraction (XRD), thermogravimetric analysis (TGA). The results show that the types of sodium salt have obvious influences on the content of both β-sheet, intermolecular hydrogen bond, breaking strength and surface morphology in SA/AKP composite fibers, but have a negligible effect on the crystallinity and thermal stability. Copyright © 2018 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Liu, Xiaochun; Yin, Hang; Li, Hui; Shi, Ying
2017-04-01
DFT and TDDFT methods were carried out to investigate the influences of intramolecular and intermolecular hydrogen bonding on excited state charge transfer for coumarin 343 (C343). Intramolecular hydrogen bonding is formed between carboxylic acid group and carbonyl group in C343 monomer. However, in dimethylsulfoxide (DMSO) solution, DMSO 'opens up' the intramolecular hydrogen bonding and forms solute-solvent intermolecular hydrogen bonded C343-DMSO complex. Analysis of frontier molecular orbitals reveals that intramolecular charge transfer (ICT) occurs in the first excited state both for C343 monomer and complex. The results of optimized geometric structures indicate that the intramolecular hydrogen bonding interaction is strengthened while the intermolecular hydrogen bonding is weakened in excited state, which is confirmed again by monitoring the shifts of characteristic peaks of infrared spectra. We demonstrated that DMSO solvent can not only break the intramolecular hydrogen bonding to form intermolecular hydrogen bonding with C343 but also alter the mechanism of excited state hydrogen bonding strengthening.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Çırak, Çağrı; Sert, Yusuf; Ucun, Fatih
2013-09-01
In the present work, the experimental and theoretical vibrational spectra of 4-chlorobenzothioamide were investigated. The FT-IR (400-4000 cm-1) and μ-Raman spectra (100-4000 cm-1) of 4-chlorobenzothioamide in the solid phase were recorded. The geometric parameters (bond lengths and bond angles), vibrational frequencies, Infrared and Raman intensities of the title molecule in the ground state were calculated using ab initio Hartree-Fock and density functional theory (B3LYP) methods with the 6-311++G(d,p) basis set for the first time. The optimized geometric parameters and the theoretical vibrational frequencies were found to be in good agreement with the corresponding experimental data and with the results found in the literature. The vibrational frequencies were assigned based on the potential energy distribution using the VEDA 4 program. The dimeric form of 4-chlorobenzothioamide was also simulated to evaluate the effect of intermolecular hydrogen bonding on the vibrational frequencies. It was observed that the Nsbnd H stretching modes shifted to lower frequencies, while the in-plane and out-of-plane bending modes shifted to higher frequencies due to the intermolecular Nsbnd H⋯S hydrogen bond. Also, the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies and diagrams were presented.
Directory of Open Access Journals (Sweden)
Jiufang Duan
2015-01-01
Full Text Available A novel cellulose-chitosan gel was successfully prepared in three steps: (1 ferrocene- (Fc- cellulose with degrees of substitution (DS of 0.5 wt% was synthesised by ferrocenecarboxylic acid and cellulose within dimethylacetamide/lithium chloride (DMAc/LiCl; (2 the β-cyclodextrin (β-CD groups were introduced onto the chitosan chains by reacting chitosan with epichlorohydrin in dimethyl sulphoxide and a DS of 0.35 wt%; (3 thus, the cellulose-chitosan gel was obtained via an intermolecular inclusion interaction of Fc-cellulose and β-CD-chitosan in DMA/LiCl, that is, by an intermolecular inclusion interaction, between the Fc groups of cellulose and the β-CD groups on the chitosan backbone at room temperature. The successful synthesis of Fc-cellulose and β-CD-chitosan was characterised by 13C-NMR spectroscopy. The gel based on β-CD-chitosan and Fc-cellulose was formed under mild conditions which can engender autonomous healing between cut surfaces after 24 hours: the gel cannot self-heal while the cut surfaces were coated with a solution of a competitive guest (adamantane acid. The cellulose-chitosan complex made by this method underwent self-healing. Therefore, this study provided a novel method of expanding the application of chitosan by binding it with another polymer.
Connecting Protein Structure to Intermolecular Interactions: A Computer Modeling Laboratory
Abualia, Mohammed; Schroeder, Lianne; Garcia, Megan; Daubenmire, Patrick L.; Wink, Donald J.; Clark, Ginevra A.
2016-01-01
An understanding of protein folding relies on a solid foundation of a number of critical chemical concepts, such as molecular structure, intra-/intermolecular interactions, and relating structure to function. Recent reports show that students struggle on all levels to achieve these understandings and use them in meaningful ways. Further, several…
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Alkorta, Ibon; Elguero, José; Elguero, Eric
2017-11-01
1125 X-ray structures of nitroxide free radicals presenting intermolecular hydrogen bonds have been reported in the Cambridge Structural Database. We will report in this paper a qualitative and quantitative analysis of these bonds. The observation in some plots of an excluded region was statistically analyzed using convex hull and kernel smooting methodologies. A theoretical study at the MP2 level with different basis has been carried out indicating that the nitronyl nitroxide radicals (five electrons) lie just in between nitroso compounds (four electrons) and amine N-oxides (six electrons) as far as hydrogen-bond basicity is concerned.
A Method to Predict the Structure and Stability of RNA/RNA Complexes.
Xu, Xiaojun; Chen, Shi-Jie
2016-01-01
RNA/RNA interactions are essential for genomic RNA dimerization and regulation of gene expression. Intermolecular loop-loop base pairing is a widespread and functionally important tertiary structure motif in RNA machinery. However, computational prediction of intermolecular loop-loop base pairing is challenged by the entropy and free energy calculation due to the conformational constraint and the intermolecular interactions. In this chapter, we describe a recently developed statistical mechanics-based method for the prediction of RNA/RNA complex structures and stabilities. The method is based on the virtual bond RNA folding model (Vfold). The main emphasis in the method is placed on the evaluation of the entropy and free energy for the loops, especially tertiary kissing loops. The method also uses recursive partition function calculations and two-step screening algorithm for large, complicated structures of RNA/RNA complexes. As case studies, we use the HIV-1 Mal dimer and the siRNA/HIV-1 mutant (T4) to illustrate the method.
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Energy Technology Data Exchange (ETDEWEB)
Azar, Richard Julian, E-mail: julianazar2323@berkeley.edu; Head-Gordon, Martin, E-mail: mhg@cchem.berkeley.edu [Kenneth S. Pitzer Center for Theoretical Chemistry, Department of Chemistry, University of California and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)
2015-05-28
Your correspondents develop and apply fully nonorthogonal, local-reference perturbation theories describing non-covalent interactions. Our formulations are based on a Löwdin partitioning of the similarity-transformed Hamiltonian into a zeroth-order intramonomer piece (taking local CCSD solutions as its zeroth-order eigenfunction) plus a first-order piece coupling the fragments. If considerations are limited to a single molecule, the proposed intermolecular similarity-transformed perturbation theory represents a frozen-orbital variant of the “(2)”-type theories shown to be competitive with CCSD(T) and of similar cost if all terms are retained. Different restrictions on the zeroth- and first-order amplitudes are explored in the context of large-computation tractability and elucidation of non-local effects in the space of singles and doubles. To accurately approximate CCSD intermolecular interaction energies, a quadratically growing number of variables must be included at zeroth-order.
Kurnosov, Alexander; Cacciatore, Mario; Laganà, Antonio; Pirani, Fernando; Bartolomei, Massimiliano; Garcia, Ernesto
2014-04-05
The rate coefficients for N2-N2 collision-induced vibrational energy exchange (important for the enhancement of several modern innovative technologies) have been computed over a wide range of temperature. Potential energy surfaces based on different formulations of the intramolecular and intermolecular components of the interaction have been used to compute quasiclassically and semiclassically some vibrational to vibrational energy transfer rate coefficients. Related outcomes have been rationalized in terms of state-to-state probabilities and cross sections for quasi-resonant transitions and deexcitations from the first excited vibrational level (for which experimental information are available). On this ground, it has been possible to spot critical differences on the vibrational energy exchange mechanisms supported by the different surfaces (mainly by their intermolecular components) in the low collision energy regime, though still effective for temperatures as high as 10,000 K. It was found, in particular, that the most recently proposed intermolecular potential becomes the most effective in promoting vibrational energy exchange near threshold temperatures and has a behavior opposite to the previously proposed one when varying the coupling of vibration with the other degrees of freedom. Copyright © 2014 Wiley Periodicals, Inc.
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Effect of donor orientation on ultrafast intermolecular electron transfer in coumarin-amine systems
International Nuclear Information System (INIS)
Singh, P. K.; Nath, S.; Bhasikuttan, A. C.; Kumbhakar, M.; Mohanty, J.; Sarkar, S. K.; Mukherjee, T.; Pal, H.
2008-01-01
Effect of donor amine orientation on nondiffusive ultrafast intermolecular electron transfer (ET) reactions in coumarin-amine systems has been investigated using femtosecond fluorescence upconversion measurements. Intermolecular ET from different aromatic and aliphatic amines used as donor solvents to the excited coumarin-151 (C151) acceptor occurs with ultrafast rates such that the shortest fluorescence lifetime component (τ 1 ) is the measure of the fastest ET rate (τ 1 =τ ET fast =(k ET fast ) -1 ), assigned to the C151-amine contact pairs in which amine donors are properly oriented with respect to C151 to maximize the acceptor-donor electronic coupling (V el ). It is interestingly observed that as the amine solvents are diluted by suitable diluents (either keeping solvent dielectric constant similar or with increasing dielectric constant), the τ 1 remains almost in the similar range as long as the amine dilution does not cross a certain critical limit, which in terms of the amine mole fraction (x A ) is found to be ∼0.4 for aromatic amines and ∼0.8 for aliphatic amines. Beyond these dilutions in the two respective cases of the amine systems, the τ 1 values are seen to increase very sharply. The large difference in the critical x A values involving aromatic and aliphatic amine donors has been rationalized in terms of the largely different orientational restrictions for the ET reactions as imposed by the aliphatic (n-type) and aromatic (π-type) nature of the amine donors [A. K. Satpati et al., J. Mol. Struct. 878, 84 (2008)]. Since the highest occupied molecular orbital (HOMO) of the n-type aliphatic amines is mostly centralized at the amino nitrogen, only some specific orientations of these amines with respect to the close-contact acceptor dye [also of π-character; A. K. Satpati et al., J. Mol. Struct. 878, 84 (2008) and E. W. Castner et al., J. Phys. Chem. A 104, 2869 (2000)] can give suitable V el and thus ultrafast ET reaction. In contrary, the
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
Glazier, Samantha; Marano, Nadia; Eisen, Laura
2010-01-01
We describe how we use boiling-point trends of group IV-VII hydrides to introduce intermolecular forces in our first-year general chemistry classes. Starting with the idea that molecules in the liquid state are held together by some kind of force that must be overcome for boiling to take place, students use data analysis and critical reasoning to…
El-Kader, M. S. A.; Godet, J.-L.; Gustafsson, M.; Maroulis, G.
2018-04-01
Quantum mechanical lineshapes of collision-induced absorption (CIA), collision-induced light scattering (CILS) and collision-induced hyper-Rayleigh scattering (CIHR) at room temperature (295 K) are computed for gaseous mixtures of molecular hydrogen with neon, krypton and xenon. The induced spectra are detected using theoretical values for induced dipole moment, pair-polarizability trace and anisotropy, hyper-polarizability and updated intermolecular potentials. Good agreement is observed for all spectra when the literature and the present potentials which are constructed from the transport and thermo-physical properties are used.
Catalytic Intermolecular Cross-Couplings of Azides and LUMO-Activated Unsaturated Acyl Azoliums
Li, Wenjun; Ajitha, Manjaly John; Lang, Ming; Huang, Kuo-Wei; Wang, Jian
2017-01-01
An example for the catalytic synthesis of densely functionalized 1,2,3-triazoles through a LUMO activation mode has been developed. The protocol is enabled by intermolecular cross coupling reactions of azides with in situ-generated alpha
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The effect of strong intermolecular and chemical interactions on the compatibility of polymers
International Nuclear Information System (INIS)
Askadskii, Andrei A
1999-01-01
The data on compatibility and on the properties of polymer blends are generalised. The emphasis is placed on the formation of strong intermolecular interactions (dipole-dipole interaction and hydrogen bonding) between the components of blends, as well as on the chemical reactions between them. A criterion for the prediction of compatibility of polymers is described in detail. Different cases of compatibility are considered and the dependences of the glass transition temperatures on the composition of blends are analysed. The published data on the effect of strong intermolecular interactions between the blend components on the glass transition temperature are considered. The preparation of interpolymers is described whose macromolecules are composed of incompatible polymers, which leads to the so-called 'forced compatibility.' The bibliography includes 80 references.
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
Sutton, Christopher
2015-10-30
Noncovalent intermolecular interactions, which can be tuned through the toolbox of synthetic chemistry, determine not only the molecular packing but also the resulting electronic, optical, and mechanical properties of materials derived from π-conjugated molecules, oligomers, and polymers. Here, we provide an overview of the theoretical underpinnings of noncovalent intermolecular interactions and briefly discuss the computational chemistry approaches used to understand the magnitude of these interactions. These methodologies are then exploited to illustrate how noncovalent intermolecular interactions impact important electronic properties-such as the electronic coupling between adjacent molecules, a key parameter for charge-carrier transport-through a comparison between the prototype organic semiconductor pentacene with a series of N-substituted heteropentacenes. Incorporating an understanding of these interactions into the design of organic semiconductors can assist in developing novel materials systems from this fascinating molecular class. © 2015 American Chemical Society.
MAu2GeS4-Chalcogel (M = Co, Ni): Heterogeneous Intra- and Intermolecular Hydroamination Catalysts
Davaasuren, Bambar
2017-08-08
High surface area macroporous chalcogenide aerogels (chalcogels) MAu2GeS4 (M = Co, Ni) were prepared from K2Au2GeS4 precursor and Co(OAc)2 or NiCl2 by one-pot sol-gel metathesis reactions in aqueous media. The MAu2GeS4-chalcogels were screened for catalytic intramolecular hydroamination of 4-pentyn-1-amine substrate at different temperatures. 87% and 58% conversion was achieved at 100 °C, using CoAu2GeS4- and NiAu2GeS4-chalcogels respectively, and the reaction kinetics follows the first order. It was established that the catalytic performance of the aerogels is associated with the M(2+) centers present in the structure. Intermolecular hydroamination of aniline with 1-R-4-ethynylbenzene (R = -H, -OCH3, -Br, -F) was carried out at 100 °C using CoAu2GeS4-chalcogel catalyst, due to its promising catalytic performance. The CoAu2GeS4-chalcogel regioselectively converted the pair of substrates to respective Markovnikov products, (E)-1-(4-R-phenyl)-N-phenylethan-1-imine, with 38% to 60% conversion.
MAu2GeS4-Chalcogel (M = Co, Ni): Heterogeneous Intra- and Intermolecular Hydroamination Catalysts
Davaasuren, Bambar; Emwas, Abdul-Hamid M.; Rothenberger, Alexander
2017-01-01
High surface area macroporous chalcogenide aerogels (chalcogels) MAu2GeS4 (M = Co, Ni) were prepared from K2Au2GeS4 precursor and Co(OAc)2 or NiCl2 by one-pot sol-gel metathesis reactions in aqueous media. The MAu2GeS4-chalcogels were screened for catalytic intramolecular hydroamination of 4-pentyn-1-amine substrate at different temperatures. 87% and 58% conversion was achieved at 100 °C, using CoAu2GeS4- and NiAu2GeS4-chalcogels respectively, and the reaction kinetics follows the first order. It was established that the catalytic performance of the aerogels is associated with the M(2+) centers present in the structure. Intermolecular hydroamination of aniline with 1-R-4-ethynylbenzene (R = -H, -OCH3, -Br, -F) was carried out at 100 °C using CoAu2GeS4-chalcogel catalyst, due to its promising catalytic performance. The CoAu2GeS4-chalcogel regioselectively converted the pair of substrates to respective Markovnikov products, (E)-1-(4-R-phenyl)-N-phenylethan-1-imine, with 38% to 60% conversion.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Quantitative analysis of intermolecular interactions in orthorhombic rubrene
Directory of Open Access Journals (Sweden)
Venkatesha R. Hathwar
2015-09-01
Full Text Available Rubrene is one of the most studied organic semiconductors to date due to its high charge carrier mobility which makes it a potentially applicable compound in modern electronic devices. Previous electronic device characterizations and first principles theoretical calculations assigned the semiconducting properties of rubrene to the presence of a large overlap of the extended π-conjugated core between molecules. We present here the electron density distribution in rubrene at 20 K and at 100 K obtained using a combination of high-resolution X-ray and neutron diffraction data. The topology of the electron density and energies of intermolecular interactions are studied quantitatively. Specifically, the presence of Cπ...Cπ interactions between neighbouring tetracene backbones of the rubrene molecules is experimentally confirmed from a topological analysis of the electron density, Non-Covalent Interaction (NCI analysis and the calculated interaction energy of molecular dimers. A significant contribution to the lattice energy of the crystal is provided by H—H interactions. The electron density features of H—H bonding, and the interaction energy of molecular dimers connected by H—H interaction clearly demonstrate an importance of these weak interactions in the stabilization of the crystal structure. The quantitative nature of the intermolecular interactions is virtually unchanged between 20 K and 100 K suggesting that any changes in carrier transport at these low temperatures would have a different origin. The obtained experimental results are further supported by theoretical calculations.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls
Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David
2015-01-01
International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.
Energy Technology Data Exchange (ETDEWEB)
Daneshfar, Nader, E-mail: ndaneshfar@gmail.com, E-mail: ndaneshfar@razi.ac.ir; Yavari, Asghar [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)
2016-05-15
Our model is applied to the calculation of interaction energy between a pair of dipolar molecules (point dipoles) in the vicinity of a nanoshell monomer with core-shell structure, based on the dipole quasi-electrostatic theory of classical electrodynamics and using the Drude and Maxwell-Garnett model. In other words, this work discusses the intermolecular energy transfer from a donor molecule to an acceptor molecule near a spherical nanoparticle that is important for practical applications like sensing. It is shown that the proximity of plasmonic nanoparticles can have a strong effect on the energy transfer between molecules. In addition to the influence of the size, composition, embedding medium, and the filling fraction of doped particles on the interaction energy, the contribution of the dipolar, quadrupolar, octupolar, hexadecapolar, triakontadipolar, and higher order multipole interactions is presented and analyzed. Briefly, we will show that it is possible to achieve enhanced energy transfer by manipulation of different parameters as mentioned above.
Intermolecular cope-type hydroamination of alkenes and alkynes using hydroxylamines.
Moran, Joseph; Gorelsky, Serge I; Dimitrijevic, Elena; Lebrun, Marie-Eve; Bédard, Anne-Catherine; Séguin, Catherine; Beauchemin, André M
2008-12-31
The development of the Cope-type hydroamination as a method for the metal- and acid-free intermolecular hydroamination of hydroxylamines with alkenes and alkynes is described. Aqueous hydroxylamine reacts efficiently with alkynes in a Markovnikov fashion to give oximes and with strained alkenes to give N-alkylhydroxylamines, while unstrained alkenes are more challenging. N-Alkylhydroxylamines also display similar reactivity with strained alkenes and give modest to good yields with vinylarenes. Electron-rich vinylarenes lead to branched products while electron-deficient vinylarenes give linear products. A beneficial additive effect is observed with sodium cyanoborohydride, the extent of which is dependent on the structure of the hydroxylamine. The reaction conditions are found to be compatible with common protecting groups, free OH and NH bonds, as well as bromoarenes. Both experimental and theoretical results suggest the proton transfer step of the N-oxide intermediate is of vital importance in the intermolecular reactions of alkenes. Details are disclosed concerning optimization, reaction scope, limitations, and theoretical analysis by DFT, which includes a detailed molecular orbital description for the concerted hydroamination process and an exhaustive set of calculated potential energy surfaces for the reactions of various alkenes, alkynes, and hydroxylamines.
Chen, Yu-Chun; Tang, Ping-Han; Wu, Ten-Ming
2013-11-28
By exploiting the instantaneous normal mode (INM) analysis for models of flexible molecules, we investigate intermolecular and intramolecular vibrations of water from the atomic point of view. With two flexible SPC/E models, our investigations include three aspects about their INM spectra, which are separated into the unstable, intermolecular, bending, and stretching bands. First, the O- and H-atom contributions in the four INM bands are calculated and their stable INM spectra are compared with the power spectra of the atomic velocity autocorrelation functions. The unstable and intermolecular bands of the flexible models are also compared with those of the SPC/E model of rigid molecules. Second, we formulate the inverse participation ratio (IPR) of the INMs, respectively, for the O- and H-atom and molecule. With the IPRs, the numbers of the three species participated in the INMs are estimated so that the localization characters of the INMs in each band are studied. Further, by the ratio of the IPR of the H atom to that of the O atom, we explore the number of involved OH bond per molecule participated in the INMs. Third, by classifying simulated molecules into subensembles according to the geometry of their local environments or their H-bond configurations, we examine the local-structure effects on the bending and stretching INM bands. All of our results are verified to be insensible to the definition of H-bond. Our conclusions about the intermolecular and intramolecular vibrations in water are given.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Highly Stereoselective Intermolecular Haloetherification and Haloesterification of Allyl Amides
Soltanzadeh, Bardia; Jaganathan, Arvind; Staples, Richard J.
2016-01-01
An organocatalytic and highly regio-, diastereo-, and enantioselective intermolecular haloetherification and haloesterification reaction of allyl amides is reported. A variety of alkene substituents and substitution patterns are compatible with this chemistry. Notably, electronically unbiased alkene substrates exhibit exquisite regio- and diastereoselectivity for the title transformation. We also demonstrate that the same catalytic system can be used in both chlorination and bromination reactions of allyl amides with a variety of nucleophiles with little or no modification. PMID:26110812
DEFF Research Database (Denmark)
Hansen, Flemming Yssing; Alldredge, G. P.; Bruch, L. W.
1985-01-01
and gives a repulsive rather than an attractive electrostatic interaction at typical intermolecular distances. In the local multipole model, the atom-site dipoles give the largest contribution to both the molecular quadrupole moment and the intermolecular interaction. The Journal of Chemical Physics...
Houjou, Hirohiko
2011-10-01
Using theory of harmonic normal-mode vibration analysis, we developed a procedure for evaluating the anisotropic stiffness of intermolecular forces. Our scheme for coarse-graining of molecular motions is modified so as to account for intramolecular vibrations in addition to relative translational/rotational displacement. We applied this new analytical scheme to four carboxylic acid dimers, for which coupling between intra- and intermolecular vibrations is crucial for determining the apparent stiffness of the intermolecular double hydrogen bond. The apparent stiffness constant was analyzed on the basis of a conjunct spring model, which defines contributions from true intermolecular stiffness and molecular internal stiffness. Consequently, the true intermolecular stiffness was in the range of 43-48 N m-1 for all carboxylic acids studied, regardless of the molecules' acidity. We concluded that the difference in the apparent stiffness can be attributed to differences in the internal stiffness of the respective molecules.
Energy Technology Data Exchange (ETDEWEB)
Xantheas, Sotiris S.
2004-05-01
The modeling of the macroscopic properties of homogeneous and inhomogeneous systems via atomistic simulations such as molecular dynamics (MD) or Monte Carlo (MC) techniques is based on the accurate description of the relevant solvent-solute and solvent-solvent intermolecular interactions. The total energy (U) of an n-body molecular system can be formally written as [1,2,3
Analysis of intermolecular RNA-RNA recombination by rubella virus
International Nuclear Information System (INIS)
Adams, Sandra D.; Tzeng, W.-P.; Chen, M.-H.; Frey, Teryl K.
2003-01-01
To investigate whether rubella virus (RUB) undergoes intermolecular RNA-RNA recombination, cells were cotransfected with pairs of in vitro transcripts from genomic cDNA plasmid vectors engineered to contain nonoverlapping deletions: the replicative transcript maintained the 5'-proximal nonstructural (NS) ORF (which contained the replicase, making it RNA replication competent), had a deletion in the 3'-proximal structural protein (SP) ORF, and maintained the 3' end of the genome, including the putative 3' cis-acting elements (CSE), while the nonreplicative transcript consisted of the 3' half of the genome including the SP-ORF and 3' CSE. Cotransfection yielded plaque-forming virus that synthesized the standard genomic and subgenomic RNAs and thus was generated by RNA-RNA recombination. Using transcripts tagged with a 3'-terminal deletion, it was found that recombinants contained the 3' end derived from the replicative strand, indicating a cis-preference for initiation of negative-strand synthesis. In cotransfections in which the replicative transcript lacked the 3' CSE, recombination occurred, albeit at lower efficiency, indicating that initiation in trans from the NS-ORF can occur. The 3' CSE was sufficient as a nonreplicative transcript, showing that it can serve as a promoter for negative-strand RNA synthesis. While deletion mutagenesis showed that the presence of the junction untranslated region (J-UTR) between the ORFs appeared to be necessary on both transcripts for recombination in this region of the genome, analysis with transcripts tagged with restriction sites showed that the J-UTR was not a hot spot for recombination compared to neighboring regions in both ORFs. Sequence analysis of recombinants revealed that both precise (homologous) and imprecise recombination (aberrant, homologous resulting in duplications) occurred; however, imprecise recombination only involved the J-UTR or the 3' end of the NS-ORF and the J-UTR (maintaining the NS-ORF), indicating
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Liepinsh, Edvards; Sodano, Patrick; Tassin, Severine; Marion, Didier; Vovelle, Francoise; Otting, Gottfried
1999-01-01
Intermolecular nuclear Overhauser effects (NOEs) were measured between the protons of various small solvent or gas molecules and the non-specific lipid transfer protein (ns-LTP) from wheat. Intermolecular NOEs were observed with the hydrophobic pocket in the interior of wheat ns-LTP, which grew in intensity in the order cyclopropane (saturated solution) < methane (140 bar) < ethane (40 bar) < acetonitrile (5% in water) < cyclohexane (saturated solution) < benzene (saturated solution). No intermolecular NOEs were observed with dioxane (5% in water). The intermolecular NOEs were negative for all of the organic molecules tested. Intermolecular NOEs between wheat ns-LTP and water were weak or could not be distinguished from exchange-relayed NOEs. As illustrated by the NOEs with cyclohexane versus dioxane, the hydrophobic pocket in wheat ns-LTP preferably binds non-polar molecules. Yet, polar molecules like acetonitrile can also be accommodated. The pressure dependence of the NOEs between methane and wheat ns-LTP indicated incomplete occupancy, even at 190 bar methane pressure. In general, NOE intensities increased with the size of the ligand molecule and its vapor pressure. NMR of the vapor phase showed excellent resolution between the signals from the gas phase and those from the liquid phase. The vapor concentration of cyclohexane was fivefold higher than that of the dioxane solution, supporting the binding of cyclohexane versus uptake of dioxane
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Time series regression-based pairs trading in the Korean equities market
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Çırak, Çağrı; Sert, Yusuf; Ucun, Fatih
2014-06-01
In the present work, the experimental and theoretical vibrational spectra of 5-hydroxymethyluracil were investigated. The FT-IR (4000-400 cm-1) spectrum of the molecule in the solid phase was recorded. The geometric parameters (bond lengths and bond angles), vibrational frequencies, Infrared intensities of the title molecule in the ground state were calculated using density functional B3LYP and M06-2X methods with the 6-311++G(d,p) basis set for the first time. The optimized geometric parameters and theoretical vibrational frequencies were found to be in good agreement with the corresponding experimental data, and with the results found in the literature. The vibrational frequencies were assigned based on the potential energy distribution using the VEDA 4 program. The dimeric form of 5-hydroxymethyluracil molecule was also simulated to evaluate the effect of intermolecular hydrogen bonding on its vibrational frequencies. It was observed that the Nsbnd H stretching modes shifted to lower frequencies, while its in-plane and out-of-plane bending modes shifted to higher frequencies due to the intermolecular Nsbnd H⋯O hydrogen bond. Also, the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies and diagrams were presented.
Prediction of plant promoters based on hexamers and random triplet pair analysis
Directory of Open Access Journals (Sweden)
Noman Nasimul
2011-06-01
Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Dolan, Nicholas S; Scamp, Ryan J; Yang, Tzuhsiung; Berry, John F; Schomaker, Jennifer M
2016-11-09
The development of new catalysts for selective nitrene transfer is a continuing area of interest. In particular, the ability to control the chemoselectivity of intermolecular reactions in the presence of multiple reactive sites has been a long-standing challenge in the field. In this paper, we demonstrate examples of silver-catalyzed, nondirected, intermolecular nitrene transfer reactions that are both chemoselective and flexible for aziridination or C-H insertion, depending on the choice of ligand. Experimental probes present a puzzling picture of the mechanistic details of the pathways mediated by [( t Bu 3 tpy)AgOTf] 2 and (tpa)AgOTf. Computational studies elucidate these subtleties and provide guidance for the future development of new catalysts exhibiting improved tunability in group transfer reactions.
International Nuclear Information System (INIS)
Stiegler, Thomas; Sadus, Richard J.
2015-01-01
General methods for combining interactions between particles characterised by non-identical intermolecular potentials are investigated. The combination methods are tested by performing molecular dynamics simulations to determine the pressure, energy, isochoric and isobaric heat capacities, thermal expansion coefficient, isothermal compressibility, Joule-Thomson coefficient, and speed of sound of 10-5 + 12-6 Mie potential binary mixtures. In addition to the two non-identical Mie potentials, mixtures are also studied with non-identical intermolecular parameters. The combination methods are compared with results obtained by simply averaging the Mie exponents. When either the energy or size parameters are non-identical, very significant differences emerge in the thermodynamic properties predicted by the alternative combination methods. The isobaric heat capacity is the thermodynamic property that is most affected by the relative magnitude of the intermolecular potential parameters and the method for combining non-identical potentials. Either the arithmetic or geometric combination of potentials provides a simple and effective way of performing simulations involving mixtures of components characterised by non-identical intermolecular potentials, which is independent of their functional form
Meng, Qingxi; Shen, Wei; Li, Ming
2012-03-01
Density functional theory (DFT) was used to investigate the Rh(I)-catalyzed intermolecular hydroacylation of vinylsilane with benzaldehyde. All intermediates and transition states were optimized completely at the B3LYP/6-31G(d,p) level (LANL2DZ(f) for Rh). Calculations indicated that Rh(I)-catalyzed intermolecular hydroacylation is exergonic, and the total free energy released is -110 kJ mol(-1). Rh(I)-catalyzed intermolecular hydroacylation mainly involves the active catalyst CA2, rhodium-alkene-benzaldehyde complex M1, rhodium-alkene-hydrogen-acyl complex M2, rhodium-alkyl-acyl complex M3, rhodium-alkyl-carbonyl-phenyl complex M4, rhodium-acyl-phenyl complex M5, and rhodium-ketone complex M6. The reaction pathway CA2 + R2 → M1b → T1b → M2b → T2b1 → M3b1 → T4b → M4b → T5b → M5b → T6b → M6b → P2 is the most favorable among all reaction channels of Rh(I)-catalyzed intermolecular hydroacylation. The reductive elimination reaction is the rate-determining step for this pathway, and the dominant product predicted theoretically is the linear ketone, which is consistent with Brookhart's experiments. Solvation has a significant effect, and it greatly decreases the free energies of all species. The use of the ligand Cp' (Cp' = C(5)Me(4)CF(3)) decreased the free energies in general, and in this case the rate-determining step was again the reductive elimination reaction.
Moddemeijer, R
In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a
International Nuclear Information System (INIS)
Nguyen Thanh Duoc; Nguyen Thi Ai Nhung; Tran Duong; Pham Van Tat
2015-01-01
The results presented in this paper are the ab initio intermolecular potentials and the second virial coefficient, B_2 (T) of the dimer Cl_2-Cl_2. These ab initio potentials were proposed by the quantum chemical calculations at high level of theory CCSD(T) with basis sets of Dunning valence correlation-consistent aug-cc-pVmZ (m = 2, 3); these results were extrapolated to complete basis set limit aug-cc-pV23Z. The ab initio energies of complete basis set limit aug-cc-pV23Z resulted from the exponential extrapolation were used to construct the 5-site pair potential functions. The second virial coefficients for this dimer were predicted from those with four-dimensional integration. The second virial coefficients were also corrected to first-order quantum effects. The results turn out to be in good agreement with experimental data, if available, or with those from empirical correlation. The quality of ab initio 5-site potentials proved the reliability for prediction of molecular thermodynamic properties. (author)
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Directory of Open Access Journals (Sweden)
Ji-Jian Chin
2014-01-01
Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
Koperwas, K.; Affouard, F.; Gerges, J.; Valdes, L.-C.; Adrjanowicz, K.; Paluch, M.
2017-12-01
In this paper, we examine, in terms of the classical nucleation theory, how the strengthening of the attractive intermolecular interactions influences the crystallization process for systems like Lennard-Jones at different isobaric conditions. For this purpose, we modify the standard Lennard-Jones potential, and as a result, we obtain three different systems characterized by various strengths of attractive potentials occurring between molecules, which are in direct relationship to the physical quantities describing molecules, e.g., its polarizability or dipole moment. Based on performed analysis, we demonstrate that the molecular attraction primarily impacts the thermodynamics of the interface between liquid and crystal. This is reflected in the behavior of nucleation and overall crystallization rates during compression of the system.
Graphene-enhanced intermolecular interaction at interface between copper- and cobalt-phthalocyanines
Energy Technology Data Exchange (ETDEWEB)
Dou, Wei-Dong [Department of Physics, Shaoxing University, Shaoxing 312000 (China); Center of Super-Diamond and Advanced Films (COSDAF) and Department of Physics and Material Science, City University of Hong Kong, Hong Kong (China); Huang, Shu-Ping [Department of Chemistry, University of South Dakota, Vermillion, South Dakota 57069 (United States); Lee, Chun-Sing, E-mail: apcslee@cityu.edu.hk [Center of Super-Diamond and Advanced Films (COSDAF) and Department of Physics and Material Science, City University of Hong Kong, Hong Kong (China)
2015-10-07
Interfacial electronic structures of copper-phthalocyanine (CuPc), cobalt-phthalocyanine (CoPc), and graphene were investigated experimentally by using photoelectron spectroscopy. While the CuPc/graphene interface shows flat band structure and negligible interfacial dipole indicating quite weak molecule-substrate interaction, the CuPc/CoPc/graphene interface shows a large interfacial dipole and obvious energy level bending. Controlled experiments ruled out possible influences from the change in film structure of CuPc and pure π–π interaction between CoPc and CuPc. Analysis based on X-ray photoelectron spectroscopy and density functional theory reveals that the decrease in the work function for the CuPc/CoPc/graphene system is induced by the intermolecular interaction between CuPc and CoPc which is enhanced owning to the peculiar electronic properties at the CoPc-graphene interface.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Imoto, Mitsutaka; Ikeda, Hiroshi; Fujii, Takayuki; Taniguchi, Hisaji; Tamaki, Akihiro; Takeda, Motonori; Mizuno, Kazuhiko
2010-05-07
An intramolecular exciplex is formed upon excitation of the cyclohexane solution of the 1,4-dicyano-2-methylnaphthalene-N,N-dimethyl-p-toluidine dyad, but little if any intramolecular CT complex exists in the ground state of this substance in solution. In contrast, in the crystalline state, the dyad forms an intermolecular mixed-stack CT complex in the ground state and an intermolecular exciplex when it is photoexcited.
DEFF Research Database (Denmark)
Fernández, Berta; Henriksen, Christian; Farrelly, David
2013-01-01
A refined CCSD(T) intermolecular potential energy surface is developed for the He-C2H2 van der Waals complex. For this, 206 points on the intermolecular potential energy surface, evaluated using the CCSD(T) method and the aug-cc-pVQZ basis set extended with a set of 3s3p2d1f1g midbond functions...
DEFF Research Database (Denmark)
Carli, Lorenzo; Genta, G; Cantatore, Angela
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...
International Nuclear Information System (INIS)
Pyzer-Knapp, Edward O.; Thompson, Hugh P. G.; Day, Graeme M.
2016-01-01
An empirically parameterized intermolecular force field is developed for crystal structure modelling and prediction. The model is optimized for use with an atomic multipole description of electrostatic interactions. We present a re-parameterization of a popular intermolecular force field for describing intermolecular interactions in the organic solid state. Specifically we optimize the performance of the exp-6 force field when used in conjunction with atomic multipole electrostatics. We also parameterize force fields that are optimized for use with multipoles derived from polarized molecular electron densities, to account for induction effects in molecular crystals. Parameterization is performed against a set of 186 experimentally determined, low-temperature crystal structures and 53 measured sublimation enthalpies of hydrogen-bonding organic molecules. The resulting force fields are tested on a validation set of 129 crystal structures and show improved reproduction of the structures and lattice energies of a range of organic molecular crystals compared with the original force field with atomic partial charge electrostatics. Unit-cell dimensions of the validation set are typically reproduced to within 3% with the re-parameterized force fields. Lattice energies, which were all included during parameterization, are systematically underestimated when compared with measured sublimation enthalpies, with mean absolute errors of between 7.4 and 9.0%
Directory of Open Access Journals (Sweden)
GAO Shan
2017-12-01
Full Text Available Halogen bond, as hydrogen bond, is a non-covalent bond. Dynamic nuclear polarization (DNP technique has been used previously to study hydrogen bonds-mediated intermolecular interactions. However, no study has been carried out so far to study the halogen bond-mediated intermolecular interactions with DNP. In this work, 19F DNP polarization efficiency of the halogen bonds existing in supramolecular assembling by 4-OH-TEMPO and 1,4-diiodotetrafluorobenzene (DITFB was studied on a home-made DNP system. The formation of intermolecular halogen bonds appeared to increase 19F DNP polarization efficiency, suggesting that the spin-spin interactions among electrons were weakened by the halogen bonds, resulting in an increased T2e and a larger saturation factor.
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Salting Effects as an Illustration of the Relative Strength of Intermolecular Forces
Person, Eric C.; Golden, Donnie R.; Royce, Brenda R.
2010-01-01
This quick and inexpensive demonstration of the salting of an alcohol out of an aqueous solution illustrates the impact of intermolecular forces on solubility using materials familiar to many students. Ammonium sulfate (fertilizer) is added to an aqueous 35% solution of isopropyl alcohol (rubbing alcohol and water) containing food coloring as a…
Exciplex: An Intermolecular Charge-Transfer Approach for TADF.
Sarma, Monima; Wong, Ken-Tsung
2018-04-03
Organic materials that display thermally activated delayed fluorescence (TADF) are a striking class of functional materials that have witnessed a booming progress in recent years. In addition to pure TADF emitters achieved by the subtle manipulations of intramolecular charge transfer processes with sophisticated molecular structures, a new class of efficient TADF-based OLEDs with emitting layer formed by blending electron donor and acceptor molecules that involve intermolecular charge transfer have also been fabricated. In contrast to pure TADF materials, the exciplex-based systems can realize small ΔEST (0-0.05 eV) much more easily since the electron and hole are positioned on two different molecules, thereby giving small exchange energy. Consequently, exciplex-based OLEDs have the prospective to maximize the TADF contribution and achieve theoretical 100% internal quantum efficiency. Therefore, the challenging issue of achieving small ΔEST in organic systems could be solved. In this article, we summarize and discuss the latest and most significant developments regarding these rapidly evolving functional materials, wherein the majority of the reported exciplex forming systems are categorized into two sub-groups, viz. (a) exciplex as TADF emitters and (b) those as hosts for fluorescent, phosphorescent and TADF dopants according to their structural features and applications. The working mechanisms of the direct electroluminescence from the donor/acceptor interface and the exciplex-forming systems as co-host for the realization of high efficiency OLEDs are reviewed and discussed. This article delivers a summary of the current progresses and achievements of exciplex-based researches and points out the future challenges to trigger more research endeavors to this growing field.
Argon intermolecular potential from a measurement of the total scattering cross-section
International Nuclear Information System (INIS)
Wong, Y.W.
1975-01-01
An inversion method to obtain accurate intermolecular potentials from experimental total cross section measurements is presented. This method is based on the high energy Massey--Smith approximation. The attractive portion of the potential is represented by a multi-parameter spline function and the repulsive part by a Morse function. The best fit potential is obtained by a least squares minimization based on comparison of experimental cross sections with those obtained by a Fourier transform of the reduced Massey--Smith phase shift curve. An experimental method was developed to obtain the total cross sections needed for the above inversion procedure. In this technique, integral cross sections are measured at various resolutions and the total cross section is obtained by extrapolating to infinite resolution. Experimental results obtained for the Ar--Ar system are in excellent agreement with total cross sections calculated using the Barker-Fisher-Watts potential. Inversion of the data to obtain a potential distinguishable from the BFW-potential requires an extension of the method based on the Massey--Smith approximation to permit use of JWKB phase shifts and was not attempted
Strong Intermolecular Exciton Couplings in Solid-State Circular Dichroism of Aryl Benzyl Sulfoxides
Czech Academy of Sciences Publication Activity Database
Padula, Daniele; Di Pietro, S.; Capozzi, M. A. M.; Cardellicchio, C.; Pescitelli, G.
2014-01-01
Roč. 26, č. 9 (2014), s. 462-470 ISSN 0899-0042 Institutional support: RVO:61388963 Keywords : organic crystals * TDDFT CD calculations * pairwise additive approximation * two-body effects * intermolecular forces in crystal lattices Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.886, year: 2014
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
Dye-sensitized solar cell with a pair of carbon-based electrodes
International Nuclear Information System (INIS)
Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun
2012-01-01
We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
International Nuclear Information System (INIS)
Cai Congbo; Chen Zhong; Cai Shuhui; Zhong Jianhui
2005-01-01
In this paper, behaviors of single-quantum coherences and inter-molecular multiple-quantum coherences under restricted diffusion in nuclear magnetic resonance experiments were investigated. The propagator formalism based on the loss of spin phase memory during random motion was applied to describe the diffusion-induced signal attenuation. The exact expression of the signal attenuation under the short gradient pulse approximation for restricted diffusion between two parallel plates was obtained using this propagator method. For long gradient pulses, a modified formalism was proposed. The simulated signal attenuation under the effects of gradient pulses of different width based on the Monte Carlo method agrees with the theoretical predictions. The propagator formalism and computer simulation can provide convenient, intuitive and precise methods for the study of the diffusion behaviors
PandA : pairings and arithmetic
Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.
2014-01-01
This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give
International Nuclear Information System (INIS)
Murad, S.; Gubbins, K.E.; Gray, C.G.
1983-01-01
We compare several recently proposed theories for the angular pair correlation function g(rω 1 ω 2 ), including first- and second-order perturbation theory (the u-expansion), a Pade approximant to this series, first-order f-expansion, the single superchain, generalized mean field, linearized hypernetted chain, and quadratic hypernetted chain approximations. Numerical results from these theories are compared with available computer simulation data for four model fluids whose intermolecular pair potential is of the form u 0 +usub(a), where u 0 is a hard-sphere of Lennard-Jones model, while usub(a) is a dipole-dipole or quadrupole-quadrupole interaction; we refer to these model fluids as HS+μμ, HS+QQ, LJ+μμ, and LJ+QQ. Properties studied include the angular pair correlation function and its spherical harmonic components, the thermodynamic properties, and the angular correlation parameters G 1 and G 2 that are related to the dielectric and Kerr constants. The second-order perturbation theory is superior to the integral equation theories for the thermodynamic harmonics of g(rω 1 ω 2 ) and for the thermodynamic properties themselves at moderate multipole strengths. For other harmonics and properties, the integral equation theories are better, with the quadratic hypernetted chain approximation being the best overall. (orig.)
Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.
Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi
2018-02-19
It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
DEFF Research Database (Denmark)
Cybulski, Hubert; Fernandez, Berta; Henriksen, Christian
2012-01-01
to the axis perpendicular to the phenylacetylene plane and containing the center of mass. The calculated interaction energy is -418.9 cm(-1). To check further the potential, we obtain the rovibrational spectrum of the complex and the results are compared to the available experimental data. (C) 2012 American......We evaluate the phenylacetylene-argon intermolecular potential energy surface by fitting a representative number of ab initio interaction energies to an analytic function. These energies are calculated at a grid of intermolecular geometries, using the CCSD(T) method and the aug-cc-pVDZ basis set...... extended with a series of 3s3p2d1flg midbond functions. The potential is characterized by two equivalent global minima where the Ar atom is located above and below the phenylacetylene plane at a distance of 3.5781 angstrom from the molecular center of mass and at an angle of 9.08 degrees with respect...
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
Catalytic Intermolecular Cross-Couplings of Azides and LUMO-Activated Unsaturated Acyl Azoliums
Li, Wenjun
2017-02-15
An example for the catalytic synthesis of densely functionalized 1,2,3-triazoles through a LUMO activation mode has been developed. The protocol is enabled by intermolecular cross coupling reactions of azides with in situ-generated alpha,beta-unsaturated acyl azoliums. High yields and broad scope as well as the investigation of reaction mechanism are reported.
Modulation of intermolecular interactions in single-molecule magnets
Heroux, Katie Jeanne
Polynuclear manganese clusters exhibiting interesting magnetic and quantum properties have been an area of intense research since the discovery of the first single-molecule magnet (SMM) in 1993. These molecules, below their blocking temperature, function as single-domain magnetic particles which exhibit classical macroscale magnetic properties as well as quantum mechanical phenomena such as quantum tunnelling of magnetization (QTM) and quantum phase interference. The union of classical and quantum behavior in these nanomaterials makes SMMs ideal candidates for high-density information storage and quantum computing. However, environmental coupling factors (nuclear spins, phonons, neighboring molecules) must be minimized if such applications are ever to be fully realized. The focus of this work is making small structural changes in well-known manganese SMMs in order to drastically enhance the overall magnetic and quantum properties of the system. Well-isolated molecules of high crystalline quality should lead to well-defined energetic and spectral properties as well. An advantage of SMMs over bulk magnetic materials is that they can be chemically altered from a "bottom-up" approach providing a synthetic tool for tuning magnetic properties. This systematic approach is utilized in the work presented herein by incorporating bulky ligands and/or counterions to "isolate" the magnetic core of [Mn4] dicubane SMMs. Reducing intermolecular interactions in the crystal lattice (neighboring molecules, solvate molecules, dipolar interactions) is an important step toward developing viable quantum computing devices. Detailed bulk magnetic studies as well as single crystal magnetization hysteresis and high-frequency EPR studies on these sterically-isolated complexes show enhanced, and sometimes even unexpected, quantum dynamics. The importance of intra- and intermolecular interactions remains a common theme throughout this work, extending to other SMMs of various topology including
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Paired structures and other opposite-based models
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel
2015-01-01
, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...
An approach to the intermolecular energy in pure liquids
Directory of Open Access Journals (Sweden)
GAbriel Hernández de la Torre
2010-07-01
Full Text Available Se propone un método para: estimar la energía potencial de repulsión de cualquier molécula central como una función de las densidades ortobáricas en líquidos puros no auto asociados; estimar los parámetros necesarios para calcular la energía de dispersión de London; calcular los números de coordinación promedio, distancias intermoleculares de interacción, diámetros moleculares y de grupos; en moléculas globulares, moléculas planas y parafinas normales.
International Nuclear Information System (INIS)
Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun
2017-01-01
Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
Taucher, Christian; Berger, Angelika; Mandl, Christian W.
2010-01-01
Intermolecular recombination between the genomes of closely related RNA viruses can result in the emergence of novel strains with altered pathogenic potential and antigenicity. Although recombination between flavivirus genomes has never been demonstrated experimentally, the potential risk of generating undesirable recombinants has nevertheless been a matter of concern and controversy with respect to the development of live flavivirus vaccines. As an experimental system for investigating the ability of flavivirus genomes to recombine, we developed a “recombination trap,” which was designed to allow the products of rare recombination events to be selected and amplified. To do this, we established reciprocal packaging systems consisting of pairs of self-replicating subgenomic RNAs (replicons) derived from tick-borne encephalitis virus (TBEV), West Nile virus (WNV), and Japanese encephalitis virus (JEV) that could complement each other in trans and thus be propagated together in cell culture over multiple passages. Any infectious viruses with intact, full-length genomes that were generated by recombination of the two replicons would be selected and enriched by end point dilution passage, as was demonstrated in a spiking experiment in which a small amount of wild-type virus was mixed with the packaged replicons. Using the recombination trap and the JEV system, we detected two aberrant recombination events, both of which yielded unnatural genomes containing duplications. Infectious clones of both of these genomes yielded viruses with impaired growth properties. Despite the fact that the replicon pairs shared approximately 600 nucleotides of identical sequence where a precise homologous crossover event would have yielded a wild-type genome, this was not observed in any of these systems, and the TBEV and WNV systems did not yield any viable recombinant genomes at all. Our results show that intergenomic recombination can occur in the structural region of flaviviruses
Directory of Open Access Journals (Sweden)
Lu Hu
2018-03-01
Full Text Available This work reveals the silyl ketene acetal (SKA/B(C6F53 Lewis pair-catalyzed room-temperature group transfer polymerization (GTP of polar acrylic monomers, including methyl linear methacrylate (MMA, and the biorenewable cyclic monomers γ-methyl-α-methylene-γ-butyrolactone (MMBL and α-methylene-γ-butyrolactone (MBL as well. The in situ NMR monitored reaction of SKA with B(C6F53 indicated the formation of Frustrated Lewis Pairs (FLPs, although it is sluggish for MMA polymerization, such a FLP system exhibits highly activity and living GTP of MMBL and MBL. Detailed investigations, including the characterization of key reaction intermediates, polymerization kinetics and polymer structures have led to a polymerization mechanism, in which the polymerization is initiated with an intermolecular Michael addition of the ester enolate group of SKA to the vinyl group of B(C6F53-activated monomer, while the silyl group is transferred to the carbonyl group of the B(C6F53-activated monomer to generate the single-monomer-addition species or the active propagating species; the coordinated B(C6F53 is released to the incoming monomer, followed by repeated intermolecular Michael additions in the subsequent propagation cycle. Such neutral SKA analogues are the real active species for the polymerization and are retained in the whole process as confirmed by experimental data and the chain-end analysis by matrix-assisted laser desorption/ionization time of flight mass spectroscopy (MALDI-TOF MS. Moreover, using this method, we have successfully synthesized well-defined PMMBL-b-PMBL, PMMBL-b-PMBL-b-PMMBL and random copolymers with the predicated molecular weights (Mn and narrow molecular weight distribution (MWD.
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
Directory of Open Access Journals (Sweden)
Das Tanmoy
2012-03-01
Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.
N,N′-Bis(2-hydroxy-3-ethoxybenzylidenebutane-1,4-diamine
Directory of Open Access Journals (Sweden)
Hoong-Kun Fun
2009-04-01
Full Text Available The title Schiff base compound, C22H28N2O4, lies across a crystallographic inversion centre and adopts an E configuration with respect to the C=N bond. Pairs of weak intermolecular C—H...O interactions link neighbouring molecules into dimers with an R22(28 ring motif. The crystal structure is stabilized by intermolecular C—H...π interactions. An intramolecular O—H...N hydrogen bond occurs.
Non-standard base pairing and stacked structures in methyl xanthine clusters
Czech Academy of Sciences Publication Activity Database
Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.
2008-01-01
Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008
DEFF Research Database (Denmark)
Andersen, Jonas; Heimdal, J.; Wallin Mahler Andersen, Denise
2014-01-01
have been assigned and provide crucial observables for benchmark theoretical descriptions of this systems’ flat intermolecular potential energy surface. A (semi)-empirical value for the zero-point energy of 273 ± 15 cm−1 from the class of intermolecular van der Waals vibrations is proposed...... and the combination with high-level quantum chemical calculations provides a value of 726 ± 15 cm−1 for the dissociation energy D0...
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
International Nuclear Information System (INIS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.
1985-01-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states
Testing intermolecular potential functions using transport property data
International Nuclear Information System (INIS)
Clifford, A.A.; Dickinson, E.; Gray, P.; Scott, A.C.
1975-01-01
The viscosity of hydrogen has been measured at eight temperatures from 273 to 1060K, using a capillary-flow viscometer. The results have been used to test the repulsive part of a recently formulated H 2 /H 2 intermolecular potential function, obtained from molecular-beam measurements. Agreement between the experimental and predicted values for viscosity is within 3.5%, which corresponds approximately to the combined quoted uncertainties in the two sets of data. However, if the value of the distance parameter of the potential is reduced by about 1.5%, the agreement obtained is within 0.75% over the whole temperature range. This modified potential function gives better agreement with the available higher temperature viscosities and second virial coefficients. (author)
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
Directory of Open Access Journals (Sweden)
Hernan Garcia-Ruiz
2018-03-01
Full Text Available Positive-strand RNA viruses replicate their genomes in membrane-bound replication compartments. Brome mosaic virus (BMV replicates in vesicular invaginations of the endoplasmic reticulum membrane. BMV has served as a productive model system to study processes like virus-host interactions, RNA replication and recombination. Here we present multiple lines of evidence showing that the structure of the viral RNA replication compartments plays a fundamental role and that recruitment of parental RNAs to a common replication compartment is a limiting step in intermolecular RNA recombination. We show that a previously defined requirement for an RNA recruitment element on both parental RNAs is not to function as a preferred crossover site, but in order for individual RNAs to be recruited into the replication compartments. Moreover, modulating the form of the replication compartments from spherular vesicles (spherules to more expansive membrane layers increased intermolecular RNA recombination frequency by 200- to 1000-fold. We propose that intermolecular RNA recombination requires parental RNAs to be recruited into replication compartments as monomers, and that recruitment of multiple RNAs into a contiguous space is much more common for layers than for spherules. These results could explain differences in recombination frequencies between viruses that replicate in association with smaller spherules versus larger double-membrane vesicles and convoluted membranes.
Efficient Implementation of the Pairing on Mobilephones Using BREW
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
Directory of Open Access Journals (Sweden)
Alexander S. Mikherdov
2018-02-01
Full Text Available The coupling of cis-[PdCl2(CNXyl2] (Xyl = 2,6-Me2C6H3 with 4-phenylthiazol-2-amine in molar ratio 2:3 at RT in CH2Cl2 leads to binuclear (diaminocarbenePdII complex 3c. The complex was characterized by HRESI+-MS, 1H NMR spectroscopy, and its structure was elucidated by single-crystal XRD. Inspection of the XRD data for 3c and for three relevant earlier obtained thiazole/thiadiazole derived binuclear diaminocarbene complexes (3a EYOVIZ; 3b: EYOWAS; 3d: EYOVOF suggests that the structures of all these species exhibit intra-/intermolecular bifurcated chalcogen bonding (BCB. The obtained data indicate the presence of intramolecular S•••Cl chalcogen bonds in all of the structures, whereas varying of substituent in the 4th and 5th positions of the thiazaheterocyclic fragment leads to changes of the intermolecular chalcogen bonding type, viz. S•••π in 3a,b, S•••S in 3c, and S•••O in 3d. At the same time, the change of heterocyclic system (from 1,3-thiazole to 1,3,4-thiadiazole does not affect the pattern of non-covalent interactions. Presence of such intermolecular chalcogen bonding leads to the formation of one-dimensional (1D polymeric chains (for 3a,b, dimeric associates (for 3c, or the fixation of an acetone molecule in the hollow between two diaminocarbene complexes (for 3d in the solid state. The Hirshfeld surface analysis for the studied X-ray structures estimated the contributions of intermolecular chalcogen bonds in crystal packing of 3a–d: S•••π (3a: 2.4%; 3b: 2.4%, S•••S (3c: less 1%, S•••O (3d: less 1%. The additionally performed DFT calculations, followed by the topological analysis of the electron density distribution within the framework of Bader’s theory (AIM method, confirm the presence of intra-/intermolecular BCB S•••Cl/S•••S in dimer of 3c taken as a model system (solid state geometry. The AIM analysis demonstrates the presence of appropriate bond critical points for these
Directory of Open Access Journals (Sweden)
Francisco Geraldo Barbosa
2015-12-01
Full Text Available Intermolecular forces are a useful concept that can explain the attraction between particulate matter as well as numerous phenomena in our lives such as viscosity, solubility, drug interactions, and dyeing of fibers. However, studies show that students have difficulty understanding this important concept, which has led us to develop a free educational software in English and Portuguese. The software can be used interactively by teachers and students, thus facilitating better understanding. Professors and students, both graduate and undergraduate, were questioned about the software quality and its intuitiveness of use, facility of navigation, and pedagogical application using a Likert scale. The results led to the conclusion that the developed computer application can be characterized as an auxiliary tool to assist teachers in their lectures and students in their learning process of intermolecular forces.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
International Nuclear Information System (INIS)
Brooks, R.; Porter, R.A.R.; Kalos, F.; Grosser, A.E.
1975-01-01
A velocity selected molecular beam of D 2 O was crossed with a nozzle beam of Ar and the angular distribution of the scattered D 2 O was measured mass spectrometrically. By varying the velocity of the D 2 O beam, the differential cross section was measured at two collision energies. The experimental results were compared with synthetic differential cross sections calculated from Lennard-Jones and Kihara-Stockmayer trial potentials to determine potential parameters. Implications for the H 2 O pair potential are discussed
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
Energy Technology Data Exchange (ETDEWEB)
Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.
2016-09-10
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
International Nuclear Information System (INIS)
Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.
2016-01-01
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
Energy Technology Data Exchange (ETDEWEB)
Chavda, Bhavin R., E-mail: chavdabhavin9@gmail.com; Dubey, Rahul P.; Patel, Urmila H. [Department of Physics, Sardar Patel University, Vallabh Vidyanagar-388120, Gujarat (India); Gandhi, Sahaj A. [Bhavan’s Shri I.L. Pandya Arts-Science and Smt. J.M. shah Commerce College, Dakar, Anand -388001, Gujarat, Indian (India); Barot, Vijay M. [P. G. Center in Chemistry, Smt. S. M. Panchal Science College, Talod, Gujarat 383 215 (India)
2016-05-06
The novel chalcone derivatives have widespread applications in material science and medicinal industries. The density functional theory (DFT) is used to optimized the molecular structure of the three chalcone derivatives (M-I, II, III). The observed discrepancies between the theoretical and experimental (X-ray data) results attributed to different environments of the molecules, the experimental values are of the molecule in solid state there by subjected to the intermolecular forces, like non-bonded hydrogen bond interactions, where as isolated state in gas phase for theoretical studies. The lattice energy of all the molecules have been calculated using PIXELC module in Coulomb –London –Pauli (CLP) package and is partitioned into corresponding coulombic, polarization, dispersion and repulsion contributions. Lattice energy data confirm and strengthen the finding of the X-ray results that the weak but significant intermolecular interactions like C-H…O, Π- Π and C-H… Π plays an important role in the stabilization of crystal packing.
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F
Intermolecular Interactions in the TMEM16A Dimer Controlling Channel Activity.
Scudieri, Paolo; Musante, Ilaria; Gianotti, Ambra; Moran, Oscar; Galietta, Luis J V
2016-12-08
TMEM16A and TMEM16B are plasma membrane proteins with Ca 2+ -dependent Cl - channel function. By replacing the carboxy-terminus of TMEM16A with the equivalent region of TMEM16B, we obtained channels with potentiation of channel activity. Progressive shortening of the chimeric region restricted the "activating domain" to a short sequence close to the last transmembrane domain and led to TMEM16A channels with high activity at very low intracellular Ca 2+ concentrations. To elucidate the molecular mechanism underlying this effect, we carried out experiments based on double chimeras, Forster resonance energy transfer, and intermolecular cross-linking. We also modeled TMEM16A structure using the Nectria haematococca TMEM16 protein as template. Our results indicate that the enhanced activity in chimeric channels is due to altered interaction between the carboxy-terminus and the first intracellular loop in the TMEM16A homo-dimer. Mimicking this perturbation with a small molecule could be the basis for a pharmacological stimulation of TMEM16A-dependent Cl - transport.
Sutton, Christopher; Risko, Chad; Bredas, Jean-Luc
2015-01-01
Noncovalent intermolecular interactions, which can be tuned through the toolbox of synthetic chemistry, determine not only the molecular packing but also the resulting electronic, optical, and mechanical properties of materials derived from π
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Moghadasi, Jalil; Yousefi, Fakhri; Papari, Mohammad Mehdi; Faghihi, Mohammad Ali; Mohsenipour, Ali Asghar
2009-09-01
It is the purpose of this paper to extract unlike intermolecular potential energies of five carbon dioxide-based binary gas mixtures including CO2-He, CO2-Ne, CO2-Ar, CO2-Kr, and CO2-Xe from viscosity data and compare the calculated potentials with other models potential energy reported in literature. Then, dilute transport properties consisting of viscosity, diffusion coefficient, thermal diffusion factor, and thermal conductivity of aforementioned mixtures are calculated from the calculated potential energies and compared with literature data. Rather accurate correlations for the viscosity coefficient of afore-cited mixtures embracing the temperature range 200 K < T < 3273.15 K is reproduced from the present unlike intermolecular potentials energy. Our estimated accuracies for the viscosity are to within ±2%. In addition, the calculated potential energies are used to present smooth correlations for other transport properties. The accuracies of the binary diffusion coefficients are of the order of ±3%. Finally, the unlike interaction energy and the calculated low density viscosity have been employed to calculate high density viscosities using Vesovic-Wakeham method.
Energy Technology Data Exchange (ETDEWEB)
Moghadasi, Jalil; Yousefi, Fakhri [Shiraz University, Department of Chemistry, Shiraz (Iran); Papari, Mohammad Mehdi; Faghihi, Mohammad Ali [Shiraz University of Technology, Department of Chemistry, Shiraz (Iran); Mohsenipour, Ali Asghar [University of Waterloo, Department of Chemical Engineering, Waterloo (Canada)
2009-09-15
It is the purpose of this paper to extract unlike intermolecular potential energies of five carbon dioxide-based binary gas mixtures including CO{sub 2}-He, CO{sub 2}-Ne, CO{sub 2}-Ar, CO{sub 2}-Kr, and CO{sub 2}-Xe from viscosity data and compare the calculated potentials with other models potential energy reported in literature. Then, dilute transport properties consisting of viscosity, diffusion coefficient, thermal diffusion factor, and thermal conductivity of aforementioned mixtures are calculated from the calculated potential energies and compared with literature data. Rather accurate correlations for the viscosity coefficient of afore-cited mixtures embracing the temperature range 200 K
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs
Directory of Open Access Journals (Sweden)
Ye Zhi-Qiang
2011-08-01
Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.
International Nuclear Information System (INIS)
Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia
2014-01-01
The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Directory of Open Access Journals (Sweden)
Saied M. Soliman
2016-12-01
Full Text Available Intermolecular interactions play a vital role in crystal structures. Therefore, we conducted a topological study, using Hirshfeld surfaces and atom in molecules (AIM analysis, to decompose and analyze, respectively, the different intermolecular interactions in six hydrazone-diacetyl platinum(II complexes. Using AIM and natural bond orbital (NBO analyses, we determined the type, nature, and strength of the interactions. All the studied complexes contain C-H⋯O interactions, and the presence of bond critical points along the intermolecular paths underlines their significance. The electron densities (ρ(r at the bond critical points (0.0031–0.0156 e/a03 fall within the typical range for H-bonding interactions. Also, the positive values of the Laplacian of the electron density (∇2ρ(r revealed the depletion of electronic charge on the interatomic path, another characteristic feature of closed-shell interactions. The ratios of the absolute potential energy density to the kinetic energy density (|V(r|/G(r and ρ(r are highest for the O2⋯H15-N3 interaction in [Pt(COMe2(2-pyCMe=NNH2] (1; hence, this interaction has the highest covalent character of all the O⋯H intermolecular interactions. Interestingly, in [Pt(COMe2(H2NN=CMe-CMe=NNH2] (3, there are significant N-H⋯Pt interactions. Using the NBO method, the second-order interaction energies, E(2, of these interactions range from 3.894 to 4.061 kJ/mol. Furthermore, the hybrid Pt orbitals involved in these interactions are comprised of dxy, dxz, and s atomic orbitals.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Schoen, Martin; Haslam, Andrew J; Jackson, George
2017-10-24
The phase behavior and structure of a simple square-well bulk fluid with anisotropic interactions is described in detail. The orientation dependence of the intermolecular interactions allows for the formation of a nematic liquid-crystalline phase in addition to the more conventional isotropic gas and liquid phases. A version of classical density functional theory (DFT) is employed to determine the properties of the model, and comparisons are made with the corresponding data from Monte Carlo (MC) computer simulations in both the grand canonical and canonical ensembles, providing a benchmark to assess the adequacy of the DFT results. A novel element of the DFT approach is the assumption that the structure of the fluid is dominated by intermolecular interactions in the isotropic fluid. A so-called augmented modified mean-field (AMMF) approximation is employed accounting for the influence of anisotropic interactions. The AMMF approximation becomes exact in the limit of vanishing density. We discuss advantages and disadvantages of the AMMF approximation with respect to an accurate description of isotropic and nematic branches of the phase diagram, the degree of orientational order, and orientation-dependent pair correlations. The performance of the AMMF approximations is found to be good in comparison with the MC data; the AMMF approximation has clear advantages with respect to an accurate and more detailed description of the fluid structure. Possible strategies to improve the DFT are discussed.
Localized-overlap approach to calculations of intermolecular interactions
Rob, Fazle
Symmetry-adapted perturbation theory (SAPT) based on the density functional theory (DFT) description of the monomers [SAPT(DFT)] is one of the most robust tools for computing intermolecular interaction energies. Currently, one can use the SAPT(DFT) method to calculate interaction energies of dimers consisting of about a hundred atoms. To remove the methodological and technical limits and extend the size of the systems that can be calculated with the method, a novel approach has been proposed that redefines the electron densities and polarizabilities in a localized way. In the new method, accurate but computationally expensive quantum-chemical calculations are only applied for the regions where it is necessary and for other regions, where overlap effects of the wave functions are negligible, inexpensive asymptotic techniques are used. Unlike other hybrid methods, this new approach is mathematically rigorous. The main benefit of this method is that with the increasing size of the system the calculation scales linearly and, therefore, this approach will be denoted as local-overlap SAPT(DFT) or LSAPT(DFT). As a byproduct of developing LSAPT(DFT), some important problems concerning distributed molecular response, in particular, the unphysical charge-flow terms were eliminated. Additionally, to illustrate the capabilities of SAPT(DFT), a potential energy function has been developed for an energetic molecular crystal of 1,1-diamino-2,2-dinitroethylene (FOX-7), where an excellent agreement with the experimental data has been found.
Coiodação de alquenos com nucleófilos oxigenados: reações intermoleculares
Directory of Open Access Journals (Sweden)
Sanseverino Antonio Manzolillo
2001-01-01
Full Text Available A review on the electrophilic addition of iodine to alkenes in the presence of oxygen containing nucleophiles (cohalogenation reaction is presented. The intermolecular reactions are discussed with emphasis in methods of reaction and synthetic applications of the resulting vicinal iodo-functionalized products (iodohydrins, beta-iodoethers and beta-iodocarboxylates.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Andrew Evans, P.; Sawyer, James R.; Lai, Kwong Wah; Huffman, John C.
2006-01-01
The crossed intermolecular rhodium-catalyzed [2 + 2 + 2] carbocyclization of carbon and heteroatom tethered 1,6-enynes can be accomplished with symmetrical and unsymmetrical alkynes, to afford the corresponding bicyclohexadienes in an efficient and highly selective manner. PMID:16075089
Intermolecular interaction studies of glyphosate with water
Manon, Priti; Juglan, K. C.; Kaur, Kirandeep; Sethi, Nidhi; Kaur, J. P.
2017-07-01
The density (ρ), viscosity (η) and ultrasonic velocity (U) of glyphosate with water have been measured on different ultrasonic frequency ranges from 1MHz, 2MHz, 3MHz & 5MHz by varying concentrations (0.05%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, & 0.40%) at 30°C. The specific gravity bottle, Ostwald's viscometer and quartz crystal interferometer were used to determine density (ρ), viscosity (η) and ultrasonic velocity (U). These three factors contribute in evaluating the other parameters as acoustic impedance (Z), adiabatic compressibility (β), relaxation time (τ), intermolecular free length (Lf), free volume (Vf), ultrasonic attenuation (α/f2), Rao's constant (R), Wada's constant (W) and relative strength (R). Solute-solvent interaction is confirmed by ultrasonic velocity and viscosity values, which increases with increase in concentration indicates stronger association between solute and solvent molecules. With rise in ultrasonic frequency the interaction between the solute and solvent particles decreases. The linear variations in Rao's constant and Wada's constant suggest the absence of complex formation.
Bouzková, Kateřina; Babinský, Martin; Novosadová, Lucie; Marek, Radek
2013-06-11
An understanding of the role of intermolecular interactions in crystal formation is essential to control the generation of diverse crystalline forms which is an important concern for pharmaceutical industry. Very recently, we reported a new approach to interpret the relationships between intermolecular hydrogen bonding, redistribution of electron density in the system, and NMR chemical shifts (Babinský et al. J. Phys. Chem. A, 2013, 117, 497). Here, we employ this approach to characterize a full set of crystal interactions in a sample of anhydrous theobromine as reflected in (13)C NMR chemical shift tensors (CSTs). The important intermolecular contacts are identified by comparing the DFT-calculated NMR CSTs for an isolated theobromine molecule and for clusters composed of several molecules as selected from the available X-ray diffraction data. Furthermore, electron deformation density (EDD) and shielding deformation density (SDD) in the proximity of the nuclei involved in the proposed interactions are calculated and visualized. In addition to the recently reported observations for hydrogen bonding, we focus here particularly on the stacking interactions. Although the principal relations between the EDD and CST for hydrogen bonding (HB) and stacking interactions are similar, the real-space consequences are rather different. Whereas the C-H···X hydrogen bonding influences predominantly and significantly the in-plane principal component of the (13)C CST perpendicular to the HB path and the C═O···H hydrogen bonding modulates both in-plane components of the carbonyl (13)C CST, the stacking modulates the out-of-plane electron density resulting in weak deshielding (2-8 ppm) of both in-plane principal components of the CST and weak shielding (∼ 5 ppm) of the out-of-plane component. The hydrogen-bonding and stacking interactions may add to or subtract from one another to produce total values observed experimentally. On the example of theobromine, we demonstrate
Investigations into nuclear pairing
International Nuclear Information System (INIS)
Clark, R.M.
2006-01-01
This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)
Matched molecular pair-based data sets for computer-aided medicinal chemistry
Bajorath, Jürgen
2014-01-01
Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
International Nuclear Information System (INIS)
Wylie, Benjamin J.; Dzikovski, Boris G.; Pawsey, Shane; Caporini, Marc; Rosay, Melanie; Freed, Jack H.; McDermott, Ann E.
2015-01-01
We demonstrate that dynamic nuclear polarization of membrane proteins in lipid bilayers may be achieved using a novel polarizing agent: pairs of spin labels covalently bound to a protein of interest interacting at an intermolecular interaction surface. For gramicidin A, nitroxide tags attached to the N-terminal intermolecular interface region become proximal only when bimolecular channels forms in the membrane. We obtained signal enhancements of sixfold for the dimeric protein. The enhancement effect was comparable to that of a doubly tagged sample of gramicidin C, with intramolecular spin pairs. This approach could be a powerful and selective means for signal enhancement in membrane proteins, and for recognizing intermolecular interfaces
Intermolecular Interactions between Eosin Y and Caffeine Using 1H-NMR Spectroscopy
Directory of Open Access Journals (Sweden)
Macduff O. Okuom
2013-01-01
Full Text Available DETECHIP has been used in testing analytes including caffeine, cocaine, and tetrahydrocannabinol (THC from marijuana, as well as date rape and club drugs such as flunitrazepam, gamma-hydroxybutyric acid (GHB, and methamphetamine. This study investigates the intermolecular interaction between DETECHIP sensor eosin Y (DC1 and the analyte (caffeine that is responsible for the fluorescence and color changes observed in the actual array. Using 1H-NMR, 1H-COSY, and 1H-DOSY NMR methods, a proton exchange from C-8 of caffeine to eosin Y is proposed.
The same number of optimized parameters scheme for determining intermolecular interaction energies
DEFF Research Database (Denmark)
Kristensen, Kasper; Ettenhuber, Patrick; Eriksen, Janus Juul
2015-01-01
We propose the Same Number Of Optimized Parameters (SNOOP) scheme as an alternative to the counterpoise method for treating basis set superposition errors in calculations of intermolecular interaction energies. The key point of the SNOOP scheme is to enforce that the number of optimized wave...... as numerically. Numerical results for second-order Møller-Plesset perturbation theory (MP2) and coupled-cluster with single, double, and approximate triple excitations (CCSD(T)) show that the SNOOP scheme in general outperforms the uncorrected and counterpoise approaches. Furthermore, we show that SNOOP...
Symmetry in the polarization expansion for intermolecular forces
International Nuclear Information System (INIS)
Chipman, D.M.; Hirschfelder, J.O.
1980-01-01
In the usual polarization expansion for intermolecular forces, exchange effects that determine the separations of energy levels within the manifold of interacting states are ignored. Previous low order calculations on simple physical systems have indicated that these exchange terms can be described reasonably well by an appropriate ad hoc symmetrization of the polarization wave function (the SYM-P method). But theoretical considerations suggest that the SYM-P method should be good for only one of the interacting states and not for the others in the manifold. Here this long standing apparent conflict between theoretical expectations and actual results is explained by consideration of a simple model system in which the relevant equations can be solved exactly. It is concluded that while the SYM-P method is potentially exact for only one of the interacting states, it may provide good approximations to the other states of the manifold in the case of large separations of the interacting subsystems
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
International Nuclear Information System (INIS)
Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively
Wang, Dong-Hui; Yu, Jin-Quan
2011-01-01
The total synthesis of (+)-lithospermic acid is reported, which exploits two successive C–H activation reactions as the key steps. Rh-catalyzed carbene C–H insertion reaction using Davies’ catalyst built the dihydrobenzofuran core, and a late-stage intermolecular C–H olefination coupled the olefin unit with the dihydrobenzofuran core to construct the molecule in a highly convergent manner. PMID:21443224
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The origins of the directionality of noncovalent intermolecular interactions.
Wang, Changwei; Guan, Liangyu; Danovich, David; Shaik, Sason; Mo, Yirong
2016-01-05
The recent σ-hole concept emphasizes the contribution of electrostatic attraction to noncovalent bonds, and implies that the electrostatic force has an angular dependency. Here a set of clusters, which includes hydrogen bonding, halogen bonding, chalcogen bonding, and pnicogen bonding systems, is investigated to probe the magnitude of covalency and its contribution to the directionality in noncovalent bonding. The study is based on the block-localized wavefunction (BLW) method that decomposes the binding energy into the steric and the charge transfer (CT) (hyperconjugation) contributions. One unique feature of the BLW method is its capability to derive optimal geometries with only steric effect taken into account, while excluding the CT interaction. The results reveal that the overall steric energy exhibits angular dependency notably in halogen bonding, chalcogen bonding, and pnicogen bonding systems. Turning on the CT interactions further shortens the intermolecular distances. This bond shortening enhances the Pauli repulsion, which in turn offsets the electrostatic attraction, such that in the final sum, the contribution of the steric effect to bonding is diminished, leaving the CT to dominate the binding energy. In several other systems particularly hydrogen bonding systems, the steric effect nevertheless still plays the major role whereas the CT interaction is minor. However, in all cases, the CT exhibits strong directionality, suggesting that the linearity or near linearity of noncovalent bonds is largely governed by the charge-transfer interaction whose magnitude determines the covalency in noncovalent bonds. © 2015 Wiley Periodicals, Inc.
Anda, André; De Vico, Luca; Hansen, Thorsten
2017-06-08
Light-harvesting system 2 (LH2) executes the primary processes of photosynthesis in purple bacteria; photon absorption, and energy transportation to the reaction center. A detailed mechanistic insight into these operations is obscured by the complexity of the light-harvesting systems, particularly by the chromophore-environment interaction. In this work, we focus on the effects of the protein residues that are ligated to the bacteriochlorophylls (BChls) and construct potential energy surfaces of the ground and first optically excited state for the various BChl-residue systems where we in each case consider two degrees of freedom in the intermolecular region. We find that the excitation energies are only slightly affected by the considered modes. In addition, we see that axial ligands and hydrogen-bonded residues have opposite effects on both excitation energies and oscillator strengths by comparing to the isolated BChls. Our results indicate that only a small part of the chromophore-environment interaction can be associated with the intermolecular region between a BChl and an adjacent residue, but that it may be possible to selectively raise or lower the excitation energy at the axial and planar residue positions, respectively.
Directory of Open Access Journals (Sweden)
Javier Francos
2017-11-01
Full Text Available The metal-catalyzed addition of carboxylic acids to alkynes is a very effective tool for the synthesis of carboxylate-functionalized olefinic compounds in an atom-economical manner. Thus, a large variety of synthetically useful lactones and enol-esters can be accessed through the intra- or intermolecular versions of this process. In order to reduce the environmental impact of these reactions, considerable efforts have been devoted in recent years to the development of catalytic systems able to operate in aqueous media, which represent a real challenge taking into account the tendency of alkynes to undergo hydration in the presence of transition metals. Despite this, different Pd, Pt, Au, Cu and Ru catalysts capable of promoting the intra- and intermolecular addition of carboxylic acids to alkynes in a selective manner in aqueous environments have appeared in the literature. In this review article, an overview of this chemistry is provided. The synthesis of β-oxo esters by catalytic addition of carboxylic acids to terminal propargylic alcohols in water is also discussed.
International Nuclear Information System (INIS)
Machida, S; Hirai, H; Kawamura, T; Yamamoto, Y; Yagi, T
2010-01-01
High-pressure experiments of hydrogen hydrate were performed using a diamond anvil cell under conditions of 0.1-44.2 GPa and at room temperature. Also, high pressure Raman studies of solid hydrogen were performed in the pressure range of 0.1-43.7 GPa. X-ray diffractometry (XRD) for hydrogen hydrate revealed that a known high-pressure structure, filled ice Ic structure, of hydrogen hydrate transformed to a new high-pressure structure at approximately 35-40 GPa. A comparison of the Raman spectroscopy of a vibron for hydrogen molecules between hydrogen hydrate and solid hydrogen revealed that the extraction of hydrogen molecules from hydrogen hydrate occurred above 20 GPa. Also, the Raman spectra of a roton revealed that the rotation of hydrogen molecules in hydrogen hydrate was suppressed at around 20 GPa and that the rotation recovered under higher pressure. These results indicated that remarkable intermolecular interactions in hydrogen hydrate between neighboring hydrogen molecules and between guest hydrogen molecules and host water molecules might occur. These intermolecular interactions could produce the stability of hydrogen hydrate.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Vallavoju, Nandini; Selvakumar, Sermadurai; Pemberton, Barry C; Jockusch, Steffen; Sibi, Mukund P; Sivaguru, Jayaraman
2016-04-25
Mechanistic investigations of the intermolecular [2+2] photocycloaddition of coumarin with tetramethylethylene mediated by thiourea catalysts reveal that the reaction is enabled by a combination of minimized aggregation, enhanced intersystem crossing, and altered excited-state lifetime(s). These results clarify how the excited-state reactivity can be manipulated through catalyst-substrate interactions and reveal a third mechanistic pathway for thiourea-mediated organo-photocatalysis. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
Energy Technology Data Exchange (ETDEWEB)
He, Zhiqiang; Liu, Jinrong; Zhang, Jianbin; Zhang, Na [Inner Mongolia University of Technology, Huhhot (China)
2014-03-15
Poly-Ethylene Glycol (PEG) 300+H{sub 2}O solutions (PEGWs) has been used as a promising medium for the absorption of SO{sub 2}. We investigated the UV, FTIR, {sup 1}H-NMR, and fluorescence spectra in the absorption processes of SO{sub 2} in PEGWs to present an important absorption mechanism. Based on the spectral results, the possibility of intermolecular hydrogen bond formation by hydroxyl oxygen atom in the PEG molecule with hydrogen atom in H{sub 2}O and S…O interaction formation by the oxygen atoms in PEG with the sulfur atom in SO{sub 2} are discussed. This shows that the spectral changes may be due to the formation of -CH{sub 2}CH{sub 2}O(H)…HOH… and -CH{sub 2}-CH{sub 2}-O(CH{sub 2}-CH{sub 2}-)…HOH… in PEGWs and the formation of -CH{sub 2}CH{sub 2}OH…OSO…, and intermolecular S…O interaction between PEG and SO{sub 2} as the formation of -CH{sub 2}CH{sub 2}OCH{sub 2}CH{sub 2}O(H)…(O)S(O)… and -CH{sub 2}-CH{sub 2}-O(CH{sub 2}-CH{sub 2}-) …(O)S(O)…. The existence of these bonds benefits the absorption and desorption processes of SO{sub 2} in PEGWs.
Gu, Jianmin; Yin, Baipeng; Fu, Shaoyan; Jin, Cuihong; Liu, Xin; Bian, Zhenpan; Li, Jianjun; Wang, Lu; Li, Xiaoyu
2018-03-01
Due to the intense influence of the shape and size of the photon building blocks on the limitation and guidance of optical waves, an important strategy is the fabrication of different structures. Herein, organic semiconductor tris-(8-hydroxyquinoline)aluminium (Alq3) nanostructures with controllable morphology, ranging from one-dimensional nanowires to two-dimensional plates, have been prepared through altering intermolecular interactions with employing the anti-solvent diffusion cooperate with solvent-volatilization induced self-assembly method. The morphologies of the formed nanostructures, which are closely related to the stacking modes of the molecules, can be exactly controlled by altering the polarity of anti-solvents that can influence various intermolecular interactions. The synthesis strategy reported here can potentially be extended to other functional organic nanomaterials.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
International Nuclear Information System (INIS)
Almeida, Ana R.R.P.; Monte, Manuel J.S.
2014-01-01
Highlights: • Vapour pressures of 1-methyl derivatives of benzimidazole, pyrazole and indole. • Enthalpies, entropies and Gibbs free energies of sublimation/vaporisation were derived. • Temperatures and enthalpies of fusion were determined. • Energy of the intermolecular hydrogen bond N-H⋯N was estimated. - Abstract: The vapour pressures of the liquid phase of 1-methylpyrazole, 1-methylbenzimidazole and 1-methylindole were measured over the temperature ranges (253.9 to 293.3) K, (303.2 to 372.5) K, and (268.6 to 341.9) K, respectively, using a static method. The vapour pressures of the crystalline phase of the two latter compounds were also measured at temperatures between (301.2 to 328.9) K and (267.6 to 275.5) K, respectively. The results obtained enabled the determination of the standard molar enthalpies and entropies of sublimation and of vaporisation at the mean temperatures of the measurements and at T = 298.15 K. The temperatures and molar enthalpies of fusion were determined using differential scanning calorimetry. The enthalpies of the intermolecular hydrogen bonds N-H⋯N in the crystalline phase of benzimidazole and pyrazole were determined and compared with the result previously determined for the energy of the intermolecular hydrogen bond in crystalline imidazole
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel
2015-01-01
In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C
2014-07-30
Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Güloğlu, Pınar; Acar, Nursel, E-mail: nursel.acar@ege.edu.tr
2016-10-20
Highlights: • Intermolecular interactions of pyrene with phenothiazine/promazine were investigated. • All investigated systems were optimized at ωB97XD/6-31G(d,p) level in gas phase. • The electronic transitions were determined using frontier orbitals. • Both Py–Pheno and Py–Prom are potential candidates for charge transfer systems. - Abstract: The intermolecular interactions between the pyrene (Py) (as acceptor) and phenothiazine (Pheno), promazine (Prom) (as donors) were investigated using UV/Vis absorption and fluorescence spectroscopy. Fluorescence quenching rate constants for Py–Pheno and Py–Prom systems have been calculated approximately 10{sup 10} M{sup −1} s{sup −1}, indicating diffusion controlled processes. A computational investigation has also been carried out in gas phase at ωB97XD/6-31G(d,p) level. Time-dependent density functional theory (TDDFT) was used to calculate the electronic transitions of molecules at B3LYP/6-311++G(d,p) level. Total electronic energies, complexation energies, free energy differences, excitation wavelengths, and HOMO–LUMO energy gaps are discussed in gas phase. Analyses of first excited singlet states have indicated charge transfers transitions between Py and Pheno, Prom through π–π stacking in gas phase at 433 nm and 466 nm, respectively. Due to its charge transfer character, Py–Pheno and Py–Prom systems seem to be appropriate models to investigate and design photosensitive materials.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Jiang, Li-lin; Liu, Wei-long; Song, Yun-fei; He, Xing; Wang, Yang; Wang, Chang; Wu, Hong-lin; Yang, Fang; Yang, Yan-qiang
2014-01-01
Highlights: • Mechanism of PIET reaction process for the Rh101 + /DEA system is investigated. • The significant geometrical changes of the charge–transfer complex are explained. • Forward Electron transfer from DEA to Rh101 +∗ occurs with lifetime of 425–560 fs. • Backward electron transfer occurs with a time constant of 46.16–51.40 ps. • Intramolecular vibrational relaxation occurs with lifetime of 2.77–5.39 ps. - Abstract: The ultrafast photoinduced intermolecular electron transfer (PIET) reaction of Rhodamine 101 (Rh101 + ) in N,N-diethylaniline (DEA) was investigated using off-resonance Raman, femtosecond time-resolved multiplex transient grating (TG) and transient absorption (TA) spectroscopies. The Raman spectra indicate that the C=C stretching vibration of the chromophore aromatic ring is more sensitive to ET compared with the C-C stretching mode. The ultrafast photoinduced intermolecular forward ET (FET) from DEA to Rh101 +∗ occurs on a time scale of τ FET = 425–560 fs. The backward ET (BET) occurs in the inverted region with a time constant of τ BET = 46.16–51.40 ps. The intramolecular vibrational relaxation (IVR) process occurs on the excited state potential energy surface with the time constant of τ IVR = 2.77–5.39 ps
Intermolecular Interactions in Ternary Glycerol–Sample–H2O
DEFF Research Database (Denmark)
Westh, Peter; Rasmussen, Erik Lumby; Koga, Yoshikata
2011-01-01
We studied the intermolecular interactions in ternary glycerol (Gly)–sample (S)–H2O systems at 25 °C. By measuring the excess partial molar enthalpy of Gly, HGlyEHEGly, we evaluated the Gly–Gly enthalpic interaction, HGly-GlyEHEGly--Gly, in the presence of various samples (S). For S, tert...... little effect on HGly-GlyEHEGly--Gly. This contrasts with our earlier studies on 1P–S–H2O in that Na+, F− and Cl− are found as hydration centers from the induced changes on HIP-IPEHEIP--IP in the presence of S, while Br−, I−, and SCN− are found to act as hydrophiles. In comparison with the Hofmeister...... ranking of these ions, the kosmotropes are hydration centers and the more kosmotropic the higher the hydration number, consistent with the original Hofmeister’s concept of “H2O withdrawing power.” Br−, I− and SCN−, on the other hand, acted as hydrophiles and the more chaotropic they are the more...
International Nuclear Information System (INIS)
Tang, Chun; Clore, G. Marius
2006-01-01
A simple and reliable approach for docking protein-protein complexes from very sparse NOE-derived intermolecular distance restraints (as few as three from a single point) in combination with a novel representation for an attractive potential between mapped interaction surfaces is described. Unambiguous assignments of very sparse intermolecular NOEs are obtained using a reverse labeling strategy in which one the components is fully deuterated with the exception of selective protonation of the δ-methyl groups of isoleucine, while the other component is uniformly 13 C-labeled. This labeling strategy can be readily extended to selective protonation of Ala, Leu, Val or Met. The attractive potential is described by a 'reduced' radius of gyration potential applied specifically to a subset of interfacial residues (those with an accessible surface area ≥ 50% in the free proteins) that have been delineated by chemical shift perturbation. Docking is achieved by rigid body minimization on the basis of a target function comprising the sparse NOE distance restraints, a van der Waals repulsion potential and the 'reduced' radius of gyration potential. The method is demonstrated for two protein-protein complexes (EIN-HPr and IIA Glc -HPr) from the bacterial phosphotransferase system. In both cases, starting from 100 different random orientations of the X-ray structures of the free proteins, 100% convergence is achieved to a single cluster (with near identical atomic positions) with an overall backbone accuracy of ∼2 A. The approach described is not limited to NMR, since interfaces can also be mapped by alanine scanning mutagenesis, and sparse intermolecular distance restraints can be derived from double cycle mutagenesis, cross-linking combined with mass spectrometry, or fluorescence energy transfer
Mapping the force field of a hydrogen-bonded assembly
Sweetman, A. M.; Jarvis, S. P.; Sang, Hongqian; Lekkas, I.; Rahe, P.; Wang, Yu; Wang, Jianbo; Champness, N. R.; Kantorovich, L.; Moriarty, P.
2014-05-01
Hydrogen bonding underpins the properties of a vast array of systems spanning a wide variety of scientific fields. From the elegance of base pair interactions in DNA to the symmetry of extended supramolecular assemblies, hydrogen bonds play an essential role in directing intermolecular forces. Yet fundamental aspects of the hydrogen bond continue to be vigorously debated. Here we use dynamic force microscopy (DFM) to quantitatively map the tip-sample force field for naphthalene tetracarboxylic diimide molecules hydrogen-bonded in two-dimensional assemblies. A comparison of experimental images and force spectra with their simulated counterparts shows that intermolecular contrast arises from repulsive tip-sample interactions whose interpretation can be aided via an examination of charge density depletion across the molecular system. Interpreting DFM images of hydrogen-bonded systems therefore necessitates detailed consideration of the coupled tip-molecule system: analyses based on intermolecular charge density in the absence of the tip fail to capture the essential physical chemistry underpinning the imaging mechanism.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS
Directory of Open Access Journals (Sweden)
Editorial Foreword
2015-12-01
Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain
Wang, Hui; Liu, Ju; Wang, Weizhou
2018-02-14
Single-crystal X-ray diffraction reveals that polymorphic ortho-nitrophenyl selenocyanate (o-NSC, crystals 1a and 1b) and monomorphic para-nitrophenyl selenocyanate (p-NSC, crystal 2) crystals are all stabilized mainly by intermolecular and very strong intramolecular C-SeO/N chalcogen bonds, as well as by other different interactions. Thermogravimetric (TG) and differential scanning calorimetry thermogram (DSC) analyses show that the starting decomposition temperatures and melting points of the three crystals are different, following the order 1b > 1a > 2, which is consistent with the structural characteristics of the crystals. In addition, atoms in molecules (AIM) and natural bond orbital (NBO) analyses indicate that the total strengths of the C-SeO and C-SeN chalcogen bonds decrease in the order 1b > 1a > 2. This study could be significant for engineering functional crystals based on robust C-SeO and C-SeN chalcogen bonds, and for designing drugs containing selenium as well as understanding their interaction in biosystems.
Intermolecular symmetry-adapted perturbation theory study of large organic complexes
International Nuclear Information System (INIS)
Heßelmann, Andreas; Korona, Tatiana
2014-01-01
Binding energies for the complexes of the S12L database by Grimme [Chem. Eur. J. 18, 9955 (2012)] were calculated using intermolecular symmetry-adapted perturbation theory combined with a density-functional theory description of the interacting molecules. The individual interaction energy decompositions revealed no particular change in the stabilisation pattern as compared to smaller dimer systems at equilibrium structures. This demonstrates that, to some extent, the qualitative description of the interaction of small dimer systems may be extrapolated to larger systems, a method that is widely used in force-fields in which the total interaction energy is decomposed into atom-atom contributions. A comparison of the binding energies with accurate experimental reference values from Grimme, the latter including thermodynamic corrections from semiempirical calculations, has shown a fairly good agreement to within the error range of the reference binding energies
INS study of intermolecular interaction at the silicone-fumed silica interface
International Nuclear Information System (INIS)
Sheka, E.F.; Natkaniec, I.
1999-01-01
Complete text of publication follows. The paper presents results related to the interface formed between finned silica particles and polydimethylsiloxane polymers, presented in the study by a five-member cyclic oligomer SiS. The substrate surface is terminated by either hydroxyl units or by trimethylsiloxy ones. When the interface is formed, methyl units are the main constituents providing neutron scattering. Protium/deuterium exchange has been used to distinguish the latter belonging to either adsorbate or substrate. A detailed analysis of the intermolecular interaction impact on both adsorbed molecule and substrate has been performed. The observed features are supported by the vibrational spectra calculations performed on the basis of a modem quantum-chemical approach and supplemented by the solution of the inverse spectral problem. (author)
Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan
2016-01-01
It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...
Czech Academy of Sciences Publication Activity Database
Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír
2016-01-01
Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016
Generalized pairing strategies-a bridge from pairing strategies to colorings
Directory of Open Access Journals (Sweden)
Győrffy Lajos
2016-12-01
Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.
Multi-user distribution of polarization entangled photon pairs
Energy Technology Data Exchange (ETDEWEB)
Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)
2015-10-14
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.
Basset, Jean-Marie
2016-06-09
The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.
DEFF Research Database (Denmark)
Medjanik, K.; Perkert, S.; Naghavi, S.
2010-01-01
Ultrahigh vacuum (UHV)-deposited films of the mixed phase of tetramethoxypyrene and tetracyanoquinodimethane (TMP -TCNQ ) on gold have been studied using ultraviolet photoelectron spectroscopy (UPS), x-ray diffraction (XRD), infrared (IR) spectroscopy, and scanning tunneling spectroscopy (STS......). The formation of an intermolecular charge-transfer (CT) compound is evident from the appearance of new reflexes in XRD (d =0.894nm and d =0.677nm). A softening of the CN stretching vibration (redshift by 7 cm⊃-1) of TCNQ is visible in the IR spectra, being indicative of a CT on the order of 0.3e from TMP...
Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G
To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Energy Technology Data Exchange (ETDEWEB)
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)
2015-07-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2015-03-01
Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Error-correcting pairs for a public-key cryptosystem
International Nuclear Information System (INIS)
Pellikaan, Ruud; Márquez-Corbella, Irene
2017-01-01
Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
Mönig, Harry; Amirjalayer, Saeed; Timmer, Alexander; Hu, Zhixin; Liu, Lacheng; Díaz Arado, Oscar; Cnudde, Marvin; Strassert, Cristian Alejandro; Ji, Wei; Rohlfing, Michael; Fuchs, Harald
2018-05-01
Atomic force microscopy is an impressive tool with which to directly resolve the bonding structure of organic compounds1-5. The methodology usually involves chemical passivation of the probe-tip termination by attaching single molecules or atoms such as CO or Xe (refs 1,6-9). However, these probe particles are only weakly connected to the metallic apex, which results in considerable dynamic deflection. This probe particle deflection leads to pronounced image distortions, systematic overestimation of bond lengths, and in some cases even spurious bond-like contrast features, thus inhibiting reliable data interpretation8-12. Recently, an alternative approach to tip passivation has been used in which slightly indenting a tip into oxidized copper substrates and subsequent contrast analysis allows for the verification of an oxygen-terminated Cu tip13-15. Here we show that, due to the covalently bound configuration of the terminal oxygen atom, this copper oxide tip (CuOx tip) has a high structural stability, allowing not only a quantitative determination of individual bond lengths and access to bond order effects, but also reliable intermolecular bond characterization. In particular, by removing the previous limitations of flexible probe particles, we are able to provide conclusive experimental evidence for an unusual intermolecular N-Au-N three-centre bond. Furthermore, we demonstrate that CuOx tips allow the characterization of the strength and configuration of individual hydrogen bonds within a molecular assembly.
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Graham, Kenneth; Cabanetos, Clement; Jahnke, Justin P.; Idso, Matthew N.; El Labban, Abdulrahman; Ngongang Ndjawa, Guy Olivier; Heumueller, Thomas; Vandewal, Koen; Salleo, Alberto; Chmelka, Bradley F.; Amassian, Aram; Beaujuge, Pierre; McGehee, Michael D.
2014-01-01
The performance of organic photovoltaic (OPV) material systems are hypothesized to depend strongly on the intermolecular arrangements at the donor:fullerene interfaces. A review of some of the most efficient polymers utilized in polymer:fullerene PV devices, combined with an analysis of reported polymer donor materials wherein the same conjugated backbone was used with varying alkyl substituents, supports this hypothesis. Specifically, the literature shows that higher-performing donor-acceptor type polymers generally have acceptor moieties that are sterically accessible for interactions with the fullerene derivative, whereas the corresponding donor moieties tend to have branched alkyl substituents that sterically hinder interactions with the fullerene. To further explore the idea that the most beneficial polymer:fullerene arrangement involves the fullerene docking with the acceptor moiety, a family of benzo[1,2-b:4,5-b]dithiophene-thieno[3,4-c]pyrrole-4,6-dione polymers (PBDTTPD derivatives) was synthesized and tested in a variety of PV device types with vastly different aggregation states of the polymer. In agreement with our hypothesis, the PBDTTPD derivative with a more sterically accessible acceptor moiety and a more sterically hindered donor moiety shows the highest performance in bulk-heterojunction, bilayer, and low-polymer concentration PV devices where fullerene derivatives serve as the electron-accepting materials. Furthermore, external quantum efficiency measurements of the charge-transfer state and solid-state two-dimensional (2D) 13C{1H} heteronuclear correlation (HETCOR) NMR analyses support that a specific polymer:fullerene arrangement is present for the highest performing PBDTTPD derivative, in which the fullerene is in closer proximity to the acceptor moiety of the polymer. This work demonstrates that the polymer:fullerene arrangement and resulting intermolecular interactions may be key factors in determining the performance of OPV material systems
Graham, Kenneth
2014-07-09
The performance of organic photovoltaic (OPV) material systems are hypothesized to depend strongly on the intermolecular arrangements at the donor:fullerene interfaces. A review of some of the most efficient polymers utilized in polymer:fullerene PV devices, combined with an analysis of reported polymer donor materials wherein the same conjugated backbone was used with varying alkyl substituents, supports this hypothesis. Specifically, the literature shows that higher-performing donor-acceptor type polymers generally have acceptor moieties that are sterically accessible for interactions with the fullerene derivative, whereas the corresponding donor moieties tend to have branched alkyl substituents that sterically hinder interactions with the fullerene. To further explore the idea that the most beneficial polymer:fullerene arrangement involves the fullerene docking with the acceptor moiety, a family of benzo[1,2-b:4,5-b]dithiophene-thieno[3,4-c]pyrrole-4,6-dione polymers (PBDTTPD derivatives) was synthesized and tested in a variety of PV device types with vastly different aggregation states of the polymer. In agreement with our hypothesis, the PBDTTPD derivative with a more sterically accessible acceptor moiety and a more sterically hindered donor moiety shows the highest performance in bulk-heterojunction, bilayer, and low-polymer concentration PV devices where fullerene derivatives serve as the electron-accepting materials. Furthermore, external quantum efficiency measurements of the charge-transfer state and solid-state two-dimensional (2D) 13C{1H} heteronuclear correlation (HETCOR) NMR analyses support that a specific polymer:fullerene arrangement is present for the highest performing PBDTTPD derivative, in which the fullerene is in closer proximity to the acceptor moiety of the polymer. This work demonstrates that the polymer:fullerene arrangement and resulting intermolecular interactions may be key factors in determining the performance of OPV material systems
The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA
Czech Academy of Sciences Publication Activity Database
Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.
2002-01-01
Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2013-01-01
of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Energy Technology Data Exchange (ETDEWEB)
Tang, Chun; Clore, G. Marius [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)], E-mail: mariusc@intra.niddk.nih.gov
2006-09-15
A simple and reliable approach for docking protein-protein complexes from very sparse NOE-derived intermolecular distance restraints (as few as three from a single point) in combination with a novel representation for an attractive potential between mapped interaction surfaces is described. Unambiguous assignments of very sparse intermolecular NOEs are obtained using a reverse labeling strategy in which one the components is fully deuterated with the exception of selective protonation of the {delta}-methyl groups of isoleucine, while the other component is uniformly {sup 13}C-labeled. This labeling strategy can be readily extended to selective protonation of Ala, Leu, Val or Met. The attractive potential is described by a 'reduced' radius of gyration potential applied specifically to a subset of interfacial residues (those with an accessible surface area {>=} 50% in the free proteins) that have been delineated by chemical shift perturbation. Docking is achieved by rigid body minimization on the basis of a target function comprising the sparse NOE distance restraints, a van der Waals repulsion potential and the 'reduced' radius of gyration potential. The method is demonstrated for two protein-protein complexes (EIN-HPr and IIA{sup Glc}-HPr) from the bacterial phosphotransferase system. In both cases, starting from 100 different random orientations of the X-ray structures of the free proteins, 100% convergence is achieved to a single cluster (with near identical atomic positions) with an overall backbone accuracy of {approx}2 A. The approach described is not limited to NMR, since interfaces can also be mapped by alanine scanning mutagenesis, and sparse intermolecular distance restraints can be derived from double cycle mutagenesis, cross-linking combined with mass spectrometry, or fluorescence energy transfer.
English for au pairs the au pair's guide to learning English
Curtis, Lucy
2014-01-01
English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.
Directory of Open Access Journals (Sweden)
Kateřina Klapilová
2014-01-01
Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.
International Nuclear Information System (INIS)
Karayel, A.; Özbey, S.; Ayhan-Kılcıgil, G.; Kuş, C.
2015-01-01
The crystal structures of 5-(2-(p-chlorophenylbenzimidazol-1-yl-methyl)-4-(3-fluorophenyl)-2, 4-dihydro-[1,2,4]-triazole-3-thione (G6C) and 5-(2-(p-chlorophenylbenzimidazol-1-yl-methyl)-4-(2-methylphenyl)-2, 4-dihydro-[1,2,4]-triazole-3-thione (G4C) have been determined by single-crystal X-ray diffraction. Benzimidazole ring systems in both molecules are planar. The triazole part is almost perpendicular to the phenyl and the benzimidazole parts of the molecules in order to avoid steric interactions between the rings. The crystal structures are stabilized by intermolecular hydrogen bonds between the amino group of the triazole and the nitrogen atom of benzimidazole of a neighboring molecule
Energy Technology Data Exchange (ETDEWEB)
Jiang, Li-lin [Department of Physics, Harbin Institute of Technology, Harbin 150001 (China); School of Mechanical and Electronic Engineering, Hezhou University, Hezhou 542800 (China); Liu, Wei-long; Song, Yun-fei; He, Xing; Wang, Yang; Wang, Chang; Wu, Hong-lin [Department of Physics, Harbin Institute of Technology, Harbin 150001 (China); Yang, Fang [National Key Laboratory of Science and Technology on Tunable Laser, Department of Optoelectronics Information Science Technology, Harbin Institute of Technology, Harbin 150001 (China); Yang, Yan-qiang, E-mail: yqyang@hit.edu.cn [Department of Physics, Harbin Institute of Technology, Harbin 150001 (China); National Key Laboratory of Shock Wave and Detonation Physics, Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang 621900, Sichuan (China)
2014-01-31
Highlights: • Mechanism of PIET reaction process for the Rh101{sup +}/DEA system is investigated. • The significant geometrical changes of the charge–transfer complex are explained. • Forward Electron transfer from DEA to Rh101{sup +∗} occurs with lifetime of 425–560 fs. • Backward electron transfer occurs with a time constant of 46.16–51.40 ps. • Intramolecular vibrational relaxation occurs with lifetime of 2.77–5.39 ps. - Abstract: The ultrafast photoinduced intermolecular electron transfer (PIET) reaction of Rhodamine 101 (Rh101{sup +}) in N,N-diethylaniline (DEA) was investigated using off-resonance Raman, femtosecond time-resolved multiplex transient grating (TG) and transient absorption (TA) spectroscopies. The Raman spectra indicate that the C=C stretching vibration of the chromophore aromatic ring is more sensitive to ET compared with the C-C stretching mode. The ultrafast photoinduced intermolecular forward ET (FET) from DEA to Rh101{sup +∗} occurs on a time scale of τ{sub FET} = 425–560 fs. The backward ET (BET) occurs in the inverted region with a time constant of τ{sub BET} = 46.16–51.40 ps. The intramolecular vibrational relaxation (IVR) process occurs on the excited state potential energy surface with the time constant of τ{sub IVR} = 2.77–5.39 ps.
Mu, Zhongcheng; Shao, Qi; Ye, Jun; Zeng, Zebing; Zhao, Yang; Hng, Huey Hoon; Boey, Freddy Yin Chiang; Wu, Jishan; Chen, Xiaodong
2011-02-15
Two-dimensional (2D) supramolecular assemblies of a series of novel C(3)-symmetric hexa-peri-hexabenzocoronene (HBC) derivatives bearing different substituents adsorbed on highly oriented pyrolytic graphite were studied by using scanning tunneling microscopy at a solid-liquid interface. It was found that the intermolecular dipole-dipole interactions play a critical role in controlling the interfacial supramolecular assembly of these C(3)-symmetric HBC derivatives at the solid-liquid interface. The HBC molecule bearing three -CF(3) groups could form 2D honeycomb structures because of antiparallel dipole-dipole interactions, whereas HBC molecules bearing three -CN or -NO(2) groups could form hexagonal superstructures because of a special trimeric arrangement induced by dipole-dipole interactions and weak hydrogen bonding interactions ([C-H···NC-] or [C-H···O(2)N-]). Molecular mechanics and dynamics simulations were performed to reveal the physics behind the 2D structures as well as detailed functional group interactions. This work provides an example of how intermolecular dipole-dipole interactions could enable fine control over the self-assembly of disklike π-conjugated molecules.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2014-01-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping
2016-02-22
We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.
Dielectric behaviour and intermolecular association between L(+) ascorbic acid and ethanol
International Nuclear Information System (INIS)
Rudyk, R.A.; Torres, M.C.; Acuna Molina, M.A.
1990-01-01
In order to determine the dipole moment of L(+) ascorbic acid and the relation to its structure the experimental variations of permitivities, refractive indices and specific volumes of a series of dilute ethanolic solutions at 25 deg C were examined. The average moment (μ) using Buckingham equation was found to be 5,58 D considering the spherical approximation and 7,81 D if the ellipsoidal form factor was considered. The calculated μ value through vectorial addition was 4,98 D. The solute partial molal volume in the studied range was calculated to be 94,73 cm 3 instead of the theoretical value of 106,71 cm 3 . Both discrepancies are attributed to intermolecular solute-solvent interactions. A possible electronic displacement which favours hydrogen bonding with the solvent is postulated. (Author) [es
McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F
2014-04-01
Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation
Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.
2011-01-01
Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.
Small angle X-ray scattering on concentrated hemoglobin solutions
International Nuclear Information System (INIS)
Zinke, M.; Damaschun, G.; Mueller, J.J.; Ruckpaul, K.
1978-01-01
The small-angle X-ray scattering technique was used to determine the intermolecular structure and interaction potentials in oxi-and deoxi-hemoglobin solutions. The pair correlation function obtained by the ZERNICKE-PRINS equation characterizes the intermolecular structure of the hemoglobin molecules. The intermolecular structure is concentration dependent. The hemoglobin molecules have a 'short range order structure' with a range of about 4 molecule diameters at 324 g/l. The potential functions of the hemoglobin-hemoglobin interaction have been determined on the basis of fluid theories. Except for the deoxi-hemoglobin solution having the concentration 370 g/l, the pair interaction consists in a short repulsion and a weak short-range attraction against kT. The potential minimum is between 1.2 - 1.5 nm above the greatest hemoglobin diameter. (author)
Thermodynamics of pairing phase transition in nuclei
International Nuclear Information System (INIS)
Karim, Afaque; Ahmad, Shakeb
2014-01-01
The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied
Ion-pair chromatography of nucleic acid derivatives
International Nuclear Information System (INIS)
Perrone, P.A.; Brown, P.R.
1985-01-01
Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented
Energy Technology Data Exchange (ETDEWEB)
Christensen, Anders S., E-mail: andersx@chem.wisc.edu, E-mail: cui@chem.wisc.edu; Cui, Qiang, E-mail: andersx@chem.wisc.edu, E-mail: cui@chem.wisc.edu [Department of Chemistry, University of Wisconsin-Madison, 1101 University Ave., Madison, Wisconsin 53706 (United States); Elstner, Marcus [Theoretische Chemische Biologie, Universität Karlsruhe, Kaiserstr. 12, 76131 Karlsruhe (Germany)
2015-08-28
Semi-empirical quantum mechanical methods traditionally expand the electron density in a minimal, valence-only electron basis set. The minimal-basis approximation causes molecular polarization to be underestimated, and hence intermolecular interaction energies are also underestimated, especially for intermolecular interactions involving charged species. In this work, the third-order self-consistent charge density functional tight-binding method (DFTB3) is augmented with an auxiliary response density using the chemical-potential equalization (CPE) method and an empirical dispersion correction (D3). The parameters in the CPE and D3 models are fitted to high-level CCSD(T) reference interaction energies for a broad range of chemical species, as well as dipole moments calculated at the DFT level; the impact of including polarizabilities of molecules in the parameterization is also considered. Parameters for the elements H, C, N, O, and S are presented. The Root Mean Square Deviation (RMSD) interaction energy is improved from 6.07 kcal/mol to 1.49 kcal/mol for interactions with one charged species, whereas the RMSD is improved from 5.60 kcal/mol to 1.73 for a set of 9 salt bridges, compared to uncorrected DFTB3. For large water clusters and complexes that are dominated by dispersion interactions, the already satisfactory performance of the DFTB3-D3 model is retained; polarizabilities of neutral molecules are also notably improved. Overall, the CPE extension of DFTB3-D3 provides a more balanced description of different types of non-covalent interactions than Neglect of Diatomic Differential Overlap type of semi-empirical methods (e.g., PM6-D3H4) and PBE-D3 with modest basis sets.
Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric
2005-03-10
Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Directory of Open Access Journals (Sweden)
Maréchal Eric
2005-03-01
Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
International Nuclear Information System (INIS)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.
2012-01-01
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
Energy Technology Data Exchange (ETDEWEB)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)
2012-04-15
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino
Energy Technology Data Exchange (ETDEWEB)
Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)
2017-08-15
The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)
International Nuclear Information System (INIS)
Straehle, U.; Klock, G.; Schuetz, G.
1987-01-01
To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.
2013-01-01
We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of
Adiabatic pair creation in heavy-ion and laser fields
International Nuclear Information System (INIS)
Pickl, P.; Durr, D.
2008-01-01
The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)
Sagan, Bruce E.; Savage, Carla D.
2012-01-01
We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...
Lax pairs: a novel type of separability
International Nuclear Information System (INIS)
Fokas, A S
2009-01-01
An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)
Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability
Directory of Open Access Journals (Sweden)
Yanli Ren
2017-01-01
Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.
Pair-correlations in swimmer suspensions
Nambiar, Sankalp; Subramanian, Ganesh
2017-11-01
Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Ponderomotive effects in multiphoton pair production
Kohlfürst, Christian; Alkofer, Reinhard
2018-02-01
The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.
Energy Technology Data Exchange (ETDEWEB)
Yourshaw, Ivan [Univ. of California, Berkeley, CA (United States)
1998-07-09
The diatomic halogen atom-rare gas diatomic complexes KrBr-, XeBr-, and KrCl- are studied in this work by zero electron kinetic energy (ZEKE) spectroscopy in order to characterize the weak intermolecular diatomic potentials of these species. Also, the ZEKE and threshold photodetachment spectra of the polyatomic clusters ArnBr- (n = 2-9) and ArnI- (n = 2-19) are studied to obtain information about the non-additive effects on the interactions among the atoms. This work is part of an ongoing effort to characterize the pair and many-body potentials of the complete series of rare gas halide clusters. In these studies we obtain information about both the anionic and neutral clusters.
Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions
Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang
2018-01-01
We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Gajewski, Andrzej; Kolenderski, Piotr L.
2016-10-01
There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the
International Nuclear Information System (INIS)
Shimizu, Yoshifumi
2009-01-01
Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)
International Nuclear Information System (INIS)
Feng, Lejun; Zheng, Danxing; Huang, Weijia
2016-01-01
Highlights: • Three new working pairs are proposed for absorption power cycle. • Sync-measured the solubility and absorption enthalpy data at 303.15 K. • Thermokinetic experiment is consistent with the previous thermodynamics study. - Abstract: In this work, three new working pairs, {fluoroethane (HFC161) + dimethylether tetraethylene glycol (DMETEG)}, {HFC161 + dimethylether triethylene glycol (DMETrEG)} and {HFC161 + dimethylether diethylene glycol (DMEDEG)}, are proposed for absorption power cycle. The working pairs are assessed from both thermodynamics and thermokinetic perspective. By combining the microcalorimetry and isothermal synthesis methods, an experimental apparatus was developed to simultaneously obtain the microcalorimetry and vapour–liquid equilibrium data. Then, the solubility and absorption enthalpy data of the three new working pairs were sync-measured at 303.15 K by this sync-measurement experimental apparatus. The thermodynamics data indicated that the affinities of the three working pairs increased from strong to weak in the following order: HFC161 + DMETEG > HFC161 + DMETrEG > HFC161 + DMEDEG. Then the thermokinetic parameters of the absorption rate constant and activation energy were analysed based on the thermokinetic experiment at (303.15, 313.15, 323.15, and 333.15) K. As a result, the affinities of the three working pairs are consistent with the previous thermodynamics study. In addition, the intermolecular interactions within the three systems were analysed according to the intermolecular hydrogen bonds; overall, the (HFC161 + DMETEG) system is considered to be the potential option for applications.
Mechanism of Intermolecular Electron Transfer in Bionanostructures
Gruodis, A.; Galikova, N.; Šarka, K.; Saulė, R.; Batiuškaitė, D.; Saulis, G.
Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Most patients are inoperable and hepatoma cells are resistant to conventional chemotherapies. Thus, the development of novel therapies for HCC treatment is of paramount importance. Amongst different alimentary factors, vitamin C and vitamin K3 In the present work, it has been shown that the treatment of mouse hepatoma MH-22A cells by vitamin C and vitamin K3 at the ratio of 100:1 greatly enhanced their cytotoxicity. When cells were subjected to vitamin C at 200 μM or to vitamin K3 at 2 μM separately, their viability reduced by only about 10%. However, when vitamins C and K3 were combined at the same concentrations, they killed more than 90% of cells. To elucidate the mechanism of the synergistic cytotoxicity of the C&K3 mixture, theoretical quantum-chemical analysis of the dynamics of intermolecular electron transfer (IET) processes within the complexes containing C (five forms) and K3 (one form) has been carried out. Optimization of the ground state complex geometry has been provided by means of GAUSSIAN03 package. Simulation of the IET has been carried out using NUVOLA package, in the framework of molecular orbitals (MO). The rate of IET has been calculated using Fermi Golden rule. The results of simulations allow us to create the preliminary model of the reaction pathway.
Experimental many-pairs nonlocality
Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian
2017-08-01
Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.
Directory of Open Access Journals (Sweden)
Cia-Hin Lau
2012-01-01
Full Text Available Epistasis (gene-gene interaction is a ubiquitous component of the genetic architecture of complex traits such as susceptibility to common human diseases. Given the strong negative correlation between circulating adiponectin and resistin levels, the potential intermolecular epistatic interactions between ADIPOQ (SNP+45T > G, SNP+276G > T, SNP+639T > C and SNP+1212A > G and RETN (SNP-420C > G and SNP+299G > A gene polymorphisms in the genetic risk underlying type 2 diabetes (T2DM and metabolic syndrome (MS were assessed. The potential mutual influence of the ADIPOQ and RETN genes on their adipokine levels was also examined. The rare homozygous genotype (risk alleles of SNP-420C > G at the RETN locus tended to be co-inherited together with the common homozygous genotypes (protective alleles of SNP+639T > C and SNP+1212A > G at the ADIPOQ locus. Despite the close structural relationship between the ADIPOQ and RETN genes, there was no evidence of an intermolecular epistatic interaction between these genes. There was also no reciprocal effect of the ADIPOQ and RETN genes on their adipokine levels, i.e., ADIPOQ did not affect resistin levels nor did RETN affect adiponectin levels. The possible influence of the ADIPOQ gene on RETN expression warrants further investigation.
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2015-01-01
pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...
Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control
International Nuclear Information System (INIS)
Takeuchi, Shin
2005-01-01
A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures
Transverse Momentum Distributions for Heavy Quark Pairs
Berger, Edmond L.; Meng, Ruibin
1993-01-01
We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...
Isominkowskian theory of Cooper Pairs in superconductors
International Nuclear Information System (INIS)
Animalu, A.O.E.
1993-01-01
Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections
Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.
2007-01-01
The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…
DEFF Research Database (Denmark)
Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf
2009-01-01
We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...
Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory
Directory of Open Access Journals (Sweden)
Y. Chen
2015-11-01
Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.
Graph-based surface reconstruction from stereo pairs using image segmentation
Bleyer, Michael; Gelautz, Margrit
2005-01-01
This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.
Single-flavour and two-flavour pairing in three-flavour quark matter
International Nuclear Information System (INIS)
Alford, Mark G; Cowan, Greig A
2006-01-01
We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities
Simulation-based investigation of the paired-gear method in cod-end selectivity studies
DEFF Research Database (Denmark)
Herrmann, Bent; Frandsen, Rikke; Holst, René
2007-01-01
In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...
Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng
2015-03-28
A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).
Guo, Liyuan; Wang, Jing
2018-01-04
Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
1-(6-Chloro-2-methyl-4-phenylquinolin-3-yl-3-(3-methoxyphenylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
Wan-Sin Loh
2010-01-01
Full Text Available In the title compound, C26H20ClNO2, the quinoline ring system is approximately planar with a maximum deviation of 0.028 (2 Å and forms a dihedral angle of 73.84 (5° with the phenyl ring. Two neighbouring molecules are arranged into a centrosymmetric dimer through a pair of intermolecular C—H...Cl interactions. A pair of intermolecular C—H...O hydrogen bonds link two methoxyphenyl groups into another centrosymmetric dimer, generating an R22(8 ring motif. The structure is further stabilized by C—H...π interactions.
Oliva, Romina; Chermak, Edrisse; Cavallo, Luigi
2015-01-01
In view of the increasing interest both in inhibitors of protein-protein interactions and in protein drugs themselves, analysis of the three-dimensional structure of protein-protein complexes is assuming greater relevance in drug design. In the many cases where an experimental structure is not available, protein-protein docking becomes the method of choice for predicting the arrangement of the complex. However, reliably scoring protein-protein docking poses is still an unsolved problem. As a consequence, the screening of many docking models is usually required in the analysis step, to possibly single out the correct ones. Here, making use of exemplary cases, we review our recently introduced methods for the analysis of protein complex structures and for the scoring of protein docking poses, based on the use of inter-residue contacts and their visualization in inter-molecular contact maps. We also show that the ensemble of tools we developed can be used in the context of rational drug design targeting protein-protein interactions.
Oliva, Romina
2015-07-01
In view of the increasing interest both in inhibitors of protein-protein interactions and in protein drugs themselves, analysis of the three-dimensional structure of protein-protein complexes is assuming greater relevance in drug design. In the many cases where an experimental structure is not available, protein-protein docking becomes the method of choice for predicting the arrangement of the complex. However, reliably scoring protein-protein docking poses is still an unsolved problem. As a consequence, the screening of many docking models is usually required in the analysis step, to possibly single out the correct ones. Here, making use of exemplary cases, we review our recently introduced methods for the analysis of protein complex structures and for the scoring of protein docking poses, based on the use of inter-residue contacts and their visualization in inter-molecular contact maps. We also show that the ensemble of tools we developed can be used in the context of rational drug design targeting protein-protein interactions.
QED peripheral mechanism of pair production at colliders
International Nuclear Information System (INIS)
Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.
2008-01-01
Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.
Space-Efficient Re-Pair Compression
DEFF Research Database (Denmark)
Bille, Philip; Gørtz, Inge Li; Prezza, Nicola
2017-01-01
Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...
The paired-domination and the upper paired-domination numbers of graphs
Directory of Open Access Journals (Sweden)
Włodzimierz Ulatowski
2015-01-01
Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.
International Nuclear Information System (INIS)
Zheng, Rui; Zheng, Limin; Yang, Minghui; Lu, Yunpeng
2015-01-01
Theoretical studies of the potential energy surface (PES) and bound states are performed for the N 2 –N 2 O van der Waals (vdW) complex. A four-dimensional intermolecular PES is constructed at the level of single and double excitation coupled-cluster method with a non-iterative perturbation treatment of triple excitations [CCSD(T)] with aug-cc-pVTZ basis set supplemented with bond functions. Two equivalent T-shaped global minima are located, in which the O atom of N 2 O monomer is near the N 2 monomer. The intermolecular fundamental vibrational states are assigned by inspecting the orientation of the nodal surface of the wavefunctions. The calculated frequency for intermolecular disrotation mode is 23.086 cm −1 , which is in good agreement with the available experimental data of 22.334 cm −1 . A negligible tunneling splitting with the value of 4.2 MHz is determined for the ground vibrational state and the tunneling splitting increases as the increment of the vibrational frequencies. Rotational levels and transition frequencies are calculated for both isotopomers 14 N 2 –N 2 O and 15 N 2 –N 2 O. The accuracy of the PES is validated by the good agreement between theoretical and experimental results for the transition frequencies and spectroscopic parameters
Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the
Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D
1984-06-19
The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)
Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul
2012-11-01
Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Ye, ChuanXiang; Zhao, Yi; Liang, WanZhen
2015-01-01
The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra with respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT
Seniority zero pair coupled cluster doubles theory
International Nuclear Information System (INIS)
Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.
2014-01-01
Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems
Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier
2005-01-01
Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...
Energy Technology Data Exchange (ETDEWEB)
Sasaki, M.; Nagaishi, H.; Yoshida, T. [Hokkaido National Industrial Research Institute, Sapporo (Japan)
1996-10-28
The reactivity of oxygen methylated coal was studied to control hydrogen bond in bituminous coal liquefaction and intermolecular cohesion such as van der Waals force. In experiment, crushed and dried Illinois coal of 100mesh or less was used as specimen, and oxygen methylated coal was prepared by Liotta`s method using tetrabutylammonium halide. Coal liquefaction was conducted in an electromagnetic agitation autoclave using tetralin solvent under initial hydrogen pressure of 100kg/cm{sup 2} while heating. The molecular weight distribution of the products obtained was measured by gel permeation chromatography (GPC) analysis. The experimental results are as follows. The effect of intermolecular cohesion in bituminous coal on the reactivity is mainly derived from decomposing reaction from preasphaltene to oil. Yields of oil fraction by methylation increase corresponding to release of intermolecular cohesion. Since the thermal release is promoted with temperature rise, the difference in yield due to different treatments decreases. 5 refs., 3 figs., 1 tab.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Measuring Intermolecular Binding Energies by Laser Spectroscopy.
Knochenmuss, Richard; Maity, Surajit; Féraud, Géraldine; Leutwyler, Samuel
2017-02-22
The ground-state dissociation energy, D0(S0), of isolated intermolecular complexes in the gas phase is a fundamental measure of the interaction strength between the molecules. We have developed a three-laser, triply resonant pump-dump-probe technique to measure dissociation energies of jet-cooled M•S complexes, where M is an aromatic chromophore and S is a closed-shell 'solvent' molecule. Stimulated emission pumping (SEP) via the S0→S1 electronic transition is used to precisely 'warm' the complex by populating high vibrational levels v" of the S0 state. If the deposited energy E(v") is less than D0(S0), the complex remains intact, and is then mass- and isomer-selectively detected by resonant two-photon ionization (R2PI) with a third (probe) laser. If the pumped level is above D0(S0), the hot complex dissociates and the probe signal disappears. Combining the fluorescence or SEP spectrum of the cold complex with the SEP breakoff of the hot complex brackets D0(S0). The UV chromophores 1-naphthol and carbazole were employed; these bind either dispersively via the aromatic rings, or form a hydrogen bond via the -OH or -NH group. Dissociation energies have been measured for dispersively bound complexes with noble gases (Ne, Kr, Ar, Xe), diatomics (N2, CO), alkanes (methane to n-butane), cycloalkanes (cyclopropane to cycloheptane), and unsaturated compounds (ethene, benzene). Hydrogen-bond dissociation energies have been measured for H2O, D2O, methanol, ethanol, ethers (oxirane, oxetane), NH3 and ND3.
Energy Technology Data Exchange (ETDEWEB)
Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)
2015-12-15
Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.
Polyelectrolyte brushes in mixed ionic medium studied via intermolecular forces
Farina, Robert; Laugel, Nicolas; Pincus, Philip; Tirrell, Matthew
2011-03-01
The vast uses and applications of polyelectrolyte brushes make them an attractive field of research especially with the growing interest in responsive materials. Polymers which respond via changes in temperature, pH, and ionic strength are increasingly being used for applications in drug delivery, chemical gating, etc. When polyelectrolyte brushes are found in either nature (e.g., surfaces of cartilage and mammalian lung interiors) or commercially (e.g., skin care products, shampoo, and surfaces of medical devices) they are always surrounded by mixed ionic medium. This makes the study of these brushes in varying ionic environments extremely relevant for both current and future potential applications. The polyelectrolyte brushes in this work are diblock co-polymers of poly-styrene sulfonate (N=420) and poly-t-butyl styrene (N=20) which tethers to a hydrophobic surface allowing for a purely thermodynamic study of the polyelectrolyte chains. Intermolecular forces between two brushes are measured using the SFA. As multi-valent concentrations are increased, the brushes collapse internally and form strong adhesion between one another after contact (properties not seen in a purely mono-valent environment).
Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.
Hao, Pei-Yi
This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory
Intermolecular ion pairs maintain the toroidal structure of Pyrococcus furiosus PCNA
Matsumiya, Shigeki; Ishino, Sonoko; Ishino, Yoshizumi; Morikawa, Kosuke
2003-01-01
Two mutant proliferating cell nuclear antigens from the hyperthermophilic archaeon Pyrococcus furiosus, PfuPCNA(D143A) and PfuPCNA(D143A/D147A), were prepared by site-specific mutagenesis. The results from gel filtration showed that mutations at D143 and D147 drastically affect the stability of the trimeric structure of PfuPCNA. The PfuPCNA(D143A) still retained the activity to stimulate the DNA polymerase reaction, but PfuPCNA(D143A/D147A) lost the activity. Crystal structures of the mutant ...
Directory of Open Access Journals (Sweden)
Jiuqiang Han
2013-03-01
Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...
Observing Pair-Work Task in an English Speaking Class
Directory of Open Access Journals (Sweden)
Diana Achmad
2014-01-01
Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.
Directory of Open Access Journals (Sweden)
O. V. Vashchenko
2016-07-01
Full Text Available Intermolecular interactions between decamethoxinum (DEC and acetylsalicylic acid (ASА have been studied in the phospholipid-containing systems of escalating complexity levels. The host media for these substances were solvents, L-α-dipalmitoylphosphatidylcholine (DPPC membranes, and samples of human erythrocytes. Peculiar effects caused by DEC-ASА interaction have been observed in each system using appropriate techniques: (a DEC-ASА non-covalent complexes formation in DPPC-containing systems were revealed by mass spectrometry with electrospray ionization; (b joint DEC-ASА action on DPPC model membranes led to increasing of membrane melting temperature Tm, whereas individual drugs caused pronounced Tm decreasing, which was demonstrated by differential scanning calorimetry; (c deceleration of DEC-induced haemolysis of erythrocytes under joint DEC-ASА application was observed by optical microscopy.
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
Chain-length-dependent intermolecular packing in polyphenylenes: a high pressure study
Heimel, G; Oehzelt, M; Hummer, K; Koppelhuber-Bitschnau, B; Porsch, F; Ambrosch-Draxl, C; Resel, R
2003-01-01
We report on pressure-induced structural changes in crystalline oligo(para-phenylenes) containing two to six phenyl rings. The results are discussed with particular emphasis put on the implications these changes in intermolecular distances and molecular arrangement have on important bulk properties of this class of materials, such as optical response and charge transport. We performed energy dispersive x-ray diffraction in a systematic study on polycrystalline powders of biphenyl, para-terphenyl, p-quaterphenyl, p-quinquephenyl and p-sexiphenyl under hydrostatic pressure up to 60 kbar. Revisiting the crystal structures at ambient conditions reveals details in the packing principle. A linear relationship between the density at ambient conditions and the number of phenyl rings is found. High pressure data not only yields pressure-dependent lattice parameters and hints towards pressure-induced changes in the molecular arrangement but also allows for an analysis of the equations of state of these substances as a ...
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
DEFF Research Database (Denmark)
Bennett, K L; Kussmann, M; Björk, P
2000-01-01
The intermolecular contact regions between monomers of the homodimeric DNA binding protein ParR and the interaction between the glycoproteins CD28 and CD80 were investigated using a strategy that combined chemical cross-linking with differential MALDI-MS analyses. ParR dimers were modified in vit...
Josephson junction analog and quasiparticle-pair current
DEFF Research Database (Denmark)
Bak, Christen Kjeldahl; Pedersen, Niels Falsig
1973-01-01
A close analogy exists between a Josephson junction and a phase-locked loop. A new type of electrical analog based on this principle is presented. It is shown that the inclusion in this analog of a low-pass filter gives rise to a current of the same form as the Josephson quasiparticle-pair current....... A simple picture of the quasiparticle-pair current, which gives the right dependences, is obtained by assuming a junction cutoff frequency to be at the energy gap. ©1973 American Institute of Physics...
Lu, Deng-Fu; Zhu, Cheng-Liang; Jia, Zhen-Xin; Xu, Hao
2014-09-24
An iron-catalyzed diastereoselective intermolecular olefin amino-oxygenation reaction is reported, which proceeds via an iron-nitrenoid generated by the N-O bond cleavage of a functionalized hydroxylamine. In this reaction, a bench-stable hydroxylamine derivative is used as the amination reagent and oxidant. This method tolerates a range of synthetically valuable substrates that have been all incompatible with existing amino-oxygenation methods. It can also provide amino alcohol derivatives with regio- and stereochemical arrays complementary to known amino-oxygenation methods.
Designing an ASIP for cryptographic pairings over Barreto-Naehrig curves
Kammler, D.; Zhang, D.; Schwabe, P.; Scharwaechter, H.; Langenberg, M.; Auras, D.; Ascheid, G.; Mathar, R.; Clavier, C.; Gaj, K.
2009-01-01
This paper presents a design-space exploration of an application-specific instruction-set processor (ASIP) for the computation of various cryptographic pairings over Barreto-Naehrig curves (BN curves). Cryptographic pairings are based on elliptic curves over finite fields—in the case of BN curves a
International Nuclear Information System (INIS)
Phadke, Sushil; Shrivastava, Bhakt Darshan; Ujle, S K; Mishra, Ashutosh; Dagaonkar, N
2014-01-01
One of the potential driving forces behind a chemical reaction is favourable a new quantity known as the Gibbs free energy (G) of the system, which reflects the balance between these forces. Ultrasonic velocity and absorption measurements in liquids and liquid mixtures find extensive application to study the nature of intermolecular forces. Ultrasonic velocity measurements have been successfully employed to detect weak and strong molecular interactions present in binary and ternary liquid mixtures. After measuring the density and ultrasonic velocity of aqueous solution of 'Borassus Flabellifier' BF and Adansonia digitata And, we calculated Gibb's energy and intermolecular free length. The velocity of ultrasonic waves was measured, using a multi-frequency ultrasonic interferometer with a high degree of accuracy operating Model M-84 by M/s Mittal Enterprises, New Delhi, at a fixed frequency of 2 MHz. Natural sample 'Borassus Flabellifier' BF fruit pulp and Adansonia digitata AnD powder was collected from Dhar, District of MP, India for this study.
Ceccon, Alberto; Marius Clore, G; Tugarinov, Vitali
2016-09-01
In an exchanging system between major and minor species, the transverse paramagnetic relaxation enhancement rate observed on the resonances of the major species (Γ 2 (app) ) is dependent upon the exchange regime between the species. Quantitative analysis of PRE data in such systems typically assumes that the overall exchange rate k ex between the species is fast on the PRE time scale (k ex ≫ Γ2). Recently, we have characterized the kinetics of binding of the model protein ubiquitin to large (LUV) and small (SUV) unilamellar lipid-based nanoparticles or liposomes (Ceccon A, Tugarinov V, Bax A, Clore GM (2016). J Am Chem Soc 138:5789-5792). Building upon these results and taking advantage of a strong paramagnetic agent with an isotropic g-tensor, Gd(3+), we were able to measure intermolecular methyl carbon and proton PREs between paramagnetically-tagged liposomes and ubiquitin. In the limit of fast exchange (k ex ≫ Γ2) the ratio of the apparent proton to carbon methyl PREs, ((1)Hm-Γ 2 (app) )/((13)Cm-Γ 2 (app) ), is equal to the square of the ratio of the gyromagnetic ratios of the two nuclei, (γΗ/γC)(2). However, outside the fast exchange regime, under intermediate exchange conditions (e.g. when Γ2 is comparable in magnitude to k ex) the ((1)Hm-Γ 2 (app) )/((13)Cm-Γ 2 (app) ) ratio provides a reliable measure of the 'true' methyl PREs.
Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs
Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.
2018-02-01
For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.
Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs
Directory of Open Access Journals (Sweden)
Ol'ha O. Brovarets'
2018-02-01
Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.
Pair formation models for sexually transmitted infections: A primer
Directory of Open Access Journals (Sweden)
Mirjam Kretzschmar
2017-08-01
Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number
Awakened Oscillations in Coupled Consumer-Resource Pairs
Directory of Open Access Journals (Sweden)
Almaz Mustafin
2014-01-01
Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.
Nanoscale protein diffusion by STED-based pair correlation analysis.
Directory of Open Access Journals (Sweden)
Paolo Bianchini
Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.
International Nuclear Information System (INIS)
Valles, James
2008-01-01
Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.
Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D
2014-05-01
The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Fog, Jacob U; Litman, Thomas
2005-01-01
cysteines predicted to be on the extracellular face of ABCG2. Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys-603 to Ala (C603A) caused the transporter to migrate as a single monomeric band....... Despite this change, C603A displayed efficient membrane targeting and preserved transport function. Because the transporter migrated as a dimer in SDS-PAGE, when only Cys-603 was present (C592A-C608A), the data suggest that Cys-603 forms a symmetrical intermolecular disulfide bridge in the ABCG2 homodimer...
International Nuclear Information System (INIS)
Xuelei Chu; Ohmoto, Hiroshi
1991-01-01
For an isotopic exchange reaction between two compounds (X and AB) in a homogeneous system, such as a gaseous or aqueous system, where one (AB) of them possesses two exchangeable atoms in non-equivalent positions and where one intramolecular isotope exchange (A ↔ B) and two intermolecular isotope exchange reactions (X ↔ A and X ↔ B) may occur, its rate law no longer obeys a pseudo-first order rate equation described for simple two-component systems by many previous investigators. The change with time of the δ value of each of the three components (X, A, and B) in a closed and homogeneous system is a complicated function of the initial δ values of the three components, the chemical concentrations of the two compounds, and the overall rate constants of the forward and reverse reactions involving the two intermolecular and one intramolecular reactions of isotope exchanges. Also, for some one of the three components, the change of its δ value with time may not be monotonic, and the relationship of 1n (1 - F) with time may be non-linear in a plot of 1n (1 - F) vs. t. In addition, the rate law of the isotope exchange reaction in this system also provides a quantitative method to estimate the overall rate constants for the one-intra-and two intermolecular isotope exchanges and the equilibrium isotopic fractionation factors among the three components
DEFF Research Database (Denmark)
Seemann, Ernst Stefan; Richter, Andreas S.; Gorodkin, Jan
2010-01-01
of that used for individual multiple alignments. Results: We derived a rather extensive algorithm. One of the advantages of our approach (in contrast to other RNARNA interaction prediction methods) is the application of covariance detection and prediction of pseudoknots between intra- and inter-molecular base...... pairs. As a proof of concept, we show an example and discuss the strengths and weaknesses of the approach....
Energy Technology Data Exchange (ETDEWEB)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)
2016-04-19
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.
Understanding Fomalhaut as a Cooper pair
Feng, F.; Jones, H. R. A.
2018-03-01
Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.
[Involvement of cranial pairs as manifestation of prostatic cancer].
Ripa Saldias, L M; Ayuso Blanco, T; Delpon Pérez, E; Sarria Octavio de Toledo, L
1994-10-01
Two cases of prostate cancer (PC) which presented clinically with affectation of the cranial pairs due to skull base metastasis. In both cases, existence of intraparenchimatous brain metastasis was excluded. Initial improvement with hormonal therapy was followed by clinical, analytical and radiological relapse due to spread of process until death, at 11 and 36 months from diagnosis. Although PC's bone metastasis are frequent, their location at the skull base is uncommon. Even more rare are the cases which present with changes in the cranial pairs in the absence of signs and symptoms of prostatism.
Charge Aspects of Composite Pair Superconductivity
Flint, Rebecca
2014-03-01
Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.
International Nuclear Information System (INIS)
Cortini, Ruggero; Cheng, Xiaolin
2017-01-01
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order of 1k B T. Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.
Universal quantum gates for Single Cooper Pair Box based quantum computing
Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.
2000-01-01
We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied
Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo
2009-01-01
We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.
Statistical deprojection of galaxy pairs
Nottale, Laurent; Chamaraux, Pierre
2018-06-01
Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.
Classification between normal and tumor tissues based on the pair-wise gene expression ratio
International Nuclear Information System (INIS)
Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine
2004-01-01
Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested
Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.
2014-01-01
We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,
Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle
2017-05-01
Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie
2013-01-01
This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156
Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.
1994-01-01
The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair
Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors
Allan, Milan P.
2013-03-01
The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple
Bereau, Tristan; DiStasio, Robert A.; Tkatchenko, Alexandre; von Lilienfeld, O. Anatole
2018-06-01
Classical intermolecular potentials typically require an extensive parametrization procedure for any new compound considered. To do away with prior parametrization, we propose a combination of physics-based potentials with machine learning (ML), coined IPML, which is transferable across small neutral organic and biologically relevant molecules. ML models provide on-the-fly predictions for environment-dependent local atomic properties: electrostatic multipole coefficients (significant error reduction compared to previously reported), the population and decay rate of valence atomic densities, and polarizabilities across conformations and chemical compositions of H, C, N, and O atoms. These parameters enable accurate calculations of intermolecular contributions—electrostatics, charge penetration, repulsion, induction/polarization, and many-body dispersion. Unlike other potentials, this model is transferable in its ability to handle new molecules and conformations without explicit prior parametrization: All local atomic properties are predicted from ML, leaving only eight global parameters—optimized once and for all across compounds. We validate IPML on various gas-phase dimers at and away from equilibrium separation, where we obtain mean absolute errors between 0.4 and 0.7 kcal/mol for several chemically and conformationally diverse datasets representative of non-covalent interactions in biologically relevant molecules. We further focus on hydrogen-bonded complexes—essential but challenging due to their directional nature—where datasets of DNA base pairs and amino acids yield an extremely encouraging 1.4 kcal/mol error. Finally, and as a first look, we consider IPML for denser systems: water clusters, supramolecular host-guest complexes, and the benzene crystal.
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Pair potentials in liquid metals
International Nuclear Information System (INIS)
Faber, T.E.
1980-01-01
The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)
Pairing correlations in nuclei
International Nuclear Information System (INIS)
Baba, C.V.K.
1988-01-01
There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda
2018-05-02
Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact
Bhabak, Krishna P.; Bhowmick, Debasish
2012-08-01
Thiourea-based antithyroid drugs are effectively used for the treatment of hyperthyroidism. In this paper, we describe the synthesis of new trisulfides (11-12) from the commonly used thiourea-based antithyroid drugs such as 6-n-propyl-2-thiouracil (PTU) and 6-methyl-2-thiouracil (MTU) in the reaction with I2/KI system. Structural analysis by single crystal X-ray diffraction studies revealed the stabilization of trisulfides by a lactam-lactim tautomerism facilitating effective intramolecular as well as intermolecular non-covalent interactions. Although the structures of both trisulfides were found to be quite similar, a notable difference in the intermolecular interactions was observed between compounds 11 and 12 leading to different structural patterns. Structural stabilization of these trisulfides by tautomerism followed by intramolecular as well as intermolecular H-bonds makes these molecules as perfect examples in molecular recognition with self-complementary donor and acceptor units within a single molecule.
Sui, Dan; Hou, Qiufei; Chai, Jia; Ye, Ling; Zhao, Liyan; Li, Min; Jiang, Shimei
2008-11-01
A new symmetric bi-pyridyl banana-shaped molecule 1,3-phenylene diisonicotinate (PDI) was designed and synthesized. Its molecular structure was confirmed by FTIR, Elemental analysis and 1H NMR. X-ray crystallographic study reveals that there is an angle of approximate 118° among the centroids of the three rings (pyridyl-phenyl-pyridyl) in each PDI molecule indicating a desired banana shape. In addition, a series of liquid crystal complexes nBA:PDI:nBA induced by intermolecular hydrogen bonding between PDI (proton acceptor) and 4-alkoxybenzoic acids (nBA, proton donor) were synthesized and characterized. The mesomorphism properties and optical textures of the complex of nBA:PDI:nBA were investigated by differential scanning calorimetry, polarizing optical microscope and X-ray diffraction.
Intermolecular Force Field Parameters Optimization for Computer Simulations of CH4 in ZIF-8
Directory of Open Access Journals (Sweden)
Phannika Kanthima
2016-01-01
Full Text Available The differential evolution (DE algorithm is applied for obtaining the optimized intermolecular interaction parameters between CH4 and 2-methylimidazolate ([C4N2H5]− using quantum binding energies of CH4-[C4N2H5]− complexes. The initial parameters and their upper/lower bounds are obtained from the general AMBER force field. The DE optimized and the AMBER parameters are then used in the molecular dynamics (MD simulations of CH4 molecules in the frameworks of ZIF-8. The results show that the DE parameters are better for representing the quantum interaction energies than the AMBER parameters. The dynamical and structural behaviors obtained from MD simulations with both sets of parameters are also of notable differences.
Czech Academy of Sciences Publication Activity Database
Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.
2015-01-01
Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015
The coevolution of long-term pair bonds and cooperation.
Song, Z; Feldman, M W
2013-05-01
The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.
Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling
International Nuclear Information System (INIS)
Friedmann, Tamar; Verlinde, Herman
2005-01-01
We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field
Pair Interaction of Catalytical Sphere Dimers in Chemically Active Media
Directory of Open Access Journals (Sweden)
Jing-Min Shi
2018-01-01
Full Text Available We study the pair dynamics of two self-propelled sphere dimers in the chemically active medium in which a cubic autocatalytic chemical reaction takes place. Concentration gradient around the dimer, created by reactions occurring on the catalytic sphere surface and responsible for the self-propulsion, is greatly influenced by the chemical activities of the environment. Consequently, the pair dynamics of two dimers mediated by the concentration field are affected. In the particle-based mesoscopic simulation, we combine molecular dynamics (MD for potential interactions and reactive multiparticle collision dynamics (RMPC for solvent flow and bulk reactions. Our results indicate three different configurations between a pair of dimers after the collision, i.e., two possible scenarios of bound dimer pairs and one unbound dimer pair. A phase diagram is sketched as a function of the rate coefficients of the environment reactions. Since the pair interactions are the basic elements of larger scale systems, we believe the results may shed light on the understanding of the collective dynamics.
Au Pair and Trafficked? - Recruitment, Residence in Denmark and Dreams for the Future
DEFF Research Database (Denmark)
Korsby, Trine Mygind
Report on the prevalence and risk of human trafficking in the situations and experiences of a group of au pairs in Denmark. The report is based on a qualitative study with interviews with 27 au pairs living in Denmark. The au pairs come from the Philippines, Belarus, Ukraine, Serbia, Nepal and Ke...
Energy Technology Data Exchange (ETDEWEB)
Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)
2001-02-01
Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es
Energy Technology Data Exchange (ETDEWEB)
Yoshizawa, Tomokazu [Research Institute for Electronic Science (RIES), Hokkaido University, N12, W6 Sapporo 060-0812 (Japan); Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810 (Japan); Mizoguchi, Miwako [Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810 (Japan); Iimori, Toshifumi [Research Institute for Electronic Science (RIES), Hokkaido University, N12, W6 Sapporo 060-0812 (Japan); Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810 (Japan); Nakabayashi, Takakazu [Research Institute for Electronic Science (RIES), Hokkaido University, N12, W6 Sapporo 060-0812 (Japan); Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810 (Japan); Ohta, Nobuhiro [Research Institute for Electronic Science (RIES), Hokkaido University, N12, W6 Sapporo 060-0812 (Japan); Graduate School of Environmental Earth Science, Hokkaido University, Sapporo 060-0810 (Japan)], E-mail: nohta@es.hokudai.ac.jp
2006-05-09
External electric-field-induced change in fluorescence spectra as well as in fluorescence decay has been measured for electron donor and acceptor pairs of pyrene (PY) and N-methylphthalimide (NMPI) doped in a polymer film. Field-induced quenching and field-induced shortening of lifetime are observed for fluorescence emitted from the locally excited (LE) state of PY, indicating that intermolecular electron transfer from the excited state of PY to NMPI is enhanced by an electric field in a polymer film. A simulation has been made for the field effect on decay profile of the LE fluorescence of PY. Exciplex fluorescence is also quenched by an electric field because of the field-induced decrease in the initial population of the fluorescent exciplex. Both in LE fluorescence of PY and in exciplex fluorescence, electric-field-induced quenching becomes less efficient in the presence of a magnetic field. The mechanism of the synergy effect of electric and magnetic fields on fluorescence has been discussed.
International Nuclear Information System (INIS)
Yoshizawa, Tomokazu; Mizoguchi, Miwako; Iimori, Toshifumi; Nakabayashi, Takakazu; Ohta, Nobuhiro
2006-01-01
External electric-field-induced change in fluorescence spectra as well as in fluorescence decay has been measured for electron donor and acceptor pairs of pyrene (PY) and N-methylphthalimide (NMPI) doped in a polymer film. Field-induced quenching and field-induced shortening of lifetime are observed for fluorescence emitted from the locally excited (LE) state of PY, indicating that intermolecular electron transfer from the excited state of PY to NMPI is enhanced by an electric field in a polymer film. A simulation has been made for the field effect on decay profile of the LE fluorescence of PY. Exciplex fluorescence is also quenched by an electric field because of the field-induced decrease in the initial population of the fluorescent exciplex. Both in LE fluorescence of PY and in exciplex fluorescence, electric-field-induced quenching becomes less efficient in the presence of a magnetic field. The mechanism of the synergy effect of electric and magnetic fields on fluorescence has been discussed
Nichols, Pilarin; Li, Li; Kumar, Sandeep; Buck, Patrick M; Singh, Satish K; Goswami, Sumit; Balthazor, Bryan; Conley, Tami R; Sek, David; Allen, Martin J
2015-01-01
High viscosity of monoclonal antibody formulations at concentrations ≥100 mg/mL can impede their development as products suitable for subcutaneous delivery. The effects of hydrophobic and electrostatic intermolecular interactions on the solution behavior of MAB 1, which becomes unacceptably viscous at high concentrations, was studied by testing 5 single point mutants. The mutations were designed to reduce viscosity by disrupting either an aggregation prone region (APR), which also participates in 2 hydrophobic surface patches, or a negatively charged surface patch in the variable region. The disruption of an APR that lies at the interface of light and heavy chain variable domains, VH and VL, via L45K mutation destabilized MAB 1 and abolished antigen binding. However, mutation at the preceding residue (V44K), which also lies in the same APR, increased apparent solubility and reduced viscosity of MAB 1 without sacrificing antigen binding or thermal stability. Neutralizing the negatively charged surface patch (E59Y) also increased apparent solubility and reduced viscosity of MAB 1, but charge reversal at the same position (E59K/R) caused destabilization, decreased solubility and led to difficulties in sample manipulation that precluded their viscosity measurements at high concentrations. Both V44K and E59Y mutations showed similar increase in apparent solubility. However, the viscosity profile of E59Y was considerably better than that of the V44K, providing evidence that inter-molecular interactions in MAB 1 are electrostatically driven. In conclusion, neutralizing negatively charged surface patches may be more beneficial toward reducing viscosity of highly concentrated antibody solutions than charge reversal or aggregation prone motif disruption.
Mesoscopic pairing without superconductivity
Hofmann, Johannes
2017-12-01
We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.
Pairing field and moments of inertia of superdeformed nuclei
International Nuclear Information System (INIS)
Chen Yongjing; Chen Yongshou; Xu Fuxin
2002-01-01
The authors have systematically analysed the dynamic moments of inertia of the experimental superdeformed (SD) bands observed in the A = 190, 150 and 60-80 mass regions as functions of rotational frequency. By combining the different mass regions, the dramatic features of the dynamic moments of inertia were found and explained based on the calculations of the pairing fields of SD nuclei with the anisotropic harmonic oscillator quadrupole pairing Hartree-Fock-Bogoliubov model
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Pair production of scalar dyons in Kerr-Newman black holes
Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi
2018-06-01
We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.
A Scaffold Analysis Tool Using Mate-Pair Information in Genome Sequencing
Directory of Open Access Journals (Sweden)
Pan-Gyu Kim
2008-01-01
Full Text Available We have developed a Windows-based program, ConPath, as a scaffold analyzer. ConPath constructs scaffolds by ordering and orienting separate sequence contigs by exploiting the mate-pair information between contig-pairs. Our algorithm builds directed graphs from link information and traverses them to find the longest acyclic graphs. Using end read pairs of fixed-sized mate-pair libraries, ConPath determines relative orientations of all contigs, estimates the gap size of each adjacent contig pair, and reports wrong assembly information by validating orientations and gap sizes. We have utilized ConPath in more than 10 microbial genome projects, including Mannheimia succiniciproducens and Vibro vulnificus, where we verified contig assembly and identified several erroneous contigs using the four types of error defined in ConPath. Also, ConPath supports some convenient features and viewers that permit investigation of each contig in detail; these include contig viewer, scaffold viewer, edge information list, mate-pair list, and the printing of complex scaffold structures.
Energy Technology Data Exchange (ETDEWEB)
Taddei, Paola, E-mail: paola.taddei@unibo.it [Dipartimento di Scienze Biomediche e Neuromotorie, Università di Bologna, Via Belmeloro 8/2, 40126 Bologna (Italy); Tozzi, Silvia [Dipartimento di Scienze Biomediche e Neuromotorie, Università di Bologna, Via Belmeloro 8/2, 40126 Bologna (Italy); Zuccheri, Giampaolo [Dipartimento di Farmacia e Biotecnologie e Centro Interdipartimentale di Ricerca Industriale Scienze della Vita e Tecnologie per la Salute, Università di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Centro S3, Istituto Nanoscienze, Consiglio Nazionale delle Ricerche, Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (Italy); Martinotti, Simona; Ranzato, Elia [Dipartimento di Scienze e Innovazione Tecnologica, DiSIT, Università del Piemonte Orientale, viale Teresa Michel 11, 15121 Alessandria (Italy); Chiono, Valeria; Carmagnola, Irene [Dipartimento di Ingegneria Meccanica e Aerospaziale, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); Tsukada, Masuhiro [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, 3-15-1, Tokida, Ueda, Nagano 386-8567 (Japan)
2017-01-01
In this study, composite nanofibrous scaffolds were obtained by electrospinning a trifluoroacetic acid solution containing B. mori silk fibroin (SF) and poly(L-lactic acid) (PLLA) in a 1:1 weight ratio. SF, PLLA and SF/PLLA nanofibres were prepared with average diameter sizes of 360 ± 90 nm, 470 ± 240 nm and 580 ± 220 nm, respectively, as assessed by SEM analysis. Vibrational and thermal analyses showed that upon blending in the SF/PLLA nanofibres, the crystallisation of PLLA was hindered by the presence of SF, which crystallized preferentially and underwent conformational changes that did not significantly change its prevailing β-sheet structure. The two components were thermodynamically compatible and the intermolecular interactions between them were revealed for the first time. Human keratinocytes were cultured on nanofibres and their viability and proliferation were determined. Preliminary in vitro tests showed that the incorporation of SF into the PLLA component enhanced cell adhesion and proliferation with respect to the unfunctionalised material. SF has been successfully used to modify the biomaterial properties and confirmed to be an efficient bioactive protein to mediate cell-biomaterial interaction. - Highlights: • Composite silk fibroin-poly(L-lactic acid) scaffolds were obtained by electrospinning. • Intermolecular interactions between SF and PLLA were revealed for the first time. • Upon blending, the crystallisation of PLLA was hindered by the presence of SF. • SF crystallized preferentially and maintained its prevailing β-sheet structure. • The incorporation of SF into PLLA enhanced human keratinocytes adhesion and proliferation.
Augmenting Think-Pair-Share with Simulations
Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS
2009-01-01
Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the
DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions
Megens, Rik P.; Roelfes, Gerard
2012-01-01
Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as
Neese, Frank; Wennmohs, Frank; Hansen, Andreas
2009-03-21
Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500
ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.
Directory of Open Access Journals (Sweden)
Alexandra Peacock-Villada
Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.
Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao
2017-08-01
To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2016-01-01
Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...
Zhen, Jun-Ping; Wei, Xiao-Chun; Shi, Wen-Jing; Huang, Zhu-Yuan; Jin, Bo; Zhou, Yu-Kun
2017-11-14
In order to examine the origin of the drug action and design new DNA/RNA-targeted drugs, the cooperativity effect involving drug-DNA/RNA intermolecular interaction in ketoprofen⋯cytosine⋯H 2 O ternary system were investigated by the B3LYP, B3LYP-D3, and MP2 methods with the 6-311++G(2d,p) basis set. The thermodynamic cooperativity was also evaluated at 310.15 K. The N-H⋯O, O-H⋯O, O-H⋯N, C-H⋯N, and C-H⋯O H bonds coexist in ternary complexes. The intermolecular interactions obtained by B3LYP-D3 are close to those calculated by MP2. The steric effects and van der Waals interactions have little influence on the cooperativity effects. The anti-cooperativity effect in ket⋯cyt⋯H 2 O is far more notable than the cooperativity effect, and the stability of the cyclic structure with anti-cooperativity effect is higher than that of the linear structure with cooperativity effect, as is confirmed by the AIM (atoms in molecules) and RDG (reduced density gradient) analysis. Thus, it can be inferred that, in the presence of H 2 O, the anti-cooperativity effect plays a dominant role in the drug-DNA/RNA interaction, and the nature of the hydration in the binding of drugs to DNA/RNA bases is the H-bonding anti-cooperativity effect. Furthermore, the drug always links simultaneously with DNA/RNA base and H 2 O, and only in this way can the biological activity of drugs play a role. In most cases, the enthalpy change is the major factor driving the cooperativity, as is different from most of biomacromolecule complexes.
Paired peer review of university classroom teaching in a school of nursing and midwifery.
Bennett, Paul N; Parker, Steve; Smigiel, Heather
2012-08-01
Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.
Rai, U. S.; Singh, Manjeet; Rai, R. N.
2017-09-01
The phase diagram of 2-hydroxy-1, 2-diphenylethanone (HDPE)-4-nitro-o-phenylenediamine (NOPDA) system, determined by the thaw-melt method, gives two eutectics E1 (m p = 66.0 °C) and E2 (m p = 155.0 °C) with 0.30 and 0.55 mol fractions of NOPDA, respectively, and an 1:1 inter-molecular compound (IMC) (m p 162.0 °C). This IMC was synthesized by adopting the green synthetic method of solid state reaction. While its formation and structure were confirmed by the X-ray diffraction and spectroscopic methods, the ORTEP view gives mode of crystal packing, C‒H…O, C‒H…N, π-π stacking and the inter-molecular hydrogen bonding in the compound. The single crystal of the IMC shows 53% transmission and emits significantly higher dual fluorescence, and the band gap was computed to be 3.04 eV. The values of solubility of the IMC, measured in the temperature range 304-322 K, satisfy the mole fraction (X) and temperature equation: Xeq= 5.1324 × 10-7 e 0.01356T.
International Nuclear Information System (INIS)
Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.
2016-01-01
Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.
Plasma analog of particle-pair production
International Nuclear Information System (INIS)
Tsidulko, Yu.A.; Berk, H.L.
1996-09-01
It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws
Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars
International Nuclear Information System (INIS)
Leinson, L.B.
2001-01-01
The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating