Electron-beam-induced-current and active secondary-electron voltage-contrast with aberration-corrected electron probes

Energy Technology Data Exchange (ETDEWEB)

Han, Myung-Geun, E-mail: mghan@bnl.gov [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Garlow, Joseph A. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Materials Science and Engineering Department, Stony Brook University, Stony Brook, NY 11794 (United States); Marshall, Matthew S.J.; Tiano, Amanda L. [Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Wong, Stanislaus S. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Cheong, Sang-Wook [Department of Physics and Astronomy, Rutgers Center for Emergent Materials, Rutgers University, Piscataway, NJ 08854 (United States); Walker, Frederick J.; Ahn, Charles H. [Department of Applied Physics and Center for Research on Interface Structures and Phenomena, Yale University, New Haven, CT 06520 (United States); Department of Mechanical Engineering and Materials Science, Yale University, New Haven, CT 06520 (United States); Zhu, Yimei [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States)

2017-05-15

Highlights: • Electron-beam-induced-current (EBIC) and active secondary-electron voltage-contrast (SE-VC) are demonstrated in STEM mode combined with in situ electrical biasing in a TEM. • Electrostatic potential maps in ferroelectric thin films, multiferroic nanowires, and single crystals obtained by off-axis electron holography were compared with EBIC and SE-VC data. • Simultaneous EBIC and active SE-VC performed with atomic resolution STEM are demonstrated. - Abstract: The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fields and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.

On some aspects of high voltage electron microscopy

International Nuclear Information System (INIS)

Jouffrey, B.; Trinquier, J.

1987-01-01

The present paper deals with high voltage electron microscopy (HVEM). It is an overview on this domain due to the pionneer work of G. Dupouy which has permitted to perform a new kind of electron microscopy. Since this time, HVEM has shown its interest in high resolution, irradiations, chemical analysis, in situ experiments

Electron beam generation in high voltage glow discharges

International Nuclear Information System (INIS)

Rocca, J.J.; Szapiro, B.; Murray, C.

1989-01-01

The generation of intense CW and pulsed electron beams in glow discharges in reviewed. Glow discharge electron guns operate at a pressure of the order of 1 Torr and often have an advantage in applications that require a broad area electron beam in a gaseous atmosphere, such as laser excitation and some aspects of materials processing. Aspects of electron gun design are covered. Diagnostics of the high voltage glow discharges including the electric field distribution mapped by Doppler free laser spectroscopy, and plasma density and electron temperature measurements of the electron yield of different cathode materials under glow discharge conditions are presented

Electron microscopic analysis of rotavirus assembly-replication intermediates

International Nuclear Information System (INIS)

Boudreaux, Crystal E.; Kelly, Deborah F.; McDonald, Sarah M.

2015-01-01

Rotaviruses (RVs) replicate their segmented, double-stranded RNA genomes in tandem with early virion assembly. In this study, we sought to gain insight into the ultrastructure of RV assembly-replication intermediates (RIs) using transmission electron microscopy (EM). Specifically, we examined a replicase-competent, subcellular fraction that contains all known RV RIs. Three never-before-seen complexes were visualized in this fraction. Using in vitro reconstitution, we showed that ~15-nm doughnut-shaped proteins in strings were nonstructural protein 2 (NSP2) bound to viral RNA transcripts. Moreover, using immunoaffinity-capture EM, we revealed that ~20-nm pebble-shaped complexes contain the viral RNA polymerase (VP1) and RNA capping enzyme (VP3). Finally, using a gel purification method, we demonstrated that ~30–70-nm electron-dense, particle-shaped complexes represent replicase-competent core RIs, containing VP1, VP3, and NSP2 as well as capsid proteins VP2 and VP6. The results of this study raise new questions about the interactions among viral proteins and RNA during the concerted assembly–replicase process. - Highlights: • Rotaviruses replicate their genomes in tandem with early virion assembly. • Little is known about rotavirus assembly-replication intermediates. • Assembly-replication intermediates were imaged using electron microscopy

Electron microscopic analysis of rotavirus assembly-replication intermediates

Energy Technology Data Exchange (ETDEWEB)

Boudreaux, Crystal E.; Kelly, Deborah F. [Virginia Tech Carilion School of Medicine and Research Institute, Roanoke, VA (United States); McDonald, Sarah M., E-mail: mcdonaldsa@vtc.vt.edu [Virginia Tech Carilion School of Medicine and Research Institute, Roanoke, VA (United States); Department of Biomedical Sciences and Pathobiology, Virginia—Maryland Regional College of Veterinary Medicine, Blacksburg, VA (United States)

2015-03-15

Rotaviruses (RVs) replicate their segmented, double-stranded RNA genomes in tandem with early virion assembly. In this study, we sought to gain insight into the ultrastructure of RV assembly-replication intermediates (RIs) using transmission electron microscopy (EM). Specifically, we examined a replicase-competent, subcellular fraction that contains all known RV RIs. Three never-before-seen complexes were visualized in this fraction. Using in vitro reconstitution, we showed that ~15-nm doughnut-shaped proteins in strings were nonstructural protein 2 (NSP2) bound to viral RNA transcripts. Moreover, using immunoaffinity-capture EM, we revealed that ~20-nm pebble-shaped complexes contain the viral RNA polymerase (VP1) and RNA capping enzyme (VP3). Finally, using a gel purification method, we demonstrated that ~30–70-nm electron-dense, particle-shaped complexes represent replicase-competent core RIs, containing VP1, VP3, and NSP2 as well as capsid proteins VP2 and VP6. The results of this study raise new questions about the interactions among viral proteins and RNA during the concerted assembly–replicase process. - Highlights: • Rotaviruses replicate their genomes in tandem with early virion assembly. • Little is known about rotavirus assembly-replication intermediates. • Assembly-replication intermediates were imaged using electron microscopy.

Void formation in NiTi shape memory alloys by medium-voltage electron irradiation

International Nuclear Information System (INIS)

Schlossmacher, P.; Stober, T.

1995-01-01

In-situ electron irradiation experiments of NiTi shape memory alloys, using high-voltage transmission electron microscopes, result in amorphization of the intermetallic compound. In all of these experiments high-voltages more than 1.0 MeV had to be applied in order to induce the crystalline-to-amorphous transformation. To their knowledge no irradiation effects of medium-voltage electrons of e.g. 0.5 MeV have been reported in the literature. In this contribution, the authors describe void formation in two different NiTi shape memory alloys, resulting from in-situ electron irradiation, using a 300 kV electron beam in a transmission electron microscope. First evidence is presented that void formation is correlated with the total oxygen content of the alloys

Modular low-voltage electron beams

International Nuclear Information System (INIS)

Berejka, A.J.; Avnery, Tovi; Carlson, Carl

2004-01-01

Modular, low-voltage systems have simplified electron beam (EB) technology for industrial uses and for research and development. Modular EB units are produced in quantity as sealed systems that are evacuated at the factory eliminating the need for vacuum pumps at the point of use. A simple plug-out--plug-in method of replacement eliminates downtime for servicing. Use of ultra-thin beam windows (<10 μm of titanium foil), solid-state 19 in. (48 cm) rack-mounted power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, combine for ease of use and electrical transfer efficiency at voltages that can be varied between 80 and 150 kV and with high beam currents (up to 40 mA across the 25 cm window). These electron systems are available in three widths, the standard 25 cm and new 5 and 40 cm beams. Traditional uses in the graphic arts and coatings areas as well as uses in surface sterilization have found these compact, lightweight (approximately 15 kg) modular beams of interest. Units have been configured around complex shapes to enable three-dimensional surface curing (as for coatings on aluminum tubing) to be achieved at high production rates. Details of the beam construction and some industrial uses are discussed

Trusted intermediating agents in electronic trade networks

NARCIS (Netherlands)

T.B. Klos (Tomas); F. Alkemade (Floortje)

2005-01-01

htmlabstract Electronic commerce and trading of information goods significantly impact the role of intermediaries: consumers can bypass intermediating agents by forming direct links to producers. One reason that traditional intermediaries can still make a profit, is that they have more knowledge of

Wearable electronics formed on intermediate layer on textiles

KAUST Repository

Hussain, Muhammad Mustafa

2017-07-27

One manner of producing more desirable clothing with electronic capabilities is to manufacture electronics, such as the charging wires or devices themselves, directly onto the textile materials. Textile materials generally do not support the manufacturing of electronic devices, in part because the surface of the textile is too rough for electronic devices or the processes used to manufacturing electronic devices. An intermediate layer (204) may be placed on the textile material (202) to reduce the roughness of the surface of the textile material and provide other beneficial characteristics for the placement of electronic devices (206) directly on the textile material.

High voltage high brightness electron accelerator with MITL voltage adder coupled to foilless diode

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poulkey, J.W.; Rovang, D.

1995-01-01

The design and analysis of a high brightness electron beam experiment under construction at Sandia National Laboratory is presented. The beam energy is 12 MeV, the current 35-40 kA, the rms radius 0.5 mm, and the pulse duration FWHM 40 ns. The accelerator is SABRE a pulsed inductive voltage adder, and the electron source is a magnetically immersed foilless diode. This experiment has as its goal to stretch the technology to the edge and produce the highest possible electron current in a submillimeter radius beam

Investigation of the open-circuit voltage in wide-bandgap InGaP-host InP quantum dot intermediate-band solar cells

Science.gov (United States)

Aihara, Taketo; Tayagaki, Takeshi; Nagato, Yuki; Okano, Yoshinobu; Sugaya, Takeyoshi

2018-04-01

To analyze the open-circuit voltage (V oc) in intermediate-band solar cells, we investigated the current-voltage characteristics in wide-bandgap InGaP-based InP quantum dot (QD) solar cells. From the temperature dependence of the current-voltage curves, we show that the V oc in InP QD solar cells increases with decreasing temperature. We use a simple diode model to extract V oc at the zero-temperature limit, V 0, and the temperature coefficient C of the solar cells. Our results show that, while the C of InP QD solar cells is slightly larger than that of the reference InGaP solar cells, V 0 significantly decreases and coincides with the bandgap energy of the InP QDs rather than that of the InGaP host. This V 0 indicates that the V oc reduction in the InP QD solar cells is primarily caused by the breaking of the Fermi energy separation between the QDs and the host semiconductor in intermediate-band solar cells, rather than by enhanced carrier recombination.

Successful application of Low Voltage Electron Microscopy to practical materials problems

International Nuclear Information System (INIS)

Bell, David C.; Mankin, Max; Day, Robert W.; Erdman, Natasha

2014-01-01

Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely

BANSHEE: High-voltage repetitively pulsed electron-beam driver

International Nuclear Information System (INIS)

VanHaaften, F.

1992-01-01

BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-μs pulse width driving a load of ∼100 Ω, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 Ω, up to a level of ∼650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of ∼100 Ω

Lowering effect of radioactive irradiation on breakdown voltage and electron avalanche pulse characteristics

International Nuclear Information System (INIS)

Kawahashi, Akira; Nakano, Toru; Hosokawa, Tatsuzo; Miyoshi, Yosinori.

1976-01-01

In the time resolving measurement of the growing process and breakdown of electron avalanche in a gap of uniform electric field, the phenomenon that DC breakdown voltage slightly lowered was observed when β ray was irradiated as the initial electron source, as compared with unirradiated condition. Beta source used is 90 Sr- 90 Y of 2 mCi in radiative equilibrium. The experimental results and the examination are described in detail. In brief, the remarkable superposition of succeeding avalanche pulse over the preceeding avalanche pulse waveform was observed under the gap condition in which the breakdown voltage decreased in β-ray irradiation. Thus this superposition of avalanche pulses is considered as one of the causes of the breakdown voltage reduction. When β source is used as the initial electron source, the number of supplied initial electrons is very large as compared with unity, and at the same time, a great number of initial electrons can be supplied within the diffusion radius r of avalanche. Then the effect of initial electron number n 0 was considered by employing a diagram for breakdown scheme. The transition from Townsend type breakdown to streamer type breakdown occurs owing to increasing n 0 , and in that condition, the breakdown voltage lowers slightly. (Wakatsuki, Y)

Capacitive divider for output voltage measurement of intense electron beam accelerator

International Nuclear Information System (INIS)

Ding Desheng; Yi Lingzhi; Yu Binxiong; Hong Zhiqiang; Liu Jinliang

2012-01-01

A kind of simple-mechanism, easy-disassembly self-integrating capacitive divider used for measuring diode output voltage of intense electron beam accelerator (IEBA) is developed. The structure of the capacitive divider is described, and the capacitance value of the capacitive divider is calculated by theoretical analysis and electromagnetic simulation. The dependence of measurement voltage on electrical parameters such as stray capacitance, earth capacitance of front resistance is obtained by PSpice simulation. Measured waveforms appear overshoot phenomenon when stray capacitance of front resistance is larger, and the wavefront will be affected when earth capacitance of front resistance is larger. The diode output voltage waveforms of intense electron beam accelerator, are measured by capacitive divider and calibrated by water resistance divider, which is accordance with that measured by a resistive divider, the division ratio is about 563007. The designed capacitive divider can be used to measure high-voltage pulse with 100 ns full width at half maximum. (authors)

Subnanosecond breakdown development in high-voltage pulse discharge: Effect of secondary electron emission

Science.gov (United States)

Alexandrov, A. L.; Schweigert, I. V.; Zakrevskiy, Dm. E.; Bokhan, P. A.; Gugin, P.; Lavrukhin, M.

2017-10-01

A subnanosecond breakdown in high-voltage pulse discharge may be a key tool for superfast commutation of high power devices. The breakdown in high-voltage open discharge at mid-high pressure in helium was studied in experiment and in kinetic simulations. The kinetic model of electron avalanche development was constructed, based on PIC-MCC simulations, including dynamics of electrons, ions and fast helium atoms, produced by ions scattering. Special attention was paid to electron emission processes from cathode, such as: photoemission by Doppler-shifted resonant photons, produced in excitation processes involving fast atoms; electron emission by ions and fast atoms bombardment of cathode; the secondary electron emission (SEE) by hot electrons from bulk plasma. The simulations show that the fast atoms accumulation is the main reason of emission growth at the early stage of breakdown, but at the final stage, when the voltage on plasma gap diminishes, namely the SEE is responsible for subnanosecond rate of current growth. It was shown that the characteristic time of the current growth can be controlled by the SEE yield. The influence of SEE yield for three types of cathode material (titanium, SiC, and CuAlMg-alloy) was tested. By changing the pulse voltage amplitude and gas pressure, the area of existence of subnanosecond breakdown is identified. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time value as small as τs = 0.4 ns, for the pulse voltage amplitude of 5÷12 kV. An increase of gas pressure from 15 Torr to 30 Torr essentially decreases the time of of current front growth, whereas the pulse voltage variation weakly affects the results.

Comparison of three-phase three-level voltage source inverter with intermediate dc–dc boost converter and quasi-Z-source inverter

DEFF Research Database (Denmark)

Panfilov, Dmitry; Husev, Oleksandr; Blaabjerg, Frede

2016-01-01

This study compares a three-phase three-level voltage source inverter with an intermediate dc-dc boost converter and a quasi-Z-source inverter in terms of passive elements values and dimensions, semiconductor stresses, and overall efficiency. A comparative analysis was conducted with relative...

Charged particle transport in gaseous nitrogen at intermediate E/N using the voltage transient method

International Nuclear Information System (INIS)

Purdie, P.H.; Fletcher, J.

1992-01-01

A pulsed swarm of charged particles crossing an inter-electrode gap under the influence of an applied electric field E will produce a pulsed current in the external circuit which, when integrated over time, will result in a transient voltage pulse, the shape and magnitude of which is characteristic of the number of type of charged particles. This voltage transient technique has been used to investigate a gas discharge in nitrogen gas at values of E/N (the ratio of applied electric field to gas number density), such that ionization is non-negligible. The voltage transients have been subjected to a theoretical analysis, which has previously been reported, which includes not only cathode and anode image terms but also both electron and ion diffusion terms. Electron transport parameters are reported for E/N ≤ 350 Td (1 Td = 10 -17 V cm 2 ). Data are also obtained for the drift velocities and diffusion coefficients of the ions operative within the nitrogen discharge. An estimate is obtained for the collisional decay rate of N 2 + . 21 refs., 7 figs

An inverted-geometry, high voltage polarized electron gun with UHV load lock

International Nuclear Information System (INIS)

Breidenbach, M.; Foss, M.; Hodgson, J.; Kulikov, A.; Odian, A.; Putallaz, G.; Rogers, H.; Schindler, R.; Skarpaas, K.; Zolotorev, M.

1994-01-01

The design of a high voltage electron source with a GaAs photocathode and a load lock system is described. The inverted high voltage structure of the gun permits a compact and simple design. Test results demonstrate that the load lock system provides a reliable way to achieve high quantum efficiency of the photocathode in a high voltage device. ((orig.))

Evolution of graphene nanoribbons under low-voltage electron irradiation

KAUST Repository

Zhu, Wenpeng

2012-01-01

Though the all-semiconducting nature of ultrathin graphene nanoribbons (GNRs) has been demonstrated in field-effect transistors operated at room temperature with ∼10⁵ on-off current ratios, the borderline for the potential of GNRs is still untouched. There remains a great challenge in fabricating even thinner GNRs with precise width, known edge configurations and specified crystallographic orientations. Unparalleled to other methods, low-voltage electron irradiation leads to a continuous reduction in width to a sub-nanometer range until the occurrence of structural instability. The underlying mechanisms have been investigated by the molecular dynamics method herein, combined with in situ aberration-corrected transmission electron microscopy and density functional theory calculations. The structural evolution reveals that the zigzag edges are dynamically more stable than the chiral ones. Preferential bond breaking induces atomic rings and dangling bonds as the initial defects. The defects grow, combine and reconstruct to complex edge structures. Dynamic recovery is enhanced by thermal activation, especially in cooperation with electron irradiation. Roughness develops under irradiation and reaches a plateau less than 1 nm for all edge configurations after longtime exposure. These features render low-voltage electron irradiation an attractive technique in the fabrication of ultrathin GNRs for exploring the ultimate electronic properties. © 2012 The Royal Society of Chemistry.

Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

Energy Technology Data Exchange (ETDEWEB)

Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

2007-02-21

During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

Particle flows to shape and voltage surface discontinuities in the electron sheath surrounding a high voltage solar array in LEO

Science.gov (United States)

Metz, Roger N.

1991-01-01

This paper discusses the numerical modeling of electron flows from the sheath surrounding high positively biased objects in LEO (Low Earth Orbit) to regions of voltage or shape discontinuity on the biased surfaces. The sheath equations are derived from the Two-fluid, Warm Plasma Model. An equipotential corner and a plane containing strips of alternating voltage bias are treated in two dimensions. A self-consistent field solution of the sheath equations is outlined and is pursued through one cycle. The electron density field is determined by numerical solution of Poisson's equation for the electrostatic potential in the sheath using the NASCAP-LEO relation between electrostatic potential and charge density. Electron flows are calculated numerically from the electron continuity equation. Magnetic field effects are not treated.

Innovative energy efficient low-voltage electron beam emitters

International Nuclear Information System (INIS)

Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

2002-01-01

Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates

Innovative energy efficient low-voltage electron beam emitters

Science.gov (United States)

Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

2002-03-01

Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates.

Symmetric low-voltage powering system for relativistic electronic devices

International Nuclear Information System (INIS)

Agafonov, A.V.; Lebedev, A.N.; Krastelev, E.G.

2005-01-01

A special driver for double-sided powering of relativistic magnetrons and several methods of localized electron flow forming in the interaction region of relativistic magnetrons are proposed and discussed. Two experimental installations are presented and discussed. One of them is designed for laboratory research and demonstration experiments at a rather low voltage. The other one is a prototype of a full-scale installation for an experimental research at relativistic levels of voltages on the microwave generation in the new integrated system consisting of a relativistic magnetron and symmetrical induction driver

Bias voltage effect on electron tunneling across a junction with a ferroelectric–ferromagnetic two-phase composite barrier

International Nuclear Information System (INIS)

Wang Jian; Ju Sheng; Li, Z.Y.

2012-01-01

The effect of bias voltage on electron tunneling across a junction with a ferroelectric–ferromagnetic composite barrier is investigated theoretically. Because of the inversion symmetry breaking of the spontaneous ferroelectric polarization, bias voltage dependence of the electron tunneling shows significant differences between the positive bias and the negative one. The differences of spin filtering or tunnel magnetoresistance increase with the increasing absolute value of bias voltage. Such direction preferred electron tunneling is found intimately related with the unusual asymmetry of the electrical potential profile in two-phase composite barrier and provides a unique change to realize rectifying functions in spintronics. - Highlights: ► Electron tunneling across a ferroelectric–ferromagnetic composite barrier junction. ► TMR effect is different under the same value but opposite direction bias voltage. ► This directionality of the electron tunneling enhances with increasing bias voltage.

Electron emission of cathode holder of vacuum diode of an intense electron-beam accelerator and its effect on the output voltage

Directory of Open Access Journals (Sweden)

Xin-Bing Cheng

2011-04-01

Full Text Available The vacuum diode which is used to generate relativistic electron beams is one of the most important parts of a pulsed-power modulator. In this paper, the electron emission of cathode holder of a vacuum diode and its effect on the output voltage is investigated by experiments on an intense electron-beam accelerator with 180 ns full width at half maximum and 200–500 kV output voltage. First, the field emission is analyzed and the electric field of the vacuum chamber is calculated. Then, the flatness of the output voltage is discussed before and after adding an insulation plate when a water load is used. It is found that the electron emission at the edges of the cathode holder is the main reason to cause the change of the flatness. Last, a piece of polyester film is used as a target to further show the electron emission of the cathode holder. This analysis shows that decreasing the electron emission of the cathode holder in such a pulse power modulator could be a good way to improve the quality of the output voltage.

Calculated sputtering and atomic displacement cross-sections for applications to medium voltage analytical electron microscopy

International Nuclear Information System (INIS)

Bradley, C.R.; Zaluzec, N.J.

1987-08-01

The development of medium voltage electron microscopes having high brightness electron sources and ultra-high vacuum environments has been anticipated by the microscopy community now for several years. The advantages of such a configuration have been discussed to great lengths, while the potential disadvantages have for the most part been neglected. The most detrimental of these relative to microcharacterization are the effects of electron sputtering and atomic displacement to the local specimen composition. These effects have in the past been considered mainly in the high voltage electron microscope regime and generally were ignored in lower voltage instruments. Recent experimental measurements have shown that the effects of electron sputtering as well as radiation induced segregation can be observed in conventional transmission electron microscopes. It is, therefore, important to determine at what point the effects will begin to manifest themselves in the new generation of medium voltage analytical electron microscopes. In this manuscript we present new calculations which allow the individual experimentalist to determine the potential threshold levels for a particular elemental system and thus avoid the dangers of introducing artifacts during microanalysis. 12 refs., 3 figs

Voltage surges induced in transformer secondaries with loads characterized by sensitive electronic equipment

Energy Technology Data Exchange (ETDEWEB)

Cogo, Joao Roberto [GSI Engenharia e Consultoria Ltda., Taubate, SP (Brazil)], Email: gsi@gsiconsultoria.com.br; Dommel, Hermann Wilhelm [University of British Columbia, Vancouver (Canada)], Email: hermannd@ece.ubc.ca

2007-07-01

The grounding of sensitive electronic equipment such as computers, programmable logic controllers (PLC), process control systems, and other electronic equipment is one of the most important considerations towards obtaining an efficient operation of such systems. Such equipment, which for the purposes of this work is called 'Sensitive Electronic Equipment - SEE' is very sensitive to faults and low intensity random voltages which have no effect upon the electrical power equipment and upon human beings. In this work, the grounding problem is evaluated, to guide the user on the proper installation of SEEs, so as to prevent them from being damaged. The following items will be discussed: voltages which SEEs are subject to during incidence of atmospheric surges in the distribution overhead lines to which they are connected; sustained voltage that the high voltage supply of SEEs must be able to withstand during line-to-ground faults that originate from atmospheric surges that reach the transmission lines which are connected to the electrical power self producers (or electrical power independent producers). (author)

Photon- and electron-induced surface voltage in electron spectroscopies on ZnSe(0 0 1)

International Nuclear Information System (INIS)

Cantoni, M.; Bertacco, R.; Brambilla, A.; Ciccacci, F.

2009-01-01

The surface band bending in ZnSe(0 0 1), as a function of the temperature, is investigated both in the valence band (by photoemission) and in the conduction band (by inverse photoemission and absorbed current spectroscopies). Two different mechanisms are invoked for interpreting the experimental data: the band bending due to surface states, and the surface voltage induced by the incident beam. While the latter is well known in photoemission (surface photovoltage), we demonstrate the existence of a similar effect in inverse photoemission and absorbed current spectroscopies, induced by the incident electrons instead of photons. These results point to the importance of considering the surface voltage effect even in electron-in techniques for a correct evaluation of the band bending.

Technological guns which form the profiled electron beans

International Nuclear Information System (INIS)

Mel'nik, V.I.

1998-01-01

Electron guns with high-voltage glow discharge are developed which form disc - and tubule-like,hollow conic and linear electron beams,as well as devices and systems for control of gun parameter and technological processes in low and intermediate vacuum

On FEL integral equation and electron energy loss in intermediate gain regime

International Nuclear Information System (INIS)

Takao, Masaru

1994-03-01

The FEL pendulum equation in a intermediate gain small signal regime is investigated. By calculating the energy loss of the electron beam in terms of the solution of the pendulum equation, we confirm the consistency of the FEL equation in intermediate gain regime. (author)

Design of full digital 50 kV electronic gun high voltage power supply

International Nuclear Information System (INIS)

Ge Lei; Shang Lei

2014-01-01

The design of full digital electronic gun high voltage power supply based on DSP was introduced in this paper. This power supply has innovations of full digital feedback circuit and PID closed-loop control mode. The application of high frequency resonant converter circuit reduces the size of the resonant element and transformer. The current-coupling distributed high voltage transformer and rectifier circuit were employed in this power supply. By this way, the power supply efficiency is improved and the number of distributed parameters is reduced, and the rectifier circuit could work under the oil-free environment. This power supply has been used in electronic grid-control high voltage system of the irradiation accelerator. (authors)

Protonic/electronic hybrid oxide transistor gated by chitosan and its full-swing low voltage inverter applications

Energy Technology Data Exchange (ETDEWEB)

Chao, Jin Yu [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zhu, Li Qiang, E-mail: lqzhu@nimte.ac.cn; Xiao, Hui [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Yuan, Zhi Guo, E-mail: ncityzg@163.com [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China)

2015-12-21

Modulation of charge carrier density in condensed materials based on ionic/electronic interaction has attracted much attention. Here, protonic/electronic hybrid indium-zinc-oxide (IZO) transistors gated by chitosan based electrolyte were obtained. The chitosan-based electrolyte illustrates a high proton conductivity and an extremely strong proton gating behavior. The transistor illustrates good electrical performances at a low operating voltage of ∼1.0 V such as on/off ratio of ∼3 × 10{sup 7}, subthreshold swing of ∼65 mV/dec, threshold voltage of ∼0.3 V, and mobility of ∼7 cm{sup 2}/V s. Good positive gate bias stress stabilities are obtained. Furthermore, a low voltage driven resistor-loaded inverter was built by using an IZO transistor in series with a load resistor, exhibiting a linear relationship between the voltage gain and the supplied voltage. The inverter is also used for decreasing noises of input signals. The protonic/electronic hybrid IZO transistors have potential applications in biochemical sensors and portable electronics.

Electron heating of voltage-driven and matched dual frequency discharges

International Nuclear Information System (INIS)

Lieberman, M A; Lichtenberg, A J

2010-01-01

In a dual frequency capacitive sheath, a high frequency uniform sheath motion is coupled with a low frequency Child law sheath motion. For current-driven high and low frequency sheaths, the high frequency sheath motion generates most of the ohmic and stochastic heating of the discharge electrons. The low frequency motion, in addition to its primary purpose of establishing the ion bombarding energy, also increases the heating by widening the sheath width and transporting the oscillating electrons to regions of lower plasma density, and hence higher sheath velocity. In this work, we show that for voltage-driven high and low frequency sheaths, increasing the low frequency voltage reduces the heating, due to the reduced high frequency current that flows through the sheath under voltage-driven conditions. We determine the dependence of the heating on various parameters and compare the results with the current-driven case. Particle-in-cell simulations are used to confirm this result. Discharges generally employ a matching network to maximize the power transmitted to the plasma. We obtain analytic expressions for the effect of the low frequency source under matched conditions and, again, find that the low frequency source reduces the heating.

Power-supply system for high-voltage electron guns with grid control

International Nuclear Information System (INIS)

Grigorev, Y.V.

1985-01-01

A power-supply system for electron guns with grid control is described which consists of a source of accelerating voltage between 20 and 180 kV with a current of 100 mA and a control circuit for an electron gun that contains a pulse generator having an output voltage of up to 5 kV for pulse durations of 2, 10, 50 and 90 microseconds. The output pulses of the generator are synchronized with a certain phase of the cathode heater current of the gun, and they can be repeated at a frequency between 100 and 0.4 Hz. The system is reliable and resistant to the overloads associated with breakdowns in the gun

Choice of operating voltage for a transmission electron microscope

International Nuclear Information System (INIS)

Egerton, R.F.

2014-01-01

An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

SVC or VSC for reduction of voltage sags and flicker. Trends in power electronics

Energy Technology Data Exchange (ETDEWEB)

Haeusler, M; Schnettler, A [ABB Calor Emag Schaltanlagen AG, Mannheim (Germany); Halvarsson, P [ABB Power Systems AB, Vaesteraas (Sweden)

1997-07-01

In the past complaints about insufficient power quality were often caused by flicker observed in the neighbourhood of industrial networks. Voltage sags due to faults in the power system pass, however, mostly unnoticed as not-so-common events. Now electronic controls are penetrating more and more in industry. Electronic controllers on factory machines - particularly those for variable speed motors - are vulnerable to voltage sags. A one-tenth second sag can cause a $200.000 downtime incident in a big factory. Therefore the demands on power quality are rising in industry as well. The costly separation in clean networks for residential areas and dirty networks for industrial grids is no perfect solution to avoid such problems. Static VAr Compensators (SVC) are traditionally one means to control the voltage in industrial networks. Because of the recent development of powerful gate turn-off semiconductor devices another type of converter has gained new interest for mitigation of system disturbances, the voltage-source converter (VSC). The characteristics of both types of power electronics in view of their possibilities for this application are presented. (orig.)

Electron bunch structure in energy recovery linac with high-voltage dc photoelectron gun

Directory of Open Access Journals (Sweden)

Y. M. Saveliev

2016-09-01

Full Text Available The internal structure of electron bunches generated in an injector line with a dc photoelectron gun is investigated. Experiments were conducted on the ALICE (accelerators and lasers in combined experiments energy recovery linac at Daresbury Laboratory. At a relatively low dc gun voltage of 230 kV, the bunch normally consisted of two beamlets with different electron energies, as well as transverse and longitudinal characteristics. The beamlets are formed at the head and the tail of the bunch. At a higher gun voltage of 325 kV, the beam substructure is much less pronounced and could be observed only at nonoptimal injector settings. Experiments and computer simulations demonstrated that the bunch structure develops during the initial beam acceleration in the superconducting rf booster cavity and can be alleviated either by increasing the gun voltage to the highest possible level or by controlling the beam acceleration from the gun voltage in the first accelerating structure.

Study of nonlinear interaction between bunched beam and intermediate cavities in a relativistic klystron amplifier

Energy Technology Data Exchange (ETDEWEB)

Wu, Y. [Department of Engineering Physics, Tsinghua University, Beijing 100084 (China); Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Science and Technology on High Power Microwave Laboratory, Mianyang 621900 (China); Xu, Z.; Li, Z. H. [Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Tang, C. X. [Department of Engineering Physics, Tsinghua University, Beijing 100084 (China)

2012-07-15

In intermediate cavities of a relativistic klystron amplifier (RKA) driven by intense relativistic electron beam, the equivalent circuit model, which is widely adopted to investigate the interaction between bunched beam and the intermediate cavity in a conventional klystron design, is invalid due to the high gap voltage and the nonlinear beam loading in a RKA. According to Maxwell equations and Lorentz equation, the self-consistent equations for beam-wave interaction in the intermediate cavity are introduced to study the nonlinear interaction between bunched beam and the intermediate cavity in a RKA. Based on the equations, the effects of modulation depth and modulation frequency of the beam on the gap voltage amplitude and its phase are obtained. It is shown that the gap voltage is significantly lower than that estimated by the equivalent circuit model when the beam modulation is high. And the bandwidth becomes wider as the beam modulation depth increases. An S-band high gain relativistic klystron amplifier is designed based on the result. And the corresponding experiment is carried out on the linear transformer driver accelerator. The peak output power has achieved 1.2 GW with an efficiency of 28.6% and a gain of 46 dB in the corresponding experiment.

Study of nonlinear interaction between bunched beam and intermediate cavities in a relativistic klystron amplifier

Science.gov (United States)

Wu, Y.; Xu, Z.; Li, Z. H.; Tang, C. X.

2012-07-01

In intermediate cavities of a relativistic klystron amplifier (RKA) driven by intense relativistic electron beam, the equivalent circuit model, which is widely adopted to investigate the interaction between bunched beam and the intermediate cavity in a conventional klystron design, is invalid due to the high gap voltage and the nonlinear beam loading in a RKA. According to Maxwell equations and Lorentz equation, the self-consistent equations for beam-wave interaction in the intermediate cavity are introduced to study the nonlinear interaction between bunched beam and the intermediate cavity in a RKA. Based on the equations, the effects of modulation depth and modulation frequency of the beam on the gap voltage amplitude and its phase are obtained. It is shown that the gap voltage is significantly lower than that estimated by the equivalent circuit model when the beam modulation is high. And the bandwidth becomes wider as the beam modulation depth increases. An S-band high gain relativistic klystron amplifier is designed based on the result. And the corresponding experiment is carried out on the linear transformer driver accelerator. The peak output power has achieved 1.2 GW with an efficiency of 28.6% and a gain of 46 dB in the corresponding experiment.

A high voltage test stand for electron gun qualification for LINACs

International Nuclear Information System (INIS)

Wanmode, Yashwant D.; Mulchandani, J.; Acharya, M.; Bhisikar, A.; Singh, H.G.; Shrivastava, Purushottam

2011-01-01

An electron gun lest stand has been developed at RRCAT. The test stand consists of a high voltage pulsed power supply, electron gun filament supply, grid supply, UHV system and electron gun current measurement system. Several electron guns developed indigenously were evaluated on this test stand. The shielding is provided for the electron gun set up. Electron gun tests can be tested upto 55 kV with pulse width of 15 microsecs and pulse repetition rates up to 200 Hz. The technical details of the subsystems are furnished and results of performance of the test stand have been reported in this paper. (author)

Automotive Electrical and Electronic System II; Automotive Mechanics-Intermediate: 9045.04.

Science.gov (United States)

Dade County Public Schools, Miami, FL.

This automotive electrical and electronic system course is an intermediate course designed for the student who has completed automotive Electrical and Electronic System I. The theory and principles of operation of the components of the starting and charging systems and other electrical accessory systems in the automobile will be learned by the…

Electron emission of cathode holder of vacuum diode of an intense electron-beam accelerator and its effect on the output voltage

OpenAIRE

Xin-Bing Cheng; Jin-Liang Liu; Hong-Bo Zhang; Zhi-Qiang Hong; Bao-Liang Qian

2011-01-01

The vacuum diode which is used to generate relativistic electron beams is one of the most important parts of a pulsed-power modulator. In this paper, the electron emission of cathode holder of a vacuum diode and its effect on the output voltage is investigated by experiments on an intense electron-beam accelerator with 180 ns full width at half maximum and 200–500 kV output voltage. First, the field emission is analyzed and the electric field of the vacuum chamber is calculated. Then, the fla...

Electron emission in collisions of intermediate energy ions with atoms

International Nuclear Information System (INIS)

Garibotti, C.R.

1988-01-01

The aim of this work, is the analysis of the processes of electronic emission produced in the collisions of small ions (H + , He ++ ) of intermediate energy (50 a 200 KeV/amu) with light gaseous targets. (A.C.A.G.) [pt

Electron scattering from sodium at intermediate energies

International Nuclear Information System (INIS)

Mitroy, J.; McCarthy, I.E.

1986-10-01

A comprehensive comparison is made between theoretical calculations and experimental data for intermediate energy (≥ 10 eV) electron scattering from sodium vapour. The theoretical predictions of coupled-channels calculations (including one, two or four channels) do not agree with experimental values of the differential cross sections for elastic scattering or the resonant 3s to 3p excitation. Increasingly-more-sophisticated calculations, incorporating electron correlations in the target states, and also including core-excited states in the close-coupling expansion, are done at a few selected energies in an attempt to isolate the cause of the discrepancies between theory and experiment. It is found that these more-sophisticated calculations give essentially the same results as the two- and four-channel calculations using Hartree-Fock wavefunctions. Comparison of the sodium high-energy elastic differential cross sections with those of neon suggests that the sodium differential cross section experiments may suffer from systematic errors. There is also disagreement, at the higher energies, between theoretical values for the scattering parameters and those that are derived from laser-excited superelastic scattering and electron photon coincidence experiments. When allowance is made for the finite acceptance angle of the electron spectrometers used in the experiments by convoluting the theory with a function representing the distribution of electrons entering the electron spectrometer it is found that the magnitudes of the differences between theory and experiment are reduced

Control and protection system for an electron injector installed in a high-voltage terminal

International Nuclear Information System (INIS)

Martin, D.; Radu, A.; Baciu, G.; Grigore, D.

1979-01-01

The basic principles of operation of the control and protection system for an electron accelerator gun are described. The electron gun parameters are independently controlled by using four special secondary windings of the high-voltage transformer providing the accelerating voltage. Four groups of thyristor ac regulators employing phase control are connected so as to provide independent adjustment of each parameter of the gun. The power controller of modular construction has a single-phase supply from the 50 Hz 220 V mains. (orig.)

Progress in element analysis on a high-voltage electron microscope

International Nuclear Information System (INIS)

Tivol, W.F.; Barnard, D.; Guha, T.

1985-01-01

X-Ray microprobe (XMA) and electron energy-loss (EELS) spectrometers have been installed on the high-voltage electron microscope (HVEM). The probe size has been measured and background reduction is in progress for XMA and EELS as are improvements in electron optics for EELS and sensitivity measurements. XMA is currently useful for qualitative analysis and has been used by several investigators from our laboratory and outside laboratories. However, EELS background levels are still too high for meaningful results to be obtained. Standards suitable for biological specimens are being measured, and a library for quantitative analysis is being compiled

Effect of secondary electron emission on subnanosecond breakdown in high-voltage pulse discharge

Science.gov (United States)

Schweigert, I. V.; Alexandrov, A. L.; Gugin, P.; Lavrukhin, M.; Bokhan, P. A.; Zakrevsky, Dm E.

2017-11-01

The subnanosecond breakdown in open discharge may be applied for producing superfast high power switches. Such fast breakdown in high-voltage pulse discharge in helium was explored both in experiment and in kinetic simulations. The kinetic model of electron avalanche development was developed using PIC-MCC technique. The model simulates motion of electrons, ions and fast helium atoms, appearing due to ions scattering. It was shown that the mechanism responsible for ultra-fast breakdown development is the electron emission from cathode. The photoemission and emission by ions or fast atoms impact is the main reason of current growth at the early stage of breakdown, but at the final stage, when the voltage on discharge gap drops, the secondary electron emission (SEE) is responsible for subnanosecond time scale of current growth. It was also found that the characteristic time of the current growth τS depends on the SEE yield of the cathode material. Three types of cathode material (titanium, SiC, and CuAlMg-alloy) were tested. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time as small as τS = 0.4 ns, for the pulse voltage amplitude of 5- 12 kV..

Magnetic lens apparatus for a low-voltage high-resolution electron microscope

Science.gov (United States)

Crewe, Albert V.

1996-01-01

A lens apparatus in which a beam of charged particles of low accelerating voltage is brought to a focus by a magnetic field, the lens being situated behind the target position. The lens comprises an electrically-conducting coil arranged around the axis of the beam and a magnetic pole piece extending along the axis of the beam at least within the space surrounded by the coil. The lens apparatus comprises the sole focusing lens for high-resolution imaging in a low-voltage scanning electron microscope.

Sharing of secondary electrons by in-lens and out-lens detector in low-voltage scanning electron microscope equipped with immersion lens.

Science.gov (United States)

Kumagai, Kazuhiro; Sekiguchi, Takashi

2009-03-01

To understand secondary electron (SE) image formation with in-lens and out-lens detector in low-voltage scanning electron microscopy (LV-SEM), we have evaluated SE signals of an in-lens and an out-lens detector in LV-SEM. From the energy distribution spectra of SEs with various boosting voltages of the immersion lens system, we revealed that the electrostatic field of the immersion lens mainly collects electrons with energy lower than 40eV, acting as a low-pass filter. This effect is also observed as a contrast change in LV-SEM images taken by in-lens and out-lens detectors.

High voltage processing of the SLC polarized electron gun

International Nuclear Information System (INIS)

Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

1993-04-01

The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

Use of high voltage electron microscope to simulate radiation damage by neutrons

International Nuclear Information System (INIS)

Mayer, R.M.

1976-01-01

The use of the high voltage electron microscope to simulate radiation damage by neutrons is briefly reviewed. This information is important in explaining how alloying affects void formation during neutron irradiation

The effect of voltage droop on the output of an electrostatic accelerator free electron laser

International Nuclear Information System (INIS)

Wright, C.C.; Al-Shamma'a, A.I.; Lucas, J.; Stuart, R.A.

2000-01-01

Electrostatic accelerator FEL oscillators when operated with energy recovery offer the prospect of long pulse, single-mode operation with very narrow linewidth at high-power levels. However, special care with wiggler construction, electron beam steering, and collector design is necessary to reduce the fraction of the electron beam lost before depressed collection to a sufficiently small value to stop the output hopping from one longitudinal mode of the cavity to another due to the droop of the terminal accelerating voltage. We are investigating what minimum recovery fraction is required both experimentally and theoretically. We have constructed a pulsed microwave FEM oscillator having an accelerating voltage of 65 kV supplied by a source, which is a capacitor, charged by a low-current, high-voltage supply. By changing the capacitor value, it is easily possible to achieve a range of voltage droop rates. Furthermore, because the gain bandwidth of the FEM is small, only 1 or 2 longitudinal modes are capable of being amplified at any voltage which eases the problem of analysing mode hopping behaviour. A simple model of mode switching is outlined

Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

Science.gov (United States)

Cui, Jianmin

2016-01-01

Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

A Protection System of High Voltage Generator Electron Acceleration foran Electron Beam Machine 500 kV/10 mA

International Nuclear Information System (INIS)

Prajitno; Sudiyanto; Djaziman

2000-01-01

Hardwired electronic circuit of protection system to prevent high voltagegenerator EBM have been made. The protection system consists of processparameters such as safety parameter, dynamic logic circuits and interlockrelay drive circuits. Safety parameters using transducer which is factorymade so that the accuracy and reliability could be controlled. A good resultof electronic circuit has been tested which cover: water flow and temperaturemonitoring, grid current, anode current, anode voltage and logic control. Therange of monitoring temperature from 30 o C to 100 o C with output voltagefrom 1.47 V to 5.38 V. The voltage output of water flow monitoring is 0.083 Vto 3.391 V which is equivalent to 1.5 - 30 l/min. Response time of the logiccontrol about 10 ms. By using design and construction of protection system,have been through about the security aspect of high voltage generatoroperation and also system will give early warning if the disturbance andabnormal operation occurred. (author)

Electron beam producing system for very high acceleration voltages and beam powers

International Nuclear Information System (INIS)

Andelfinger, C.; Dommaschk, W.; Ott, W.; Ulrich, M.; Weber, G.

1975-01-01

An electron beam producing system for acceleration voltages on the order of megavolts and beam powers on the order of gigawatts is described. A tubular housing of insulating material is used, and adjacent to its one closed end, a field emission cathode with a large surface area is arranged, while at its other end, from which the electron beam emerges, an annular anode is arranged. The device for collimating the electron beam consists of annular electrodes. (auth)

Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

The effect of voltage droop on the output of an electrostatic accelerator free electron laser

CERN Document Server

Wright, C C; Lucas, J; Stuart, R A

2000-01-01

Electrostatic accelerator FEL oscillators when operated with energy recovery offer the prospect of long pulse, single-mode operation with very narrow linewidth at high-power levels. However, special care with wiggler construction, electron beam steering, and collector design is necessary to reduce the fraction of the electron beam lost before depressed collection to a sufficiently small value to stop the output hopping from one longitudinal mode of the cavity to another due to the droop of the terminal accelerating voltage. We are investigating what minimum recovery fraction is required both experimentally and theoretically. We have constructed a pulsed microwave FEM oscillator having an accelerating voltage of 65 kV supplied by a source, which is a capacitor, charged by a low-current, high-voltage supply. By changing the capacitor value, it is easily possible to achieve a range of voltage droop rates. Furthermore, because the gain bandwidth of the FEM is small, only 1 or 2 longitudinal modes are capable of b...

Calculation of current-voltage characteristics of electron-capture detectors

International Nuclear Information System (INIS)

Hinneburg, D.; Grosse, H.J.; Leonhardt, J.; Popp, P.

1983-01-01

Starting from the law of conservation of charge a stationary one-dimensional non-linear differential equation system is derived, which is applied to the direct-current mode of an electron-capture detector with parallel electrode plates. The theory takes into account space-charge, recombination, and inhomogeneous ionization and it deals with three kinds of charge carriers with different mobilities (positive and negative ions, electrons). Terms due to diffusion and gas-flow losses are excluded. The equations so constructed were programmed to get a means of calculating the charge and field distributions and the current-voltage characteristics as functions of various parameters of the detectors, the attaching gas and the ionization. For two cases the results are given. (author)

HIGH VOLTAGE ENVIRONMENTAL APPLICATIONS, INC.ELECTRON BEAM TECHNOLOGY - INNOVATIVE TECHNOLOGY EVALUATION REPORT

Science.gov (United States)

This report evaluates a high-voltage electron beam (E-beam) technology's ability to destroy volatile organic compounds (VOCs) and other contaminants present in liquid wastes. Specifically, this report discusses performance and economic data from a Superfund Innovative Technology...

Ion Back-Bombardment of GaAs Photocathodes Inside DC High Voltage Electron Guns

CERN Document Server

Grames, Joseph M; Brittian, Joshua; Charles, Daniel; Clark, Jim; Hansknecht, John; Lynn Stutzman, Marcy; Poelker, Matthew; Surles-Law, Kenneth E

2005-01-01

The primary limitation for sustained high quantum efficiency operation of GaAs photocathodes inside DC high voltage electron guns is ion back-bombardment of the photocathode. This process results from ionization of residual gas within the cathode/anode gap by the extracted electron beam, which is subsequently accelerated backwards to the photocathode. The damage mechanism is believed to be either destruction of the negative electron affinity condition at the surface of the photocathode or damage to the crystal structure by implantation of the bombarding ions. This work characterizes ion formation within the anode/cathode gap for gas species typical of UHV vacuum chambers (i.e., hydrogen, carbon monoxide and methane). Calculations and simulations are performed to determine the ion trajectories and stopping distance within the photocathode material. The results of the simulations are compared with test results obtained using a 100 keV DC high voltage GaAs photoemission gun and beamline at currents up to 10 mA D...

A quantum accurate waveform synthesizer as a voltage reference for an electronic primary thermometer

Science.gov (United States)

Pollarolo, Alessio; Benz, Samuel; Rogalla, Horst; Dresselhaus, Paul

2014-03-01

We are using a quantum voltage noise source (QVNS) for use as an intrinsically accurate voltage reference for a new type of electronic temperature standard. In Johnson Noise Thermometry (JNT) the noise of a resistor is used to measure temperature or Boltzmann's constant k, because the Nyquist equation =4kTR Δf shows that the power spectral density is proportional to k, temperature T, resistance R and measurement bandwidth Δf . The QVNS is a digital to analog converter used to synthesize a voltage waveform that resembles pseudo-random noise comparable in amplitude to the resistor noise. The signal generated is a frequency comb of harmonics tones that are equally spaced in frequency, all having identical amplitudes but random phases. The QVNS is an array superconducting Josephson junctions that are biased with a pulsed waveform clocked at 10 GHz. The accuracy of the voltage waveform derives from the identical voltage pulses produced by each junction that are perfectly quantized because their time-integrals are always equal to flux quantum h/2 e. The time-dependent output voltage waveform is determined by the number of pulses and their density in time. The measurement electronics exploits cross-correlation techniques to reduce the uncorrelated measurement noise so as to reveal the resistor noise, both of which are on the order of 2 nV/ √Hz. With this technique we have measured k with an uncertainty of about one part in 105, which we hope to improve by another order of magnitude with further research.

Excitation of vibrational quanta in furfural by intermediate-energy electrons

Science.gov (United States)

Jones, D. B.; Neves, R. F. C.; Lopes, M. C. A.; da Costa, R. F.; Varella, M. T. do N.; Bettega, M. H. F.; Lima, M. A. P.; García, G.; Blanco, F.; Brunger, M. J.

2015-12-01

We report cross sections for electron-impact excitation of vibrational quanta in furfural, at intermediate incident electron energies (20, 30, and 40 eV). The present differential cross sections are measured over the scattered electron angular range 10°-90°, with corresponding integral cross sections subsequently being determined. Furfural is a viable plant-derived alternative to petrochemicals, being produced via low-temperature plasma treatment of biomass. Current yields, however, need to be significantly improved, possibly through modelling, with the present cross sections being an important component of such simulations. To the best of our knowledge, there are no other cross sections for vibrational excitation of furfural available in the literature, so the present data are valuable for this important molecule.

Excitation of vibrational quanta in furfural by intermediate-energy electrons

Energy Technology Data Exchange (ETDEWEB)

Jones, D. B. [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia); Neves, R. F. C. [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia); Instituto Federal do Sul de Minas Gerais, Campus Poços de Caldas, Minas Gerais (Brazil); Departamento de Física, Universidade Federal de Juiz de Fora, 36036-900, Juiz de Fora, MG (Brazil); Lopes, M. C. A. [Departamento de Física, Universidade Federal de Juiz de Fora, 36036-900, Juiz de Fora, MG (Brazil); Costa, R. F. da [Instituto de Física “Gleb Wataghin,” Universidade Estadual de Campinas, Campinas, 13083-859 São Paulo (Brazil); Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, Santo André, 09210-580 São Paulo (Brazil); Varella, M. T. do N. [Instituto de Física, Universidade de São Paulo, CP 66318, 05315-970 São Paulo, São Paulo (Brazil); Bettega, M. H. F. [Departamento de Física, Universidade Federal do Paraná, CP 19044, 81531-990 Curitiba, Paraná (Brazil); Lima, M. A. P. [Instituto de Física “Gleb Wataghin,” Universidade Estadual de Campinas, Campinas, 13083-859 São Paulo (Brazil); García, G. [Instituto de Física Fundamental, CSIC, Serrano 113-bis, 28006 Madrid (Spain); and others

2015-12-14

We report cross sections for electron-impact excitation of vibrational quanta in furfural, at intermediate incident electron energies (20, 30, and 40 eV). The present differential cross sections are measured over the scattered electron angular range 10°–90°, with corresponding integral cross sections subsequently being determined. Furfural is a viable plant-derived alternative to petrochemicals, being produced via low-temperature plasma treatment of biomass. Current yields, however, need to be significantly improved, possibly through modelling, with the present cross sections being an important component of such simulations. To the best of our knowledge, there are no other cross sections for vibrational excitation of furfural available in the literature, so the present data are valuable for this important molecule.

Excitation of vibrational quanta in furfural by intermediate-energy electrons

International Nuclear Information System (INIS)

Jones, D. B.; Neves, R. F. C.; Lopes, M. C. A.; Costa, R. F. da; Varella, M. T. do N.; Bettega, M. H. F.; Lima, M. A. P.; García, G.

2015-01-01

We report cross sections for electron-impact excitation of vibrational quanta in furfural, at intermediate incident electron energies (20, 30, and 40 eV). The present differential cross sections are measured over the scattered electron angular range 10°–90°, with corresponding integral cross sections subsequently being determined. Furfural is a viable plant-derived alternative to petrochemicals, being produced via low-temperature plasma treatment of biomass. Current yields, however, need to be significantly improved, possibly through modelling, with the present cross sections being an important component of such simulations. To the best of our knowledge, there are no other cross sections for vibrational excitation of furfural available in the literature, so the present data are valuable for this important molecule

Development of an environmental high-voltage electron microscope for reaction science.

Science.gov (United States)

Tanaka, Nobuo; Usukura, Jiro; Kusunoki, Michiko; Saito, Yahachi; Sasaki, Katuhiro; Tanji, Takayoshi; Muto, Shunsuke; Arai, Shigeo

2013-02-01

Environmental transmission electron microscopy and ultra-high resolution electron microscopic observation using aberration correctors have recently emerged as topics of great interest. The former method is an extension of the so-called in situ electron microscopy that has been performed since the 1970s. Current research in this area has been focusing on dynamic observation with atomic resolution under gaseous atmospheres and in liquids. Since 2007, Nagoya University has been developing a new 1-MV high voltage (scanning) transmission electron microscope that can be used to observe nanomaterials under conditions that include the presence of gases, liquids and illuminating lights, and it can be also used to perform mechanical operations to nanometre-sized areas as well as electron tomography and elemental analysis by electron energy loss spectroscopy. The new instrument has been used to image and analyse various types of samples including biological ones.

THREE-DIMENSIONAL OBSERVATIONS ON THICK BIOLOGICAL SPECIMENS BY HIGH VOLTAGE ELECTRON MICROSCOPY

Directory of Open Access Journals (Sweden)

Tetsuji Nagata

2011-05-01

Full Text Available Thick biological specimens prepared as whole mount cultured cells or thick sections from embedded tissues were stained with histochemical reactions, such as thiamine pyrophosphatase, glucose-6-phosphatase, cytochrome oxidase, acid phosphatase, DAB reactions and radioautography, to observe 3-D ultrastructures of cell organelles producing stereo-pairs by high voltage electron microscopy at accerelating voltages of 400-1000 kV. The organelles demonstrated were Golgi apparatus, endoplasmic reticulum, mitochondria, lysosomes, peroxisomes, pinocytotic vesicles and incorporations of radioactive compounds. As the results, those cell organelles were observed 3- dimensionally and the relative relationships between these organelles were demonstrated.

Disinfection of sludge and waste-water by irradiation with electrons of low accelerating voltage

International Nuclear Information System (INIS)

Holl, P.; Schneider, H.

1975-01-01

From the point of view of hygiene, sewage sludge and water accumulating in ever increasing quantities, some of which is used in agriculture, represent a potential threat to the health of man and beast, as well as to the environment. It is known that these chains of infection can be broken up by ionizing radiation. The use of natural ionizing radiation or electron radiation with high accelerating voltage has not been accepted in practice because the radiation cannot be cut off and the investment cost for electron accelerators with an accelerating voltage of more than 1 MV is very high. These disadvantages may be overcome by using an electron accelerator with low accelerating voltage. Complex experiments have shown that it is not necessary to adapt the thickness of sewage sludge or water layer to the range of electrons. The layer to be irradiated may be much thicker if the substrate is revolved during irradiation. The advantages of this method are low accelerating voltage for the electrons and hence less costly radiation shielding, complete absorption of the radiated energy by the substrate, and low investment and operating cost. The sterilizing effect of the process can be explained by the secondary reactions that take place in the water, in addition to the primary reactions, when irradiating with high specific ionizing density. It is known from experiments carried out by Muenzner that water irradiated with electrons of high specific ionization density, when added to bacterial cultures, will destroy them. This is explained by the Weiss radical theory of water, with reaction products such as H 2 , O 2 and H 2 O 2 . The success of this process is shown by experiments with Escherichia coli, tap water to which Salmonella senftenberg were added, and by the content of Enterobacteriaceae in various sludges as a function of the irradiation period, as well as by the rate at which various invariable species of strongilide larvae, eggs of Ascaris suum, Fasciola hepatica and

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

The energy spectrum of the 'runaway' electrons from a high voltage pulsed discharge

International Nuclear Information System (INIS)

Ruset, C.

1985-01-01

Some experimental results are presented on the influence of the pressure upon the energy spectrum of the runaway electrons generated into a pulsed high voltage argon discharge. These electrons enter a state of continuous acceleration between two collisions with rapidly increasing free path. The applied discharge current varies from 10 to 300 A, the pulse time is about 800 ns. Relativistic effects are taken into consideration. Theoretical explanation is based on the pnenomenon of electron spreading on plasma oscillations. (D.Gy.)

Direct, coherent and incoherent intermediate state tunneling and scanning tunnel microscopy (STM)

International Nuclear Information System (INIS)

Halbritter, J.

1997-01-01

Theory and experiment in tunneling are still qualitative in nature, which hold true also for the latest developments in direct-, resonant-, coherent- and incoherent-tunneling. Those tunnel processes have recently branched out of the field of ''solid state tunnel junctions'' into the fields of scanning tunnel microscopy (STM), single electron tunneling (SET) and semiconducting resonant tunnel structures (RTS). All these fields have promoted the understanding of tunneling in different ways reaching from the effect of coherence, of incoherence and of charging in tunneling, to spin flip or inelastic effects. STM allows not only the accurate measurements of the tunnel current and its voltage dependence but, more importantly, the easy quantification via the (quantum) tunnel channel conductance and the distance dependence. This new degree of freedom entering exponentially the tunnel current allows an unique identification of individual tunnel channels and their quantification. In STM measurements large tunnel currents are observed for large distances d > 1 nm explainable by intermediate state tunneling. Direct tunneling with its reduced tunnel time and reduced off-site Coulomb charging bridges distances below 1 nm, only. The effective charge transfer process with its larger off-site and on-site charging at intermediate states dominates tunnel transfer in STM, biology and chemistry over distances in the nm-range. Intermediates state tunneling becomes variable range hopping conduction for distances larger than d > 2 nm, for larger densities of intermediate states n 1 (ε) and for larger temperatures T or voltages U, still allowing high resolution imaging

The electron-electron instability in a spherical plasma structure with an intermediate double layer

International Nuclear Information System (INIS)

Lapuerta, V.; Ahedo, E.

2003-01-01

A linear dynamic model of a spherical plasma structure with an intermediate double layer is analyzed in the high-frequency range. The two ion populations tend to stay frozen in their stationary response and this prevents the displacement of the double layer. Different electron modes dominate the plasma dynamics in each quasineutral region. The electrostatic potential and the electron current are the magnitudes most perturbed. The structure develops a reactive electron-electron instability, which is made up of a countable family of eigenmodes. Space-charge effects must be included in the quasineutral regions to determine the eigenmode carrying the maximum growth rate. Except for very small Debye lengths, the fundamental eigenmode governs the instability. The growth rate for the higher harmonics approaches that of an infinite plasma. The instability modes develop mainly on the plasma at the high-potential side of the double layer. The influence of the parameters defining the stationary solution on the instability growth rate is investigated, and the parametric regions of stability are found. The comparison with a couple of experiments on plasma contactors is satisfactory

On selection rules and inelastic electron scattering at intermediate energies

International Nuclear Information System (INIS)

Nuroh, K.

1986-12-01

Correlation effects are included in the Bethe-Born theory for the generalized oscillator strength of inelastic scattering of electrons on atoms. The formulation is such as to allow for the calculation of relative line strengths of multiplets. It is used to analyze line strengths of the 4d → 4f transition in La 3+ and Ce 4+ within LS-coupling. The analysis indicates that only singlet states of the intermediate 4d 9 4f configuration are allowed. Calculated line strengths are compared with a recent core electron energy loss spectra of metallic La and tetravalent CeO 2 and there is an overall qualitative agreement between theory and experiment. (author). 11 refs, 4 figs, 2 tabs

High voltage engineering fundamentals

CERN Document Server

Kuffel, E; Hammond, P

1984-01-01

Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

Science.gov (United States)

Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

2017-09-01

The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

Investigation of electrically active defects in InGaAs quantum wire intermediate-band solar cells using deep-level transient spectroscopy (DLTS) technique

OpenAIRE

Al Saqri, Noor alhuda; Felix, Jorlandio F.; Aziz, Mohsin; Kunets, Vasyl P.; Jameel, Dler Adil; Taylor, David; Henini, M.; Abd El-sadek, Mahmmoud S.; Furrow, Colin; Ware, Morgan E.; Benamara, Mourad; Mortazavi, Mansour; Salamo, Gregory

2016-01-01

InGaAs quantum wire (QWr) intermediate-band solar cell based nanostructures grown by molecular beam epitaxy are studied. The electrical and interface properties of these solar cell devices, as determined by current–voltage (I–V) and capacitance–voltage (C-V) techniques, were found to change with temperature over a wide range of 20–340 K. The electron and hole traps present in these devices have been investigated using deep-level transient spectroscopy (DLTS). The DLTS results showed that the ...

Differential cross sections for electron-impact vibrational-excitation of tetrahydrofuran at intermediate impact energies

Energy Technology Data Exchange (ETDEWEB)

Do, T. P. T. [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia); School of Education, Can Tho University, Campus II, 3/2 Street, Xuan Khanh, Ninh Kieu, Can Tho City (Viet Nam); Duque, H. V. [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia); Departamento de Física, Universidade Federal de Juiz de Fora, 36036-330 Juiz de Fora, Minas Gerais (Brazil); Lopes, M. C. A. [Departamento de Física, Universidade Federal de Juiz de Fora, 36036-330 Juiz de Fora, Minas Gerais (Brazil); Konovalov, D. A.; White, R. D. [College of Science, Technology and Engineering, James Cook University, Townsville (Australia); Brunger, M. J., E-mail: michael.brunger@flinders.edu.au, E-mail: darryl.jones@flinders.edu.au [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia); Institute of Mathematical Sciences, University of Malaya, 50603 Kuala Lumpur (Malaysia); Jones, D. B., E-mail: michael.brunger@flinders.edu.au, E-mail: darryl.jones@flinders.edu.au [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, South Australia 5001 (Australia)

2015-03-28

We report differential cross sections (DCSs) for electron-impact vibrational-excitation of tetrahydrofuran, at intermediate incident electron energies (15-50 eV) and over the 10°-90° scattered electron angular range. These measurements extend the available DCS data for vibrational excitation for this species, which have previously been obtained at lower incident electron energies (≤20 eV). Where possible, our data are compared to the earlier measurements in the overlapping energy ranges. Here, quite good agreement was generally observed where the measurements overlapped.

TiN coated aluminum electrodes for DC high voltage electron guns

International Nuclear Information System (INIS)

Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew

2015-01-01

Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes

Carrier behavior in special multilayer device composed of different transition metal oxide-based intermediate connectors

International Nuclear Information System (INIS)

Deng, Yan-Hong; Chen, Xiang-Yu; Ou, Qing-Dong; Wang, Qian-Kun; Jiang, Xiao-Cheng; Zhang, Dan-Dan; Li, Yan-Qing

2014-01-01

The impact of illumination on the connection part of the tandem organic light-emitting diodes was studied by using a special organic multilayer sample consisted of two organic active layers coupled with different transition metal oxide (TMO)-based intermediate connectors (ICs). Through measuring the current density-voltage characteristic, interfacial electronic structures, and capacitance-voltage characteristic, we observe an unsymmetrical phenomenon in current density-voltage and capacitance-voltage curves of Mg:Alq 3 /MoO 3 and MoO 3 composed devices, which was induced by the charge spouting zone near the ICs region and the recombination state in the MoO 3 layer. Moreover, Mg:Alq 3 /MoO 3 composed device displays a photovoltaic effect and the V oc shifts to forward bias under illumination. Our results demonstrate that the TMO-based IC structure coupled with photovoltaic effect can be a good approach for the study of photodetector, light sensor, and so on.

Low-voltage protonic/electronic hybrid indium zinc oxide synaptic transistors on paper substrates

International Nuclear Information System (INIS)

Wu, Guodong; Wan, Changjin; Wan, Qing; Zhou, Jumei; Zhu, Liqiang

2014-01-01

Low-voltage (1.5 V) indium zinc oxide (IZO)-based electric-double-layer (EDL) thin-film transistors (TFTs) gated by nanogranular proton conducting SiO 2 electrolyte films are fabricated on paper substrates. Both enhancement-mode and depletion-mode operation are obtained by tuning the thickness of the IZO channel layer. Furthermore, such flexible IZO protonic/electronic hybrid EDL TFTs can be used as artificial synapses, and synaptic stimulation response and short-term synaptic plasticity function are demonstrated. The protonic/electronic hybrid EDL TFTs on paper substrates proposed here are promising for low-power flexible paper electronics, artificial synapses and bioelectronics. (paper)

Electronic monitoring and voice prompts improve hand hygiene and decrease nosocomial infections in an intermediate care unit.

Science.gov (United States)

Swoboda, Sandra M; Earsing, Karen; Strauss, Kevin; Lane, Stephen; Lipsett, Pamela A

2004-02-01

To determine whether electronic monitoring of hand hygiene and voice prompts can improve hand hygiene and decrease nosocomial infection rates in a surgical intermediate care unit. Three-phase quasi-experimental design. Phase I was electronic monitoring and direct observation; phase II was electronic monitoring and computerized voice prompts for failure to perform hand hygiene on room exit; and phase III was electronic monitoring only. Nine-room, 14-bed intermediate care unit in a university, tertiary-care institution. All patient rooms, utility room, and staff lavatory were monitored electronically. All healthcare personnel including physicians, nurses, nursing support personnel, ancillary staff, all visitors and family members, and any other personnel interacting with patients on the intermediate care unit. All patients with an intermediate care unit length of stay >48 hrs were followed for nosocomial infection. Electronic monitoring during all phases, computerized voice prompts during phase II only. We evaluated a total of 283,488 electronically monitored entries into a patient room with 251,526 exits for 420 days (10,080 hrs and 3,549 patient days). Compared with phase I, hand hygiene compliance in patient rooms improved 37% during phase II (odds ratio, 1.38; 95% confidence interval, 1.04-1.83) and 41% in phase III (odds ratio, 1.41; 95% confidence interval, 1.07-1.84). When adjusting for patient admissions during each phase, point estimates of nosocomial infections decreased by 22% during phase II and 48% during phase III; when adjusting for patient days, the number of infections decreased by 10% during phase II and 40% during phase III. Although the overall rate of nosocomial infections significantly decreased when combining phases II and III, the association between nosocomial infection and individual phase was not significant. Electronic monitoring provided effective ongoing feedback about hand hygiene compliance. During both the voice prompt phase and post

Tunable valley polarization by a gate voltage when an electron tunnels through multiple line defects in graphene.

Science.gov (United States)

Liu, Zhe; Jiang, Liwei; Zheng, Yisong

2015-02-04

By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.

Operation Manual of the high voltage generator of the Pelletron electron accelerator

International Nuclear Information System (INIS)

Hernandez M, V.; Lopez V, H.; Alba P, U.

1988-04-01

The first version of a manual to operate the generator of high voltage generator of the Pelletron electron accelerator built in the ININ is presented. Since this generator has several components and/or elements, the one manual present has the purpose that the armed one or maintenance of anyone on its parts, is carried out in an orderly and efficient way. (Author)

Studies of dislocation loops produced by irradiation of ZnO in a high-voltage electron microscope

International Nuclear Information System (INIS)

Yoshiie, T.; Iwanaga, H.; Shibata, N.; Suzuki, K.; Takeuchi, S.

1980-01-01

Electron-irradiation studies on vapour-grown ZnO ribbon crystals have been carried out in situ in a high-voltage electron microscope. Dislocation loops nucleate both on stacking-fault planes and in the matrix by irradiation with electron accelerated through voltages higher than 700 kV at room temperature. Two types of loops with the Burgers vectors b=1/2c and b=a exist in the matrix, where a=1/3 and c=[0001]. On the other hand, loops with b=1/2c+a/3 and those with b=1/2c are formed on the prismatic fault planes and basal fault planes, respectively. Diffraction-contrast experiments show these loops to be of interstitial type. A re-irradiation experiment after the annealing indicates a possibility that there exist vacancies in the matrix at 700 0 C. (author)

Radiation effects on residual voltage of polyethylene films

International Nuclear Information System (INIS)

Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

1986-01-01

It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

Spectrum analysis of a voltage source converter due to semiconductor voltage drops

DEFF Research Database (Denmark)

Rasmussen, Tonny Wederberg; Eltouki, Mustafa

2017-01-01

It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

OBSERVATION OF MAGNETIC DOMAINS IN IRRADIATED TRANSITION METALS BY HIGH VOLTAGE ELECTRON MICROSCOPY

OpenAIRE

Ono , F.; Jakubovics , J.; Maeta , H.

1988-01-01

The effect of irradiation on the movement of domain walls was studied in ferromagnetic transition metals by using a high voltage electron microscope. In iron, a domain wall became easily movable at a 300 kV irradiation. The mobility was less affected in cobalt, while in nickel the effect was the greatest.

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

Science.gov (United States)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

Current-voltage curves for molecular junctions computed using all-electron basis sets

International Nuclear Information System (INIS)

Bauschlicher, Charles W.; Lawson, John W.

2006-01-01

We present current-voltage (I-V) curves computed using all-electron basis sets on the conducting molecule. The all-electron results are very similar to previous results obtained using effective core potentials (ECP). A hybrid integration scheme is used that keeps the all-electron calculations cost competitive with respect to the ECP calculations. By neglecting the coupling of states to the contacts below a fixed energy cutoff, the density matrix for the core electrons can be evaluated analytically. The full density matrix is formed by adding this core contribution to the valence part that is evaluated numerically. Expanding the definition of the core in the all-electron calculations significantly reduces the computational effort and, up to biases of about 2 V, the results are very similar to those obtained using more rigorous approaches. The convergence of the I-V curves and transmission coefficients with respect to basis set is discussed. The addition of diffuse functions is critical in approaching basis set completeness

Evaluation of the practical peak voltage quantity for clinical equipment in diagnostic radiology

International Nuclear Information System (INIS)

Pires, Joao dos Santos Justo

2007-01-01

The objective of this work is to evaluate the calculation of the Practical Peak Voltage (PPV) from the voltage waveform and the kerma contrast for two kinds of X-ray equipment: a single phase clinical equipment, a three phase clinical equipment. The PPV from a mammography system voltage waveform will also be established. The development of this work involves intermediate objectives that indicate the quality of the used methods to calculate the PPV. One of these intermediate objectives is the comparison between the invasive calculations of PPV (using a voltage divider) with the response of kVp meter that calculate the PPV. Another intermediate objective is to compare the PPV with the Contrast Equivalent Voltage (the original non-invasive PPV definition). The variation of the PPV with quantities that influence in the voltage waveform like ripple and sample rate will also be contemplated in this work. The results showed that the PPV quantity could be invasive determined trustworthy. Therefore, the ripple quantity is the mainly influence to determinate the PPV that affecting the non-invasive determination. This fact suggest that the non-invasive instruments manufacturers must reevaluate the calculation of the PPV quantity in their instruments. (author)

Low voltage powering of on-detector electronics for HL-LHC experiments upgrades

CERN Document Server

Bobillier, Vincent; Vasey, Francois; Karmakar, Sabyasachi; Maity, Manas; Roy, Subhasish; Kundu, Tapas Kumar

2018-01-01

All LHC experiments will be upgraded during the next LHC long shutdowns (LS2 and LS3). The increase in resolution and luminosity and the use of more advanced CMOS technology nodes typically implies higher current consumption of the on-detector electronics. In this context, and in view of limiting the cable voltage drop, point-of-load DC-DC converters will be used on detector. This will have a direct impact on the existing powering scheme, implying new AC-DC and/or DC-DC stages as well as changes in the power cabling infrastructure. This paper presents the first results obtained while evaluating different LV powering schemes and distribution layouts for HL-LHC trackers. The precise low voltage power source requirements are being assessed and understood using the CMS tracker upgrade as a use-case.

Electronic Devices for Controlling the Very High Voltage in the ALICE TPC Detector

CERN Document Server

Boccioli, Marco

2007-01-01

The Time Projection Chamber (TPC) is the core of the ALICE experiment at CERN. The TPC Very High Voltage project covers the development of the control system for the power supply that generates the 100kV necessary for the drift field in the TPC. This paper reports on the project progress, introducing the control system architecture from the electronics up to the control level. All the electronic devices will be described, highlighting their communication issues, and the challenges in integrating these devices in a PLC-based control system.

Development and application of a window-type environmental cell in high voltage electron microscope

International Nuclear Information System (INIS)

Wakasugi, Takenobu; Isobe, Shigehito; Umeda, Ayaka; Wang, Yongming; Hashimoto, Naoyuki; Ohnuki, Somei

2013-01-01

Highlights: ► A window-type environmental cell for a high voltage electron microscope (HVEM) is developed. ► In situ HVEM image of Pd under an H2 gas pressure is obtained. ► The effect of the window materials on the resolution and contamination of the HVEM image is tested. -- Abstract: A close type of an environmental cell was developed for a high voltage electron microscope. Using this cell allowed an in situ observation of hydrogenation in Pd particles under H 2 gas of 0.05 MPa at RT. Two types of window films, Tri-Acetyl-Cellulose (TAC) and Silicon Nitride (SiN), were used for testing the contamination on the sample, as well as the strength for pressure. We confirmed the hydrogenation in diffraction patterns and images, and additionally the image resolution of 0.19 nm was obtained by using a SiN film with a thickness of 17 nm

The energy-deposition model. Electron loss of heavy ions in collisions with neutral atoms at low and intermediate energies

International Nuclear Information System (INIS)

Shevelko, V.P.; Litsarev, M.S.; Kato, D.; Tawara, H.

2010-09-01

Single- and multiple-electron loss processes in collisions of heavy many-electron ions (positive and negative) in collisions with neutral atoms at low and intermediate energies are considered using the energy-deposition model. The DEPOSIT computer code, created earlier to calculate electron-loss cross sections at high projectile energies, is extended for low and intermediate energies. A description of a new version of DEPOSIT code is given, and the limits of validity for collision velocity in the model are discussed. Calculated electron-loss cross sections for heavy ions and atoms (N + , Ar + , Xe + , U + , U 28+ , W, W + , Ge - , Au - ), colliding with neutral atoms (He, Ne, Ar, W) are compared with available experimental and theoretical data at energies E > 10 keV/u. It is found that in most cases the agreement between experimental data and the present model is within a factor of 2. Combining results obtained by the DEPOSIT code at low and intermediate energies with those by the LOSS-R code at high energies (relativistic Born approximation), recommended electron-loss cross sections in a wide range of collision energy are presented. (author)

Development of novel low-voltage free-electron lasers in the 5-500GHz region

International Nuclear Information System (INIS)

Zhong, Xiehe

2002-01-01

The electromagnetic spectrum from 5GHz to 500GHz is important for many industrial, commercial, and scientific applications. In particular for the 100 - 500GHz region, free electron lasers (FELs) are usually the only viable radiation sources with sizeable output power and as such are an attractive enabling technology for many applications. One major issue for widespread application of free electron lasers is to reduce their cost and size. This is particularly challenging because of the expensive electron accelerator system they employ. To make it significantly more attractive economically for many important applications, the electron energy has to be reduced to below 300keV. In this thesis two novel electron-energy-reduction techniques are investigated for FEL systems operated in the spectrum from 5GHz to 500GHz with the development of a suite of suitable FEL codes. In the microwave to millimetre-wave region, a novel energy reduction technique based on second harmonic waveguide FELs is studied. It is shown that the required electron voltage is approximately half of what is normally required for comparable conventional waveguide FELs. Effect of electron energy spread is studied for second harmonic waveguide FELs both in microwave and millimetre-wave regions. It is shown that strong wiggler field enhances electron hunching thereby increasing the small-signal gain as well as the insusceptibility to electron voltage spread. Saturation behaviour of second harmonic waveguide FELs is also studied because it is important for evaluation of output power. For FEL generation above 300GHz, it is found that second harmonic waveguide FELs need to increase electron energy above 300keV. To this end, a second energy reduction technique is considered based on a novel quasiperiodic wiggler. It is established that by changing the initial phase angle between the two component wigglers, strong radiation can be generated near 1THz with electron energy below 300keV. (author)

Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

Science.gov (United States)

Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

2017-10-01

Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Novel semiconductor solar cell structures: The quantum dot intermediate band solar cell

International Nuclear Information System (INIS)

Marti, A.; Lopez, N.; Antolin, E.; Canovas, E.; Stanley, C.; Farmer, C.; Cuadra, L.; Luque, A.

2006-01-01

The Quantum Dot Intermediate Band Solar Cell (QD-IBSC) has been proposed for studying experimentally the operating principles of a generic class of photovoltaic devices, the intermediate band solar cells (IBSC). The performance of an IBSC is based on the properties of a semiconductor-like material which is characterised by the existence of an intermediate band (IB) located within what would otherwise be its conventional bandgap. The improvement in efficiency of the cell arises from its potential (i) to absorb below bandgap energy photons and thus produce additional photocurrent, and (ii) to inject this enhanced photocurrent without degrading its output photo-voltage. The implementation of the IBSC using quantum dots (QDs) takes advantage of the discrete nature of the carrier density of states in a 0-dimensional nano-structure, an essential property for realising the IB concept. In the QD-IBSC, the IB arises from the confined electron states in an array of quantum dots. This paper reviews the operation of the first prototype QD-IBSCs and discusses some of the lessons learnt from their characterisation

Novel semiconductor solar cell structures: The quantum dot intermediate band solar cell

Energy Technology Data Exchange (ETDEWEB)

Marti, A. [Instituto de Energia Solar-UPM, ETSIT de Madrid, Ciudad Universitaria sn, 28040 Madrid (Spain)]. E-mail: amarti@etsit.upm.es; Lopez, N. [Instituto de Energia Solar-UPM, ETSIT de Madrid, Ciudad Universitaria sn, 28040 Madrid (Spain); Antolin, E. [Instituto de Energia Solar-UPM, ETSIT de Madrid, Ciudad Universitaria sn, 28040 Madrid (Spain); Canovas, E. [Instituto de Energia Solar-UPM, ETSIT de Madrid, Ciudad Universitaria sn, 28040 Madrid (Spain); Stanley, C. [Department of Electronics and Electrical Engineering, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Farmer, C. [Department of Electronics and Electrical Engineering, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Cuadra, L. [Departamento de Teoria de la Senal y Comunicaciones- Escuela Politecnica Superior, Universidad de Alcala, Ctra. Madrid-Barcelona, km. 33600, 28805-Alcala de Henares (Madrid) (Spain); Luque, A. [Instituto de Energia Solar-UPM, ETSIT de Madrid, Ciudad Universitaria sn, 28040 Madrid (Spain)

2006-07-26

The Quantum Dot Intermediate Band Solar Cell (QD-IBSC) has been proposed for studying experimentally the operating principles of a generic class of photovoltaic devices, the intermediate band solar cells (IBSC). The performance of an IBSC is based on the properties of a semiconductor-like material which is characterised by the existence of an intermediate band (IB) located within what would otherwise be its conventional bandgap. The improvement in efficiency of the cell arises from its potential (i) to absorb below bandgap energy photons and thus produce additional photocurrent, and (ii) to inject this enhanced photocurrent without degrading its output photo-voltage. The implementation of the IBSC using quantum dots (QDs) takes advantage of the discrete nature of the carrier density of states in a 0-dimensional nano-structure, an essential property for realising the IB concept. In the QD-IBSC, the IB arises from the confined electron states in an array of quantum dots. This paper reviews the operation of the first prototype QD-IBSCs and discusses some of the lessons learnt from their characterisation.

Improvement the Capacity of Cockcroft-Walton High Voltage Source from 300 kV/20 mA to 500 kV/20 mA for Accelerating Voltage of Electron Beam Machine

International Nuclear Information System (INIS)

Suprapto; Djasiman

2002-01-01

The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)

Ultrahigh Voltage Electron Microscopy Links Neuroanatomy and Neuroscience/Neuroendocrinology

Directory of Open Access Journals (Sweden)

Hirotaka Sakamoto

2012-01-01

Full Text Available The three-dimensional (3D analysis of anatomical ultrastructures is extremely important in most fields of biological research. Although it is very difficult to perform 3D image analysis on exact serial sets of ultrathin sections, 3D reconstruction from serial ultrathin sections can generally be used to obtain 3D information. However, this technique can only be applied to small areas of a specimen because of technical and physical difficulties. We used ultrahigh voltage electron microscopy (UHVEM to overcome these difficulties and to study the chemical neuroanatomy of 3D ultrastructures. This methodology, which links UHVEM and light microscopy, is a useful and powerful tool for studying molecular and/or chemical neuroanatomy at the ultrastructural level.

Microwave-Induced Magneto-Oscillations and Signatures of Zero-Resistance States in Phonon-Drag Voltage in Two-Dimensional Electron Systems.

Science.gov (United States)

Levin, A D; Momtaz, Z S; Gusev, G M; Raichev, O E; Bakarov, A K

2015-11-13

We observe the phonon-drag voltage oscillations correlating with the resistance oscillations under microwave irradiation in a two-dimensional electron gas in perpendicular magnetic field. This phenomenon is explained by the influence of dissipative resistivity modified by microwaves on the phonon-drag voltage perpendicular to the phonon flux. When the lowest-order resistance minima evolve into zero-resistance states, the phonon-drag voltage demonstrates sharp features suggesting that current domains associated with these states can exist in the absence of external dc driving.

Some applications of the high voltage electron microscope in physical metallurgy

International Nuclear Information System (INIS)

Regnier, P.; Thomas de Montpreville, C.

1976-01-01

The high voltage electron microscope (HVEM) is a microscope with a much higher penetration than the usual ones, as well as being a remarkable irradiation machine. The possible applications of the HVEM related to its advantages over the conventional microscopes are first discussed. The simultaneous use of the HVEM as an irradiation machine and an observation tool is then discussed, experiments carried in the laboratory being referred to. The last use of the HVEM makes it an irreplaceable tool for continuously following the clustering of irradiation defects [fr

Current transport and capacitance-voltage characteristics of an n-PbTe/p-GaP heterojunction prepared using the electron beam deposition technique

Science.gov (United States)

Nasr, Mahmoud; El Radaf, I. M.; Mansour, A. M.

2018-04-01

In this study, a crystalline n-PbTe/p-GaP heterojunction was fabricated using the electron beam deposition technique. The structural properties of the prepared heterojunction were examined by X-ray diffraction and scanning electron microscopy. The dark current-voltage characteristics of the heterojunction were investigated at different temperatures ranging from 298 to 398 K. The rectification factor, series resistance, shunt resistance, diode ideality factor, and effective barrier height (ϕb) were determined. The photovoltaic parameters were identified based on the current density-voltage characteristics under illumination. The capacitance-voltage characteristics showed that the junction was abrupt in nature.

Note: Self-biased voltage to suppress secondary electrons by a ZnO varistor in a compact pulsed neutron generator

Science.gov (United States)

Yang, Z.; Li, X.; Li, J.; Long, J. D.; Lan, C. H.; Wang, T.; Dong, P.; He, J. L.

2017-03-01

A large amount of back streaming electrons will bring about a part of current drain on power supply, cause sparking or high-voltage breakdowns, and affect the neutron yield and waveform for a compact sealed-tube pulsed neutron generator. A novel idea which uses a ZnO varistor to provide a constant self-biased voltage to suppress the secondary electrons is introduced. The I-V curve for the ZnO varistor was measured in the experiment. The effects of suppressing the secondary electrons were investigated using a ZnO varistor, linear resistors, and an independent power supply, respectively. The results show that the secondary electrons are suppressed effectively by the compact ZnO varistor, while not increasing the size and the component of the device. It is a promising design for compact sealed-tube neutron generators.

Reconstruction of the electron energy distribution function from probe characteristics at intermediate and high pressures

International Nuclear Information System (INIS)

Arslanbekov, R.R.; Kolokolov, N.B.; Kudryavtsev, A.A.; Khromov, N.A.

1991-01-01

Gorbunov et al. have developed a kinetic theory of the electron current drawn by a probe, which substantially extends the region of applicability of the probe method for determining the electron energy distribution function, enabling probes to be used for intermediate and high pressures (up to p ≤ 0.5 atm for monatomic gases). They showed that for λ var-epsilon >> a + d (where a is the probe radius, d is the sheath thickness, and λ var-epsilon is the electron energy relaxation length) the current density j e (V) drawn by the probe is related to the unperturbed distribution function by an integral equation involving the distribution function. The kernal of the integral equation can be written as a function of the diffusion parameter. In the present paper the method of quadrature sums is employed in order to obtain the electron energy distribution function from probe characteristics at intermediate and high pressures. This technique enables them to recover the distribution function from the integral equation when the diffusion parameter has an arbitrary energy dependence ψ 0 (var-epsilon) in any given energy range. The effectiveness of the method is demonstrated by application to both model problems and experimental data

High-Current Plasma Electron Sources

International Nuclear Information System (INIS)

Gushenets, J.Z.; Krokhmal, V.A.; Krasik, Ya. E.; Felsteiner, J.; Gushenets, V.

2002-01-01

In this report we present the design, electrical schemes and preliminary results of a test of 4 different electron plasma cathodes operating under Kg h-voltage pulses in a vacuum diode. The first plasma cathode consists of 6 azimuthally symmetrically distributed arc guns and a hollow anode having an output window covered by a metal grid. Plasma formation is initiated by a surface discharge over a ceramic washer placed between a W-made cathode and an intermediate electrode. Further plasma expansion leads to a redistribution of the discharge between the W-cathode and the hollow anode. An accelerating pulse applied between the output anode grid and the collector extracts electrons from this plasma. The operation of another plasma cathode design is based on Penning discharge for preliminary plasma formation. The main glow discharge occurs between an intermediate electrode of the Penning gun and the hollow anode. To keep the background pressure in the accelerating gap at P S 2.5x10 4 Torr either differential pumping or a pulsed gas puff valve were used. The operation of the latter electron plasma source is based on a hollow cathode discharge. To achieve a sharp pressure gradient between the cathode cavity and the accelerating gap a pulsed gas puff valve was used. A specially designed ferroelectric plasma cathode initiated plasma formation inside the hollow cathode. This type of the hollow cathode discharge ignition allowed to achieve a discharge current of 1.2 kA at a background pressure of 2x10 4 Torr. All these cathodes were developed and initially tested inside a planar diode with a background pressure S 2x10 4 Torr under the same conditions: accelerating voltage 180 - 300 kV, pulse duration 200 - 400 ns, electron beam current - 1 - 1.5 kA, and cross-sectional area of the extracted electron beam 113 cm 2

Electron tunnelling through single azurin molecules can be on/off switched by voltage pulses

Energy Technology Data Exchange (ETDEWEB)

Baldacchini, Chiara [Biophysics and Nanoscience Centre, DEB-CNISM, Università della Tuscia, I-01100 Viterbo (Italy); Institute of Agro-Environmental and Forest Biology, CNR, I-05010 Porano (Italy); Kumar, Vivek; Bizzarri, Anna Rita; Cannistraro, Salvatore, E-mail: cannistr@unitus.it [Biophysics and Nanoscience Centre, DEB-CNISM, Università della Tuscia, I-01100 Viterbo (Italy)

2015-05-04

Redox metalloproteins are emerging as promising candidates for future bio-optoelectronic and nano-biomemory devices, and the control of their electron transfer properties through external signals is still a crucial task. Here, we show that a reversible on/off switching of the electron current tunnelling through a single protein can be achieved in azurin protein molecules adsorbed on gold surfaces, by applying appropriate voltage pulses through a scanning tunnelling microscope tip. The observed changes in the hybrid system tunnelling properties are discussed in terms of long-sustained charging of the protein milieu.

Voltage Dependence of Supercapacitor Capacitance

Directory of Open Access Journals (Sweden)

Szewczyk Arkadiusz

2016-09-01

Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

Control Method for DC-Link Voltage Ripple Cancellation in Voltage Source Inverter under Unbalanced Three-Phase Voltage Supply Conditions

Czech Academy of Sciences Publication Activity Database

Chomát, Miroslav; Schreier, Luděk

2005-01-01

Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005

Voltage control of a power-frequency E-beam irradiator

International Nuclear Information System (INIS)

Zhou Zhizhong; Hu Shouming; Wang Jun; Guo Honglei; Su Haijun

2012-01-01

Voltage stability and precision are key specifications of an electron beam irradiator. A voltage control system was developed for smooth high voltage regulating on a power frequency electron accelerator. Pillar variac driven by servo motor was used as the regulating device, with a programmable logic controller as the control unit. An industrial PC was employed to realize human-machine interaction. Open-loop and closed-loop modes were employed to regulate the high voltage. Experimental results show that the speed, stability and precision for high voltage regulating were improved greatly, hence a much better performance of the electron accelerator. (authors)

Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

KAUST Repository

Graham, Kenneth; Erwin, Patrick; Nordlund, Dennis; Vandewal, Koen; Li, Ruipeng; Ngongang Ndjawa, Guy Olivier; Hoke, Eric T.; Salleo, Alberto; Thompson, Mark E.; McGehee, Michael D.; Amassian, Aram

2013-01-01

The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

KAUST Repository

Graham, Kenneth

2013-07-30

The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

Directory of Open Access Journals (Sweden)

Chaichana Amornchai

2017-01-01

Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

Interactions in 2D electron and hole systems in the intermediate and ballistic regimes

International Nuclear Information System (INIS)

Proskuryakov, Y Y; Savchenko, A K; Safonov, S S; Li, L; Pepper, M; Simmons, M Y; Ritchie, D A; Linfield, E H; Kvon, Z D

2003-01-01

In different 2D semiconductor systems we study the interaction correction to the Drude conductivity in the intermediate and ballistic regimes, where the parameter k B Tτ/ h-bar changes from 0.1 to 10 (τ is momentum relaxation time). The temperature dependence of the resistance and magnetoresistance in parallel and perpendicular magnetic fields is analysed in terms of the recent theories of electron-electron interactions in systems with different degree of disorder and different character of the fluctuation potential. Generally, good agreement is found between the experiments and the theories

Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

International Nuclear Information System (INIS)

Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

2015-01-01

The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

Theoretical treatment of electron capture and excitation in two-electron system ion-atom, atom-atom collisions at low to intermediate energy

International Nuclear Information System (INIS)

Kimura, M.

1986-01-01

A review of various theoretical treatments which have been used to study electron-capture and excitation processes in two-electron-system ion-atom, atom-atom collisions at low to intermediate energy is presented. Advantages as well as limitations associated with these theoretical models in application to practical many-electron ion-atom, atom-atom collisions are specifically pointed out. Although a rigorous theoretical study of many-electron systems has just begun so that reports of theoretical calculations are scarce to date in comparison to flourishing experimental activities, some theoretical results are of great interest and provide important information for understanding collision dynamics of the system which contains many electrons. Selected examples are given for electron capture in a multiply charged ion-He collision, ion-pair formation in an atom-atom collision and alignment and orientation in a Li + + He collision. (Auth.)

Low-voltage gyrotrons

International Nuclear Information System (INIS)

Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

2013-01-01

For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

Soft X-ray generation in gases by means of a pulsed electron beam produced in a high-voltage barier discharge

NARCIS (Netherlands)

Azarov, A.V.; Peters, P.J.M.; Boller, Klaus J.

2007-01-01

A large area pulsed electron beam is produced by a high-voltage barrier discharge. We compare the properties of the x-rays generated by stopping this beam of electrons in a thin metal foil with those generated by stopping the electrons directly in various gases. The generation of x-rays was

Calibration of Monte Carlo simulation code to low voltage electron beams through radiachromic dosimetry

International Nuclear Information System (INIS)

Weiss, D.E.; Kalweit, H.W.; Kensek, R.P.

1994-01-01

A simple multilayer slab model of an electron beam using the ITS/TIGER code can consistently account for about 80% of the actual dose delivered by a low voltage electron beam. The difference in calculated values is principally due to the 3D hibachi structure which blocks 22% of the beam. A 3D model was constructed using the ITS/ACCEPT code to improve upon the TIGER simulations. A rectangular source description update to the code and reproduction of all key geometric elements involved, including the hibachi, accounted for 90-95% of the dose received by routine dosimetry

Simulation of forward dark current voltage characteristics of tandem solar cells

International Nuclear Information System (INIS)

Rubinelli, F.A.

2012-01-01

The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

Electronic emission produced by light projectiles at intermediate energies

International Nuclear Information System (INIS)

Bernardi, G.C.

1989-01-01

Two aspects of the electronic emission produced by light projectiles of intermediate energies have been studied experimentally. In the first place, measurements of angular distributions in the range from θ = 0 deg -50 deg induced by collisions of 50-200 keV H + incident on He have been realized. It was found that the double differential cross section of electron emission presents a structure focussed in the forward direction and which extends up to relatively large angles. Secondly, the dependence of the double differential cross section on the projectile charge was studied using H + and He 3 2+ projectiles of 50 and 100 keV/amu incident on He. Strong deviations from a constant scaling factor were found for increasing projectile charge. The double differential cross sections and the single differential cross sections as a function of the emission angle, and the ratios of the emissions induced by He 3 2+ and H + at equal incident projectile velocities are compared with the 'Continuum Distorted Wave-Eikonal Initial State' (CDW-EIS) approximation and the 'Classical Trajectory Monte Carlo' (CTMC) method. Both approximations, in which the potential of the projectile exercises a relevant role, reproduce the general aspects of the experimental results. An electron analyzer and the corresponding projectile beam line has been designed and installed; it is characterized by a series of properties which are particularly appropriate for the study of double differential electronic emission in gaseous as well as solid targets. The design permits to assure the conditions to obtain a well localized gaseous target and avoid instrumental distortions of the measured distributions. (Author) [es

MOS Capacitance—Voltage Characteristics II. Sensitivity of Electronic Trapping at Dopant Impurity from Parameter Variations

International Nuclear Information System (INIS)

Jie Binbin; Sah Chihtang

2011-01-01

Low-frequency and high-frequency Capacitance—Voltage (C—V) curves of Metal—Oxide—Semiconductor Capacitors (MOSC), including electron and hole trapping at the dopant donor and acceptor impurities, are presented to illustrate giant trapping capacitances, from > 0.01C OX to > 10C OX . Five device and materials parameters are varied for fundamental trapping parameter characterization, and electrical and optical signal processing applications. Parameters include spatially constant concentration of the dopant-donor-impurity electron trap, N DD , the ground state electron trapping energy level depth measured from the conduction band edge, E C –E D , the degeneracy of the trapped electron at the ground state, g D , the device temperature, T, and the gate oxide thickness, x OX . (invited papers)

Prediction of breakdown voltages in novel gases for high voltage insulation

International Nuclear Information System (INIS)

Koch, M.

2015-01-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

Formation of 1.4 MeV runaway electron flows in air using a solid-state generator with 10 MV/ns voltage rise rate

Science.gov (United States)

Mesyats, G. A.; Pedos, M. S.; Rukin, S. N.; Rostov, V. V.; Romanchenko, I. V.; Sadykova, A. G.; Sharypov, K. A.; Shpak, V. G.; Shunailov, S. A.; Ul'masculov, M. R.; Yalandin, M. I.

2018-04-01

Fulfillment of the condition that the voltage rise time across an air gap is comparable with the time of electron acceleration from a cathode to an anode allows a flow of runaway electrons (REs) to be formed with relativistic energies approaching that determined by the amplitude of the voltage pulse. In the experiment described here, an RE energy of 1.4 MeV was observed by applying a negative travelling voltage pulse of 860-kV with a maximum rise rate of 10 MV/ns and a rise time of 100-ps. The voltage pulse amplitude was doubled at the cathode of the 2-cm-long air gap due to the delay of conventional pulsed breakdown. The above-mentioned record-breaking voltage pulse of ˜120 ps duration with a peak power of 15 GW was produced by an all-solid-state pulsed power source utilising pulse compression/sharpening in a multistage gyromagnetic nonlinear transmission line.

Improving the output voltage waveform of an intense electron-beam accelerator based on helical type Blumlein pulse forming line

Directory of Open Access Journals (Sweden)

Xin-Bing Cheng

2010-07-01

Full Text Available The Blumlein pulse forming line (BPFL consisting of an inner coaxial pulse forming line (PFL and an outer coaxial PFL is widely used in the field of pulsed power, especially for intense electron-beam accelerators (IEBA. The output voltage waveform determines the quality and characteristics of the output beam current of the IEBA. Comparing with the conventional BPFL, an IEBA based on a helical type BPFL can increase the duration of the output voltage in the same geometrical volume. However, for the helical type BPFL, the voltage waveform on a matched load may be distorted which influences the electron-beam quality. In this paper, an IEBA based on helical type BPFL is studied theoretically. Based on telegrapher equations of the BPFL, a formula for the output voltage of IEBA is obtained when the transition section is taken into account, where the transition section is between the middle cylinder of BPFL and the load. From the theoretical analysis, it is found that the wave impedance and transit time of the transition section influence considerably the main pulse voltage waveform at the load, a step is formed in front of the main pulse, and a sharp spike is also formed at the end of the main pulse. In order to get a well-shaped square waveform at the load and to improve the electron-beam quality of such an accelerator, the wave impedance of the transition section should be equal to that of the inner PFL of helical type BPFL and the transit time of the transition section should be designed as short as possible. Experiments performed on an IEBA with the helical type BPFL show reasonable agreement with theoretical analysis.

High breakdown voltage in AlGaN/GaN HEMTs using AlGaN/GaN/AlGaN quantum-well electron-blocking layers.

Science.gov (United States)

Lee, Ya-Ju; Yao, Yung-Chi; Huang, Chun-Ying; Lin, Tai-Yuan; Cheng, Li-Lien; Liu, Ching-Yun; Wang, Mei-Tan; Hwang, Jung-Min

2014-01-01

In this paper, we numerically study an enhancement of breakdown voltage in AlGaN/GaN high-electron-mobility transistors (HEMTs) by using the AlGaN/GaN/AlGaN quantum-well (QW) electron-blocking layer (EBL) structure. This concept is based on the superior confinement of two-dimensional electron gases (2-DEGs) provided by the QW EBL, resulting in a significant improvement of breakdown voltage and a remarkable suppression of spilling electrons. The electron mobility of 2-DEG is hence enhanced as well. The dependence of thickness and composition of QW EBL on the device breakdown is also evaluated and discussed.

Development of Multi-Functional Voltage Restore System

Science.gov (United States)

Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki

Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.

High resolution and high voltage electron microscopy at the University of California, Berkeley

International Nuclear Information System (INIS)

Thomas, G.; Westmacott, K.H.

1978-01-01

Recent applications of high-resolution and high-voltage techniques at Berkely are described, using 100-kV TEMs and a standard 650-keV HVEM: grain boundary precipitation in Al--Zn, lattice imaging of grain boundaries in ceramics, steels, phase transitions and magnetic properties of ferrites, lattice defects, precipitation in Al--Si and behavior of interstitial dislocations under electron irradiation, effect of oxide films on loop formation in Al--Mg, and polytypism in magnesium Sialon. 13 refs. 12 figs

Prediction of breakdown voltages in novel gases for high voltage insulation

Energy Technology Data Exchange (ETDEWEB)

Koch, M.

2015-07-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

Effect of gate length on breakdown voltage in AlGaN/GaN high-electron-mobility transistor

International Nuclear Information System (INIS)

Luo Jun; Zhao Sheng-Lei; Mi Min-Han; Zhang Jin-Cheng; Ma Xiao-Hua; Hao Yue; Chen Wei-Wei; Hou Bin

2016-01-01

The effects of gate length L G on breakdown voltage V BR are investigated in AlGaN/GaN high-electron-mobility transistors (HEMTs) with L G = 1 μm∼ 20 μm. With the increase of L G , V BR is first increased, and then saturated at L G = 3 μm. For the HEMT with L G = 1 μm, breakdown voltage V BR is 117 V, and it can be enhanced to 148 V for the HEMT with L G = 3 μm. The gate length of 3 μm can alleviate the buffer-leakage-induced impact ionization compared with the gate length of 1 μm, and the suppression of the impact ionization is the reason for improving the breakdown voltage. A similar suppression of the impact ionization exists in the HEMTs with L G > 3 μm. As a result, there is no obvious difference in breakdown voltage among the HEMTs with L G = 3 μm∼20 μm, and their breakdown voltages are in a range of 140 V–156 V. (paper)

Electronic band gap and transport in graphene superlattice with a Gaussian profile potential voltage

International Nuclear Information System (INIS)

Zhang Yu-Ping; Yin Yi-Heng; Lü Huan-Huan; Zhang Hui-Yun

2014-01-01

We study the electronic properties for the graphene-based one-dimensional superlattices, whose potential voltages vary according to the envelope of a Gaussian function. It is found that an unusual Dirac point exists and its location is exactly associated with a zero-averaged wave number (zero-k-bar ) gap. This zero-k-bar gap is less sensitive to incident angle and lattice constants, properties opposing those of Bragg gap. The defect mode appearing inside the zero-k-bar gap has an effect on transmission, conductance, and shot noise, which will be useful for further investigation. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Three-Input Single-Output Voltage-Mode Multifunction Filter with Electronic Controllability Based on Single Commercially Available IC

Directory of Open Access Journals (Sweden)

Supachai Klungtong

2017-01-01

Full Text Available This paper presents a second-order voltage-mode filter with three inputs and single-output voltage using single commercially available IC, one resistor, and two capacitors. The used commercially available IC, called LT1228, is manufactured by Linear Technology Corporation. The proposed filter is based on parallel RLC circuit. The filter provides five output filter responses, namely, band-pass (BP, band-reject (BR, low-pass (LP, high-pass (HP, and all-pass (AP functions. The selection of each filter response can be done without the requirement of active and passive component matching condition. Furthermore, the natural frequency and quality factor are electronically controlled. Besides, the nonideal case is also investigated. The output voltage node exhibits low impedance. The experimental results can validate the theoretical analyses.

Modeling and Analysis of the Common Mode Voltage in a Cascaded H-Bridge Electronic Power Transformer

Directory of Open Access Journals (Sweden)

Yun Yang

2017-09-01

Full Text Available Electronic power transformers (EPTs have been identified as emerging intelligent electronic devices in the future smart grid, e.g., the Energy Internet, especially in the application of renewable energy conversion and management. Considering that the EPT is directly connected to the medium-voltage grid, e.g., a10 kV distribution system, and its cascaded H-bridges structure, the common mode voltage (CMV issue will be more complex and severe. The CMV will threaten the insulation of the entire EPT device and even produce common mode current. This paper investigates the generated mechanism and characteristics of the CMV in a cascaded H-bridge EPT (CHB-EPT under both balanced and fault grid conditions. First, the CHB-EPT system is introduced. Then, a three-phase simplified circuit model of the high-voltage side of the EPT system is presented. Combined with a unipolar modulation strategy and carrier phase shifting technology by rigorous mathematical analysis and derivation, the EPT internal CMV and its characteristics are obtained. Moreover, the influence of the sinusoidal pulse width modulation dead time is considered and discussed based on analytical calculation. Finally, the simulation results are provided to verify the validity of the aforementioned model and the analysis results. The proposed theoretical analysis method is also suitable for other similar cascaded converters and can provide a useful theoretical guide for structural design and power density optimization.

Damage structure of gallium arsenide irradiated in a high-voltage electron microscope

International Nuclear Information System (INIS)

Loretto, D.; Loretto, M.H.

1989-01-01

Semi-insulating undoped gallium arsenide has been irradiated in a high-voltage electron microscope between room temperature and about 500 0 C for doses of up to 5 x 10 22 electrons cm -2 at 1 MeV. Room-temperature irradiation produces small (less than 5 nm) damage clusters. As the temperature of the irradiation is increased, the size of these clusters increases, until at about 300 0 C a high density of dislocation loops can be resolved. The dislocation loops, 20 nm or less in diameter, which are produced at about 500 0 C have been analysed in a bright field using a two-beam inside-outside method which minimises the tilt necessary between micrographs. It is concluded that the loops are an interstitial perfect-edge type with a Burgers vector of (a/2) . (author)

Influence of the parameters of supplying pulses and polarization voltage on the signal and shape of current characteristics of the electron capture detector

International Nuclear Information System (INIS)

Lasa, J.; Sliwka, I.; Drozdowicz, B.

1989-01-01

The paper contains results of measurements of current characteristics and of the signal for the constant concentration of freon F-11 of the ECD supplied with pulse voltage of changeable time of pulse duration t p , amplitude U 1 and the time of pulse repetition t r . In the course of measurements the detector worked at temperature 573 K with the additional constant polarization voltage. The polarization voltage has been observed to cause the effect of hypercoulometry. The presented mathematical analysis helps to determine the values of the coefficient of efficiency of electron capture p, the coefficient of electron loss k D , the coefficient of collecting of electric charges by the anode k' 3 and the coefficient of collecting of electric charges by the detector cathode k u . The coefficients are determined on the basis of experimental measurements. An attempt of physical interpretation of calculated values of these coefficients and their dependence on the parameters of the pulses supplying the detector has been presented. This interpretation requires the assumption that in some pulse periods t r the concentration of positive ions in the detector considerably exceeds concentration n 0 + = √a xα e /V, where a is an efficiency of the carrier gas ionization, α e is the coefficient of the electron-ion recombination and V is the detector volume. This statement helping to describe the effects observed in the electron capture polarized by voltage U a contradicts the recognized concept that the concentration of positive ions in the detector does not exceed the concentration n 0 + . The paper shows that the detector of the cylindrical construction, supplied with a pulse voltage can be used for coulometric measurements and the voltage polarizing the cathode can cause an effect of hypercoulometry. 33 figs., 9 refs. (author)

High frequency breakdown voltage

International Nuclear Information System (INIS)

Chu, Thanh Duy.

1992-03-01

This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

Angle selective backscattered electron contrast in the low-voltage scanning electron microscope: Simulation and experiment for polymers

Energy Technology Data Exchange (ETDEWEB)

Wan, Q., E-mail: qwan2@sheffield.ac.uk [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Masters, R.C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Lidzey, D. [Department of Physics and Astronomy, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Abrams, K.J. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Dapor, M. [European Centre for Theoretical Studies in Nuclear Physics and Related Areas (ECT-FBK) and Trento Institute for Fundamental Physics and Applications (TIFPA-INFN), via Sommarive 18, I-38123 Trento (Italy); Plenderleith, R.A. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Rimmer, S. [Department of Chemistry, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom); Claeyssens, F.; Rodenburg, C. [Department of Material Science and Engineering, University of Sheffield, Western Bank, Sheffield S10 2TN (United Kingdom)

2016-12-15

Recently developed detectors can deliver high resolution and high contrast images of nanostructured carbon based materials in low voltage scanning electron microscopes (LVSEM) with beam deceleration. Monte Carlo Simulations are also used to predict under which exact imaging conditions purely compositional contrast can be obtained and optimised. This allows the prediction of the electron signal intensity in angle selective conditions for back-scattered electron (BSE) imaging in LVSEM and compares it to experimental signals. Angle selective detection with a concentric back scattered (CBS) detector is considered in the model in the absence and presence of a deceleration field, respectively. The validity of the model prediction for both cases was tested experimentally for amorphous C and Cu and applied to complex nanostructured carbon based materials, namely a Poly(N-isopropylacrylamide)/Poly(ethylene glycol) Diacrylate (PNIPAM/PEGDA) semi-interpenetration network (IPN) and a Poly(3-hexylthiophene-2,5-diyl) (P3HT) film, to map nano-scale composition and crystallinity distribution by avoiding experimental imaging conditions that lead to a mixed topographical and compositional contrast - Highlights: • An optimised model for nano-scale analysis of beam sensitive materials by LVSEM. • Simulation and separation of composition and topography in a CBS detector. • Selective angle backscattered electron collection for mapping of polymers.

Angle selective backscattered electron contrast in the low-voltage scanning electron microscope: Simulation and experiment for polymers

International Nuclear Information System (INIS)

Wan, Q.; Masters, R.C.; Lidzey, D.; Abrams, K.J.; Dapor, M.; Plenderleith, R.A.; Rimmer, S.; Claeyssens, F.; Rodenburg, C.

2016-01-01

Recently developed detectors can deliver high resolution and high contrast images of nanostructured carbon based materials in low voltage scanning electron microscopes (LVSEM) with beam deceleration. Monte Carlo Simulations are also used to predict under which exact imaging conditions purely compositional contrast can be obtained and optimised. This allows the prediction of the electron signal intensity in angle selective conditions for back-scattered electron (BSE) imaging in LVSEM and compares it to experimental signals. Angle selective detection with a concentric back scattered (CBS) detector is considered in the model in the absence and presence of a deceleration field, respectively. The validity of the model prediction for both cases was tested experimentally for amorphous C and Cu and applied to complex nanostructured carbon based materials, namely a Poly(N-isopropylacrylamide)/Poly(ethylene glycol) Diacrylate (PNIPAM/PEGDA) semi-interpenetration network (IPN) and a Poly(3-hexylthiophene-2,5-diyl) (P3HT) film, to map nano-scale composition and crystallinity distribution by avoiding experimental imaging conditions that lead to a mixed topographical and compositional contrast - Highlights: • An optimised model for nano-scale analysis of beam sensitive materials by LVSEM. • Simulation and separation of composition and topography in a CBS detector. • Selective angle backscattered electron collection for mapping of polymers.

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1993-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse

Application of Magnetically Insulated Transmission Lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1991-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

Science.gov (United States)

Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.

Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.

Investigation of voltages and electric fields in silicon semi 3D radiation detectors using Silvaco/ATLAS simulation tool and a scanning electron microscope

CERN Document Server

Palviainen, T; Tuuva, T; Eranen, S; Härkönen, J; Luukka, P; Tuovinen, E

2006-01-01

The structure of silicon semi three-dimensional radiation detector is simulated on purpose to find out its electrical characteristics such as the depletion voltage and electric field. Two-dimensional simulation results are compared to voltage and electric field measurements done by a scanning electron microscope.

Gold removal rate by ion sputtering as a function of ion-beam voltage and raster size using Auger electron spectroscopy. Final report

International Nuclear Information System (INIS)

Boehning, C.W.

1983-01-01

Gold removal rate was measured as a function of ion beam voltage and raster size using Auger electron spectroscopy (AES). Three different gold thicknesses were developed as standards. Two sputter rate calibration curves were generated by which gold sputter rate could be determined for variations in ion beam voltage or raster size

Design and construction of constant voltage and current regulated source with proper characteristics to be used in electronics laboratory designs

International Nuclear Information System (INIS)

Peon A, R.

1978-01-01

A regulated direct current feeding source was designed for the Nuclear Energy National Institute Electronics Labortory, with the following characteristics: a) voltage input 105-130V a.c. 50-60 Hz; b) voltage output 0.40 V d.c.; c) output current 0-2 Amp d.c.; d) load regulation 0.001%; e) line regulation 0.001%; f) ripple and noise 200 μ Vpp; g) temperature interval 3-60 0 C; h) stability 0.5%; i) output impedance as voltage source 0.01 ohms; j) transient response 50 μ seg. Besides of operating normally, that is as voltage source or current-source through the front controls, the source can be used and interconnected with one or other compatible sources (autoseries, autoparallel and programmed reference). The source will cost 70,000 pesos approximately. (author)

Optimization design on breakdown voltage of AlGaN/GaN high-electron mobility transistor

Science.gov (United States)

Yang, Liu; Changchun, Chai; Chunlei, Shi; Qingyang, Fan; Yuqian, Liu

2016-12-01

Simulations are carried out to explore the possibility of achieving high breakdown voltage of GaN HEMT (high-electron mobility transistor). GaN cap layers with gradual increase in the doping concentration from 2 × 1016 to 5 × 1019 cm-3 of N-type and P-type cap are investigated, respectively. Simulation results show that HEMT with P-doped GaN cap layer shows more potential to achieve higher breakdown voltage than N-doped GaN cap layer under the same doping concentration. This is because the ionized net negative space charges in P-GaN cap layer could modulate the surface electric field which makes more contribution to RESURF effect. Furthermore, a novel GaN/AlGaN/GaN HEMT with P-doped GaN buried layer in GaN buffer between gate and drain electrode is proposed. It shows enhanced performance. The breakdown voltage of the proposed structure is 640 V which is increased by 12% in comparison to UID (un-intentionally doped) GaN/AlGaN/GaN HEMT. We calculated and analyzed the distribution of electrons' density. It is found that the depleted region is wider and electric field maximum value is induced at the left edge of buried layer. So the novel structure with P-doped GaN buried layer embedded in GaN buffer has the better improving characteristics of the power devices. Project supported by the National Basic Research Program of China (No. 2014CB339900) and the Open Fund of Key Laboratory of Complex Electromagnetic Environment Science and Technology, China Academy of Engineering Physics (No. 2015-0214.XY.K).

A summary of the low angle x-ray atomic scattering factors which have been measured by the critical voltage effect in High Energy Electron Diffraction (HEED)

International Nuclear Information System (INIS)

Fox, A.G.; Fisher, R.M.

1987-08-01

A tabulated summary of all the accurate (/approximately/0.1%) low-angle x-ray atomic scattering (form) factors which have been determined by the systematic critical voltage technique in HEED is presented. For low atomic number elements (Z/approx lt/40) the low angle form factors can be significantly different to best free atom values, and so the best band structure calculated and/or x-ray measured form factors consistent with the critical voltage measurements are also indicated. At intermediate atomic numbers Z≅40→50 only the very low-angle form factors appear to be different to the best free atom values, and even then only by a small amount. For heavy elements (Z/approx lt/70) the best free atom form factors appear to agree very closely with the critical voltage measured values and so, in this case, critical voltage measurements give very accurate measurements of Debye-Waller factors. 48 refs

Investigation of Electron Beam Induced Mass Loss of Embedding Media in the Low Voltage STEM

Czech Academy of Sciences Publication Activity Database

Novotná, V.; Hrubanová, Kamila; Nebesářová, J.; Krzyžánek, Vladislav

2014-01-01

Roč. 20, S3 (2014), s. 1270-1271 ISSN 1431-9276 R&D Projects: GA MŠk EE.2.3.20.0103; GA MŠk(CZ) LO1212; GA ČR(CZ) GA14-20012S; GA TA ČR TE01020118 Institutional support: RVO:68081731 Keywords : mass loss * mass -thickness measurement * low voltage STEM Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 1.877, year: 2014

Present status of intermediate band solar cell research

International Nuclear Information System (INIS)

Cuadra, L.; Marti, A.; Luque, A.

2004-01-01

The intermediate band solar cell is a theoretical concept with the potential for exceeding the performance of conventional single-gap solar cells. This novel photovoltaic converter bases its superior theoretical efficiency over single-gap solar cells by enhancing its photogenerated current, via the two-step absorption of sub-band gap photons, without reducing its output voltage. This is achieved through a material with an electrically isolated and partially filled intermediate band located within a higher forbidden gap. This material is commonly named intermediate band material. This paper centres on summarising the present status of intermediate band solar cell research. A number of attempts, which aim to implement the intermediate band concept, are being followed: the direct engineering of the intermediate band material, its implementation by means of quantum dots and the highly porous material approach. Among other sub-band gap absorbing proposals, there is a renewed interest on the impurity photovoltaic effect, the quantum well solar cells and the particularly promising proposal for the use of up- and down-converters

Differential cross sections for inelastic scattering of electrons on Kr and Xe atoms at intermediate energies

International Nuclear Information System (INIS)

Filipovic, D.M.

1989-01-01

Electron-impact excitation of the larger- number noble-gas atoms is a way of understanding excitation mechanisms in atomic collisional processes. Krypton and xenon have the largest atomic number of all the stable noble gases. Therefore, effects dependent on the size of a target atom, such as alignment and orientation of the atomic outer shell charge cloud after collisional excitation, are best observed by studying these atoms. Normalized, absolute differential cross sections (DCS's) for the lowest electronic states of Kr and Xe atoms, at intermediate energies, are the subject of this report

Switching between dynamic states in intermediate-length Josephson junctions

DEFF Research Database (Denmark)

Pagano, S.; Sørensen, Mads Peter; Parmentier, R. D.

1986-01-01

The appearance of zero-field steps (ZFS’s) in the current-voltage characteristics of intermediate-length overlap-geometry Josephson tunnel junctions described by a perturbed sine-Gordon equation (PSGE) is associated with the growth of parametrically excited instabilities of the McCumber backgroun...

Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

KAUST Repository

Useinov, Arthur

2011-10-22

In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.

An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers

International Nuclear Information System (INIS)

Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

2013-01-01

Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class

An accurate online calibration system based on combined clamp-shape coil for high voltage electronic current transformers.

Science.gov (United States)

Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi

2013-07-01

Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.

High-voltage engineering and testing

CERN Document Server

Ryan, Hugh M

2013-01-01

This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

Phase-wise enhanced voltage support from electric vehicles in a Danish low-voltage distribution grid

DEFF Research Database (Denmark)

Knezovic, Katarina; Marinelli, Mattia

2016-01-01

High deployment of electric vehicles (EVs) imposes great challenges for the distribution grids, especially in unbalanced systems with notable voltage variations which detrimentally affect security of supply. On the other hand, with development of Vehicle-to-Grid technology, EVs may be able...... to provide numerous services for grid support, e.g., voltage control. Implemented electronic equipment will allow them to exchange reactive power for autonomous voltage support without communicating with the distribution system operator or influencing the available active power for primary transportation...

Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

Science.gov (United States)

Petit, C.; Zander, D.

2007-10-01

It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

Quantum-well charge and voltage distribution in a metal–insulator–semiconductor structure upon resonant electron Tunneling

Energy Technology Data Exchange (ETDEWEB)

Vexler, M. I., E-mail: vexler@mail.ioffe.ru; Illarionov, Yu. Yu.; Grekhov, I. V. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation)

2017-04-15

The prerequisites for electron storage in the quantum well of a metal–oxide–p{sup +}-Si resonant-tunneling structure and the effect of the stored charge on the voltage distribution are theoretically investigated. Systems with SiO{sub 2}, HfO{sub 2}, and TiO{sub 2} insulators are studied. It is demonstrated that the occurrence of a charge in the well in the case of resonant transport can be expected in structures on substrates with an acceptor concentration from (5–6) × 10{sup 18} to (2–3) × 10{sup 19} cm{sup –3} in the range of oxide thicknesses dependent on this concentration. In particular, the oxide layer thickness in the structures with SiO{sub 2}/p{sup +}-Si(10{sup 19} cm{sup –3}) should exceed ~3 nm. The electron density in the well can reach ~10{sup 12} cm{sup –2} and higher. However, the effect of this charge on the electrostatics of the structure becomes noticeable only at relatively high voltages far above the activation of resonant transport through the first subband.

Low-voltage organic electronics based on a gate-tunable injection barrier in vertical graphene-organic semiconductor heterostructures.

Science.gov (United States)

Hlaing, Htay; Kim, Chang-Hyun; Carta, Fabio; Nam, Chang-Yong; Barton, Rob A; Petrone, Nicholas; Hone, James; Kymissis, Ioannis

2015-01-14

The vertical integration of graphene with inorganic semiconductors, oxide semiconductors, and newly emerging layered materials has recently been demonstrated as a promising route toward novel electronic and optoelectronic devices. Here, we report organic thin film transistors based on vertical heterojunctions of graphene and organic semiconductors. In these thin heterostructure devices, current modulation is accomplished by tuning of the injection barriers at the semiconductor/graphene interface with the application of a gate voltage. N-channel devices fabricated with a thin layer of C60 show a room temperature on/off ratio >10(4) and current density of up to 44 mAcm(-2). Because of the ultrashort channel intrinsic to the vertical structure, the device is fully operational at a driving voltage of 200 mV. A complementary p-channel device is also investigated, and a logic inverter based on two complementary transistors is demonstrated. The vertical integration of graphene with organic semiconductors via simple, scalable, and low-temperature fabrication processes opens up new opportunities to realize flexible, transparent organic electronic, and optoelectronic devices.

Threshold-Voltage Shifts in Organic Transistors Due to Self-Assembled Monolayers at the Dielectric: Evidence for Electronic Coupling and Dipolar Effects.

Science.gov (United States)

Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen

2015-10-21

The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.

Innovation of High Voltage Supply Adjustment Device on Diagnostic X-Ray Machine

International Nuclear Information System (INIS)

Sujatno; Wiranto Budi Santoso

2010-01-01

Innovation of high voltage supply adjustment device on diagnostic x-ray machine has been carried out. The innovation is conducted by utilizing an electronic circuit as a high voltage adjustment device. Usually a diagnostic x-ray machine utilizes a transformer or an auto-transformer as a high voltage supply adjustment device. A high power diagnostic x-ray machine needs a high power transformer which has big physical dimension. Therefore a box control where the transformer is located has to have big physical dimension. Besides, the price of the transformer is expensive and hardly found in local markets. In this innovation, the transformer is replaced by an electronic circuit. The main component of the electronic circuit is Triac BTA-40. As adjustment device, the triac is controlled by a variable resistor which is coupled by a stepper motor. A step movement of stepper motor varies a value of resistor. The resistor value determines the triac gate voltage. Furthermore the triac will open according to the value of electrical current flowing to the gate. When the gate is open, electrical voltage and current will flow from cathode to anode of the triac. The value of these electrical voltage and current depend on gate open condition. Then this triac output voltage is feed to diagnostic x-ray machine high voltage supply. Therefore the high voltage value of diagnostic x-ray machine is adjusted by the output voltage of the electronic circuit. By using this electronic circuit, the physical dimension of diagnostic x-ray machine box control and the price of the equipment can be reduced. (author)

Thyristor current-pulse generator for betatron electromagnet with independent low-voltage supply

International Nuclear Information System (INIS)

Baginskii, B.A.; Makarevich, V.N.; Shtein, M.M.

1989-01-01

A thyristor generator is described that produces unipolar current pulses in the winding of a betatron electromagnet. The voltage on the electro-magnet is increased and the shape of the current pulses is improved by use of an intermediate inductive storage device. The current pulses have a duration of 11 msec, an amplitude of 190 A, and a repetition frequency of 50 Hz. The maximum magnetic-field energy is 450 J, the voltage on the electromagnet winding is 1.5 kV, and the supply voltage is 27 V

Low-Power, Low-Voltage Analog to Digital ΣΔ

DEFF Research Database (Denmark)

Wismar, Ulrik Sørensen

2007-01-01

, and since long operation time is required, low supply voltage and low power consumption are of paramount importance. Consequently, various topologies have been compared to nd the most power ecient audio frequency modulator topology. Chapter 4 of this thesis compares power consumption of two of the most...... prevalent topologies, the single-loop modulator with integration in discrete time and the single-loop modulator with integration in continuous time. Both modulator topologies are with feedback, and all intermediate signals are in the voltage mode. Chapter 5 treats a modulator without feedback. Another...

Monitoring the metering performance of an electronic voltage transformer on-line based on cyber-physics correlation analysis

Science.gov (United States)

Zhang, Zhu; Li, Hongbin; Tang, Dengping; Hu, Chen; Jiao, Yang

2017-10-01

Metering performance is the key parameter of an electronic voltage transformer (EVT), and it requires high accuracy. The conventional off-line calibration method using a standard voltage transformer is not suitable for the key equipment in a smart substation, which needs on-line monitoring. In this article, we propose a method for monitoring the metering performance of an EVT on-line based on cyber-physics correlation analysis. By the electrical and physical properties of a substation running in three-phase symmetry, the principal component analysis method is used to separate the metering deviation caused by the primary fluctuation and the EVT anomaly. The characteristic statistics of the measured data during operation are extracted, and the metering performance of the EVT is evaluated by analyzing the change in statistics. The experimental results show that the method successfully monitors the metering deviation of a Class 0.2 EVT accurately. The method demonstrates the accurate evaluation of on-line monitoring of the metering performance on an EVT without a standard voltage transformer.

Monitoring the metering performance of an electronic voltage transformer on-line based on cyber-physics correlation analysis

International Nuclear Information System (INIS)

Zhang, Zhu; Li, Hongbin; Hu, Chen; Jiao, Yang; Tang, Dengping

2017-01-01

Metering performance is the key parameter of an electronic voltage transformer (EVT), and it requires high accuracy. The conventional off-line calibration method using a standard voltage transformer is not suitable for the key equipment in a smart substation, which needs on-line monitoring. In this article, we propose a method for monitoring the metering performance of an EVT on-line based on cyber-physics correlation analysis. By the electrical and physical properties of a substation running in three-phase symmetry, the principal component analysis method is used to separate the metering deviation caused by the primary fluctuation and the EVT anomaly. The characteristic statistics of the measured data during operation are extracted, and the metering performance of the EVT is evaluated by analyzing the change in statistics. The experimental results show that the method successfully monitors the metering deviation of a Class 0.2 EVT accurately. The method demonstrates the accurate evaluation of on-line monitoring of the metering performance on an EVT without a standard voltage transformer. (paper)

Advanced DVR with Zero-Sequence Voltage Component and Voltage Harmonic Elimination for Three-Phase Three-Wire Distribution Systems

Directory of Open Access Journals (Sweden)

Margo P

2009-11-01

Full Text Available Dynamic Voltage Restorer (DVR is a power electronics device to protect sensitive load when voltage sag occurs. Commonly, sensitive loads are electronic-based devices which generate harmonics. The magnitude and phase of compensated voltage in DVR depend on grounding system and type of fault. If the system is floating, the zero sequence components do not appear on the load side. Meanwhile, in a neutral grounded system, voltage sag is extremely affected by zero sequence components. A blocking transformer is commonly installed in series with DVR to reduce the effect of zero sequence components. This paper proposes a new DVR control scheme that is capable of eliminating the blocking transformer and reducing harmonic distortion. The system uses fuzzy polar controller to replace the conventional PI or FL controller that is commonly used. By taking into account the zero sequence components in the controller design, the effects of zero sequence components can be compensated. Simulated results show the effectiveness of the proposed DVR controller

Microdosimetry of intermediate energy neutrons in fast neutron fields

International Nuclear Information System (INIS)

Saion, E.B.; Watt, D.E.

1988-01-01

A coaxial double cylindrical proportional counter has been constructed for microdosimetry of intermediate energy neutrons in mixed fields. Details are given of the measured gas gain and resolution characteristics of the counter for a wide range of anode voltages. Event spectra due to intermediate neutrons in any desired energy band is achieved by an appropriate choice of thickness of the common dividing wall in the counter and by appropriate use of the coincidence, anticoincidence pulse counting arrangements. Calculated estimates indicate that the dose contribution by fast neutrons to the energy deposition events in the intermediate neutron range may be as large as 25%. Empirical procedures being investigated aim to determine the necessary corrections to be applied to the microdose distributions, with a precision of 10%. (author)

Demonstration of Li-based alloy coatings as low-voltage stable electron-emission surfaces for field-emission devices

International Nuclear Information System (INIS)

Auciello, O.; Krauss, A.R.; Gruen, D.M.; Shah, P.; Corrigan, T.; Kordesch, M.E.; Chang, R.P.; Barr, T.L.

1999-01-01

Alkali metals have extremely low work functions and are, therefore, expected to result in significant enhancement of the electron emission if they are used as coatings on Mo or Si microtip field-emission arrays (FEAs). However, the alkali metals are physically and chemically unstable in layers exceeding a few Angstrom in thickness. Maximum enhancement of electron emission occurs for alkali - metal layers 0.5 - 1 ML thick, but it is extremely difficult to fabricate and maintain such a thin alkali - metal coating. We present here an alternative means of producing chemically and thermally stable, self-replenishing lithium coatings approximately 1 ML thick, which results in a 13-fold reduction in the threshold voltage for electron emission compared with uncoated Si FEAs. copyright 1999 American Institute of Physics

Fiber-optic voltage measuring system

Science.gov (United States)

Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

1993-09-01

A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

Hysteresis analysis of graphene transistor under repeated test and gate voltage stress

International Nuclear Information System (INIS)

Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang

2014-01-01

The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)

On the theory of non-self-maintained low voltage arc discharge

International Nuclear Information System (INIS)

Shcherbinin, P.P.; Cherednichenko, Yu.G.

1980-01-01

In the approximation of constant temperature of plasma electrons for two emitter temperatures 1440 and 1830 K calculated are the volt-ampere characteristics and components of the voltage internal drop in a thermionic converter in the cases of self-maintained discharge in cesium and with an external source of atom ionization and electron heating. It is obtained, that using an external ionization source the decrease of voltage drop in the interelectrode gap with account of ionization energy constitutes about 0.1 V. Electron heating is not effective. For further reduction of voltage losses it is necessary to search for ways for decreasing electron Coulomb scattering on ions

Operation Manual of the high voltage generator of the Pelletron electron accelerator; Manual de operacion del generador de alto voltaje del acelerador de electrones Pelletron

Energy Technology Data Exchange (ETDEWEB)

Hernandez M, V; Lopez V, H; Alba P, U

1988-04-15

The first version of a manual to operate the generator of high voltage generator of the Pelletron electron accelerator built in the ININ is presented. Since this generator has several components and/or elements, the one manual present has the purpose that the armed one or maintenance of anyone on its parts, is carried out in an orderly and efficient way. (Author)

Lithium hydride doped intermediate connector for high-efficiency and long-term stable tandem organic light-emitting diodes.

Science.gov (United States)

Ding, Lei; Tang, Xun; Xu, Mei-Feng; Shi, Xiao-Bo; Wang, Zhao-Kui; Liao, Liang-Sheng

2014-10-22

Lithium hydride (LiH) is employed as a novel n-dopant in the intermediate connector for tandem organic light-emitting diodes (OLEDs) because of its easy coevaporation with other electron transporting materials. The tandem OLEDs with two and three electroluminescent (EL) units connected by a combination of LiH doped 8-hydroxyquinoline aluminum (Alq3) and 1,4,5,8,9,11-hexaazatriphenylene-hexacarbonitrile (HAT-CN) demonstrate approximately 2-fold and 3-fold enhancement in current efficiency, respectively. In addition, no extra voltage drop across the intermediate connector is observed. Particularly, the lifetime (T75%) in the tandem OLED with two and three EL units is substantially improved by 3.8 times and 7.4 times, respectively. The doping effect of LiH into Alq3, the charge injection, and transport characteristics of LiH-doped Alq3 are further investigated by ultraviolet photoelectron spectroscopy (UPS) and X-ray photoemission spectroscopy (XPS).

Design and Control of a Dynamic Voltage Restorer

DEFF Research Database (Denmark)

Nielsen, John Godsk

voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...

Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

Science.gov (United States)

Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

2014-11-01

The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

Calculation of the electron trajectory for 200 kV self-shielded electron accelerator

International Nuclear Information System (INIS)

Wang Shuiqing

2000-01-01

In order to calculate the electron trajectory of 200 kV self-shielded electron accelerator, the electric field is calculated with a TRAJ program. In this program, following electron track mash points one by one, the electron beam trajectories are calculated. Knowing the effect of grid voltage on electron optics and gaining grid voltage focusing effect in the various energy grades, the authors have gained scientific basis for adjusting grid voltage, and also accumulated a wealth of experience for designing self-shielded electron accelerator or electron curtain in future

Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

KAUST Repository

Useinov, Arthur; Mryasov, Oleg; Kosel, Jü rgen

2011-01-01

In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR

Performance, stability and operation voltage optimization of screen-printed aqueous supercapacitors.

Science.gov (United States)

Lehtimäki, Suvi; Railanmaa, Anna; Keskinen, Jari; Kujala, Manu; Tuukkanen, Sampo; Lupo, Donald

2017-04-06

Harvesting micropower energy from the ambient environment requires an intermediate energy storage, for which printed aqueous supercapacitors are well suited due to their low cost and environmental friendliness. In this work, a systematic study of a large set of devices is used to investigate the effect of process variability and operating voltage on the performance and stability of screen printed aqueous supercapacitors. The current collectors and active layers are printed with graphite and activated carbon inks, respectively, and aqueous NaCl used as the electrolyte. The devices are characterized through galvanostatic discharge measurements for quantitative determination of capacitance and equivalent series resistance (ESR), as well as impedance spectroscopy for a detailed study of the factors contributing to ESR. The capacitances are 200-360 mF and the ESRs 7.9-12.7 Ω, depending on the layer thicknesses. The ESR is found to be dominated by the resistance of the graphite current collectors and is compatible with applications in low-power distributed electronics. The effects of different operating voltages on the capacitance, leakage and aging rate of the supercapacitors are tested, and 1.0 V found to be the optimal choice for using the devices in energy harvesting applications.

Loop-voltage tomography in tokamaks using transient synchrotron radiation

International Nuclear Information System (INIS)

Fisch, N.J.; Kritz, A.H.; Hunter Coll., New York, NY

1989-07-01

The loop voltage in tokamaks is particularly difficult to measure anywhere but at the plasma periphery. A brief, deliberate, perturbation of hot plasma electrons, however, produces a transient radiation response that is sensitive to this voltage. We investigate how such a radiation response can be used to diagnose the loop voltage. 24 refs., 6 figs

Retention of intermediate polarization states in ferroelectric materials enabling memories for multi-bit data storage

Energy Technology Data Exchange (ETDEWEB)

Zhao, Dong; Asadi, Kamal; Blom, Paul W. M.; Leeuw, Dago M. de, E-mail: deleeuw@mpip-mainz.mpg.de [Max-Planck Institute for Polymer Research, Ackermannweg 10, 55128 Mainz (Germany); Katsouras, Ilias [Holst Centre, High Tech Campus 31, 5656AE Eindhoven (Netherlands); Groen, Wilhelm A. [Holst Centre, High Tech Campus 31, 5656AE Eindhoven (Netherlands); Faculty of Aerospace Engineering, Delft University of Technology, Kluyverweg 1 2629 HS, Delft (Netherlands)

2016-06-06

A homogeneous ferroelectric single crystal exhibits only two remanent polarization states that are stable over time, whereas intermediate, or unsaturated, polarization states are thermodynamically instable. Commonly used ferroelectric materials however, are inhomogeneous polycrystalline thin films or ceramics. To investigate the stability of intermediate polarization states, formed upon incomplete, or partial, switching, we have systematically studied their retention in capacitors comprising two classic ferroelectric materials, viz. random copolymer of vinylidene fluoride with trifluoroethylene, P(VDF-TrFE), and Pb(Zr,Ti)O{sub 3}. Each experiment started from a discharged and electrically depolarized ferroelectric capacitor. Voltage pulses were applied to set the given polarization states. The retention was measured as a function of time at various temperatures. The intermediate polarization states are stable over time, up to the Curie temperature. We argue that the remarkable stability originates from the coexistence of effectively independent domains, with different values of polarization and coercive field. A domain growth model is derived quantitatively describing deterministic switching between the intermediate polarization states. We show that by using well-defined voltage pulses, the polarization can be set to any arbitrary value, allowing arithmetic programming. The feasibility of arithmetic programming along with the inherent stability of intermediate polarization states makes ferroelectric materials ideal candidates for multibit data storage.

Retention of intermediate polarization states in ferroelectric materials enabling memories for multi-bit data storage

Science.gov (United States)

Zhao, Dong; Katsouras, Ilias; Asadi, Kamal; Groen, Wilhelm A.; Blom, Paul W. M.; de Leeuw, Dago M.

2016-06-01

A homogeneous ferroelectric single crystal exhibits only two remanent polarization states that are stable over time, whereas intermediate, or unsaturated, polarization states are thermodynamically instable. Commonly used ferroelectric materials however, are inhomogeneous polycrystalline thin films or ceramics. To investigate the stability of intermediate polarization states, formed upon incomplete, or partial, switching, we have systematically studied their retention in capacitors comprising two classic ferroelectric materials, viz. random copolymer of vinylidene fluoride with trifluoroethylene, P(VDF-TrFE), and Pb(Zr,Ti)O3. Each experiment started from a discharged and electrically depolarized ferroelectric capacitor. Voltage pulses were applied to set the given polarization states. The retention was measured as a function of time at various temperatures. The intermediate polarization states are stable over time, up to the Curie temperature. We argue that the remarkable stability originates from the coexistence of effectively independent domains, with different values of polarization and coercive field. A domain growth model is derived quantitatively describing deterministic switching between the intermediate polarization states. We show that by using well-defined voltage pulses, the polarization can be set to any arbitrary value, allowing arithmetic programming. The feasibility of arithmetic programming along with the inherent stability of intermediate polarization states makes ferroelectric materials ideal candidates for multibit data storage.

Constant potential high-voltage generator

International Nuclear Information System (INIS)

Resnick, T.A.; Dupuis, W.A.; Palermo, T.

1980-01-01

An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)

Differences between signal currents for both polarities of applied voltages on cavity ionization chambers

International Nuclear Information System (INIS)

Takata, N.

2000-01-01

It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the

Electron capture in low- and intermediate-energy collisions between completely stripped light ions and metastable H(2s) targets

International Nuclear Information System (INIS)

Blanco, S.A.; Falcon, C.A.; Reinhold, C.O.; Casaubon, J.I.; Piacentini, R.D.

1987-01-01

Total cross sections for electron capture from H(2s) targets by He 2+ ions have been computed in the impact velocity range 0.05-0.5 au. Calculations were performed using a molecular close-coupling approach with inclusion of electron translation factors. A ten-state molecular basis set was considered. A comparison is made with Landau-Zener results for the same system. Intermediate projectile energy classical Monte Carlo capture cross sections are also presented for H + , He 2+ , Li 3+ and C 6+ projectiles. (author)

Antibonding intermediate state in the theory of vibrational excitation of diatomic molecules by slow electrons

International Nuclear Information System (INIS)

Kazanskii, A.K.

1982-01-01

An exactly solvable model is constructed for the description of the processes that take place when a slow electron collides with a diatomic molecule (vibrational excitation, associative detachment, and dissociative attachment). As a particular model of the variant, the case of an antibonding (virtual) state of an intermediate state is considered, and a term of this state is parametrized in a very simple manner. The vibrational excitation and dissociative attachment are calculated for a system corresponding to the HCl molecule. The results are in good qualitative agreement with experiment

High-voltage CMOS detectors

International Nuclear Information System (INIS)

Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

2016-01-01

High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

High-voltage CMOS detectors

Energy Technology Data Exchange (ETDEWEB)

Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

2016-07-11

High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

Macroeconomic Assessment of Voltage Sags

Directory of Open Access Journals (Sweden)

Sinan Küfeoğlu

2016-12-01

Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

A matter of quantum voltages

Energy Technology Data Exchange (ETDEWEB)

Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

2014-11-14

Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

High-voltage electron-microscopical observation of crack-tip dislocations in silicon crystals

International Nuclear Information System (INIS)

Tanaka, Masaki; Higashida, Kenji

2005-01-01

Crack-tip dislocations in silicon single crystals were observed by high-voltage electron microscopy. Cracks were introduced into silicon wafers at room temperature by a Vickers indenter. The indented specimens were annealed at 823 K in order to activate dislocation emission from the crack tip under the residual stress due to the indentation. In the specimen without annealing, no dislocations were observed around the crack. On the other hand, in the specimen after the annealing, the aspect of the early stage of dislocation emission was observed, where dislocations were emitted not as a perfect dislocation but as a partial dislocation in the hinge-type plastic zone. Prominent dislocation arrays that were emitted from a crack tip were also observed, and they were found to be of shielding type, which increases the fracture toughness of those crystals

The fabrication of 3-D nanostructures by a low- voltage EBL

Energy Technology Data Exchange (ETDEWEB)

Oh, Seung Hun [Department of Nano Science and Technology, Pusan National University (Korea, Republic of); Kim, Jae Gu [Department of Nano-Mechanical Systems, Korea Institute of Machinery and Materials (Korea, Republic of); Kim, Chang Seok [Department of Cogno-Mechatronics Engineering, Pusan National University (Korea, Republic of); Choi, Doo Sun; Chang, Sunghwan [Department of Nano-Mechanical Systems, Korea Institute of Machinery and Materials (Korea, Republic of); Jeong, Myung Yung, E-mail: myjeong@pusan.ac.kr [Department of Cogno-Mechatronics Engineering, Pusan National University (Korea, Republic of)

2011-02-15

Three-dimensional (3-D) structures are used in many applications, including the fabrication of opto-electronic and bio-MEMS devices. Among the various fabrication techniques available for 3-D structures, nano imprint lithography (NIL) is preferred for producing nanoscale 3-D patterns because of its simplicity, relatively short processing time, and high manufacturing precision. For efficient replication in NIL, a precise 3-D stamp must be used as an imprinting tool. Hence, we attempted the fabrication of original 3-D master molds by low-voltage electron beam lithography (EBL). We then fabricated polydimethylsiloxane (PDMS) stamps from the original 3-D mold via replica molding with ultrasonic vibration.First, we experimentally analyzed the characteristics of low-voltage EBL in terms of various parameters such as resist thickness, acceleration voltage, aperture size, and baking temperature. From these e-beam exposure experiments, we found that the exposure depth and width were almost saturated at 3 kV or lesser, even when the electron dosage was increased. This allowed for the fabrication of various stepped 3-D nanostructures at a low voltage. In addition, by using line-dose EBL, V-groove patterns could be fabricated on a cured electron resist (ER) at a low voltage and low baking temperature. Finally, the depth variation could be controlled to within 10 nm through superposition exposure at 1 kV. From these results, we determined the optimum electron beam exposure conditions for the fabrication of various 3-D structures on ERs by low-voltage EBL. We then fabricated PDMS stamps via the replica molding process.

Effect of the change in the load resistance on the high voltage pulse transformer of the intense electron-beam accelerators.

Science.gov (United States)

Cheng, Xin-bing; Liu, Jin-liang; Qian, Bao-liang; Zhang, Yu; Zhang, Hong-bo

2009-11-01

A high voltage pulse transformer (HVPT) is usually used as a charging device for the pulse forming line (PFL) of intense electron-beam accelerators (IEBAs). Insulation of the HVPT is one of the important factors that restrict the development of the HVPT. Until now, considerable effort has been focused on minimizing high field regions to avoid insulation breakdown between windings. Characteristics of the HVPT have been widely discussed to achieve these goals, but the effects of the PFL and load resistance on HVPT are usually neglected. In this paper, a HVPT is used as a charging device for the PFL of an IEBA and the effect of the change in the load resistance on the HVPT of the IEBA is presented. When the load resistance does not match the wave impedance of the PFL, a high-frequency bipolar oscillating voltage will occur, and the amplitude of the oscillating voltage will increase with the decrease in the load resistance. The load resistance approximates to zero and the amplitude of the oscillating voltage is much higher. This makes it easier for surface flashover along the insulation materials to form and decrease the lifetime of the HVPT.

Operation voltage behavior of organic light emitting diodes with polymeric buffer layers doped by weak electron acceptor

Energy Technology Data Exchange (ETDEWEB)

Jeon, Hyeon Soo; Cho, Sang Hee [Department of Information Display and Advanced Display Research Center, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Seo, Jaewon; Park, Yongsup [Department of Physics, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Suh, Min Chul, E-mail: mcsuh@khu.ac.kr [Department of Information Display and Advanced Display Research Center, Kyung Hee University, Seoul 130-701 (Korea, Republic of)

2013-11-01

We present polymeric buffer materials based on poly[2,7-(9,9-dioctyl-fluorene)-co-(1,4-phenylene -((4-sec-butylphenyl)imino)-1,4-phenylene)] (TFB) for highly efficient solution processed organic light emitting diodes (OLEDs). Doped TFB with 9,10-dicyanoanthracene, a weak electron acceptor results in significant improvement of current flow and driving voltage. Maximum current- and power-efficiency value of 12.6 cd/A and 18.1 lm/W are demonstrated from phosphorescent red OLEDs with this doped polymeric anode buffer system. - Highlights: • Polymeric buffer materials for organic light emitting diodes (OLEDs). • Method to control hole conductivity of polymeric buffer layer in OLED device. • Enhanced current density of buffer layers upon 9,10-dicyanoanthracene (DCA) doping. • Comparison of OLED devices having polymeric buffer layer with or without DCA. • Effect on operating voltage by doping DCA in the buffer layer.

Silicone elastomers with covalently incorporated aromatic voltage stabilisers

DEFF Research Database (Denmark)

A Razak, Aliff Hisyam; Skov, Anne Ladegaard

2017-01-01

to the incorporationof an aromatic voltage stabiliser, were prepared by cross-linking synthesised polydimethylsiloxane–polyphenylmethylsiloxane (PDMS–PPMS) copolymers. PPMS possesses voltage stabilisation capabilitiesbut is immiscible in PDMS, and thus the copolymerisation of the two components was necessary...... forhomogeneity. Concentrations of the voltage stabiliser were varied by changing the molecular weights ofthe PPMS in the copolymer. The developed elastomers were inherently soft with enhanced electricalbreakdown strengths, due to delocalisedp-electrons of the aromatic constituent. An optimumconcentration...

Intermediate Temperature Fuel Cell Using Gypsum Based Electrolyte And Electrodes

International Nuclear Information System (INIS)

Suzuki, Satoshi; Nagai, Masayuki; Katagiri, Yuji

2011-01-01

The proton conductive electrolyte membrane and the electrodes for intermediate temperature fuel cell were made from the phosphoric acid treated gypsum as a proton conductor. The membrane and the electrodes were built into single cell and tested at intermediate temperature region. The power density of the fuel cell was 0.56 mW/cm -2 at 150 deg. C without any humidification and 1.38 mW/cm -2 at 150 deg. C, 5% relative humidity. The open circuit voltage of the cell was increased higher than 0.7 V when the electrodes were annealed at 150 deg. C, 5%R.H., however the reasons for this are still to be further investigated. The results show that the potential of the phosphoric acid treated gypsum for the intermediate temperature proton conductor.

Precision High-Voltage DC Dividers and Their Calibration

Czech Academy of Sciences Publication Activity Database

Dragounová, Naděžda

2005-01-01

Roč. 54, č. 5 (2005), s. 1911-1915 ISSN 0018-9456 R&D Projects: GA AV ČR KSK1048102; GA ČR GA202/03/0889 Keywords : calibration * dc voltage * high voltage (HV) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.665, year: 2005

Modular High Voltage Power Supply

Energy Technology Data Exchange (ETDEWEB)

Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-05-18

The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

Harmonic current interaction at a low voltage customer's installations

NARCIS (Netherlands)

Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.

2009-01-01

The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low

High-voltage picoamperemeter

Energy Technology Data Exchange (ETDEWEB)

Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

2014-07-01

Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

An accurate on-site calibration system for electronic voltage transformers using a standard capacitor

Science.gov (United States)

Hu, Chen; Chen, Mian-zhou; Li, Hong-bin; Zhang, Zhu; Jiao, Yang; Shao, Haiming

2018-05-01

Ordinarily electronic voltage transformers (EVTs) are calibrated off-line and the calibration procedure requires complex switching operations, which will influence the reliability of the power grid and induce large economic losses. To overcome this problem, this paper investigates a 110 kV on-site calibration system for EVTs, including a standard channel, a calibrated channel and a PC equipped with the LabView environment. The standard channel employs a standard capacitor and an analogue integrating circuit to reconstruct the primary voltage signal. Moreover, an adaptive full-phase discrete Fourier transform (DFT) algorithm is proposed to extract electrical parameters. The algorithm involves the process of extracting the frequency of the grid, adjusting the operation points, and calculating the results using DFT. In addition, an insulated automatic lifting device is designed to realize the live connection of the standard capacitor, which is driven by a wireless remote controller. A performance test of the capacitor verifies the accurateness of the standard capacitor. A system calibration test shows that the system ratio error is less than 0.04% and the phase error is below 2‧, which meets the requirement of the 0.2 accuracy class. Finally, the developed calibration system was used in a substation, and the field test data validates the availability of the system.

Recycling potential for low voltage and high voltage high rupturing capacity fuse links.

Science.gov (United States)

Psomopoulos, Constantinos S; Barkas, Dimitrios A; Kaminaris, Stavros D; Ioannidis, George C; Karagiannopoulos, Panagiotis

2017-12-01

Low voltage and high voltage high-rupturing-capacity fuse links are used in LV and HV installations respectively, protecting mainly the LV and HV electricity distribution and transportation networks. The Waste Electrical and Electronic Equipment Directive (2002/96/EC) for "Waste of electrical and electronic equipment" is the main related legislation and as it concerns electrical and electronic equipment, it includes electric fuses. Although, the fuse links consist of recyclable materials, only small scale actions have been implemented for their recycling around Europe. This work presents the possibilities for material recovery from this specialized industrial waste for which there are only limited volume data. Furthermore, in order to present the huge possibilities and environmental benefits, it presents the potential for recycling of HRC fuses used by the Public Power Corporation of Greece, which is the major consumer for the country, but one of the smallest ones in Europe and globally, emphasizing in this way in the issue. According to the obtained results, fuse recycling could contribute to the effort for minimize the impacts on the environment through materials recovery and reduction of the wastes' volume disposed of in landfills. Copyright © 2017 Elsevier Ltd. All rights reserved.

Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

Directory of Open Access Journals (Sweden)

N Hatefi Kargan

2013-09-01

Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

Generation of low KV x-ray portal images with mega-voltage electron beams

International Nuclear Information System (INIS)

Kenny, J.; Ebert, M.

2004-01-01

Full text: The increasing complexity of radiation therapy plans and reduced target margins, have made accurate localization of patients at treatment a crucial quality assurance issue. Mega-voltage portal images, the standard for treatment localization, are inherently low in contrast because x-ray attenuation at these energies is similar for most body tissues. Thus anatomical features are difficult to distinguish and match to features on a reference diagnostic image. This project investigates the possibly of using x-rays created by an external target placed in the path of a clinical mega-voltage electron beam. This target is optimised to produce a higher proportion of useful imaging x-rays in the range of 50-200kV. It is thought that a high efficiency Varian aSi500 amorphous silicon EPID will be sufficient to compensate for the very low efficiency of x-ray production. The project was undertaken with concurrent theoretical and experimental components. The former involved Monte Carlo models of low Z target design while in the later, experimental data was gathered to validate the model and explore the practical issues associated with electron mode image acquisition. A 6 MeV electron beam model for a Varian Clinac 21EX was developed with EGS4/BEAMnrc User Code and compared to measured beam data. Phase space data scored at the secondary collimator then became the input for simulations of a target placed in the accessory tray. Target materials were predominately low atomic number (Z) because a) production of high energy x-rays is minimized and, b) fewer low energy x-rays produced will be absorbed within the target. Photon and electron energy spectrums of the modified beam were evaluated for a range of target geometries. Ultimately, several materials were used in combination to optimise an x-ray yield for energies <200kV while removing electrons and very low energy x-rays, that contribute to patient dose but not to image formation. Low energy images of a PIPs EPID QA

All-Pass Filter Based Linear Voltage Controlled Quadrature Oscillator

Directory of Open Access Journals (Sweden)

Koushick Mathur

2017-01-01

Full Text Available A linear voltage controlled quadrature oscillator implemented from a first-order electronically tunable all-pass filter (ETAF is presented. The active element is commercially available current feedback amplifier (AD844 in conjunction with the relatively new Multiplication Mode Current Conveyor (MMCC device. Electronic tunability is obtained by the control node voltage (V of the MMCC. Effects of the device nonidealities, namely, the parasitic capacitors and the roll-off poles of the port-transfer ratios of the device, are shown to be negligible, even though the usable high-frequency ranges are constrained by these imperfections. Subsequently the filter is looped with an electronically tunable integrator (ETI to implement the quadrature oscillator (QO. Experimental responses on the voltage tunable phase of the filter and the linear-tuning law of the quadrature oscillator up to 9.9 MHz at low THD are verified by simulation and hardware tests.

High-Voltage Clock Driver for Photon-Counting CCD Characterization

Science.gov (United States)

Baker, Robert

2013-01-01

A document discusses the CCD97 from e2v technologies as it is being evaluated at Goddard Space Flight Center's Detector Characterization Laboratory (DCL) for possible use in ultra-low background noise space astronomy applications, such as Terrestrial Planet Finder Coronagraph (TPF-C). The CCD97 includes a photoncounting mode where the equivalent output noise is less than one electron. Use of this mode requires a clock signal at a voltage level greater than the level achievable by the existing CCD (charge-coupled-device) electronics. A high-voltage waveform generator has been developed in code 660/601 to support the CCD97 evaluation. The unit generates required clock waveforms at voltage levels from -20 to +50 V. It deals with standard and arbitrary waveforms and supports pixel rates from 50 to 500 kHz. The system is designed to interface with existing Leach CCD electronics.

Experiments in high voltage electron microscopy. Progress report, October 31, 1975--August 1976

International Nuclear Information System (INIS)

Mitchell, T.E.; Das, G.; Barnard, R.; Ro, D.

1976-08-01

High voltage electron microscopy (HVEM) is being used to study the effects of irradiation on a variety of materials. The vacancies and interstitials produced by displacement can agglomerate to form dislocation loops and voids, annihilate at sinks, or enhance various diffusion processes such as precipitation and recrystallization. Threshold displacement energies, E/sub d/, have been determined for a number of fcc, bcc, and hcp metals. Directions for minimum E/sub d/ have been correlated with the crystal structure and the magnitude of E/sub d/ has been related to the sublimation energy. The effects of electron irradiation on precipitation in Al--Cu, Al--Si and Ni--Al alloys have been investigated. Precipitation respectively of theta', Si and γ' is enhanced and growth rates are being related quantitatively to theories of radiation-enhanced diffusion. Results on radiation damage in oxides (quartz, alumina, and magnesia) have also been obtained. Displacement damage gives rise to dislocation loop nucleation and growth in all cases, including multi-layer loops in Al 2 O 3 . In SiO 2 , ionization damage also occurs, which destroys the crystallinity. Threshold displacement and temperature effects have also been investigated

High-voltage electron-microscope investigation of point-defect agglomerates in irradiated copper during in-situ annealing

International Nuclear Information System (INIS)

Jaeger, W.; Urban, K.; Frank, W.

1980-01-01

Thin copper foils were irradiated with 650 keV electrons at 10 K in a high-voltage electron microscope (HVEM) to doses phi in the range 2 x 10 23 electrons/m 2 approximately 25 electrons /m 2 and then annealed in situ up to room temperature and outside the HVEM between room temperature and 470 K. During irradiation visible defect clusters were formed only at phi >= 2.5 x 10 24 electrons/m 2 . At smaller doses defect clusters became visible after annealing at 50 K. Between 50 K and 120 K further clusters, mainly dislocation loops on brace111 planes, appeared. Above 120 K, particularly between 160 K and 300 K, some of the dislocation loops became glissile. They glided out of the specimens or agglomerated to larger clusters of frequently complex shapes. As a consequence between 160 K and 300 K the cluster density decreased strongly, whereas the mean cluster size increased monotonously through the entire range of annealing temperatures covered. Contrast analyses between 180 K and 400 K revealed that the great majority of the dislocation loops were of interstitial type. At 470 K a new type of small clusters emerged, presumably of vacancy type. These observations are compared with other studies on electron-irradiated copper and with the current models of radiation damage in metals. (author)

Single electron capture differential cross section in H+ + He collisions at intermediate and high collision energies

International Nuclear Information System (INIS)

Abufager, P N; Fainstein, P D; MartInez, A E; Rivarola, R D

2005-01-01

The generalized continuum distorted wave-eikonal initial state (CDW-EIS II) approximation is employed to study differential cross sections (DCS) for single electron capture in H + + He collisions at intermediate and high energies. Present results are compared with theoretical calculations obtained using the previous CDW-EIS formulation in order to show the importance of the description of the bound and continuum target states in the entrance and exit channels, respectively. Both DCS are also shown together with other theoretical results and with experimental data

The voltage optimization of a four-element lens used on a hemispherical spectrograph with virtual entry for highest energy resolution

International Nuclear Information System (INIS)

Sise, O.; Martínez, G.; Madesis, I.; Laoutaris, A.; Dimitriou, A.; Fernández-Martín, M.; Zouros, T.J.M.

2016-01-01

Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics

The voltage optimization of a four-element lens used on a hemispherical spectrograph with virtual entry for highest energy resolution

Energy Technology Data Exchange (ETDEWEB)

Sise, O., E-mail: omersise@sdu.edu.tr [Department of Science Education, Faculty of Education, Suleyman Demirel University, 32260 Isparta (Turkey); Martínez, G. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Madesis, I. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Laoutaris, A. [Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Department of Applied Physics, National Technical University of Athens, GR, 15780 Athens (Greece); Dimitriou, A. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece); Fernández-Martín, M. [Departamento de Física Aplicada III, Facultad de Física, UCM, 28040 Madrid (Spain); Zouros, T.J.M. [Department of Physics, University of Crete, P.O. Box 2208, GR, 71003 Heraklion (Greece); Tandem Accelerator Laboratory, INPP, NCSR Demokritos, GR, 15310 Ag Paraskevi (Greece)

2016-08-15

Highlights: • We investigate the voltage settings for the four-element injection lens of an HDA. • The two well-known approaches, BEM and FDM, in charged particle optics were used. • We tested optimal lens voltages from simulation on the actual experimental setup. • The measured FWHM were well modeled using realistic source parameters. • The results are helpful to experimenters. - Abstract: The methodology and results of a detailed four-element lens optimization analysis based on electron trajectory numerical simulations are presented for a hemispherical deflector analyzer (HDA), whose entry aperture size is determined by the injection lens itself and is therefore virtual. Trajectory calculations were performed using both the boundary-element method (BEM) and the finite-difference method (FDM) and results from these two different approaches were benchmarked against each other, to probe and confirm the accuracy of our results. Since the first and last electrode are held at fixed potentials, the two intermediate adjustable lens electrode voltages were varied over the entire available voltage space in a direct, systematic, brute-force approach, while minima in beam spot size on the 2-D position sensitive detector (PSD) at the exit of the HDA were investigated using a beam shaping approach. Lens voltages demonstrating improved energy resolution for the combined lens/HDA/PSD spectrograph system were sought with and without pre-retardation. The optimal voltages were then tested experimentally on the modeled HDA system using a hot-wire electron gun. The measured energy resolution was found to be in good overall agreement with our simulations, particularly at the highest resolution (∼0.05%) working conditions. These simulations also provide a detailed insight to the distinctive trajectory optics and positions of the first and second image planes, when the PSD has to be placed some distance away from the HDA exit plane, and is therefore not at the ideal optics

A compact control system to achieve stable voltage and low jitter trigger for repetitive intense electron-beam accelerator based on resonant charging

Science.gov (United States)

Qiu, Yongfeng; Liu, Jinliang; Yang, Jianhua; Cheng, Xinbing; Yang, Xiao

2017-08-01

A compact control system based on Delphi and Field Programmable Gate Array(FPGA) is developed for a repetitive intense electron-beam accelerator(IEBA), whose output power is 10GW and pulse duration is 160ns. The system uses both hardware and software solutions. It comprises a host computer, a communication module and a main control unit. A device independent applications programming interface, devised using Delphi, is installed on the host computer. Stability theory of voltage in repetitive mode is analyzed and a detailed overview of the hardware and software configuration is presented. High voltage experiment showed that the control system fulfilled the requests of remote operation and data-acquisition. The control system based on a time-sequence control method is used to keep constant of the voltage of the primary capacitor in every shot, which ensured the stable and reliable operation of the electron beam accelerator in the repetitive mode during the experiment. Compared with the former control system based on Labview and PIC micro-controller developed in our laboratory, the present one is more compact, and with higher precision in the time dimension. It is particularly useful for automatic control of IEBA in the high power microwave effects research experiments where pulse-to-pulse reproducibility is required.

Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

KAUST Repository

Kim, Younggy

2011-01-01

Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

Effect of Advanced Plasma Source bias voltage on properties of HfO2 films prepared by plasma ion assisted electron evaporation from metal hafnium

International Nuclear Information System (INIS)

Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda

2013-01-01

HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V

Temperature Induced Voltage Offset Drifts in Silicon Carbide Pressure Sensors

Science.gov (United States)

Okojie, Robert S.; Lukco, Dorothy; Nguyen, Vu; Savrun, Ender

2012-01-01

We report the reduction of transient drifts in the zero pressure offset voltage in silicon carbide (SiC) pressure sensors when operating at 600 C. The previously observed maximum drift of +/- 10 mV of the reference offset voltage at 600 C was reduced to within +/- 5 mV. The offset voltage drifts and bridge resistance changes over time at test temperature are explained in terms of the microstructure and phase changes occurring within the contact metallization, as analyzed by Auger electron spectroscopy and field emission scanning electron microscopy. The results have helped to identify the upper temperature reliable operational limit of this particular metallization scheme to be 605 C.

Current voltage perspective of an organic electronic device

Science.gov (United States)

Mukherjee, Ayash K.; Kumari, Nikita

2018-05-01

Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.

Localized conductive patterning via focused electron beam reduction of graphene oxide

Energy Technology Data Exchange (ETDEWEB)

Kim, Songkil; Henry, Mathias [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); Kulkarni, Dhaval D.; Zackowski, Paul; Jang, Seung Soon; Tsukruk, Vladimir V. [School of Materials Science and Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); Fedorov, Andrei G., E-mail: agf@gatech.edu [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); Parker H. Petit Institute for Bioengineering and Bioscience, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States)

2015-03-30

We report on a method for “direct-write” conductive patterning via reduction of graphene oxide (GO) sheets using focused electron beam induced deposition (FEBID) of carbon. FEBID treatment of the intrinsically dielectric graphene oxide between two metal terminals opens up the conduction channel, thus enabling a unique capability for nanoscale conductive domain patterning in GO. An increase in FEBID electron dose results in a significant increase of the domain electrical conductivity with improving linearity of drain-source current vs. voltage dependence, indicative of a change of graphene oxide electronic properties from insulating to semiconducting. Density functional theory calculations suggest a possible mechanism underlying this experimentally observed phenomenon, as localized reduction of graphene oxide layers via interactions with highly reactive intermediates of electron-beam-assisted dissociation of surface-adsorbed hydrocarbon molecules. These findings establish an unusual route for using FEBID as nanoscale lithography and patterning technique for engineering carbon-based nanomaterials and devices with locally tailored electronic properties.

Voltage regulation and power losses reduction in a wind farm integrated MV distribution network

Science.gov (United States)

Fandi, Ghaeth; Igbinovia, Famous Omar; Tlusty, Josef; Mahmoud, Rateb

2018-01-01

A medium-voltage (MV) wind production system is proposed in this paper. The system applies a medium-voltage permanent magnet synchronous generator (PMSG) as well as MV interconnection and distribution networks. The simulation scheme of an existing commercial electric-power system (Case A) and a proposed wind farm with a gearless PMSG insulated gate bipolar transistor (IGBT) power electronics converter scheme (Case B) is compared. The analyses carried out in MATLAB/Simulink environment shows an enhanced voltage profile and reduced power losses, thus, efficiency in installed IGBT power electronics devices in the wind farm. The resulting wind energy transformation scheme is a simple and controllable medium voltage application since it is not restrained by the IGBT power electronics voltage source converter (VSC) arrangement. Active and reactive power control is made possible with the aid of the gearless PMSG IGBT power converters.

Control voltage and power fluctuations when connecting wind farms

Science.gov (United States)

Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

2015-12-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

Control voltage and power fluctuations when connecting wind farms

International Nuclear Information System (INIS)

Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana

2015-01-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve

Control voltage and power fluctuations when connecting wind farms

Energy Technology Data Exchange (ETDEWEB)

Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

2015-12-23

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

A high-voltage triggered pseudospark discharge experiment

International Nuclear Information System (INIS)

Ramaswamy, K.; Destler, W.W.; Rodgers, J.

1996-01-01

The design and execution of a pulsed high-voltage (350 endash 400 keV) triggered pseudospark discharge experiment is reported. Experimental studies were carried out to obtain an optimal design for stable and reliable pseudospark operation in a high-voltage regime (approx-gt 350 kV). Experiments were performed to determine the most suitable fill gas for electron-beam formation. The pseudospark discharge is initiated by a trigger mechanism involving a flashover between the trigger electrode and hollow cathode housing. Experimental results characterizing the electron-beam energy using the range-energy method are reported. Source size imaging was carried out using an x-ray pinhole camera and a novel technique using Mylar as a witness plate. It was experimentally determined that strong pinching occurred later in time and was associated with the lower-energy electrons. copyright 1996 American Institute of Physics

Power electronic solutions for interfacing offshore wind turbine generators to medium voltage DC collection grids

Science.gov (United States)

Daniel, Michael T.

Here in the early 21st century humanity is continuing to seek improved quality of life for citizens throughout the world. This global advancement is providing more people than ever with access to state-of-the-art services in areas such as transportation, entertainment, computing, communication, and so on. Providing these services to an ever-growing population while considering the constraints levied by continuing climate change will require new frontiers of clean energy to be developed. At the time of this writing, offshore wind has been proven as both a politically and economically agreeable source of clean, sustainable energy by northern European nations with many wind farms deployed in the North, Baltic, and Irish Seas. Modern offshore wind farms are equipped with an electrical system within the farm itself to aggregate the energy from all turbines in the farm before it is transmitted to shore. This collection grid is traditionally a 3-phase medium voltage alternating current (MVAC) system. Due to reactive power and other practical constraints, it is preferable to use a medium voltage direct current (MVDC) collection grid when siting farms >150 km from shore. To date, no offshore wind farm features an MVDC collection grid. However, MVDC collection grids are expected to be deployed with future offshore wind farms as they are sited further out to sea. In this work it is assumed that many future offshore wind farms may utilize an MVDC collection grid to aggregate electrical energy generated by individual wind turbines. As such, this work presents both per-phase and per-pole power electronic converter systems suitable for interfacing individual wind turbines to such an MVDC collection grid. Both interfaces are shown to provide high input power factor at the wind turbine while providing DC output current to the MVDC grid. Common mode voltage stress and circulating currents are investigated, and mitigation strategies are provided for both interfaces. A power sharing

New method for determining avalanche breakdown voltage of silicon photomultipliers

International Nuclear Information System (INIS)

Chirikov-Zorin, I.

2017-01-01

The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

Absolute Determination of High DC Voltages by Means of Frequency Measurement

Science.gov (United States)

Peier, Dirk; Schulz, Bernd

1983-01-01

A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

Voltage generators of high voltage high power accelerators

International Nuclear Information System (INIS)

Svinin, M.P.

1981-01-01

High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

International Nuclear Information System (INIS)

Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

1988-01-01

A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

A new linear induction voltage adder approach to radiography

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.

1992-01-01

At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap

E-beam high voltage switching power supply

Science.gov (United States)

Shimer, Daniel W.; Lange, Arnold C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

E-beam high voltage switching power supply

International Nuclear Information System (INIS)

Shimer, D.W.; Lange, A.C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

Science.gov (United States)

Cai, Yuanji; Guan, Yonggang; Liu, Weidong

2017-06-01

Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

Alternating voltage-induced electrochemical synthesis of colloidal Au nanoicosahedra

Energy Technology Data Exchange (ETDEWEB)

McCann, Kevin; Cloud, Jacqueline E.; Yang, Yongan, E-mail: yonyang@mines.edu [Colorado School of Mines, Department of Chemistry and Geochemistry (United States)

2013-11-15

A simple method of alternating voltage-induced electrochemical synthesis has been developed to synthesize highly dispersed colloidal Au nanoicosahedra of 14 ± 3 nm in size. This simple and effective method uses a common transformer to apply a zero-offset alternating voltage to a pair of identical Au electrodes that are immersed in an electrolyte solution containing ligands. The obtained Au nanoicosahedra in this work are among the smallest Au icosahedra synthesized in aqueous solutions. A series of experimental conditions have been studied, such as voltage, the electrolyte identity and concentration, stabilizer identity and concentration, and reaction temperature. The mechanistic study indicates that Au nanoicosahedra are produced on electrode surfaces through an intermediate state of AuO{sub x}. The kinetic rate constant of these Au icosahedra in catalyzing the reduction of 4-nitrophenol with sodium borohydride is found much larger than the literature values of similar Au nanocrystals. In addition, the synthesis of Au–Pd-alloyed NCs has also been attempted.Graphical Abstract.

Determination of the internal parameters of tc from the current-voltage characteristics

International Nuclear Information System (INIS)

Kaibyshev, V.Z.

1986-01-01

This paper proposes a method for determining the effective work function of a collector, the electron temperature, and the voltage drop in the interelectrode gap from the experimental vurrent-voltage characteristics (IVC). Analysis of the boundary conditions at the collector shows that as the emission from the collector increases the height of the potential jump retarding plasma electrons decrease

Distorted wave models applied to electron emission study in ion-atom collisions at intermediate and high energies

International Nuclear Information System (INIS)

Fainstein, P.D.

1989-01-01

The electron emission from different atoms induced by impact of multicharged bare ions at intermediate and high energies is studied. To perform these studies, the continuum distorted wave-eikonal initial state model is used. With this distorted wave model, analytical expressions are obtained for the transition amplitudes as a function of the transverse momentum transfer for hydrogen targets in an arbitrary initial state and for every any orbital of a multielectronic target represented as a linear combination of Slater type orbitals. With these expressions, the different cross sections which are compared with the experimental data available are numerically calculated. The results obtained for different targets and projectiles and the comparison with other theoretical models and experimental data allows to explain the electron emission spectra and to predict new effects which have not been measured so far. The results of the present work permit to view the ionization process as the evolution of the active electron in the combined field of the target and projectile nuclei. (Author) [es

An analytic current-voltage model for quasi-ballistic III-nitride high electron mobility transistors

Science.gov (United States)

Li, Kexin; Rakheja, Shaloo

2018-05-01

We present an analytic model to describe the DC current-voltage (I-V) relationship in scaled III-nitride high electron mobility transistors (HEMTs) in which transport within the channel is quasi-ballistic in nature. Following Landauer's transport theory and charge calculation based on two-dimensional electrostatics that incorporates negative momenta states from the drain terminal, an analytic expression for current as a function of terminal voltages is developed. The model interprets the non-linearity of access regions in non-self-aligned HEMTs. Effects of Joule heating with temperature-dependent thermal conductivity are incorporated in the model in a self-consistent manner. With a total of 26 input parameters, the analytic model offers reduced empiricism compared to existing GaN HEMT models. To verify the model, experimental I-V data of InAlN/GaN with InGaN back-barrier HEMTs with channel lengths of 42 and 105 nm are considered. Additionally, the model is validated against numerical I-V data obtained from DC hydrodynamic simulations of an unintentionally doped AlGaN-on-GaN HEMT with 50-nm gate length. The model is also verified against pulsed I-V measurements of a 150-nm T-gate GaN HEMT. Excellent agreement between the model and experimental and numerical results for output current, transconductance, and output conductance is demonstrated over a broad range of bias and temperature conditions.

Compositional redistribution in alloy films under high-voltage electron microscope irradiation

Science.gov (United States)

Lam, Nghi Q.; Leaf, O. K.; Minkoff, M.

1983-10-01

The problem of nonequilibrium segregation in alloy films under high-voltage electron microscope (HVEM) irradiation at elevated temperatures is re-examined in the present work, taking into account the damage-rate gradients caused by radial variation in the electron flux. Axial and radial compositional redistributions in model solid solutions, representative of concentrated Ni-Cu, Ni-Al and Ni-Si alloys, were calculated as a function of time, temperature, and film thickness, using a kinetic theory of segregation in binary alloys. The numerical results were achieved by means of a new software package (DISPL2) for solving convection-diffusion-kinetics problems with general orthogonal geometries. It was found that HVEM irradiation-induced segregation in thin films consists of two stages. Initially, due to the proximity of the film surfaces as sinks for point defects, the usual axial segregation (to surfaces) occurs at relatively short irradiation times, and rapidly attains quasi-steady state. Then, radial segregation becomes more and more competitive, gradually affecting the kinetics of axial segregation. At a given temperature, the buildup time to steady state is much longer in the present situation than in the simple case of one-dimensional segregation with uniform defect production. Changes in the alloy composition occur in a much larger zone than the irradiated volume. As a result, the average alloy composition within the irradiated region can differ greatly from that of the unirradiated alloy. The present calculations may be useful in the interpretation of the kinetics of certain HVEM irradiation-induced processes in alloys.

Characteristics of a cold cathode electron source combined with secondary electron emission in a FED

International Nuclear Information System (INIS)

Lei Wei; Zhang Xiaobing; Zhou Xuedong; Zhu Zuoya; Lou Chaogang; Zhao Hongping

2005-01-01

In electron beam devices, the voltage applied to the cathode (w.r.t. grid voltage) provides the initial energy for the electrons. Based on the type of electron emission, the electron sources are (mainly) classified into thermionic cathodes and cold cathodes. The power consumption of a cold cathode is smaller than that of a thermionic cathode. The delay time of the electron emission from a cold cathode following the voltage rise is also smaller. In cathode ray tubes, field emission display (=FED) panels and other devices, the electron current emitted from the cathode needs to be modulated. Since the strong electric field, which is required to extract electrons from the cold cathode, accelerates the electrons to a high velocity near the gate electrode, the required voltage swing for the current modulation is also high. The design of the driving circuit becomes quite difficult and expensive for a high driving voltage. In this paper, an insulator plate with holes is placed in front of a cold cathode. When the primary electrons hit the surface of the insulator tunnels, secondary electrons are generated. In this paper, the characteristics of the secondary electrons emitted from the gate structure are studied. Because the energies of the secondary electrons are smaller than that of the primary electron, the driving voltage for the current modulation is decreased by the introduction of the insulator tunnels, resulting in an improved energy uniformity of the electron beam. Triode structures with inclined insulator tunnels and with double insulator plates are also fabricated and lead to further improvements in the energy uniformity. The improved energy uniformity predicted by the simulation calculations is demonstrated by the improved brightness uniformity in the screen display images

Self-Driven Bioelectrochemical Mineralization of Azobenzene by Coupling Cathodic Reduction with Anodic Intermediate Oxidation

International Nuclear Information System (INIS)

Liu, Rong-Hua; Li, Wen-Wei; Sheng, Guo-Ping; Tong, Zhong-Hua; Lam, Michael Hon-Wah; Yu, Han-Qing

2015-01-01

Highlights: • Azobenzene was reduced to aniline at the cathode of an acetate-fueled MFC. • Aniline was degraded at the bioanode of a single-chamber MFC. • Cathodic reduction of azobenzene was coupled with anodic oxidation of aniline. • Self-driven, complete mineralization of azobenzene in an MFC was accomplished. - Abstract: Bioelectrochemical systems have been intensively studied as a promising technology for wastewater treatment and environment remediation. Coupling of the anodic and cathodic electrochemical reactions allows an enhanced degradation of recalcitrant organics, but external power supply is usually needed to overcome the thermodynamic barrier. In this work, we report a self-driven degradation of azobenzene in a microbial fuel cell (MFC), where the cathodic reduction of azobenzene was effectively coupled with the anodic oxidation of its reduction degradation intermediate (i.e., aniline). The anodic degradation rate of aniline, as the sole carbon source, was significantly higher than that under open-circuit conditions, suggesting a considerable bioelectrochemical oxidation of aniline. Output voltages up to 8 mV were obtained in the MFC. However, a shift of cathodic electron acceptor from oxygen to azobenzene resulted in a decreased aniline degradation rate and output voltage. The present work may provide valuable implications for development of sustainable bioelectrochemical technologies for environmental remediation

Variation of microchannel plate resistance with temperature and applied voltage

International Nuclear Information System (INIS)

Pearson, J.F.; Fraser, G.W.; Whiteley, M.J.

1987-01-01

The resistance of microchannel plate electron multiplier is well known to be a function of both applied voltage and detector temperature. We show that the apparent variation of resistance with bias voltage is simply due to plate temperature increases resulting from resistive heating. (orig.)

Current-voltage characteristics of quantum-point contacts in the closed-channel regime: Transforming the bias voltage into an energy scale

DEFF Research Database (Denmark)

Gloos, K.; Utko, P.; Aagesen, M.

2006-01-01

We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...

A comparison between different oxide dispersion strengthened ferritic steel ongoing in situ oxide dissolution in High Voltage Electron Microscope

International Nuclear Information System (INIS)

Monnet, I.; Van den Berghe, T.; Dubuisson, Ph.

2012-01-01

ODS materials are considered for nuclear applications but previous experimental studies have shown a partial dissolution of some oxides under neutron irradiation. In this work, electron irradiations were used to evaluate the stability of the oxides depending on the chemical composition of the oxide dispersion. Four ferritic steels based on EM10 (Fe–9Cr–1Mo) and reinforced respectively by Al 2 O 3 , MgO, MgAl 2 O 4 and Y 2 O 3 , were studied. These materials were irradiated with 1 MeV or 1.2 MeV electrons in a High Voltage Electron Microscope. This technique allows to follow one single oxide and to determine the evolution of its size during the irradiation. In situ HVEM observations indicate that the dissolution rate depends on the chemical composition of the oxide, on the temperature and on the irradiation dose.

In-situ observation of the alpha/beta cristobalite transition using high voltage electron microscopy

International Nuclear Information System (INIS)

Meike, A.; Glassley, W.E.

1990-01-01

A high temperature water vapor phase is expected to persist in the vicinity of high level radioactive waste packages for several hundreds of years. The authors have begun an investigation of the structural and chemical effects of water on cristobalite because of its abundance in the near field environment. A high voltage transmission electron microscope (HVEM) investigation of bulk synthesized α-cristobalite to be used in single phase dissolution and precipitation kinetics experiments revealed the presence β-cristobalite, quartz and amorphous silica, in addition to α-cristobalite. Consequently, this apparent metastable persistence of β-cristobalite and amorphous silica during the synthesis of α-cristobalite was investigated using a heating stage and an environmental cell installed in the HVEM that allowed the introduction of either dry CO 2 or a CO 2 + H 2 O vapor. Preliminary electron diffraction evidence suggests that the presence of water vapor affected the α-β transition temperature. Water vapor may also be responsible for the development of an amorphous silica phase at the transition that may persist over an interval of several tens of degrees. The amorphous phase was not documented during the dry heating experiments

In-situ observation of the alpha/beta cristobalite transition using high voltage electron microscopy

International Nuclear Information System (INIS)

Meike, A.; Glassley, W.

1989-10-01

A high temperature water vapor phase is expected to persist in the vicinity of high level radioactive waste packages for several hundreds of years. The authors have begun an investigation of the structural and chemical effects of water on cristobalite because of its abundance in the near field environment. A high voltage transmission electron microscope (HVEM) investigation of bulk synthesized α-cristobalite to be used in single phase dissolution and precipitation kinetics experiments revealed the presence β-cristobalite, quartz and amorphous silica, in addition to α-cristobalite. Consequently, this apparent metastable persistence of β-cristobalite and amorphous silica during the synthesis of α-cristobalite was investigated using a heating stage and an environmental cell installed in the HVEM that allowed the introduction of either dry CO 2 or a CO 2 + H 2 O vapor. Preliminary electron diffraction evidence suggests that the presence of water vapor affected the α-β transition temperature. Water vapor may also be responsible for the development of an amorphous silica phase at the transition that may persist over an interval of several tens of degrees. The amorphous phase was not documented during the dry heating experiments. 20 refs., 7 figs., 5 tabs

Voltage harmonics mitigation through hybrid active power filer

International Nuclear Information System (INIS)

Sahito, A.A.; Tunio, S.M.; Khizer, A.N.

2016-01-01

Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion) of 18.91 and 7.61 percentage in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter) is proposed to reduce these THD values below 5 percentage as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5 percentage. (author)

Voltage Harmonics Mitigation through Hybrid Active Power Filter

Directory of Open Access Journals (Sweden)

Anwer Ali Sahito

2016-01-01

Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.

Single electron counting using a dual MCP assembly

International Nuclear Information System (INIS)

Yang, Yuzhen; Liu, Shulin; Zhao, Tianchi; Yan, Baojun; Wang, Peiliang; Yu, Yang; Lei, Xiangcui; Yang, Luping; Wen, Kaile; Qi, Ming

2016-01-01

The gain, pulse height resolution and peak-to-valley ratio of single electrons detected by using a Chevron configured Microchannel Plate (MCP) assembly are studied. The two MCPs are separated by a 280 µm gap and are biased by four electrodes. The purpose of the study is to determine the optimum bias voltage arrangements for single electron counting. By comparing the results of various bias voltage combinations, we conclude that good performance for the electron counting can be achieved by operating the MCP assembly in saturation mode. In addition, by applying a small reverse bias voltage across the gap while adjusting the bias voltages of the MCPs, optimum performance of electron counting can be obtained. - Highlights: • Dual MCPs assembly with four electrodes using different voltage combinations has been investigated for single electron counting. • Both the MCP voltages and the gap voltage can affect the gain, pulse height resolution and P/V ratio. • A high gain of the first stage MCP, a saturation mode of the second stage MCP and an appropriately reverse gap voltage can improve the resolution greatly. • The optimum voltage arrangements is significant for the design of MCP detectors in single electron counting applications.

Optical model theory of elastic electron- and positron-atom scattering at intermediate energies

International Nuclear Information System (INIS)

Joachain, C.J.

1977-01-01

It is stated that the basic idea of the optical model theory is to enable analysis of the elastic scattering of a particle from a complex target by replacing the complicated interactions between the beam and the target by an optical potential, or pseudopotential, in which the incident particle moves. Once the optical potential is determined the original many-body elastic scattering problem reduces to a one-body situation. The resulting optical potential is, however, a very complicated operator, and the formal expressions obtained from first principles for the optical potential can only be evaluated approximately in a few simple cases, such as high energy elastic hadron-nucleus scattering, for the the optical potential can be expressed in terms of two-body hadron-nucleon amplitudes, and the non-relativistic elastic scattering of fast charged particles by atoms. The elastic scattering of an electron or positron by a neutral atom at intermediate energies is here considered. Exchange effects between the projectile and the atomic electrons are considered; also absorption and polarisation effects. Applications of the full-wave optical model have so far only been made to the elastic scattering of fast electrons and positrons by atomic H, He, Ne, and Ar. Agreements of the optical model results with absolute measurements of differential cross sections for electron scattering are very good, an agreement that improves as the energy increases, but deteriorates quickly as the incident energy becomes lower than 50 eV for atomic H or 100 eV for He. For more complex atoms the optical model calculations also appear very encouraging. With regard to positron-atom elastic scattering the optical model results for positron-He scattering differ markedly at small angles from the corresponding electron-He values. It would be interesting to have experimental angular distributions of positron-atom elastic scattering in order to check predictions of the optical model theory. (U.K.)

Hybrid Design Optimization of High Voltage Pulse Transformers for Klystron Modulators

CERN Document Server

Sylvain, Candolfi; Davide, Aguglia; Jerome, Cros

2015-01-01

This paper presents a hybrid optimization methodology for the design of high voltage pulse transformers used in klystron modulators. The optimization process is using simplified 2D FEA design models of the 3D transformer structure. Each intermediate optimal solution is evaluated by 3D FEA and correction coefficients of the 2D FEA models are derived. A new optimization process using 2D FEA models is then performed. The convergence of this hybrid optimal design methodology is obtained with a limited number of time consuming 3D FEA simulations. The method is applied to the optimal design of a monolithic high voltage pulse transformer for the CLIC klystron modulator.

An improved control method of power electronic converters in low voltage micro-grid

DEFF Research Database (Denmark)

Xiaofeng, Sun; Qingqiu, Lv; Yanjun, Tian

2011-01-01

control of the voltage and frequency deviation added to power references could achieve secondary regulation of the voltage and frequency. In this paper, the authors take the steady and transient transition of grid connecting and disconnecting of the micro-grid as an example, and demonstrate......With the increasing acceptance, micro-grid, combined with distributed generation (DG), may be operated in two modes: grid-connected mode and island mode. In grid connected mode, energy management is the control objective. While in island mode, the control of Voltage and frequency will take...... the place. The conventional droop control can perform the energy management in grid-connected mode, but may not so effective when micro-grid transferring between grid-connected mode and island mode. The paper analysis the micro-grid in different modes (Conventional droop control, Voltage reference...

Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography

International Nuclear Information System (INIS)

Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.

1998-01-01

The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured

High Efficiency Power Converter for Low Voltage High Power Applications

DEFF Research Database (Denmark)

Nymand, Morten

The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...

Intermediate stage of sleep and acute cerveau isolé preparation in the rat.

Science.gov (United States)

User, P; Gioanni, H; Gottesmann, C

1980-01-01

The acute cerveau isole rat shows spindle bursts of large amplitude alternating with low voltage activity in the frontal cortex and continuous theta rhythm in the dorsal hippocampus. These patterns closely resemble an "intermediate" stage of sleep-waking cycle, when the forebrain structures seem to be functionally disconnected from the brainstem.

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

International Nuclear Information System (INIS)

Povzner, A.A.; Volkov, A.G.

2017-01-01

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

Energy Technology Data Exchange (ETDEWEB)

Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru

2017-06-15

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

Module Seven: Combination Circuits and Voltage Dividers; Basic Electricity and Electronics Individualized Learning System.

Science.gov (United States)

Bureau of Naval Personnel, Washington, DC.

In this module the student will learn to apply the rules previously learned for series and parallel circuits to more complex circuits called series-parallel circuits, discover the utility of a common reference when making reference to voltage values, and learn how to obtain a required voltage from a voltage divider network. The module is divided…

Properties of an intermediate-duration inactivation process of the voltage-gated sodium conductance in rat hippocampal CA1 neurons.

Science.gov (United States)

French, Christopher R; Zeng, Zhen; Williams, David A; Hill-Yardin, Elisa L; O'Brien, Terence J

2016-02-01

Rapid transmembrane flow of sodium ions produces the depolarizing phase of action potentials (APs) in most excitable tissue through voltage-gated sodium channels (NaV). Macroscopic currents display rapid activation followed by fast inactivation (IF) within milliseconds. Slow inactivation (IS) has been subsequently observed in several preparations including neuronal tissues. IS serves important physiological functions, but the kinetic properties are incompletely characterized, especially the operative timescales. Here we present evidence for an "intermediate inactivation" (II) process in rat hippocampal CA1 neurons with time constants of the order of 100 ms. The half-inactivation potentials (V0.5) of steady-state inactivation curves were hyperpolarized by increasing conditioning pulse duration from 50 to 500 ms and could be described by a sum of Boltzmann relations. II state transitions were observed after opening as well as subthreshold potentials. Entry into II after opening was relatively insensitive to membrane potential, and recovery of II became more rapid at hyperpolarized potentials. Removal of fast inactivation with cytoplasmic papaine revealed time constants of INa decay corresponding to II and IS with long depolarizations. Dynamic clamp revealed attenuation of trains of APs over the 10(2)-ms timescale, suggesting a functional role of II in repetitive firing accommodation. These experimental findings could be reproduced with a five-state Markov model. It is likely that II affects important aspects of hippocampal neuron response and may provide a drug target for sodium channel modulation. Copyright © 2016 the American Physiological Society.

Suppression of the high-frequency disturbances in low-voltage circuits caused by disconnector operation in high-voltage open-air substations

Energy Technology Data Exchange (ETDEWEB)

Savic, M.S.

1986-07-01

The switching off and on of small capacitive currents charging busbar capacitances, connection conductors and open circuit breakers with disconnectors causes high-frequency transients in high-voltage networks. In low voltage circuits, these transient processes induce dangerous overvoltages for the electronic equipment in the substation. A modified construction of the disconnector with a damping resistor was investigated. Digital simulation of the transient process in a high-voltage network during the arcing period between the disconnector contacts with and without damping resistor were performed. A significant decrease of the arcing duration and the decrease of the electromagnetic field magnitude in the vicinity of the operating disconnector were noticed. In the low voltage circuit protected with the surge arrester, the overvoltage magnitude was not affected by the damping resistor due to the arrester protection effect.

Development of high voltage lead wires using electron beam irradiation

International Nuclear Information System (INIS)

Bae Hunjai; Sohn Hosoung; Choi Dongjung

1995-01-01

It is known to those skilled to the art that the electric wires used in high voltage operating electric equipments such as TV sets, microwave ovens, duplicators and etc., have such a structure that a conductor is coated with an insulating layer which is encapsulated with a protecting jacket layer. The electric wire specification such as UL and CSA requires superior cut-through property and flame-retardant property of the wire for utilization safety. The cut-through property of insulation material, for example, high density polyethylene, can be increased by crosslinking of the polymer. Also the flame-retardant property of jacket material which protects the flammable inner insulation can be raised by flame-retardant formulating of the material. In the wire and cable industry, crosslinking by electron beam processing is more effective than that by chemical processing in the viewpoint of through-put rate of the products. The jacket layer of the wire plays the role of protecting the insulation material from burning. The protecting ability of the jacket is related to its inherent flammability and formability of swollen carbonated layer when burned. Crosslinking of the material gives a good formability of swollen carbonated layer, and it protects the insulation material from direct flame. In formulating the flame-retardant jacket material, a crosslinking system must be considered with base polymers and other flame-retardant additives. (Author)

Development of high voltage lead wires using electron beam irradiation

International Nuclear Information System (INIS)

Bae Hunjai; Sohn Hosoung; Choi Dongjung

1995-01-01

It is known to those skilled to the art that the electric wires used in high voltage operating electric equipment such as TV sets, microwave ovens, duplicators etc., have such a structure that a conductor is coated with an insulating layer which is encapsulated with a protecting jacket layer. The electric wire specification such as UL and CSA requires superior cut-through and flame-retardant property of the wire for utilization safety. The cut-through property of insulation material, for example, high density polyethylene, can be increased by crosslinking of the polymer. Also the flame-retardant property of jacket material which protects the flammable inner insulation can be raised by flame-retardant formulating of the material. In the wire and cable industry, crosslinking by electron beam processing is more effective than that by chemical processing in the viewpoint of through-put rate of the products. The jacket layer of the wire plays the role of protecting the insulation material from burning. The protecting ability of the jacket is related to its inherent flammability and formability of swollen carbonated layer when burned. Crosslinking of the material gives a good formability of swollen carbonated layer, and it protects the insulation material from direct flame. In formulating the flame-retardant jacket material, a crosslinking system must be considered with base polymers and other flame-retardant additives. (Author)

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell

Directory of Open Access Journals (Sweden)

Walker Don

2017-01-01

Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.

Efficient Low-Voltage Operation of a CW Gyrotron Oscillator at 233 GHz.

Science.gov (United States)

Hornstein, Melissa K; Bajaj, Vikram S; Griffin, Robert G; Temkin, Richard J

2007-02-01

The gyrotron oscillator is a source of high average power millimeter-wave through terahertz radiation. In this paper, we report low beam power and high-efficiency operation of a tunable gyrotron oscillator at 233 GHz. The low-voltage operating mode provides a path to further miniaturization of the gyrotron through reduction in the size of the electron gun, power supply, collector, and cooling system, which will benefit industrial and scientific applications requiring portability. Detailed studies of low-voltage operation in the TE(2) (,) (3) (,) (1) mode reveal that the mode can be excited with less than 7 W of beam power at 3.5 kV. During CW operation with 3.5-kV beam voltage and 50-mA beam current, the gyrotron generates 12 W of RF power at 233.2 GHz. The EGUN electron optics code describes the low-voltage operation of the electron gun. Using gun-operating parameters derived from EGUN simulations, we show that a linear theory adequately predicts the low experimental starting currents.

Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement

International Nuclear Information System (INIS)

Boudjella, Aissa

2011-01-01

The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.

Current–voltage characteristics of manganite–titanite perovskite junctions

Directory of Open Access Journals (Sweden)

Benedikt Ifland

2015-07-01

Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

OPTIMIZATION OF OPERATION PARAMETERS OF 80-KEV ELECTRON GUN

Directory of Open Access Journals (Sweden)

JEONG DONG KIM

2014-06-01

As a first step, the electron generator of an 80-keV electron gun was manufactured. In order to produce the high beam power from electron linear accelerator, a proper beam current is required form the electron generator. In this study, the beam current was measured by evaluating the performance of the electron generator. The beam current was determined by five parameters: high voltage at the electron gun, cathode voltage, pulse width, pulse amplitude, and bias voltage at the grid. From the experimental results under optimal conditions, the high voltage was determined to be 80 kV, the pulse width was 500 ns, and the cathode voltage was from 4.2 V to 4.6 V. The beam current was measured as 1.9 A at maximum. These results satisfy the beam current required for the operation of an electron linear accelerator.

The IBA Rhodotron: an industrial high-voltage high-powered electron beam accelerator for polymers radiation processing

Science.gov (United States)

Van Lancker, Marc; Herer, Arnold; Cleland, Marshall R.; Jongen, Yves; Abs, Michel

1999-05-01

The Rhodotron is a high-voltage, high-power electron beam accelerator based on a design concept first proposed in 1989 by J. Pottier of the French Atomic Agency, Commissariat à l'Energie Atomique (CEA). In December 1991, the Belgian particle accelerator manufacturer, Ion Beam Applications s.a. (IBA) entered into an exclusive agreement with the CEA to develop and industrialize the Rhodotron. Electron beams have long been used as the preferential method to cross-link a variety of polymers, either in their bulk state or in their final form. Used extensively in the wire and cable industry to toughen insulating jackets, electron beam-treated plastics can demonstrate improved tensile and impact strength, greater abrasion resistance, increased temperature resistance and dramatically improved fire retardation. Electron beams are used to selectively cross-link or degrade a wide range of polymers in resin pellets form. Electron beams are also used for rapid curing of advanced composites, for cross-linking of floor-heating and sanitary pipes and for cross-linking of formed plastic parts. Other applications include: in-house and contract medical device sterilization, food irradiation in both electron and X-ray modes, pulp processing, electron beam doping of semi-conductors, gemstone coloration and general irradiation research. IBA currently markets three models of the Rhodotron, all capable of 10 MeV and alternate beam energies from 3 MeV upwards. The Rhodotron models TT100, TT200 and TT300 are typically specified with guaranteed beam powers of 35, 80 and 150 kW, respectively. Founded in 1986, IBA, a spin-off of the Cyclotron Research Center at the University of Louvain (UCL) in Belgium, is a pioneer in accelerator design for industrial-scale production.

The IBA Rhodotron: an industrial high-voltage high-powered electron beam accelerator for polymers radiation processing

International Nuclear Information System (INIS)

Lancker, Marc van; Herer, Arnold; Cleland, Marshall R.; Jongen, Yves; Abs, Michel

1999-01-01

The Rhodotron is a high-voltage, high-power electron beam accelerator based on a design concept first proposed in 1989 by J. Pottier of the French Atomic Agency, Commissariat a l'Energie Atomique (CEA). In December 1991, the Belgian particle accelerator manufacturer, Ion Beam Applications s.a. (IBA) entered into an exclusive agreement with the CEA to develop and industrialize the Rhodotron. Electron beams have long been used as the preferential method to cross-link a variety of polymers, either in their bulk state or in their final form. Used extensively in the wire and cable industry to toughen insulating jackets, electron beam-treated plastics can demonstrate improved tensile and impact strength, greater abrasion resistance, increased temperature resistance and dramatically improved fire retardation. Electron beams are used to selectively cross-link or degrade a wide range of polymers in resin pellets form. Electron beams are also used for rapid curing of advanced composites, for cross-linking of floor-heating and sanitary pipes and for cross-linking of formed plastic parts. Other applications include: in-house and contract medical device sterilization, food irradiation in both electron and X-ray modes, pulp processing, electron beam doping of semi-conductors, gemstone coloration and general irradiation research. IBA currently markets three models of the Rhodotron, all capable of 10 MeV and alternate beam energies from 3 MeV upwards. The Rhodotron models TT100, TT200 and TT300 are typically specified with guaranteed beam powers of 35, 80 and 150 kW, respectively. Founded in 1986, IBA, a spin-off of the Cyclotron Research Center at the University of Louvain (UCL) in Belgium, is a pioneer in accelerator design for industrial-scale production

Induced voltage due to time-dependent magnetisation textures

International Nuclear Information System (INIS)

Kudtarkar, Santosh Kumar; Dhadwal, Renu

2010-01-01

We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

Modeling and simulation of dynamic voltage restorer in power system

International Nuclear Information System (INIS)

Abdel Aziz, M.A.A.M.

2012-01-01

There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.

DEMONSTRATION BULLETIN: HIGH VOLTAGE ELECTRON BEAM TECHNOLOGY - HIGH VOLTAGE ENVIRONMENTAL APPLICATIONS, INC.

Science.gov (United States)

The high energy electron beam irradiation technology is a low temperature method for destroying complex mixtures of hazardous organic chemicals in solutions containing solids. The system consists of a computer-automated, portable electron beam accelerator and a delivery system. T...

Accurate determination of the voltage of a transmission electron ...

Indian Academy of Sciences (India)

The techniques established are found to be suitable for TEMs operating at a setting voltage of about 250 kV. For the TEM studies, a regular double-tilt specimen holder is required in order to be able to get to the desired zone axes. When the experiments were repeated using a cryogenic double-tilt holder, an improvement in ...

Inductive voltage adder advanced hydrodynamic radiographic technology demonstration

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Maenchen; Rovang, D.C.

1997-04-01

This paper presents the design, results, and analysis of a high-brightness electron beam technology demonstration experiment completed at Sandia National Laboratories, performed in collaboration with Los Alamos National Laboratory. The anticipated electron beam parameters were: 12 MeV, 35-40 kA, 0.5-mm rms radius, and 40-ns full width half maximum (FWHM) pulse duration. This beam, on an optimum thickness tantalum converter, should produce a very intense x-ray source of ∼ 1.5-mm spot size and 1 kR dose at sign 1 m. The accelerator utilized was SABRE, a pulsed inductive voltage adder, and the electron source was a magnetically immersed foilless electron diode. For these experiments, SABRE was modified to high-impedance negative-polarity operation. A new 100-ohm magnetically insulated transmission line cathode electrode was designed and constructed; the cavities were rotated 180 degrees poloidally to invert the central electrode polarity to negative; and only one of the two pulse forming lines per cavity was energized. A twenty- to thirty-Tesla solenoidal magnet insulated the diode and contained the beam at its extremely small size. These experiments were designed to demonstrate high electron currents in submillimeter radius beams resulting in a high-brightness high-intensity flash x-ray source for high-resolution thick-object hydrodynamic radiography. The SABRE facility high-impedance performance was less than what was hoped. The modifications resulted in a lower amplitude (9 MV), narrower-than-anticipated triangular voltage pulse, which limited the dose to ∼ 20% of the expected value. In addition, halo and ion-hose instabilities increased the electron beam spot size to > 1.5 mm. Subsequent, more detailed calculations explain these reduced output parameters. An accelerator designed (versus retrofit) for this purpose would provide the desired voltage and pulse shape

Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

Energy Technology Data Exchange (ETDEWEB)

Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)

2017-02-15

High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

International Nuclear Information System (INIS)

Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.

2017-01-01

High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

High-voltage nanosecond pulse shaper

International Nuclear Information System (INIS)

Kapishnikov, N.K.; Muratov, V.M.; Shatanov, A.A.

1987-01-01

A high-voltage pulse shaper with an output of up to 250 kV, a base duration of ∼ 10 nsec, and a repetition frequency of 50 pulses/sec is described. The described high-voltage nanosecond pulse shaper is designed for one-orbit extraction of an electron beam from a betatron. A diagram of the pulse shaper, which employs a single-stage generator is shown. The shaping element is a low-inductance capacitor bank of series-parallel KVI-3 (2200 pF at 10 kV) or K15-10 (4700 pF at 31.5 kV) disk ceramic capacitors. Four capacitors are connected in parallel and up to 25 are connected in series

Excitation of voltage oscillations in an induction voltage adder

Directory of Open Access Journals (Sweden)

Nichelle Bruner

2009-07-01

Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

Low-Cost Voltage Zero-Crossing Detector for AC-Grid Applications

Directory of Open Access Journals (Sweden)

Vorobyov Maxim

2014-10-01

Full Text Available Renewable energy sources and energy storage devices are becoming more popular. Some of them like small hydropower turbines, wind turbines and diesel generators produce AC voltage with different frequency and voltage than the main grid. For them power electronics converters are necessary. Power electronics converters presented in industry use two or three level energy conversion, although direct AC to AC converters exist, but one of the main problems is the switch commutation when current or voltage is crossing the zero point. Zero crossing sensors are used to solve this problem. They consist of current or voltage measurement unit and zero crossing detector. Different approaches are used for zero crossing: hardware or software. Hardware approach is simple but it has low precision. Software approach has high precision but it is complicated and expensive. In this paper a simple low cost high precision approach is presented. It takes all advantages from both approaches. While tested with two types of microcontrollers the precision of experimental measurement is 25 μs - 40 μs.

Luminescence evolution from alumina ceramic surface before flashover under direct and alternating current voltage in vacuum

Energy Technology Data Exchange (ETDEWEB)

Su, Guo-Qiang; Wang, Yi-Bo; Song, Bai-Peng; Mu, Hai-Bao, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn; Zhang, Guan-Jun, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, School of Electrical Engineering, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Li, Feng; Wang, Meng [Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China)

2016-06-15

The luminescence evolution phenomena from alumina ceramic surface in vacuum under high voltage of direct and alternating current are reported, with the voltage covering a large range from far below to close to the flashover voltage. Its time resolved and spatial distributed behaviors are examined by a photon counting system and an electron-multiplying charge-coupled device (EMCCD) together with a digital camera, respectively. The luminescence before flashover exhibits two stages as voltage increasing, i.e., under a relative low voltage (Stage A), the luminescence is ascribed to radiative recombination of hetero-charges injected into the sample surface layer by Schottky effect; under a higher voltage (Stage B), a stable secondary electron emission process, resulting from the Fowler-Nordheim emission at the cathode triple junction (CTJ), is responsible for the luminescence. Spectrum analysis implies that inner secondary electrons within the surface layer of alumina generated during the SSEE process also participate in the luminescence of Stage B. A comprehensive interpretation of the flashover process is formulated, which might promote a better understanding of flashover issue in vacuum.

Implementation of floating gate MOSFET in inverter for threshold voltage tunability

Directory of Open Access Journals (Sweden)

Musa F.A.S.

2017-01-01

Full Text Available This paper presents the ability of floating gate MOSFET (FGMOS threshold voltage to be programmed or tuned which is exploited to improve the performance of electronic circuit design. This special characteristic owns by FGMOS is definitely contributes towards low voltage and low power circuit design. The comparison of threshold voltage between FGMOS and conventional NMOS is done in order to prove that FGMOS is able to produce a lower threshold voltage compared to conventional NMOS. In addition, in this paper, an implementation of FGMOS into inverter circuit is also done to show the programmability of FGMOS threshold voltage. The operations of the inverter circuits are verified using Sypnopsys simulation in 0.1μm CMOS technology with supply voltage of 1.8V.

Studies of radiation blistering effects on voltage holding

International Nuclear Information System (INIS)

Miley, G.H.

1975-01-01

The surfaces of niobium and tungsten wires were blistered by 300-keV helium-ion irradiation and then tested for voltage holding. A cylindrical projection-tube technique was employed so that regions of strong electron emission could be observed and later examined with a scanning electron microscope (SEM). Blistering was found to cause significant increases in pre-breakdown currents. However, these currents tend to saturate over a region corresponding to around 200-400 kV/cm surface field such that the ultimate voltage breakdown limit is not seriously reduced. Emission image observations and SEM photographs suggest that, in many cases, parts of the blistered surface are gradually erected by the strong surface fields, but this may not occur until after several arc breakdowns. SEM photographs also indicate that vapor from the anode may play an important part in the breakdown mechanism. Implications of these results to the design of devices important to fusion development, such as direct collectors and ion sources, are briefly discussed. The importance of future in situ irradiation-voltage experiments is also stressed. (U.S.)

Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

International Nuclear Information System (INIS)

Kim, N.; Cheong, Y.; Song, W.

2010-01-01

We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

Electron-Electron and Electron-Phonon interactions effects on the tunnel electronic spectrum of PbS quantum dots

Science.gov (United States)

Wang, Hongyue; Lhuillier, Emmanuel; Yu, Qian; Mottaghizadeh, Alireza; Ulysse, Christian; Zimmers, Alexandre; Dubertret, Benoit; Aubin, Herve

2015-03-01

We present a tunnel spectroscopy study of the electronic spectrum of single PbS Quantum Dots (QDs) trapped between nanometer-spaced electrodes, measured at low temperature T=5 K. The carrier filling of the QD can be controlled either by the drain voltage in the shell filling regime or by a gate voltage. In the empty QD, the tunnel spectrum presents the expected signature of the 8x degenerated excited levels. In the drain controlled shell filling regime, the levels degeneracies are lifted by the global electrostatic Coulomb energy of the QD; in the gate controlled shell filling regime, the levels degeneracies are lifted by the intra-Coulomb interactions. In the charged quantum dot, electron-phonons interactions lead to the apparition of Franck-Condon side bands on the single excited levels and possibly Franck Condon blockade at low energy. The sharpening of excited levels at higher gate voltage suggests that the magnitude of electron-phonon interactions is decreased upon increasing the electron filling in the quantum dot. This work was supported by the French ANR Grants 10-BLAN-0409-01, 09-BLAN-0388-01, by the Region Ile-de-France in the framework of DIM Nano-K and by China Scholarship Council.

Cryo-EM structures of two bovine adenovirus type 3 intermediates

International Nuclear Information System (INIS)

Cheng, Lingpeng; Huang, Xiaoxing; Li, Xiaomin; Xiong, Wei; Sun, Wei; Yang, Chongwen; Zhang, Kai; Wang, Ying; Liu, Hongrong; Huang, Xiaojun; Ji, Gang; Sun, Fei; Zheng, Congyi; Zhu, Ping

2014-01-01

Adenoviruses (Ads) infect hosts from all vertebrate species and have been investigated as vaccine vectors. We report here near-atomic structures of two bovine Ad type 3 (BAd3) intermediates obtained by cryo-electron microscopy. A comparison between the two intermediate structures reveals that the differences are localized in the fivefold vertex region, while their facet structures are identical. The overall facet structure of BAd3 exhibits a similar structure to human Ads; however, BAd3 protein IX has a unique conformation. Mass spectrometry and cryo-electron tomography analyses indicate that one intermediate structure represents the stage during DNA encapsidation, whilst the other intermediate structure represents a later stage. These results also suggest that cleavage of precursor protein VI occurs during, rather than after, the DNA encapsidation process. Overall, our results provide insights into the mechanism of Ad assembly, and allow the first structural comparison between human and nonhuman Ads at backbone level. - Highlights: • First structure of bovine adenovirus type 3. • Some channels are located at the vertex of intermediate during DNA encapsidation. • Protein IX exhibits a unique conformation of trimeric coiled–coiled structure. • Cleavage of precursor protein VI occurs during the DNA encapsidation process

Cryo-EM structures of two bovine adenovirus type 3 intermediates

Energy Technology Data Exchange (ETDEWEB)

Cheng, Lingpeng; Huang, Xiaoxing; Li, Xiaomin [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xiong, Wei [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Luo-jia-shan, Wuhan, Hubei 430072 (China); Sun, Wei; Yang, Chongwen; Zhang, Kai; Wang, Ying [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Liu, Hongrong [College of Physics and Information Science, Hunan Normal University, Changsha, Hunan 410081 (China); Huang, Xiaojun; Ji, Gang; Sun, Fei [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Zheng, Congyi, E-mail: cctcc202@whu.edu.cn [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Luo-jia-shan, Wuhan, Hubei 430072 (China); Zhu, Ping, E-mail: zhup@ibp.ac.cn [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

2014-02-15

Adenoviruses (Ads) infect hosts from all vertebrate species and have been investigated as vaccine vectors. We report here near-atomic structures of two bovine Ad type 3 (BAd3) intermediates obtained by cryo-electron microscopy. A comparison between the two intermediate structures reveals that the differences are localized in the fivefold vertex region, while their facet structures are identical. The overall facet structure of BAd3 exhibits a similar structure to human Ads; however, BAd3 protein IX has a unique conformation. Mass spectrometry and cryo-electron tomography analyses indicate that one intermediate structure represents the stage during DNA encapsidation, whilst the other intermediate structure represents a later stage. These results also suggest that cleavage of precursor protein VI occurs during, rather than after, the DNA encapsidation process. Overall, our results provide insights into the mechanism of Ad assembly, and allow the first structural comparison between human and nonhuman Ads at backbone level. - Highlights: • First structure of bovine adenovirus type 3. • Some channels are located at the vertex of intermediate during DNA encapsidation. • Protein IX exhibits a unique conformation of trimeric coiled–coiled structure. • Cleavage of precursor protein VI occurs during the DNA encapsidation process.

A Smart Load Interface and Voltage Regulator for Electrostatic Vibration Energy Harvester

Science.gov (United States)

Bedier, Mohammed; Basset, Philippe; Galayko, Dimitri

2016-11-01

This paper presents a new implementation in ams 0.35μm HV technology of a complete energy management system for an electrostatic vibrational energy harvester (e-VEH). It is based on the Bennet's doubler architecture and includes a load voltage regulator (LVR) and a smart Load Interface (LI) that are self-controlled with internal voltages for maximum power point tracking (MMPT). The CMOS implementation makes use of an energy harvester that is capable of producing up to 1.8μW at harmonic excitation, given its internal voltage is kept within its optimum. An intermediate LI stage and its controller makes use of a high side switch with zero static power level shifter, and a low power hysteresis comparator. A full circuit level simulation with a VHDL-AMS model of the e-VEH presented was successfully achieved, indicating that the proposed load interface controller consumes less than 100nW average power. Moreover, a LVR regulates the buffer and discharge the harvested energy into a generic resistive load maintaining the voltage within a nominal value of 2 Volts.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment

Energy Technology Data Exchange (ETDEWEB)

König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)

2017-11-15

Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

Investigation on a Novel Discontinuous Pulse-Width Modulation Algorithm for Single-phase Voltage Source Rectifier

DEFF Research Database (Denmark)

Qu, Hao; Yang, Xijun; Guo, Yougui

2014-01-01

Single-phase voltage source converter (VSC) is an important power electronic converter (PEC), including single-phase voltage source inverter (VSI), single-phase voltage source rectifier (VSR), single-phase active power filter (APF) and single-phase grid-connection inverter (GCI). Single-phase VSC...

Experiments in high voltage electron microscopy. Progress report, October 31, 1976--August 1977

International Nuclear Information System (INIS)

Mitchell, T.E.; Hobbs, L.W.; Howitt, D.G.; Barnard, R.; Ro, H.

1977-07-01

High voltage electron microscopy (HVEM) is being used to study the effects of irradiation on a variety of materials. The vacancies and interstitials produced by displacement can aggregate to form dislocation loops and voids, annihilate at sinks, or enhance various diffusion processes such as precipitation and recrystallization. Threshold displacement energies, E/sub d/, have been determined for a number of fcc, bcc and hcp metals and for various oxides. In MgO, E/sub d/ is less along (100) than (110); also, E/sub d/ decreases with increasing temperature, possibly due to thermally activated escape of interstitials from recombination volumes or softening of saddle points. The effects of electron irradiation on precipitation in Al--Cu, Al--Si and Ni--Al alloys have been investigated. Precipitation respectively of theta', Si and γ' is enhanced and growth rates are explicable in terms of theories of radiation-enhanced diffusion, with D/sub rad/ approx. 10 -15 cm 2 sec -1 . In oxides, damage gives rise to interstitial dislocation loop nucleation and growth in all cases, perfect [110] loops in MgO faulted basal and prismatic loops in Al 2 O 3 . Quantitative analysis of loop growth rates in MgO gives a migration energy of 3.3 eV for anion vacancies. Other radiation effects include sublimation of MgO and decomposition of MgAl 2 O 4 and Mg 2 SiO 4 into MgO plus other phases

Electronic Structure of the Ferryl Intermediate in the α-Ketoglutarate Dependent Non-Heme Iron Halogenase SyrB2: Contributions to H Atom Abstraction Reactivity

Czech Academy of Sciences Publication Activity Database

Srnec, Martin; Wong, S. D.; Matthews, M. L.; Krebs, C.; Bollinger, J. M.; Solomon, E. I.

2016-01-01

Roč. 138, č. 15 (2016), s. 5110-5122 ISSN 0002-7863 R&D Projects: GA ČR(CZ) GJ15-10279Y Institutional support: RVO:61388955 Keywords : Ferryl intermediate * syringomycin halogenase * electronic structure Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 13.858, year: 2016

The Effect of Image Potential on the Current-Voltage Characteristics of a Ferritin-layer

Directory of Open Access Journals (Sweden)

Eunjung Bang

2010-11-01

Full Text Available Considering for the concept of power storage systems, such as those used to supply power to microelectronic devices, ferritins have aroused a lot of interests for applications in bioelectrochemical devices. And electron transfer rates from the proteins to electrode surface are key determinants of overall performance and efficiency of the ferritin-based devices. Here we have investigated the electron transport mechanism of ferritin layer which was immobilized on an Au electrode. The current-voltage (I-V curves are obtained by a conductive atomic force microscope (c-AFM as a function of contact area between AFM tip and the ferritin layer. In the low voltage region, I-V curves are affected by both Fowler-Nordheim tunneling and image force. On the other hand, the experimental results are consistent with a Simmons model in a high voltage region, indicating that, as the voltage increases, the image potential has a dominant effect on the electron transport mechanism. These results are attributed to the film-like character of the ferritin layer, which generates an image potential to lower the barrier height in proportion to the voltage increment.

Simulation of Electron Beam Trajectory of Thermionic Electron Gun Type with Pierce Electrode

International Nuclear Information System (INIS)

Suprapto; Djoko-SP; Djasiman

2000-01-01

The simulation of electron beam trajectory for electron gun of electron beam machine has been done. The simulation is carried out according to mechanical design of the electron gun. The simulation is carried out by using the software made by Andrzej Soltan Institute for Nuclear Studies, Swierk-Poland. The result obtained from simulation is approximately parallel electron beam trajectory of 20 mA beam current at 0.66 kV anode voltage, 15 mm cathode-anode distance and 67.5 o cathode angle. Arrangement of electron gun and accelerating tube with 15 kV voltage between anode and the first electrode of accelerating tube yields focus distance of 34 mm from the to cathode. To obtain the approximately parallel beam trajectory which has -0.03 o entrance angles to accelerating tube, the suitable cathode-anode voltage is 12.66 kV. With the entrance angle of -0.03 o it is expected that the electron beam can be accelerated and the beam profile has a small divergence after passing the accelerating tube. (author)

Demonstration of InAlN/AlGaN high electron mobility transistors with an enhanced breakdown voltage by pulsed metal organic chemical vapor deposition

Energy Technology Data Exchange (ETDEWEB)

Xue, JunShuai, E-mail: junshuaixue@hotmail.com; Zhang, JinCheng; Hao, Yue [Key Laboratory of Wide Band Gap Semiconductor Materials and Devices, School of Microelectronics, Xidian University, Xi' an 710071 (China)

2016-01-04

In this work, InAlN/AlGaN heterostructures employing wider bandgap AlGaN instead of conventional GaN channel were grown on sapphire substrate by pulsed metal organic chemical vapor deposition, where the nominal Al composition in InAlN barrier and AlGaN channel were chosen to be 83% and 5%, respectively, to achieve close lattice-matched condition. An electron mobility of 511 cm{sup 2}/V s along with a sheet carrier density of 1.88 × 10{sup 13 }cm{sup −2} were revealed in the prepared heterostructures, both of which were lower compared with lattice-matched InAlN/GaN due to increased intrinsic alloy disorder scattering resulting from AlGaN channel and compressively piezoelectric polarization in barrier, respectively. While the high electron mobility transistor (HEMT) processed on these structures not only exhibited a sufficiently high drain output current density of 854 mA/mm but also demonstrated a significantly enhanced breakdown voltage of 87 V, which is twice higher than that of reported InAlN/GaN HEMT with the same device dimension, potential characteristics for high-voltage operation of GaN-based electronic devices.

Optimising electron microscopy experiment through electron optics simulation

Energy Technology Data Exchange (ETDEWEB)

Kubo, Y. [CEMES-CNRS, 29 Rue Jeanne Marvig, 31055 Toulouse France (France); Hitachi High-Technologies Corporation, 882, Ichige, Hitachinaka, Ibaraki 312-8504 (Japan); Gatel, C.; Snoeck, E. [CEMES-CNRS, 29 Rue Jeanne Marvig, 31055 Toulouse France (France); Houdellier, F., E-mail: florent.houdellier@cemes.fr [CEMES-CNRS, 29 Rue Jeanne Marvig, 31055 Toulouse France (France)

2017-04-15

We developed a new type of electron trajectories simulation inside a complete model of a modern transmission electron microscope (TEM). Our model incorporates the precise and real design of each element constituting a TEM, i.e. the field emission (FE) cathode, the extraction optic and acceleration stages of a 300 kV cold field emission gun, the illumination lenses, the objective lens, the intermediate and projection lenses. Full trajectories can be computed using magnetically saturated or non-saturated round lenses, magnetic deflectors and even non-cylindrical symmetry elements like electrostatic biprism. This multi-scale model gathers nanometer size components (FE tip) with parts of meter length (illumination and projection systems). We demonstrate that non-trivial TEM experiments requiring specific and complex optical configurations can be simulated and optimized prior to any experiment using such model. We show that all the currents set in all optical elements of the simulated column can be implemented in the real column (I2TEM in CEMES) and used as starting alignment for the requested experiment. We argue that the combination of such complete electron trajectory simulations in the whole TEM column with automatic optimization of the microscope parameters for optimal experimental data (images, diffraction, spectra) allows drastically simplifying the implementation of complex experiments in TEM and will facilitate the development of advanced use of the electron microscope in the near future. - Highlights: • Using dedicated electron optics software, we calculate full electrons trajectories inside a modern transmission electron microscope. • We have determined how to deal with multi-scale electron optics elements like high voltage cold field emission source. • W • e have succeed to model both weak and strong magnetic lenses whether in saturated or unsaturated conditions as well as electrostatic biprism and magnetic deflectors. • We have applied this model

Optimising electron microscopy experiment through electron optics simulation

International Nuclear Information System (INIS)

Kubo, Y.; Gatel, C.; Snoeck, E.; Houdellier, F.

2017-01-01

We developed a new type of electron trajectories simulation inside a complete model of a modern transmission electron microscope (TEM). Our model incorporates the precise and real design of each element constituting a TEM, i.e. the field emission (FE) cathode, the extraction optic and acceleration stages of a 300 kV cold field emission gun, the illumination lenses, the objective lens, the intermediate and projection lenses. Full trajectories can be computed using magnetically saturated or non-saturated round lenses, magnetic deflectors and even non-cylindrical symmetry elements like electrostatic biprism. This multi-scale model gathers nanometer size components (FE tip) with parts of meter length (illumination and projection systems). We demonstrate that non-trivial TEM experiments requiring specific and complex optical configurations can be simulated and optimized prior to any experiment using such model. We show that all the currents set in all optical elements of the simulated column can be implemented in the real column (I2TEM in CEMES) and used as starting alignment for the requested experiment. We argue that the combination of such complete electron trajectory simulations in the whole TEM column with automatic optimization of the microscope parameters for optimal experimental data (images, diffraction, spectra) allows drastically simplifying the implementation of complex experiments in TEM and will facilitate the development of advanced use of the electron microscope in the near future. - Highlights: • Using dedicated electron optics software, we calculate full electrons trajectories inside a modern transmission electron microscope. • We have determined how to deal with multi-scale electron optics elements like high voltage cold field emission source. • W • e have succeed to model both weak and strong magnetic lenses whether in saturated or unsaturated conditions as well as electrostatic biprism and magnetic deflectors. • We have applied this model

The LMF triaxial MITL voltage adder system

International Nuclear Information System (INIS)

Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

1992-01-01

The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

High Efficiency Power Converter for Low Voltage High Power Applications

DEFF Research Database (Denmark)

Nymand, Morten

The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...

Future possibilities with intermediate-energy neutron beams

International Nuclear Information System (INIS)

Brady, F.P.

1987-01-01

Future possibilities for using neutrons of intermediate energies (50 - 200 MeV) as a probe of the nucleus are discussed. Some of the recent thinking concerning a systematic approach for studying elastic and inelastic scattering of electrons and hadrons and the important role of medium- and intermediate-energy neutrons in such a programme is reviewed. The advantages of neutrons in this energy range over neutrons with lower energies and over intermediate-energy pions for determining nuclear-transition and ground state densities, and for distinguishing proton from neutron density (isovector sensitivity), are noted. The important role of (n,p) charge exchange reactions in nuclear excitation studies is also reviewed. Experimental methods for utilizing neutrons as probes in elastic, inelastic, and charge exchange studies at these energies are discussed

The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model

Directory of Open Access Journals (Sweden)

Marius Birlea

2012-08-01

Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

Science.gov (United States)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with reduced leakage current and enhanced breakdown voltage using aluminum ion implantation

Energy Technology Data Exchange (ETDEWEB)

Sun, Shichuang [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China); Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Fu, Kai, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn; Yu, Guohao; Zhang, Zhili; Song, Liang; Deng, Xuguang; Li, Shuiming; Sun, Qian; Cai, Yong; Zhang, Baoshun [Key Laboratory of Nanodevices and Applications, Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Qi, Zhiqiang; Dai, Jiangnan; Chen, Changqing, E-mail: kfu2009@sinano.ac.cn, E-mail: cqchen@mail.hust.edu.cn [Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China)

2016-01-04

This letter has studied the performance of AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors on silicon substrate with GaN buffer treated by aluminum ion implantation for insulating followed by a channel regrown by metal–organic chemical vapor deposition. For samples with Al ion implantation of multiple energies of 140 keV (dose: 1.4 × 10{sup 14} cm{sup −2}) and 90 keV (dose: 1 × 10{sup 14} cm{sup −2}), the OFF-state leakage current is decreased by more than 3 orders and the breakdown voltage is enhanced by nearly 6 times compared to the samples without Al ion implantation. Besides, little degradation of electrical properties of the 2D electron gas channel is observed where the maximum drain current I{sub DSmax} at a gate voltage of 3 V was 701 mA/mm and the maximum transconductance g{sub mmax} was 83 mS/mm.

Computer-aided analysis of power-electronic systems simulation of a high-voltage power converter

International Nuclear Information System (INIS)

Bordry, F.; Isch, H.W.; Proudlock, P.

1987-01-01

In the study of semiconductor devices, simulation methods play an important role in both the design of systems and the analysis of their operation. The authors describe a new and efficient computer-aided package program for general power-electronic systems. The main difficulty when taking into account non-linear elements, such as semiconductors, lies in determining the existence and the relations of the elementary sequences defined by the conduction or nonconduction of these components. The method does not require a priori knowledge of the state sequences of the semiconductor nor of the commutation instants, but only the circuit structure, its parameters and the commands to the controlled switches. The simulation program computes automatically both transient and steady-state waveforms for any circuit configuration. The simulation of a high-voltage power converter is presented, both for its steady-state and transient overload conditions. This 100 kV power converter (4 MW) will feed two klystrons in parallel

Novel high-voltage power lateral MOSFET with adaptive buried electrodes

International Nuclear Information System (INIS)

Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

2012-01-01

A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Intrinsic non-radiative voltage losses in fullerene-based organic solar cells

Science.gov (United States)

Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen

2017-06-01

Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.

Selective irradiation for fast switching thyristor with low forward voltage drop

International Nuclear Information System (INIS)

Brown, J.L.

1975-01-01

The switching speed of a thyristor is increased without correspondingly increasing the forward voltage drop by selectively irradiating at least portions of the PN junction between the conducting and gating portions, and 5 to 30 percent of the adjacent surface area of the conducting portions of the device. 50 to 100 percent of the surface area of the gating portions, and the peripheral portions can also be irradiated at the same time to decrease gate sensitivity and increase blocking voltage of the thyristor, respectively. Preferably, the thyristor is irradiated with electron radiation which preferably is of an intensity greater than 1 MeV and most desirably about 2 MeV. The electron irradiation is preferably to a dosage of between about 1 x 10 13 electrons/cm 2 and 1 x 10 15 electrons/cm 2 . (auth)

High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter

International Nuclear Information System (INIS)

Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.

1987-01-01

The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V

Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

DEFF Research Database (Denmark)

Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

2017-01-01

This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

Current integrator using the voltage to frequency converter

International Nuclear Information System (INIS)

Ukai, K.; Gomi, K.

1975-01-01

A current integrator using the Voltage to Frequency Converter has been constructed to measure the beam intensity of the 1.3 GeV Electron Synchrotron at the INS. This integrator ranges the current 10 -7 to 10 -11 amperes and has been calibrated by the extracted electron beam and constant current sources. The accuracy of this integrator agrees with the previous integrator within 1%. (auth.)

Design and power management of an offshore medium voltage DC microgrid realized through high voltage power electronics technologies and control

Science.gov (United States)

Grainger, Brandon Michael

The growth in the electric power industry's portfolio of Direct Current (DC) based generation and loads have captured the attention of many leading research institutions. Opportunities for using DC based systems have been explored in electric ship design and have been a proven, reliable solution for transmitting bulk power onshore and offshore. To integrate many of the renewable resources into our existing AC grid, a number of power conversions through power electronics are required to condition the equipment for direct connection. Within the power conversion stages, there is always a requirement to convert to or from DC. The AC microgrid is a conceptual solution proposed for integrating various types of renewable generation resources. The fundamental microgrid requirements include the capability of operating in islanding mode and/or grid connected modes. The technical challenges associated with microgrids include (1) operation modes and transitions that comply with IEEE1547 without extensive custom engineering and (2) control architecture and communication. The Medium Voltage DC (MVDC) architecture, explored by the University of Pittsburgh, can be visualized as a special type of DC microgrid. This dissertation is multi-faceted, focused on many design aspects of an offshore DC microgrid. The focal points of the discussion are focused on optimized high power, high frequency magnetic material performance in electric machines, transformers, and DC/DC power converters---all components found within offshore, power system architectures. A new controller design based upon model reference control is proposed and shown to stabilize the electric motor drives (modeled as constant power loads), which serve as the largest power consuming entities in the microgrid. The design and simulation of a state-of-the-art multilevel converter for High Voltage DC (HVDC) is discussed and a component sensitivity analysis on fault current peaks is explored. A power management routine is

Gated-controlled electron pumping in connected quantum rings

International Nuclear Information System (INIS)

Lima, R.P.A.; Domínguez-Adame, F.

2014-01-01

We study the electronic transport across connected quantum rings attached to leads and subjected to time-harmonic side-gate voltages. Using the Floquet formalism, we calculate the net pumped current generated and controlled by the side-gate voltage. The control of the current is achieved by varying the phase shift between the two side-gate voltages as well as the Fermi energy. In particular, the maximum current is reached when the side-gate voltages are in quadrature. This new design based on connected quantum rings controlled without magnetic fields can be easily integrated in standard electronic devices. - Highlights: • We introduce and study a minimal setup to pump electrons through connected quantum rings. • Quantum pumping is achieved by time-harmonic side-gate voltages instead of the more conventional time-dependent magnetic fluxes. • Our new design could be easily integrated in standard electronic devices

Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

Science.gov (United States)

Carvalho-de-Souza, Joao L; Bezanilla, Francisco

2018-02-05

Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018

Single-molecule electron tunnelling through multiple redox levels with environmental relaxation

DEFF Research Database (Denmark)

Kuznetsov, A.M.; Ulstrup, Jens

2004-01-01

represent the substrate and tip in electrochemical in situ scanning tunnelling microscopy. An equivalent three-electrode configuration represents a molecular single-electron transistor in which the enclosing electrodes constitute source and drain, and the reference electrode the gate. Current-bias voltage...... relations at fixed electrochemical overpotential or gate voltage, and current-overpotential or current-gate voltage relations at fixed bias voltage are equivalent in the two systems. Due to the activation-less nature of the processes, electron flow between the electrodes through the molecular redox levels...... level(s) subsequent to electron transfer. Several physical mechanisms can be distinguished and distinctive current-overpotential/gate voltage or current-bias voltage relations obtained. These reflect electronic level separation, environmental nuclear reorganisation, and coherent or incoherent multi...

Computer applications: Automatic control system for high-voltage accelerator

International Nuclear Information System (INIS)

Bryukhanov, A.N.; Komissarov, P.Yu.; Lapin, V.V.; Latushkin, S.T.. Fomenko, D.E.; Yudin, L.I.

1992-01-01

An automatic control system for a high-voltage electrostatic accelerator with an accelerating potential of up to 500 kV is described. The electronic apparatus on the high-voltage platform is controlled and monitored by means of a fiber-optic data-exchange system. The system is based on CAMAC modules that are controlled by a microprocessor crate controller. Data on accelerator operation are represented and control instructions are issued by means of an alphanumeric terminal. 8 refs., 6 figs

Ultra-low specific on-resistance high-voltage vertical double diffusion metal–oxide–semiconductor field-effect transistor with continuous electron accumulation layer

International Nuclear Information System (INIS)

Ma Da; Luo Xiao-Rong; Wei Jie; Tan Qiao; Zhou Kun; Wu Jun-Feng

2016-01-01

A new ultra-low specific on-resistance (R on,sp ) vertical double diffusion metal–oxide–semiconductor field-effect transistor (VDMOS) with continuous electron accumulation (CEA) layer, denoted as CEA-VDMOS, is proposed and its new current transport mechanism is investigated. It features a trench gate directly extended to the drain, which includes two PN junctions. In on-state, the electron accumulation layers are formed along the sides of the extended gate and introduce two continuous low-resistance current paths from the source to the drain in a cell pitch. This mechanism not only dramatically reduces the R on,sp but also makes the R on,sp almost independent of the n-pillar doping concentration (N n ). In off-state, the depletion between the n-pillar and p-pillar within the extended trench gate increases the N n , and further reduces the R on,sp . Especially, the two PN junctions within the trench gate support a high gate–drain voltage in the off-state and on-state, respectively. However, the extended gate increases the gate capacitance and thus weakens the dynamic performance to some extent. Therefore, the CEA-VDMOS is more suitable for low and medium frequencies application. Simulation indicates that the CEA-VDMOS reduces the R on,sp by 80% compared with the conventional super-junction VDMOS (CSJ-VDMOS) at the same high breakdown voltage (BV). (paper)

Electron microscopy of intermediate filaments: teaming up with atomic force and confocal laser scanning microscopy.

Science.gov (United States)

Kreplak, Laurent; Richter, Karsten; Aebi, Ueli; Herrmann, Harald

2008-01-01

Intermediate filaments (IFs) were originally discovered and defined by electron microscopy in myoblasts. In the following it was demonstrated and confirmed that they constitute, in addition to microtubules and microfilaments, a third independent, general filament system in the cytoplasm of most metazoan cells. In contrast to the other two systems, IFs are present in cells in two principally distinct cytoskeletal forms: (i) extended and free-running filament arrays in the cytoplasm that are integrated into the cytoskeleton by associated proteins of the plakin type; and (ii) a membrane- and chromatin-bound thin 'lamina' of a more or less regular network of interconnected filaments made from nuclear IF proteins, the lamins, which differ in several important structural aspects from cytoplasmic IF proteins. In man, more than 65 genes code for distinct IF proteins that are expressed during embryogenesis in various routes of differentiation in a tightly controlled manner. IF proteins exhibit rather limited sequence identity implying that the different types of IFs have distinct biochemical properties. Hence, to characterize the structural properties of the various IFs, in vitro assembly regimes have been developed in combination with different visualization methods such as transmission electron microscopy of fixed and negatively stained samples as well as methods that do not use staining such as scanning transmission electron microscopy (STEM) and cryoelectron microscopy as well as atomic force microscopy. Moreover, with the generation of both IF-type specific antibodies and chimeras of fluorescent proteins and IF proteins, it has become possible to investigate the subcellular organization of IFs by correlative fluorescence and electron microscopic methods. The combination of these powerful methods should help to further develop our understanding of nuclear architecture, in particular how nuclear subcompartments are organized and in which way lamins are involved.

An Inexpensive Source of High Voltage

Science.gov (United States)

Saraiva, Carlos

2012-01-01

As a physics teacher I like recycling old apparatus and using them for demonstrations in my classes. In physics laboratories in schools, sources of high voltage include induction coils or electronic systems that can be bought from companies that sell lab equipment. But these sources can be very expensive. In this article, I will explain how you…

Soft electromagnetic bremsstrahlung in inelastic hadronic collisions at high and intermediate energies

International Nuclear Information System (INIS)

Rueckl, R.

1978-01-01

Electromagnetic bremsstrahlung in hadronic collisions was studied extensively at low and intermediate energies. It was found that the infrared divergent term of the cross section describes the data well up to surprisingly large photon energies. Using essentially the same soft photon approximation, production of low mass-low energy electron pairs via internal conversion of soft virtual bremsstrahlung accompanying the production of charged hadrons in hadron-hadron collisions at very high and intermediate energies. The resulting electron yields explain, at least in part, the direct electrons with small transverse momenta seen at the ISR, and are in no contradiction to the rates observed at LAMPF

Development of a New Cascade Voltage-Doubler for Voltage Multiplication

OpenAIRE

Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

2014-01-01

For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

Three-dimensional fine structure of the organization of microtubules in neurite varicosities by ultra-high voltage electron microscope tomography.

Science.gov (United States)

Nishida, Tomoki; Yoshimura, Ryoichi; Endo, Yasuhisa

2017-09-01

Neurite varicosities are highly specialized compartments that are involved in neurotransmitter/ neuromodulator release and provide a physiological platform for neural functions. However, it remains unclear how microtubule organization contributes to the form of varicosity. Here, we examine the three-dimensional structure of microtubules in varicosities of a differentiated PC12 neural cell line using ultra-high voltage electron microscope tomography. Three-dimensional imaging showed that a part of the varicosities contained an accumulation of organelles that were separated from parallel microtubule arrays. Further detailed analysis using serial sections and whole-mount tomography revealed microtubules running in a spindle shape of swelling in some other types of varicosities. These electron tomographic results showed that the structural diversity and heterogeneity of microtubule organization supported the form of varicosities, suggesting that a different distribution pattern of microtubules in varicosities is crucial to the regulation of varicosities development.

Recent Progress in Piezoelectric Conversion and Energy Harvesting Using Nonlinear Electronic Interfaces and Issues in Small Scale Implementation

Directory of Open Access Journals (Sweden)

Daniel Guyomar

2011-06-01

Full Text Available This paper aims at providing an up-to-date review of nonlinear electronic interfaces for energy harvesting from mechanical vibrations using piezoelectric coupling. The basic principles and the direct application to energy harvesting of nonlinear treatment of the output voltage of the transducers for conversion enhancement will be recalled, and extensions of this approach presented. Latest advances in this field will be exposed, such as the use of intermediate energy tanks for decoupling or initial energy injection for conversion magnification. A comparative analysis of each of these techniques will be performed, highlighting the advantages and drawbacks of the methods, in terms of efficiency, performance under several excitation conditions, complexity of implementation and so on. Finally, a special focus of their implementation in the case of low voltage output transducers (as in the case of microsystems will be presented.

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Characteristics of a large vacuum wave precursor on the SABRE voltage adder MITL and extraction ion diode

International Nuclear Information System (INIS)

Cuneo, M.E.; Hanson, D.L.; Menge, P.R.; Poukey, J.W.; Savage, M.E.

1994-01-01

SABRE (Sandia Accelerator and Beam Research Experiment) is a ten-cavity linear induction magnetically insulated voltage adder (6 MV, 300 kA) operated in positive polarity to investigate issues relevant to ion beam production and propagation for inertial confinement fusion. The voltage adder section is coupled to an applied-B extraction ion diode via a long coaxial output transmission line. Observations indicate that the power propagates in a vacuum wave prior to electron emission. After the electron emission threshold is reached, power propagates in a magnetically insulated wave. The precursor is observed to have a dominant impact on he turn-on, impedance history, and beam characteristics of applied-B ion diodes since the precursor voltage is large enough to cause electron emission at the diode from both the cathode feed and cathode tips. The amplitude of the precursor at the load (3--4.5 MV) is a significant fraction of the maximum load voltage (5--6 MV) because (1) the transmission line gaps ( ∼ 9 cm at output) and therefore impedances are relatively large, and hence the electric field threshold for electron emission (200 to 300 kV/cm) is not reached until well into the power pulse rise time; and (2) the rapidly falling forward wave and diode impedance reduces the ratio of main pulse voltage to precursor voltage. Experimental voltage and current data from the transmission line and the ion diode will be presented and compared with TWOQUICK (2-D electromagnetic PIC code) simulations and analytic models

Generation of runaway electron beams in high-pressure nitrogen

Science.gov (United States)

Tarasenko, V. F.; Burachenko, A. G.; Baksht, E. Kh

2017-07-01

In this paper the results of experimental studies of the amplitude-temporal characteristics of a runaway electron beam, as well as breakdown voltage in nitrogen are presented. The voltage pulses with the amplitude in incident wave ≈120 kV and the rise time of ≈0.3 ns was used. The supershort avalanche electron beam (SAEB) was detected by a collector behind the flat anode. The amplitude-time characteristics of the voltage and SAEB current were studied with subnanosecond time resolution. The maximum pressure at which a SAEB is detectable by collector was ∼1 MPa. This pressure increases with decreasing the voltage rise time. The waveforms of the discharge and runaway electron beam currents was synchronized with the voltage pulses. The mechanism of the runaway electron generation in atmospheric-pressure gases is analyzed on the basis of the obtained experimental data.

Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

International Nuclear Information System (INIS)

Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M

2016-01-01

We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)

Thin-film intermediate band chalcopyrite solar cells

International Nuclear Information System (INIS)

Fuertes Marron, D.; Marti, A.; Luque, A.

2009-01-01

Chalcopyrite-based solar cells currently lead the efficiency tables of thin-film photovoltaic technologies. Further improvements are foreseen upon implementation of an intermediate band in the absorber layers. We present a theoretical analysis of the efficiency limit for this type of device as a function of factors such as the gap of the host, the relative position of the intermediate band with respect to the band edge and the level of light concentration used as illumination. We have also considered the impact of non-idealities on the performance of the device, particularly the effect of electronic losses related to non-radiative recombination

The MHD intermediate shock interaction with an intermediate wave: Are intermediate shocks physical?

International Nuclear Information System (INIS)

Wu, C.C.

1988-01-01

Contrary to the usual belief that MHD intermediate shocks are extraneous, the authors have recently shown by numerical solutions of dissipative MHD equations that intermediate shocks are admissible and can be formed through nonlinear steepening from a continuous wave. In this paper, he clarifies the differences between the conventional view and the results by studying the interaction of an MHD intermediate shock with an intermediate wave. The study reaffirms his results. In addition, the study shows that there exists a larger class of shocklike solutions in the time-dependent dissiaptive MHD equations than are given by the MHD Rankine-Hugoniot relations. it also suggests a mechanism for forming rotational discontinuities through the interaction of an intermediate shock with an intermediate wave. The results are of importance not only to the MHD shock theory but also to studies such as magnetic field reconnection models

Mitigation of Flicker using STATCOM with Three-Level 12-pulse Voltage Source Inverter

OpenAIRE

Ali Z a'fari

2011-01-01

Voltage flicker is a disturbance in electrical power systems. The reason for this disturbance is mainly the large nonlinear loads such as electric arc furnaces. Synchronous static compensator (STATCOM) is considered as a proper technique to mitigate the voltage flicker. Application of more suitable and precise power electronic converter leads to a more precise performance of the compensator. In this paper a three-level 12-pulse voltage source inverter (VSI) with a 12-term...

Electronic ripple indicator

Science.gov (United States)

Davidson, J. K.; Houck, W. H.

1971-01-01

Electronic circuit for monitoring excessive ripple voltage on dc power lines senses voltage variations from few millivolts to maximum of 10 volts rms. Instrument is used wherever power supply fluctuations might endanger system operations or damage equipment. Device is inexpensive and easily packaged in small chassis.

Solid State High Voltage Supply for EB and X-Ray Generators

Czech Academy of Sciences Publication Activity Database

Zobač, Martin; Vlček, Ivan

2009-01-01

Roč. 44, 5-6 (2009), s. 73-75 ISSN 0861-4717 R&D Projects: GA AV ČR KAN300100702 Institutional research plan: CEZ:AV0Z20650511 Keywords : high voltage supply * electron beam generator * x-ray generator Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

Supply system with microprocessor control for electron gun

International Nuclear Information System (INIS)

Duplin, N.I.; Sergeev, N.N.

1988-01-01

Precision supply system for electron gun used in Auger-spectrometer is described. The supply system consists of control and high-voltage parts, made as separate units. Supply high-voltage unit includes system supply module, filament module to supply electron gun cathode and 6 high-volt modules to supply accelerating, modulating and three focusing electrodes of the gun. High-voltage modules have the following characteristics: U-(100-1000)V output voltage, 5x10 -5 U stability, 10 -5 xU pulsation amplitude, J-(0-5)A filament current change range at 10 -4 xJ stability. Control unit including microprocessor, timer and storage devices forms control voltage for all modules and regulates voltage and current of filament at electrodes

About the contrast of δ' precipitates in bulk Al-Cu-Li alloys in reflection mode with a field-emission scanning electron microscope at low accelerating voltage.

Science.gov (United States)

Brodusch, Nicolas; Voisard, Frédéric; Gauvin, Raynald

2017-11-01

Characterising the impact of lithium additions in the precipitation sequence in Al-Li-Cu alloys is important to control the strengthening of the final material. Since now, transmission electron microscopy (TEM) at high beam voltage has been the technique of choice to monitor the size and spatial distribution of δ' precipitates (Al 3 Li). Here we report on the imaging of the δ' phase in such alloys using backscattered electrons (BSE) and low accelerating voltage in a high-resolution field-emission scanning electron microscope. By applying low-energy Ar + ion milling to the surface after mechanical polishing (MP), the MP-induced corroded layers were efficiently removed and permitted the δ's to be visible with a limited impact on the observed microstructure. The resulting BSE contrast between the δ's and the Al matrix was compared with that obtained using Monte Carlo modelling. The artefacts possibly resulting from the sample preparation procedure were reviewed and discussed and permitted to confirm that these precipitates were effectively the metastable δ's. The method described in this report necessitates less intensive sample preparation than that required for TEM and provides a much larger field of view and an easily interpretable contrast compared to the transmission techniques. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Evaluation of the Electronic Structure of Single-Molecule Junctions Based on Current-Voltage and Thermopower Measurements: Application to C60 Single-Molecule Junction.

Science.gov (United States)

Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

2017-02-16

The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Voltage-dependent gating in a "voltage sensor-less" ion channel.

Directory of Open Access Journals (Sweden)

Harley T Kurata

2010-02-01

Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

In situ scanning tunnelling microscopy of redox molecules. Coherent electron transfer at large bias voltages

DEFF Research Database (Denmark)

Zhang, Jingdong; Kuznetsov, A.M.; Ulstrup, Jens

2003-01-01

Theories of in situ scanning tunnelling microscopy (STM) of molecules with redox levels near the substrate and tip Fermi levels point to 'spectroscopic' current-overpotential features. Prominent features require a narrow 'probing tip', i.e. a small bias voltage, eV(bias), compared...... a broad tunnelling current-overpotential range at a constant (large) bias voltage of +0.2 V. The current is found to be constant over a 0.25 V overpotential range, which covers roughly the range where the oxidised and reduced redox levels are located within the energy tip. STM contrast and apparent...... of previous theoretical work on in situ STM of redox molecules, to large bias voltages, \\eV(bias)\\ > E-r. Large bias voltages give tunnelling contrasts independent of the overpotential over a broad range, as both the oxidised and reduced redox levels are located within the 'energy tip' between the substrate...

The magnetized electron-acoustic instability driven by a warm, field-aligned electron beam

International Nuclear Information System (INIS)

Sooklal, A.; Mace, R.L.

2004-01-01

The electron-acoustic instability in a magnetized plasma having three electron components, one of which is a field-aligned beam of intermediate temperature, is investigated. When the plasma frequency of the cool electrons exceeds the electron gyrofrequency, the electron-acoustic instability 'bifurcates' at sufficiently large propagation angles with respect to the magnetic field to yield an obliquely propagating, low-frequency electron-acoustic instability and a higher frequency cyclotron-sound instability. Each of these instabilities retains certain wave features of its progenitor, the quasiparallel electron-acoustic instability, but displays also new magnetic qualities through its dependence on the electron gyrofrequency. The obliquely propagating electron-acoustic instability requires a lower threshold beam speed for its excitation than does the cyclotron-sound instability, and for low to intermediate beam speeds has the higher maximum growth rate. When the plasma is sufficiently strongly magnetized that the plasma frequency of the cool electrons is less than the electron gyrofrequency, the only instability in the electron-acoustic frequency range is the strongly magnetized electron-acoustic instability. Its growth rate and real frequency exhibit a monotonic decrease with wave propagation angle and it grows at small to intermediate wave numbers where its parallel phase speed is approximately constant. The relevance of the results to the interpretation of cusp auroral hiss and auroral broadband electrostatic noise is briefly discussed

Ion plasma electron gun

International Nuclear Information System (INIS)

Wakalopulos, G.

1976-01-01

In the disclosed electron gun positive ions generated by a hollow cathode plasma discharge in a first chamber are accelerated through control and shield grids into a second chamber containing a high voltage cold cathode. These positive ions bombard a surface of the cathode causing the cathode to emit secondary electrons which form an electron beam having a distribution adjacent to the cathode emissive surface substantially the same as the distribution of the ion beam impinging upon the cathode. After passing through the grids and the plasma discharge chamber, the electron beam exits from the electron gun via a foil window. Control of the generated electron beam is achieved by applying a relatively low control voltage between the control grid and the electron gun housing (which resides at ground potential) to control the density of the positive ions bombarding the cathode

Transient voltage sharing in series-coupled high voltage switches

Directory of Open Access Journals (Sweden)

Editorial Office

1992-07-01

Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

Cluster Analysis of Time-Dependent Crystallographic Data: Direct Identification of Time-Independent Structural Intermediates

Science.gov (United States)

Kostov, Konstantin S.; Moffat, Keith

2011-01-01

The initial output of a time-resolved macromolecular crystallography experiment is a time-dependent series of difference electron density maps that displays the time-dependent changes in underlying structure as a reaction progresses. The goal is to interpret such data in terms of a small number of crystallographically refinable, time-independent structures, each associated with a reaction intermediate; to establish the pathways and rate coefficients by which these intermediates interconvert; and thereby to elucidate a chemical kinetic mechanism. One strategy toward achieving this goal is to use cluster analysis, a statistical method that groups objects based on their similarity. If the difference electron density at a particular voxel in the time-dependent difference electron density (TDED) maps is sensitive to the presence of one and only one intermediate, then its temporal evolution will exactly parallel the concentration profile of that intermediate with time. The rationale is therefore to cluster voxels with respect to the shapes of their TDEDs, so that each group or cluster of voxels corresponds to one structural intermediate. Clusters of voxels whose TDEDs reflect the presence of two or more specific intermediates can also be identified. From such groupings one can then infer the number of intermediates, obtain their time-independent difference density characteristics, and refine the structure of each intermediate. We review the principles of cluster analysis and clustering algorithms in a crystallographic context, and describe the application of the method to simulated and experimental time-resolved crystallographic data for the photocycle of photoactive yellow protein. PMID:21244840

Wearable electronics formed on intermediate layer on textiles

KAUST Repository

Hussain, Muhammad Mustafa

2017-01-01

One manner of producing more desirable clothing with electronic capabilities is to manufacture electronics, such as the charging wires or devices themselves, directly onto the textile materials. Textile materials generally do not support

Electron refrigeration in hybrid structures with spin-split superconductors

Science.gov (United States)

Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.

2018-01-01

Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.

Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics

Directory of Open Access Journals (Sweden)

Yuji Isshiki

2018-02-01

Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.

Electron beam effects in auger electron spectroscopy and scanning electron microscopy

International Nuclear Information System (INIS)

Fontaine, J.M.; Duraud, J.P.; Le Gressus, C.

1979-01-01

Electron beam effects on Si(100) and 5% Fe/Cr alloy samples have been studied by measurements of the secondary electron yield delta, determination of the surface composition by Auger electron spectroscopy and imaging with scanning electron microscopy. Variations of delta as a function of the accelerating voltage Esub(p) (0.5 -9 Torr has no effect on technological samples covered with their reaction layers; the sensitivities to the beam depend rather on the earlier mechanical, thermal and chemical treatment of the surfaces. (author)

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Estimation of visibility of phase contrast with extraction voltages for field emission gun electron microscopes

Energy Technology Data Exchange (ETDEWEB)

Meng, Xing, E-mail: xmeng101@gmail.com

2017-02-15

Estimation was made for visibility of phase contrast with varying extraction voltages. The resulting decay rates of visibility show that images with low image contrast from cryo EM will be seriously impacted with high extraction voltages. - Highlights: • Cryo EM • Phase contrast • Extraction votage.

Experimental validation of prototype high voltage bushing

Science.gov (United States)

Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.

2017-08-01

Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.

Mitigation of voltage sags in the distribution system with dynamic voltage restorer

International Nuclear Information System (INIS)

Viglas, D.; Belan, A.

2012-01-01

Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

Nonequilibrium segregation and phase instability in alloy films during elevated-temperature irradiation in a high-voltage electron microscope

Science.gov (United States)

Lam, N. Q.; Okamoto, P. R.

1984-05-01

The effects of defect-production rate gradients, caused by the radial nonuniformity in the electron flux distribution, on solute segregation and phase stability in alloy films undergoing high-voltage electron-microscope (HVEM) irradiation at high temperatures are assessed. Two-dimensional (axially symmetric) compositional redistributions were calculated, taking into account both axial and transverse radial defect fluxes. It was found that when highly focused beams were employed radiation-induced segregation consisted of two stages: dominant axial segregation at the film surfaces at short irradiation times and competitive radial segregation at longer times. The average alloy composition within the irradiated region could differ greatly from that irradiated with a uniform beam, because of the additional atom transport from or to the region surrounding the irradiated zone under the influence of radial fluxes. Damage-rate gradient effects must be taken into account when interpreting in-situ HVEM observations of segregation-induced phase instabilities. The theoretical predictions are compared with experimental observations of the temporal and spatial dependence of segregation-induced precipitation in thin films of Ni-Al, Ni-Ge and Ni-Si solid solutions.

Atomic and molecular physics, physicochemical properties of biologically important structure, and high-voltage research

International Nuclear Information System (INIS)

Christophorou, L.G.; Allen, J.D.; Anderson, V.E.

1976-01-01

Research in atomic and molecular physics is reported. Studies included: experimental evidence for the existence of a Ramsauer-Townsend minimum in liquid methane and liquid argon; discovery of a Ramsauer-Townsend minimum in gaseous ethane and propane; motion of thermal electrons in n-alkane vapors; electron mobilities in high pressure gases; electron capture and drift in liquid media; electron attachment to molecules in dense gases; attachment of slow electrons to hexafluorobenzene; fragmentation of atmospheric halocarbons under electron impact; negative ion resonances and threshold electron excitation spectra of organic molecules; theoretical studies of negative-ion resonance states of organic molecules; kinetics of electron capture by sulfur hexafluoride in solution; interactions of slow electrons with benzene and benzene derivatives; Stokes and anti-Stokes fluorescence of 1 : 12-benzoperylene in solution; photoionization of molecules in liquid media; construction of high-voltage breakdown apparatus for gaseous insulation studies; measurements of the breakdown strengths of gaseous insulators and their relation to basic electron-collision processes; accuracy of the breakdown voltage measurements; and assembling basic data on electronegative gases of significance to breakdown

Modeling, analysis, and design of stationary reference frame droop controlled parallel three-phase voltage source inverters

DEFF Research Database (Denmark)

Vasquez, Juan Carlos; Guerrero, Josep M.; Savaghebi, Mehdi

2013-01-01

Power electronics based MicroGrids consist of a number of voltage source inverters (VSIs) operating in parallel. In this paper, the modeling, control design, and stability analysis of parallel connected three-phase VSIs are derived. The proposed voltage and current inner control loops and the mat......Power electronics based MicroGrids consist of a number of voltage source inverters (VSIs) operating in parallel. In this paper, the modeling, control design, and stability analysis of parallel connected three-phase VSIs are derived. The proposed voltage and current inner control loops...... control restores the frequency and amplitude deviations produced by the primary control. Also, a synchronization algorithm is presented in order to connect the MicroGrid to the grid. Experimental results are provided to validate the performance and robustness of the parallel VSI system control...

Breakdown voltage reduction by field emission in multi-walled carbon nanotubes based ionization gas sensor

Energy Technology Data Exchange (ETDEWEB)

Saheed, M. Shuaib M.; Muti Mohamed, Norani; Arif Burhanudin, Zainal, E-mail: zainabh@petronas.com.my [Centre of Innovative Nanostructures and Nanodevices, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak (Malaysia)

2014-03-24

Ionization gas sensors using vertically aligned multi-wall carbon nanotubes (MWCNT) are demonstrated. The sharp tips of the nanotubes generate large non-uniform electric fields at relatively low applied voltage. The enhancement of the electric field results in field emission of electrons that dominates the breakdown mechanism in gas sensor with gap spacing below 14 μm. More than 90% reduction in breakdown voltage is observed for sensors with MWCNT and 7 μm gap spacing. Transition of breakdown mechanism, dominated by avalanche electrons to field emission electrons, as decreasing gap spacing is also observed and discussed.

Voltage Balance of Separate DC Capacitors for CSAPF

Czech Academy of Sciences Publication Activity Database

You, X.; Geng, W.; Valouch, Viktor

2005-01-01

Roč. 50, č. 1 (2005), s. 23-33 ISSN 0001-7043 R&D Projects: GA AV ČR(CZ) IAA2057301 Institutional research plan: CEZ:AV0Z20570509 Keywords : cascade shunt active filter * voltage balance * control strategy Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

Warfarin traps human vitamin K epoxide reductase in an intermediate state during electron transfer

Science.gov (United States)

Shen, Guomin; Cui, Weidong; Zhang, Hao; Zhou, Fengbo; Huang, Wei; Liu, Qian; Yang, Yihu; Li, Shuang; Bowman, Gregory R.; Sadler, J. Evan; Gross, Michael L.; Li, Weikai

2017-01-01

Although warfarin is the most widely used anticoagulant worldwide, the mechanism by which warfarin inhibits its target, human vitamin K epoxide reductase (hVKOR), remains unclear. Here we show that warfarin blocks a dynamic electron-transfer process in hVKOR. A major fraction of cellular hVKOR is at an intermediate redox state of this process containing a Cys51-Cys132 disulfide, a characteristic accommodated by a four-transmembrane-helix structure of hVKOR. Warfarin selectively inhibits this major cellular form of hVKOR, whereas disruption of the Cys51-Cys132 disulfide impairs warfarin binding and causes warfarin resistance. Relying on binding interactions identified by cysteine alkylation footprinting and mass spectrometry coupled with mutagenesis analysis, we are able to conduct structure simulations to reveal a closed warfarin-binding pocket stabilized by the Cys51-Cys132 linkage. Understanding the selective warfarin inhibition of a specific redox state of hVKOR should enable the rational design of drugs that exploit the redox chemistry and associated conformational changes in hVKOR. PMID:27918545

Enhancement of VUV emission from a coaxial xenon excimer ultraviolet lamp driven by distorted bipolar square voltages

Energy Technology Data Exchange (ETDEWEB)

Jou, S.Y.; Hung, C.T.; Chiu, Y.M.; Wu, J.S. [Department of Mechanical Engineering, National Chiao Tung University, Hsinchu (China); Wei, B.Y. [High-Efficiency Gas Discharge Lamps Group, Material and Chemical Research Laboratories, Hsinchu (China)

2011-12-15

Enhancement of vacuum UV emission (172 nm VUV) from a coaxial xenon excimer UV lamp (EUV) driven by distorted 50 kHz bipolar square voltages, as compared to that by sinusoidal voltages, is investigated numerically in this paper. A self-consistent radial one-dimensional fluid model, taking into consideration non-local electron energy balance, is employed to simulate the discharge physics and chemistry. The discharge is divided into two three-period portions; these include: the pre-discharge, the discharge (most intense at 172 nm VUV emission) and the post-discharge periods. The results show that the efficiency of VUV emission using the distorted bipolar square voltages is much greater than when using sinusoidal voltages; this is attributed to two major mechanisms. The first is the much larger rate of change of the voltage in bipolar square voltages, in which only the electrons can efficiently absorb the power in a very short period of time. Energetic electrons then generate a higher concentration of metastable (and also excited dimer) xenon that is distributed more uniformly across the gap, for a longer period of time during the discharge process. The second is the comparably smaller amount of ''wasted'' power deposition by Xe{sup +}{sub 2} in the post-discharge period, as driven by distorted bipolar square voltages, because of the nearly vanishing gap voltage caused by the shielding effect resulting from accumulated charges on both dielectric surfaces (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Voltage regulating circuit

NARCIS (Netherlands)

2005-01-01

A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

Parallel operation of voltage-source converters: issues and applications

Energy Technology Data Exchange (ETDEWEB)

Almeida, F.C.B.; Silva, D.S. [Federal University of Juiz de Fora (UFJF), MG (Brazil)], Emails: felipe.brum@engenharia.ufjf.br, salomaoime@yahoo.com.br; Ribeiro, P.F. [Calvin College, Grand Rapids, MI (United States); Federal University of Juiz de Fora (UFJF), MG (Brazil)], E-mail: pfribeiro@ieee.org

2009-07-01

Technological advancements in power electronics have prompted the development of advanced AC/DC conversion systems with high efficiency and flexible performance. Among these devices, the Voltage-Source Converter (VSC) has become an essential building block. This paper considers the parallel operation of VSCs under different system conditions and how they can assist the operation of highly complex power networks. A multi-terminal VSC-based High Voltage Direct Current (M-VSC-HVDC) system is chosen to be modeled, simulated and then analyzed as an example of VSCs operating in parallel. (author)

High voltage switch triggered by a laser-photocathode subsystem

Science.gov (United States)

Chen, Ping; Lundquist, Martin L.; Yu, David U. L.

2013-01-08

A spark gap switch for controlling the output of a high voltage pulse from a high voltage source, for example, a capacitor bank or a pulse forming network, to an external load such as a high gradient electron gun, laser, pulsed power accelerator or wide band radar. The combination of a UV laser and a high vacuum quartz cell, in which a photocathode and an anode are installed, is utilized as triggering devices to switch the spark gap from a non-conducting state to a conducting state with low delay and low jitter.

Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories

Energy Technology Data Exchange (ETDEWEB)

Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)

2016-07-11

High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.

Impacts on the Voltage Profile of DC Distribution Network with DG Access

Science.gov (United States)

Tu, J. J.; Yin, Z. D.

2017-07-01

With the development of electronic, more and more distributed generations (DGs) access into grid and cause the research fever of direct current (DC) distribution network. Considering distributed generation (DG) location and capacity have great impacts on voltage profile, so use IEEE9 and IEEE33 typical circuit as examples, with DGs access in centralized and decentralized mode, to compare voltage profile in alternating and direct current (AC/DC) distribution network. Introducing the voltage change ratio as an evaluation index, so gets the general results on voltage profile of DC distributed network with DG access. Simulation shows that, in the premise of reasonable location and capacity, DC distribution network is more suitable for DG access.

Contribution to high voltage matrix switches reliability

International Nuclear Information System (INIS)

Lausenaz, Yvan

2000-01-01

Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr

High-voltage pixel sensors for ATLAS upgrade

Energy Technology Data Exchange (ETDEWEB)

Perić, I., E-mail: ivan.peric@ziti.uni-heidelberg.de [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Kreidl, C.; Fischer, P. [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Bompard, F.; Breugnon, P.; Clemens, J.-C.; Fougeron, D.; Liu, J.; Pangaud, P.; Rozanov, A.; Barbero, M. [CPPM, Marseille (France); Feigl, S.; Capeans, M.; Ferrere, D.; Pernegger, H.; Ristic, B. [CERN, Geneve (Switzerland); Muenstermann, D.; Gonzalez Sevilla, S.; La Rosa, A.; Miucci, A. [University of Geneve (Switzerland); and others

2014-11-21

The high-voltage (HV-) CMOS pixel sensors offer several good properties: a fast charge collection by drift, the possibility to implement relatively complex CMOS in-pixel electronics and the compatibility with commercial processes. The sensor element is a deep n-well diode in a p-type substrate. The n-well contains CMOS pixel electronics. The main charge collection mechanism is drift in a shallow, high field region, which leads to a fast charge collection and a high radiation tolerance. We are currently evaluating the use of the high-voltage detectors implemented in 180 nm HV-CMOS technology for the high-luminosity ATLAS upgrade. Our approach is replacing the existing pixel and strip sensors with the CMOS sensors while keeping the presently used readout ASICs. By intelligence we mean the ability of the sensor to recognize a particle hit and generate the address information. In this way we could benefit from the advantages of the HV sensor technology such as lower cost, lower mass, lower operating voltage, smaller pitch, smaller clusters at high incidence angles. Additionally we expect to achieve a radiation hardness necessary for ATLAS upgrade. In order to test the concept, we have designed two HV-CMOS prototypes that can be readout in two ways: using pixel and strip readout chips. In the case of the pixel readout, the connection between HV-CMOS sensor and the readout ASIC can be established capacitively.

Electron microscopy of boron carbide before and after electron irradiation

International Nuclear Information System (INIS)

Stoto, T.; Zuppiroli, L.; Beauvy, M.; Athanassiadis, T.

1984-06-01

The microstructure of boron carbide has been studied by electron microscopy and related to the composition of the material. After electron irradiations in an usual transmission electron microscope and in a high voltage electron microscope at different temperatures and fluxes no change of these microstructures have been observed but a sputtering of the surface of the samples, which has been studied quantitatively [fr

Intermediate Bandgap Solar Cells From Nanostructured Silicon

Energy Technology Data Exchange (ETDEWEB)

Black, Marcie [Bandgap Engineering, Lincoln, MA (United States)

2014-10-30

This project aimed to demonstrate increased electronic coupling in silicon nanostructures relative to bulk silicon for the purpose of making high efficiency intermediate bandgap solar cells using silicon. To this end, we formed nanowires with controlled crystallographic orientation, small diameter, <111> sidewall faceting, and passivated surfaces to modify the electronic band structure in silicon by breaking down the symmetry of the crystal lattice. We grew and tested these silicon nanowires with <110>-growth axes, which is an orientation that should produce the coupling enhancement.

System for high-voltage control detectors with large number photomultipliers

International Nuclear Information System (INIS)

Donskov, S.V.; Kachanov, V.A.; Mikhajlov, Yu.V.

1985-01-01

A simple and inexpensive on-line system for hihg-voltage control which is designed for detectors with a large number of photomultipliers is developed and manufactured. It has been developed for the GAMC type hodoscopic electromagnetic calorimeters, comprising up to 4 thousand photomultipliers. High voltage variation is performed by a high-speed potentiometer which is rotated by a microengine. Block-diagrams of computer control electronics are presented. The high-voltage control system has been used for five years in the IHEP and CERN accelerator experiments. The operation experience has shown that it is quite simple and convenient in operation. In case of about 6 thousand controlled channels in both experiments no potentiometer and microengines failures were observed

PLL strategies of grid connected converters under distorted input voltages

Czech Academy of Sciences Publication Activity Database

Šimek, Petr; Škramlík, Jiří; Valouch, Viktor

2014-01-01

Roč. 59, č. 1 (2014), s. 1-12 ISSN 0001-7043 Institutional support: RVO:61388998 Keywords : voltage source converter * grid - connected applications * phase locked loop Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

DC-Link Voltage Coordinated-Proportional Control for Cascaded Converter With Zero Steady-State Error and Reduced System Type

DEFF Research Database (Denmark)

Tian, Yanjun; Loh, Poh Chiang; Deng, Fujin

2016-01-01

Cascaded converter is formed by connecting two subconverters together, sharing a common intermediate dc-link voltage. Regulation of this dc-link voltage is frequently realized with a proportional-integral (PI) controller, whose high gain at dc helps to force a zero steady-state tracking error....... The proposed scheme can be used with either unidirectional or bidirectional power flow, and has been verified by simulation and experimental results presented in this paper........ Such precise tracking is, however, at the expense of increasing the system type, caused by the extra pole at the origin introduced by the PI controller. The overall system may, hence, be tougher to control. To reduce the system type while preserving precise dc-link voltage tracking, this paper proposes...

Induced over voltage test on transformers using enhanced Z-source inverter based circuit

Science.gov (United States)

Peter, Geno; Sherine, Anli

2017-09-01

The normal life of a transformer is well above 25 years. The economical operation of the distribution system has its roots in the equipments being used. The economy being such, that it is financially advantageous to replace transformers with more than 15 years of service in the second perennial market. Testing of transformer is required, as its an indication of the extent to which a transformer can comply with the customers specified requirements and the respective standards (IEC 60076-3). In this paper, induced over voltage testing on transformers using enhanced Z source inverter is discussed. Power electronic circuits are now essential for a whole array of industrial electronic products. The bulky motor generator set, which is used to generate the required frequency to conduct the induced over voltage testing of transformers is nowadays replaced by static frequency converter. First conventional Z-source inverter, and second an enhanced Z source inverter is being used to generate the required voltage and frequency to test the transformer for induced over voltage test, and its characteristics is analysed.

Research on lightning stroke model and characteristics of electronic transformer

Directory of Open Access Journals (Sweden)

Li Mu

2018-01-01

Full Text Available In order to improve the reliability of power supply, a large number of electronic voltage and current transformers are used in digital substations. In this paper, the mathematical model of the electronic transformer is analyzed firstly, and its circuit model is given. According to the difference of working characteristics between voltage transformer and current transformer, the circuit model of voltage type electronic transformer and current type electronic transformer is given respectively. By analyzing their broadband transmission characteristics, the accuracy of the model is verified, and their lightning analysis models are obtained.

Module Five: Relationships of Current, Voltage, and Resistance; Basic Electricity and Electronics Individualized Learning System.

Science.gov (United States)

Bureau of Naval Personnel, Washington, DC.

This module covers the relationships between current and voltage; resistance in a series circuit; how to determine the values of current, voltage, resistance, and power in resistive series circuits; the effects of source internal resistance; and an introduction to the troubleshooting of series circuits. This module is divided into five lessons:…

Experimental observations of electron-backscatter effects from high-atomic-number anodes in large-aspect-ratio, electron-beam diodes

Energy Technology Data Exchange (ETDEWEB)

Cooperstein, G; Mosher, D; Stephanakis, S J; Weber, B V; Young, F C [Naval Research Laboratory, Washington, DC (United States); Swanekamp, S B [JAYCOR, Vienna, VA (United States)

1997-12-31

Backscattered electrons from anodes with high-atomic-number substrates cause early-time anode-plasma formation from the surface layer leading to faster, more intense electron beam pinching, and lower diode impedance. A simple derivation of Child-Langmuir current from a thin hollow cathode shows the same dependence on the diode aspect ratio as critical current. Using this fact, it is shown that the diode voltage and current follow relativistic Child-Langmuir theory until the anode plasma is formed, and then follows critical current after the beam pinches. With thin hollow cathodes, electron beam pinching can be suppressed at low voltages (< 800 kV) even for high currents and high-atomic-number anodes. Electron beam pinching can also be suppressed at high voltages for low-atomic-number anodes as long as the electron current densities remain below the plasma turn-on threshold. (author). 8 figs., 2 refs.

Military Curricula for Vocational & Technical Education. Basic Electricity and Electronics Individualized Learning System. CANTRAC A-100-0010. Module Five: Relationships of Current, Voltage, and Resistance. Study Booklet.

Science.gov (United States)

Chief of Naval Education and Training Support, Pensacola, FL.

This individualized learning module on the relationships of current, voltage, and resistance is one in a series of modules for a course in basic electricity and electronics. The course is one of a number of military-developed curriculum packages selected for adaptaticn to vocational instructional and curriculum development in a civilian setting.…

Analysis of the current-voltage characteristics lineshapes of resonant tunneling diodes

International Nuclear Information System (INIS)

Rivera, P.H.; Schulz, P.A.

1996-01-01

It is discussed the influence of a two dimensional electron gas at the emitter-barrier interface on the current-voltage characteristics of a Ga As-Al Ga As double-barrier quantum well resonant tunneling diode. This effect is characterized by the modification of the space charge distribution along the structure. Within the framework of a self-consistent calculation we analyse the current-voltage characteristics of the tunneling diodes. This analysis permits us to infer different tunneling ways, related to the formation of confined states in the emitter region, and their signatures in the current-voltage characteristics. We show that varying the spacer layer, together with barrier heights, changes drastically the current density-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics reported in the literature. The general trend of experimental lineshapes can be reproduced and interpreted with our model. The possibility of tunneling paths is predicted for a range that has not yet been explored experimentally. (author). 12 refs., 4 figs

Electronic excitation of Na atom by electron impact

International Nuclear Information System (INIS)

Bielschowsky, C.E.; Souza, G.G.B. de; Lucas, C.A.; Nogueira, J.C.

1988-01-01

Electronic excitation of the 3s-3p transition in the Na atom was studied by intermediate energy electron impact spectroscopy. Differential Cross Sections (DCS) and Generalized Oscillator Strenghts (GOS) were determined experimentally for 1 KeV electrons. Theoretical results within the First Born Approximation as well as Glauber theory, were also performed. (A.C.A.S.) [pt

Generator voltage stabilisation for series-hybrid electric vehicles.

Science.gov (United States)

Stewart, P; Gladwin, D; Stewart, J; Cowley, R

2008-04-01

This paper presents a controller for use in speed control of an internal combustion engine for series-hybrid electric vehicle applications. Particular reference is made to the stability of the rectified DC link voltage under load disturbance. In the system under consideration, the primary power source is a four-cylinder normally aspirated gasoline internal combustion engine, which is mechanically coupled to a three-phase permanent magnet AC generator. The generated AC voltage is subsequently rectified to supply a lead-acid battery, and permanent magnet traction motors via three-phase full bridge power electronic inverters. Two complementary performance objectives exist. Firstly to maintain the internal combustion engine at its optimal operating point, and secondly to supply a stable 42 V supply to the traction drive inverters. Achievement of these goals minimises the transient energy storage requirements at the DC link, with a consequent reduction in both weight and cost. These objectives imply constant velocity operation of the internal combustion engine under external load disturbances and changes in both operating conditions and vehicle speed set-points. An electronically operated throttle allows closed loop engine velocity control. System time delays and nonlinearities render closed loop control design extremely problematic. A model-based controller is designed and shown to be effective in controlling the DC link voltage, resulting in the well-conditioned operation of the hybrid vehicle.

A digital controlled negative high voltage power source for LINAC of HLS

International Nuclear Information System (INIS)

Gao Hui; Chen Jun; Hong Jun; Wang Weibing

2005-01-01

This paper introduces the working principle of a 10-80 kV negative high voltage power source for the electronic gun of the 200 MeV LINAC of NSRL, especially how to realize the switch power, voltage/current sampling, feedback control and microcontroller module. The firmware design for the SOC microcontroller of ADuC8xx and the application software design for PC are also presented. (authors)

PHERMEX electron gun development

International Nuclear Information System (INIS)

Builta, L.A.; Elliott, J.C.; Moir, D.C.; Starke, T.P.; Vecere, C.A.

1983-01-01

The PHERMEX facility is a 50-MHz standing-wave linear accelerator. Electrons are injected, accelerated, and transported to a tungsten target where bremsstrahlung x rays are generated for flash radiography of hydrodynamic systems. The purpose of this article is to describe the progress of PHERMEX electron gun development. The goal of this program is to generate and transport a 200-ns, 1-MV, 1-kA electron beam into the first PHERMEX accelerating cavity. The standard gun is operated at a pulse voltage of 550 kV, which is the limit determined by internal breakdown of the vacuum insulator. This insulator has been redesigned, and the gun has been pulsed at 750 kV without internal breakdown. At present, the current output is not limited by voltage but by a phenomenon called pulse shortening, which occurs at a pulse voltage of approximately 650 kV. The phenomenon has been investigated and the results are presented

Some device implications of voltage controlled magnetic anisotropy in Co/Gd2O3 thin films through REDOX chemistry

Science.gov (United States)

Hao, Guanhua; Noviasky, Nicholas; Cao, Shi; Sabirianov, Ildar; Yin, Yuewei; Ilie, Carolina C.; Kirianov, Eugene; Sharma, Nishtha; Sokolov, Andrei; Marshall, Andrew; Xu, Xiaoshan; Dowben, Peter A.

2018-04-01

The effect of intermediate interfacial oxidation on the in-plane magnetization of multilayer stack Pt/Co/Gd2O3, on a p-type silicon substrate, has been investigated by magneto-optical Kerr effect (MOKE) measurements, the anomalous Hall effect, and magnetoresistance measurements. While voltage controlled perpendicular magnetic anisotropy of a metal/oxide heterostructure is known, this heterostructure displays an inverse relationship between voltage and coercivity. The anomalous Hall effect demonstrates a significant change in hysteresis, with the applied bias sign. There is a higher perpendicular magnetic anisotropy with positive bias exposure.

Development techniques and electron optical studies of high voltage, high current electron guns

International Nuclear Information System (INIS)

Rangarajan, L.M.; Mahadevan, S.; Ramamurthi, S.S.

1992-01-01

The progress of the electron gun design, limiting to axially symmetric geometries is discussed here with a view to utilise such guns for electron accelerators. The mechanical design features leading to the physical configuration of the gun with stringent tolerances are outlined. Vacuum processing is done at pressures of 1.3x10 -5 Pa. The gun employs W-filament emitter or a cathode pellet with bombarder service. A water cooled compact faraday cup is used to measure the electron current. Electron gun geometries have been studied using the computer programme. The preveance of the gun is 0.7x10 -7 A/Vsup(1.5) at 80 kV. Developmental techniques of such pulsed electron guns are described. (author). 7 refs., 5 figs

Simulation and resolution of voltage reversal in microbial fuel cell stack.

Science.gov (United States)

Sugnaux, Marc; Savy, Cyrille; Cachelin, Christian Pierre; Hugenin, Gérald; Fischer, Fabian

2017-08-01

To understand the biotic and non-biotic contributions of voltage reversals in microbial fuel cell stacks (MFC) they were simulated with an electronic MFC-Stack mimic. The simulation was then compared with results from a real 3L triple MFC-Stack with shared anolyte. It showed that voltage reversals originate from the variability of biofilms, but also the external load plays a role. When similar biofilm properties were created on all anodes the likelihood of voltage reversals was largely reduced. Homogenous biofilms on all anodes were created by electrical circuit alternation and electrostimulation. Conversely, anolyte recirculation, or increased nutriment supply, postponed reversals and unfavourable voltage asymmetries on anodes persisted. In conclusion, voltage reversals are often a negative event but occur also in close to best MFC-Stack performance. They were manageable and this with a simplified MFC architecture in which multiple anodes share the same anolyte. Copyright © 2017 Elsevier Ltd. All rights reserved.

About the structure of quantum intermediate state of superconductors

International Nuclear Information System (INIS)

Ledenev, O.P.

2008-01-01

The calculation of spatial structure of a quantum intermediate state in Type I superconductors is completed. Theoretical model of thermodynamics of considered state was proposed by Andreev. It is shown, that in a quantum case, the period of structure appears significantly smaller and has different dependence on both the magnetic field and temperature than in the classical intermediate Landau state. The decrease of thickness of normal layers results in increase of characteristic distance between the quantum Andreev levels of electronic excitations, and the transition to the quantum intermediate from classical state is realized at higher temperatures ∼1 K, than it was supposed in previous works. The comparison of calculation data with experimental results, for example using the sample of mono-crystal gallium, is conducted

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

High-voltage variable-duration pulse generator

International Nuclear Information System (INIS)

Anisimova, T.E.; Akkuratov, E.V.; Gromovenko, V.M.; Nikonov, Yu.P.; Malinin, A.N.

1988-01-01

A high-voltage generator is described that allows pulse duration tau to be varied within wide limits and has high efficiency (at least 50% for tau = 0.5 tau/sub max/) and an amplitude of up to 5 kV, a repetition frequency of up to 200 Hz,and a variable duration of 0-30 μsec. The generator is used in the controller of an electron accelerator

Partially filled intermediate band of Cr-doped GaN films

International Nuclear Information System (INIS)

Sonoda, S.

2012-01-01

We investigated the band structure of sputtered Cr-doped GaN (GaCrN) films using optical absorption, photoelectron yield spectroscopy, and charge transport measurements. It was found that an additional energy band is formed in the intrinsic band gap of GaN upon Cr doping, and that charge carriers in the material move in the inserted band. Prototype solar cells showed enhanced short circuit current and open circuit voltage in the n-GaN/GaCrN/p-GaN structure compared to the GaCrN/p-GaN structure, which validates the proposed concept of an intermediate-band solar cell.

Studies on the radicidation of natural food colorants. Effects of electron energy (accelerating voltages) and dose rate of ionizing radiation on functional properties of beet red colorant

International Nuclear Information System (INIS)

Higashimura, Yutaka; Tada, Mikiro; Furuta, Masakazu

2003-01-01

In order to the practical use of radicidation of beet red, natural food colorant with low heat stability and high possibility of microbe contamination, we studied on the energy dependency and dose rate effect for the influence on functional properties of the beet red colorant. For the elucidation of energy dependency, the γ-ray (1.33 MeV) and electron beams with different accelerating voltages (0.75, 1, 2.5, 5 and 10 MeV) were used. The dose rate effect was studied under the different dose rate by using γ-ray (0.723, 1.91 and 4.55 kGy/h) and electron beams with accelerating voltage of 10 MeV (1.0 x 10 3 , 2.6 x 10 3 , 7.0 x 10 3 , 7.0 x 10 3 , 2.0 x 10 4 and 5.0 x 10 4 kGy/h). The results obtained in this study showed that regardless of these energy and dose rate, the functional properties of the beet red colorant were little affected by irradiation less than 25 kGy of ionizing radiations. (author)

Trap Healing for High-Performance Low-Voltage Polymer Transistors and Solution-Based Analog Amplifiers on Foil.

Science.gov (United States)

Pecunia, Vincenzo; Nikolka, Mark; Sou, Antony; Nasrallah, Iyad; Amin, Atefeh Y; McCulloch, Iain; Sirringhaus, Henning

2017-06-01

Solution-processed semiconductors such as conjugated polymers have great potential in large-area electronics. While extremely appealing due to their low-temperature and high-throughput deposition methods, their integration in high-performance circuits has been difficult. An important remaining challenge is the achievement of low-voltage circuit operation. The present study focuses on state-of-the-art polymer thin-film transistors based on poly(indacenodithiophene-benzothiadiazole) and shows that the general paradigm for low-voltage operation via an enhanced gate-to-channel capacitive coupling is unable to deliver high-performance device behavior. The order-of-magnitude longitudinal-field reduction demanded by low-voltage operation plays a fundamental role, enabling bulk trapping and leading to compromised contact properties. A trap-reduction technique based on small molecule additives, however, is capable of overcoming this effect, allowing low-voltage high-mobility operation. This approach is readily applicable to low-voltage circuit integration, as this work exemplifies by demonstrating high-performance analog differential amplifiers operating at a battery-compatible power supply voltage of 5 V with power dissipation of 11 µW, and attaining a voltage gain above 60 dB at a power supply voltage below 8 V. These findings constitute an important milestone in realizing low-voltage polymer transistors for solution-based analog electronics that meets performance and power-dissipation requirements for a range of battery-powered smart-sensing applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stray voltage mitigation

Energy Technology Data Exchange (ETDEWEB)

Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

2008-04-09

This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

Development of a high power free-electron laser

Energy Technology Data Exchange (ETDEWEB)

Lee, Jong Min; Lee, Byung Chul; Kim, Sun Kook; Jung, Yung Wook; Cho, Sung Oh [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1995-01-01

A millimeter-wave free electron laser (FEL) driven by a recirculating electrostatic accelerator has been developed. The wavelength of the FEL is tunable in the range of 3 - 12 mm by tuning the energy of the electron beam. The output power is estimated to be 1 kW. The electrostatic accelerator is composed of high-current electron gun, acceleration tube, high-voltage generator, high-voltage terminal, deceleration tube, electron collator, and vacuum pumps. Two types of LaB{sub 6}-based thermionic electron guns (triode gun and diode gun) and their power supplies have been developed. The voltage of the guns is 30 kV and the output current is - 2 A. A beam-focusing planar undulator and a permanent-magnet helical undulator have been developed and 3D trajectories of electron beam in the undulators have been calculated to find optimal input condition of electron beam. 135 figs, 15 pix, 17 tabs, 98 refs. (Author).

Development of a high power free-electron laser

International Nuclear Information System (INIS)

Lee, Jong Min; Lee, Byung Chul; Kim, Sun Kook; Jung, Yung Wook; Cho, Sung Oh

1995-01-01

A millimeter-wave free electron laser (FEL) driven by a recirculating electrostatic accelerator has been developed. The wavelength of the FEL is tunable in the range of 3 - 12 mm by tuning the energy of the electron beam. The output power is estimated to be 1 kW. The electrostatic accelerator is composed of high-current electron gun, acceleration tube, high-voltage generator, high-voltage terminal, deceleration tube, electron collator, and vacuum pumps. Two types of LaB 6 -based thermionic electron guns (triode gun and diode gun) and their power supplies have been developed. The voltage of the guns is 30 kV and the output current is - 2 A. A beam-focusing planar undulator and a permanent-magnet helical undulator have been developed and 3D trajectories of electron beam in the undulators have been calculated to find optimal input condition of electron beam. 135 figs, 15 pix, 17 tabs, 98 refs. (Author)

Ferroelasticity of t'-zirconia. 1: High-voltage electron microscopy studies of the microstructure in polydomain tetragonal zirconia

International Nuclear Information System (INIS)

Baither, D.; Baufeld, B.; Messerschmidt, U.; Foitzik, A.H.; Ruehle, M.

1997-01-01

The microstructure of polydomain tetragonal zirconia (t'-ZrO 2 ), i.e., a ZrO 2 modification exhibiting ferroelastic behavior, is studied by high-voltage electron microscopy. This material consists of three domain variants of the tetragonal phase with their c-axes nearly orthogonal to each other. Always two variants of these platelike domains are alternately arranged, forming elongated regular colonies. Hence, in both variants the common habit plane of the domains is a {110} twin plane. The colonies are of columnar shape with a longitudinal axis. They are bound by {110} planes, too, which are twin planes for the domains in the contiguous colonies. Owing to their particular structure and the helical arrangement of the adjoining colonies, the material remains coherent and pseudocubic over large macroscopic regions, although it is formed by different tetragonal domains

Current—voltage characteristics of lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composites

International Nuclear Information System (INIS)

De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.

2010-01-01

Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Reactive intermediates in the gas phase generation and monitoring

CERN Document Server

Setser, D W

2013-01-01

Reactive Intermediates in the Gas Phase: Generation and Monitoring covers methods for reactive intermediates in the gas phase. The book discusses the generation and measurement of atom and radical concentrations in flow systems; the high temperature flow tubes, generation and measurement of refractory species; and the electronically excited long-lived states of atoms and diatomic molecules in flow systems. The text also describes the production and detection of reactive species with lasers in static systems; the production of small positive ions in a mass spectrometer; and the discharge-excite

Current–voltage characteristics of high-voltage 4H-SiC p{sup +}–n{sub 0}–n{sup +} diodes in the avalanche breakdown mode

Energy Technology Data Exchange (ETDEWEB)

Ivanov, P. A., E-mail: Pavel.Ivanov@mail.ioffe.ru; Potapov, A. S.; Samsonova, T. P.; Grekhov, I. V. [Ioffe Physical–Technical Institute (Russian Federation)

2017-03-15

p{sup +}–n{sub 0}–n{sup +} 4H-SiC diodes with homogeneous avalanche breakdown at 1860 V are fabricated. The pulse current–voltage characteristics are measured in the avalanche-breakdown mode up to a current density of 4000 A/cm{sup 2}. It is shown that the avalanche-breakdown voltage increases with increasing temperature. The following diode parameters are determined: the avalanche resistance (8.6 × 10{sup –2} Ω cm{sup 2}), the electron drift velocity in the n{sub 0} base at electric fields higher than 10{sup 6} V/cm (7.8 × 10{sup 6} cm/s), and the relative temperature coefficient of the breakdown voltage (2.1 × 10{sup –4} K{sup –1}).

High voltage fast switches for nuclear applications

International Nuclear Information System (INIS)

Chatroux, D.; Lausenaz, Y.; Villard, J.F.; Lafore, D.

1999-01-01

SILVA process consists in a selective ionization of the 235 uranium isotope, using laser beams generated by dye lasers pumped by copper vapour laser (C.V.L.). SILVA involves power electronic for 3 power supplies: - copper vapour laser power supply, - extraction power supply to generate the electric field in the vapour, and - electron beam power supply for vapour generation. This article reviews the main switches that are proposed on the market or are on development and that could be used in SILVA power supplies. The SILVA technical requirements are: high power, high voltage and very short pulses (200 ns width). (A.C.)

Matrix elements of intraband transitions in quantum dot intermediate band solar cells: the influence of quantum dot presence on the extended-state electron wave-functions

International Nuclear Information System (INIS)

Nozawa, Tomohiro; Arakawa, Yasuhiko

2014-01-01

The intraband transitions which are essential for quantum dot intermediate band solar cells (QD IBSCs) are theoretically investigated by estimating the matrix elements from a ground bound state, which is often regarded as an intermediate band (IB), to conduction band (CB) states for a structure with a quantum dot (QD) embedded in a matrix (a QD/matrix structure). We have found that the QD pushes away the electron envelope functions (probability densities) from the QD region in almost all quantum states above the matrix CB minimum. As a result, the matrix elements of the intraband transitions in the QD/matrix structure are largely reduced, compared to those calculated assuming the envelope functions of free electrons (i.e., plane-wave envelope functions) in a matrix structure as the final states of the intraband transitions. The result indicates the strong influence of the QD itself on the intraband transitions from the IB to the CB states in QD IBSC devices. This work will help in better understanding the problem of the intraband transitions and give new insight, that is, engineering of quantum states is indispensable for the realization of QD IBSCs with high solar energy conversion efficiencies. (paper)

Optimal Operation of Distribution Electronic Power Transformer Using Linear Quadratic Regulator Method

Directory of Open Access Journals (Sweden)

Mohammad Hosein Rezaei

2011-10-01

Full Text Available Transformers perform many functions such as voltage transformation, isolation and noise decoupling. They are indispensable components in electric power distribution system. However, at low frequencies (50 Hz, they are one of the heaviest and the most expensive equipment in an electrical distribution system. Nowadays, electronic power transformers are used instead of conventional power transformers that do voltage transformation and power delivery in power system by power electronic converter. In this paper, the structure of distribution electronic power transformer (DEPT are analized and then paid attention on the design of a linear-quadratic-regulator (LQR with integral action to improve dynamic performance of DEPT with voltage unbalance, voltage sags, voltage harmonics and voltage flicker. The presentation control strategy is simulated by MATLAB/SIMULINK. In addition, the results that are in terms of dc-link reference voltage, input and output voltages clearly show that a better dynamic performance can be achieved by using the LQR method when compared to other techniques.

Active control of flying capacitor currents in multilevel voltage-source inverters

Czech Academy of Sciences Publication Activity Database

Kokeš, Petr; Semerád, Radko

2013-01-01

Roč. 58, č. 4 (2013), s. 393-410 ISSN 0001-7043 Institutional support: RVO:61388998 Keywords : voltage source inverter (VSI) * multilevel inverter * flying capacitor Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

Directory of Open Access Journals (Sweden)

Perić Dragoslav M.

2015-01-01

Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

Charge-pump voltage converter

Science.gov (United States)

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

Development of Electromechanical Architectures for AC Voltage Metrology

Directory of Open Access Journals (Sweden)

Alexandre BOUNOUH

2010-12-01

Full Text Available This paper presents results of work undertaken for exploring MEMS capabilities to fabricate AC voltage references for electrical metrology and high precision instrumentation through the mechanical-electrical coupling in MEMS. From first MEMS test structures previously realized, a second set of devices with improved characteristics has been developed and fabricated with Silicon on Insulator (SOI Surface Micromachining process. These MEMS exhibit pull-in voltages of 5 V and 10 V to match with the best performance of the read-out electronics developed for driving the MEMS. Deep Level Transient Spectroscopy measurements carried out on the new design show resonance frequencies of about only some kHz, and the stability of the MEMS output voltage measured at 100 kHz has been found very promising for the best samples where the relative deviation from the mean value over almost 12 hours showed a standard deviation of about 6.3 ppm.

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Dragon-I injector based on the induction voltage adder technique

Directory of Open Access Journals (Sweden)

Zhang Kaizhi

2006-08-01

Full Text Available The Dragon-I injector based on the induction voltage adder technique is introduced. Twelve ferrite loaded induction cells are connected in a series through central conducting stalks to achieve a pulsed voltage higher than 3.5 MV across the diode. Electrons are extracted from the velvet emitter and guided through the anode pipe by the magnets placed inside the cathode and anode shrouds. Measurements at the exit of injector show that, with an electric field of 200  kV/cm near the velvet surface and suitable magnetic field distribution, an electron beam up to 2.8 kA can be obtained with a normalized emittance of 1040π   mm mrad, and energy spread of 2.1% (3σ around the central energy of 3.5 MeV.

Nonequilibrium segregation and phase instability in alloy films during elevated-temperature irradiation in a high-voltage electron microscope

International Nuclear Information System (INIS)

Lam, N.Q.; Okamoto, P.R.

1984-05-01

The effects of defect-production rate gradients, caused by the radial nonuniformity in the electron flux distribution, on solute segregation and phase stability in alloy films undergoing high-voltage electron-microscope (HVEM) irradiation at high temperatures are assessed. Two-dimensional (axially symmetric) compositional redistributions were calculated, taking into account both axial and transverse radial defect fluxes. It was found that when highly focused beams were employed radiation-induced segregation consisted of two stages: dominant axial segregation at the film surfaces at short irradiation times and competitive radial segregation at longer times. The average alloy composition within the irradiated region could differ greatly from that irradiated with a uniform beam, because of the additional atom transport from or to the region surrounding the irradiated zone under the influence of radial fluxes. As a result, damage-rate gradient effects must be taken into account when interpreting in-situ HVEM observations of segregation-induced phase instabilities. The theoretical predictions are compared with experimental observations of the temporal and spatial dependence of segregation-induced precipitation in thin films of Ni-Al, Ni-Ge and Ni-Si solid solutions

Parameters of a supershort avalanche electron beam generated in atmospheric-pressure air

International Nuclear Information System (INIS)

Tarasenko, V. F.

2011-01-01

Conditions under which the number of runaway electrons in atmospheric-pressure air reaches ∼5 × 10 10 are determined. Recommendations for creating runaway electron accelerators are given. Methods for measuring the parameters of a supershort avalanche electron beam and X-ray pulses from gas-filled diodes, as well as the discharge current and gap voltage, are described. A technique for determining the instant of runaway electron generation with respect to the voltage pulse is proposed. It is shown that the reduction in the gap voltage and the decrease in the beam current coincide in time. The mechanism of intense electron beam generation in gas-filled diodes is analyzed. It is confirmed experimentally that, in optimal regimes, the number of electrons generated in atmospheric-pressure air with energies T > eU m , where U m is the maximum gap voltage, is relatively small.

Parameters of a supershort avalanche electron beam generated in atmospheric-pressure air

Science.gov (United States)

Tarasenko, V. F.

2011-05-01

Conditions under which the number of runaway electrons in atmospheric-pressure air reaches ˜5 × 1010 are determined. Recommendations for creating runaway electron accelerators are given. Methods for measuring the parameters of a supershort avalanche electron beam and X-ray pulses from gas-filled diodes, as well as the discharge current and gap voltage, are described. A technique for determining the instant of runaway electron generation with respect to the voltage pulse is proposed. It is shown that the reduction in the gap voltage and the decrease in the beam current coincide in time. The mechanism of intense electron beam generation in gas-filled diodes is analyzed. It is confirmed experimentally that, in optimal regimes, the number of electrons generated in atmospheric-pressure air with energies T > eU m , where U m is the maximum gap voltage, is relatively small.

Electron Beam Generation in Tevatron Electron Lenses

International Nuclear Information System (INIS)

Kamerdzhiev, V.; Kuznetsov, G.; Shiltsev, V.; Solyak, N.; Tiunov, M.

2006-01-01

New type of high perveance electron guns with convex cathode has been developed. Three guns described in this article are built to provide transverse electron current density distributions needed for Electron Lenses for beam-beam compensation in the Tevatron collider. The current distribution can be controlled either by the gun geometry or by voltage on a special control electrode located near cathode. We present the designs of the guns and report results of beam measurements on the test bench. Because of their high current density and low transverse temperature of electrons, electron guns of this type can be used in electron cooling and beam-beam compensation devices

Electron beam generation in Tevatron electron lenses

International Nuclear Information System (INIS)

Kamerdzhiev, V.; Kuznetsov, G.; Shiltsev, V.; Solyak, N.; Tiunov, M.

2006-01-01

New type of high perveance electron guns with convex cathode has been developed. Three guns described in this article are built to provide transverse electron current density distributions needed for Electron Lenses for beam-beam compensation in the Tevatron collider. The current distribution can be controlled either by the gun geometry or by voltage on a special control electrode located near cathode. We present the designs of the guns and report results of beam measurements on the test bench. Because of their high current density and low transverse temperature of electrons, electron guns of this type can be used in electron cooling and beam-beam compensation devices

DNA comet assay for rice seeds treated with low energy electrons ('soft-electrons')

International Nuclear Information System (INIS)

Todoriki, Setsuko; Hayashi, Toru

1999-01-01

As rice seeds are sometimes contaminated with phytopathogenic organisms such as blast disease fungi and nematodes, a novel non-chemical disinfection method for rice seeds is highly required. In order to develop a disinfection method, the effect of low energy electron ('soft-electrons') on seed DNA was examined by using the neutral comet assay. Rice seeds (whole grain) were treated with electrons of different acceleration voltages (180 kV to 1 MV) at a dose of 5 kGy. Nucleus suspensions were prepared from whole brown rice and subjected to electrophoresis. DNA from un-irradiated (control) seeds relaxed and produced comets with a short tail, most of the comets distributed within the range of comet length between 30 μm to 70 μm. In the case of seeds treated with electrons at acceleration voltages up to 190 kV, cells without seed coats were not damaged and the frequency histograms of comet length showed almost the same pattern as that for control. At acceleration voltages higher than 200 kV, the cells were distributed into two categories; DNA comets with a short tail (with little DNA damages, less than 70 μm in the comet length) and DNA comets with long tails (with sever strand breaks, more than 130 μm in the comet length). The ratios of damaged cells increased with increasing acceleration voltage. The growths of rice seedlings were not affected by the treatment with electrons at up to 200 kV. On the contrary, the cells of gamma-irradiated seed showed small variations in the comet length, and which were depending on radiation dose. The individual cells of gamma-irradiated seeds at 1 kGy showed shorter comet than the damaged cells with soft electron, seed treated with gamma rays (1-5 kGy) did not shoot nor root. (author)

Fluctuation in Interface and Electronic Structure of Single-Molecule Junctions Investigated by Current versus Bias Voltage Characteristics.

Science.gov (United States)

Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

2018-03-14

Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contain the fundamental science of single-molecule transport and implication for manipulability of the transport properties in electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage ( I- V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I- V approach provides a correlated statistical description of both the degree of electronic coupling across the metal-molecule interface and the molecular orbital energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C 60 ). We demonstrate that molecular-dependent fluctuation of σ-, π-, and π-plane-type interfaces can be captured by analyzing the molecular orbital (MO) energy level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C 60 features unique distance dependence and molecular-dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrast, the MO level of C 60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular-dependent fluctuation in

Development of an electron gun for high power CW electron linac (1). Beam experiment for basic performance of electron gun

International Nuclear Information System (INIS)

Yamazaki, Yoshio; Nomura, Masahiro; Komata, Tomoki

1999-05-01

Presently, the Beam Group of Oarai Engineering Center in Japan Nuclear Cycle Development Institute (JNC) completed the high power CW electron linac. Then we started full-scale beam experiments after the government permission for a radiation equipment had given last January. Measurements of basic performance for the mesh-grid type electron gun have been done to launch stable beam at 300 mA peak current downstream of the accelerator. These experiments disclosed to increase beam loss in the electron gun in some cases of voltage supplied the mesh-grid in spite of same beam current from gun. Consequently, we could find the best condition for mesh-grid voltage and heater current to supply stable beam at 300 mA peak current for accelerator study. (author)

A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing

Science.gov (United States)

Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.

2015-01-01

This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573

Performance Analysis of Phase Controlled Unidirectional and Bidirectional AC Voltage Controllers

Directory of Open Access Journals (Sweden)

Abdul Sattar Larik

2011-01-01

Full Text Available AC voltage controllers are used to vary the output ac voltage from a fixed ac input source. They are also commonly called ac voltage regulators or ac choppers. The output voltage is either controlled by PAC (Phase Angle Control method or on-off control method. Due to various advantages of ac voltage controllers, such as high efficiency, simplicity, low cost and ability to control large amount of power they efficiently control the speed of ac motors, light dimming and industrial heating, etc. These converters are variable structure systems and generate harmonics during the operation which will affect the power quality when connected to system network. During the last couple of years, a number of new semiconductor devices and various power electronic converters has been introduced. Accordingly the subject of harmonics and its problems are of great concern to power industry and customers. In this research work, initially the simulation models of single phase unidirectional and bidirectional ac voltage controllers were developed by using MATLAB software. The harmonics of these models are investigated by simulation. In the end, the harmonics were also analyzed experimentally. The simulated as well as experimental results are presented.

The free energy barrier for arginine gating charge translation is altered by mutations in the voltage sensor domain.

Directory of Open Access Journals (Sweden)

Christine S Schwaiger

Full Text Available The gating of voltage-gated ion channels is controlled by the arginine-rich S4 helix of the voltage-sensor domain moving in response to an external potential. Recent studies have suggested that S4 moves in three to four steps to open the conducting pore, thus visiting several intermediate conformations during gating. However, the exact conformational changes are not known in detail. For instance, it has been suggested that there is a local rotation in the helix corresponding to short segments of a 3(10-helix moving along S4 during opening and closing. Here, we have explored the energetics of the transition between the fully open state (based on the X-ray structure and the first intermediate state towards channel closing (C1, modeled from experimental constraints. We show that conformations within 3 Å of the X-ray structure are obtained in simulations starting from the C1 model, and directly observe the previously suggested sliding 3(10-helix region in S4. Through systematic free energy calculations, we show that the C1 state is a stable intermediate conformation and determine free energy profiles for moving between the states without constraints. Mutations indicate several residues in a narrow hydrophobic band in the voltage sensor contribute to the barrier between the open and C1 states, with F233 in the S2 helix having the largest influence. Substitution for smaller amino acids reduces the transition cost, while introduction of a larger ring increases it, largely confirming experimental activation shift results. There is a systematic correlation between the local aromatic ring rotation, the arginine barrier crossing, and the corresponding relative free energy. In particular, it appears to be more advantageous for the F233 side chain to rotate towards the extracellular side when arginines cross the hydrophobic region.

Modification of Modulating Anode Voltage Supply of Klystron for PEFP 20 MeV Linac

International Nuclear Information System (INIS)

Kim, Dae Il; Kwon, Hyeok Jung; Kim, Han Sung; Cho, Yong Sub

2011-01-01

The klystron (TH2089F, THALES) for PEFP 20MeV proton linear accelerator has a triode type electron gun and the modulating anode voltage should be supplied. The klystron has gone through some modification in the modulating anode voltage supply circuit. Formerly, the mod-anode voltage was supplied by using the tetrode-controlled voltage divider. This system requires addition power supply for the tetrode and the grid control circuit. Recently we modified the mod-anode supply from the tetrode-controlled voltage divider to a resistive voltage divider. The resistors for the previous voltage divider were installed at a supporter with high voltage bushing structure next to the klystron. In the previous system, the resistors were exposed to the air and their size was very bulky, length of which was about 1m long. To reduce the space occupied by the voltage divider and to improve the electrical insulation performance, the voltage dividing resistors were moved into the oil tank of the klystron. During the operation of the 20 MeV linac, the klystron parameters were measured. In this paper, the modification of the voltage divider and the operational characteristics of the klystron with modified voltage divider circuit are presented

Electron capture in ion-molecule collisions at intermediate energy