WorldWideScience

Sample records for intergenic non-coding rrna

  1. Pathoadaptation of a Human Pathogen Through Non-Coding Intergenic Mutations

    DEFF Research Database (Denmark)

    Khademi, Seyed Mohammad Hossein

    of opportunistic pathogen Pseudomonas aeruginosa in long-term chronic airway infections of Cystic fibrosis (CF) patients. Using sequenced genomes of P. aeruginosa isolated from this setting, 88 intergenic regions under positive selection for adaptive mutations within and across isolates of different P. aeruginosa......Most knowledge gained from evolutionary studies of bacteria in natural and experimental settings center around contribution of intragenic mutations on bacterial evolution. While cases of adaptive intergenic mutations have sometimes been reported or explored, none of these studies consider...... intergenic mutations in broader context as key players in evolutionary adaptation of bacteria. The focus of this thesis has been to provide novel insights on contributions of non-coding intergenic mutations in natural evolution of bacteria. The model system used for these investigations is adaptation...

  2. Long intergenic non-coding RNA TUG1 is overexpressed in urothelial carcinoma of the bladder.

    Science.gov (United States)

    Han, Yonghua; Liu, Yuchen; Gui, Yaoting; Cai, Zhiming

    2013-04-01

    Long intergenic non-coding RNAs (lincRNAs) are a class of non-coding RNAs that regulate gene expression via chromatin reprogramming. Taurine Up-regulated Gene 1 (TUG1) is a lincRNA that is associated with chromatin-modifying complexes and plays roles in gene regulation. In this study, we determined the expression patterns of TUG1 and the cell proliferation inhibition and apoptosis induced by silencing TUG1 in urothelial carcinoma of the bladder. The expression levels of TUG1 were determined using Real-Time qPCR in a total of 44 patients with bladder urothelial carcinomas. Bladder urothelial carcinoma T24 and 5637 cells were transfected with TUG1 siRNA or negative control siRNA. Cell proliferation was evaluated using MTT assay. Apoptosis was determined using ELISA assay. TUG1 was up-regulated in bladder urothelial carcinoma compared to paired normal urothelium. High TUG1 expression levels were associated with high grade and stage carcinomas. Cell proliferation inhibition and apoptosis induction were observed in TUG1 siRNA-transfected bladder urothelial carcinoma T24 and 5637 cells. Our data suggest that lincRNA TUG1 is emerging as a novel player in the disease state of bladder urothelial carcinoma. TUG1 may have potential roles as a biomarker and/or a therapeutic target in bladder urothelial carcinoma. Copyright © 2012 Wiley Periodicals, Inc.

  3. Annotating long intergenic non-coding RNAs under artificial selection during chicken domestication.

    Science.gov (United States)

    Wang, Yun-Mei; Xu, Hai-Bo; Wang, Ming-Shan; Otecko, Newton Otieno; Ye, Ling-Qun; Wu, Dong-Dong; Zhang, Ya-Ping

    2017-08-15

    Numerous biological functions of long intergenic non-coding RNAs (lincRNAs) have been identified. However, the contribution of lincRNAs to the domestication process has remained elusive. Following domestication from their wild ancestors, animals display substantial changes in many phenotypic traits. Therefore, it is possible that diverse molecular drivers play important roles in this process. We analyzed 821 transcriptomes in this study and annotated 4754 lincRNA genes in the chicken genome. Our population genomic analysis indicates that 419 lincRNAs potentially evolved during artificial selection related to the domestication of chicken, while a comparative transcriptomic analysis identified 68 lincRNAs that were differentially expressed under different conditions. We also found 47 lincRNAs linked to special phenotypes. Our study provides a comprehensive view of the genome-wide landscape of lincRNAs in chicken. This will promote a better understanding of the roles of lincRNAs in domestication, and the genetic mechanisms associated with the artificial selection of domestic animals.

  4. Genome-wide identification and characterization of long intergenic non-coding RNAs in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Jianqin Li

    Full Text Available Ganoderma lucidum is a white-rot fungus best-known for its medicinal activities. We have previously sequenced its genome and annotated the protein coding genes. However, long non-coding RNAs in G. lucidum genome have not been analyzed. In this study, we have identified and characterized long intergenic non-coding RNAs (lincRNA in G. lucidum systematically. We developed a computational pipeline, which was used to analyze RNA-Seq data derived from G. lucidum samples collected from three developmental stages. A total of 402 lincRNA candidates were identified, with an average length of 609 bp. Analysis of their adjacent protein-coding genes (apcGenes revealed that 46 apcGenes belong to the pathways of triterpenoid biosynthesis and lignin degradation, or families of cytochrome P450, mating type B genes, and carbohydrate-active enzymes. To determine if lincRNAs and these apcGenes have any interactions, the corresponding pairs of lincRNAs and apcGenes were analyzed in detail. We developed a modified 3' RACE method to analyze the transcriptional direction of a transcript. Among the 46 lincRNAs, 37 were found unidirectionally transcribed, and 9 were found bidirectionally transcribed. The expression profiles of 16 of these 37 lincRNAs were found to be highly correlated with those of the apcGenes across the three developmental stages. Among them, 11 are positively correlated (r>0.8 and 5 are negatively correlated (r<-0.8. The co-localization and co-expression of lincRNAs and those apcGenes playing important functions is consistent with the notion that lincRNAs might be important regulators for cellular processes. In summary, this represents the very first study to identify and characterize lincRNAs in the genomes of basidiomycetes. The results obtained here have laid the foundation for study of potential lincRNA-mediated expression regulation of genes in G. lucidum.

  5. Systematically profiling and annotating long intergenic non-coding RNAs in human embryonic stem cell.

    Science.gov (United States)

    Tang, Xing; Hou, Mei; Ding, Yang; Li, Zhaohui; Ren, Lichen; Gao, Ge

    2013-01-01

    While more and more long intergenic non-coding RNAs (lincRNAs) were identified to take important roles in both maintaining pluripotency and regulating differentiation, how these lincRNAs may define and drive cell fate decisions on a global scale are still mostly elusive. Systematical profiling and comprehensive annotation of embryonic stem cells lincRNAs may not only bring a clearer big picture of these novel regulators but also shed light on their functionalities. Based on multiple RNA-Seq datasets, we systematically identified 300 human embryonic stem cell lincRNAs (hES lincRNAs). Of which, one forth (78 out of 300) hES lincRNAs were further identified to be biasedly expressed in human ES cells. Functional analysis showed that they were preferentially involved in several early-development related biological processes. Comparative genomics analysis further suggested that around half of the identified hES lincRNAs were conserved in mouse. To facilitate further investigation of these hES lincRNAs, we constructed an online portal for biologists to access all their sequences and annotations interactively. In addition to navigation through a genome browse interface, users can also locate lincRNAs through an advanced query interface based on both keywords and expression profiles, and analyze results through multiple tools. By integrating multiple RNA-Seq datasets, we systematically characterized and annotated 300 hES lincRNAs. A full functional web portal is available freely at http://scbrowse.cbi.pku.edu.cn. As the first global profiling and annotating of human embryonic stem cell lincRNAs, this work aims to provide a valuable resource for both experimental biologists and bioinformaticians.

  6. A Global Clustering Algorithm to Identify Long Intergenic Non-Coding RNA - with Applications in Mouse Macrophages

    OpenAIRE

    Garmire, Lana X.; Garmire, David G.; Huang, Wendy; Yao, Joyee; Glass, Christopher K.; Subramaniam, Shankar

    2011-01-01

    Identification of diffuse signals from the chromatin immunoprecipitation and high-throughput massively parallel sequencing (ChIP-Seq) technology poses significant computational challenges, and there are few methods currently available. We present a novel global clustering approach to enrich diffuse CHIP-Seq signals of RNA polymerase II and histone 3 lysine 4 trimethylation (H3K4Me3) and apply it to identify putative long intergenic non-coding RNAs (lincRNAs) in macrophage cells. Our global cl...

  7. Functional analysis of an intergenic non-coding sequence within mce1 operon of M.tuberculosis

    Directory of Open Access Journals (Sweden)

    Bose Mridula

    2010-04-01

    Full Text Available Abstract Background The mce operons play an important role in the entry of M. tuberculosis into macrophages and non-phagocytic cells. Their non-redundant function as well as complex regulation is implied by the phenotype of mce mutants. Recently, mce1 operon was found to extend over 13 genes, fadD5 (Rv0166 being the first gene of the operon. The presence of a non-coding sequence of 200 base pairs between Rv0166 and Rv0167 is peculiar to mce1 among the four mce operons of M.tuberculosis. We have examined the function of this region. Results We predicted putative promoter activity of the 200 base pairs of non-coding, intergenic region between Rv0166 and Rv0167 in silico using MEME software and designate it as intergenic promoter, IGPr. We demonstrate both promoter activity and a putative negative regulatory function of this fragment by reporter assays carried out in the surrogate host M.smegmatis. We find that the repressive elements not only control the native promoter but also repress a heterologous promoter of M.smegmatis. The higher activity of the intergenic promoter in a clinical isolate in comparison with the wild type sequence from M.tuberculosis H37Rv could be correlated with a point mutation within the negative element. We have mapped two transcription start sites for mce1 operon both of which are utilized in M.tuberculosis H37Rv as well as the clinical isolate VPCI591. Our studies show that the promoter activity in the non-coding region is relevant not only in reporter gene expression but also in the expression of mce1 operon in M. tuberculosis cells grown in synthetic medium. Conclusion The mce operon of M.tuberculosis H37Rv potentially can be transcribed from two promoters P1 and P2, former mapping upstream of Rv0166 and the latter in the non-coding intergenic region between Rv0166 and Rv0167. The transcription initiation from P1 results in a transcript with Rv0166 while that from P2 will be without it. The sequences between the

  8. PlantRNA_Sniffer: A SVM-Based Workflow to Predict Long Intergenic Non-Coding RNAs in Plants

    Directory of Open Access Journals (Sweden)

    Lucas Maciel Vieira

    2017-03-01

    Full Text Available Non-coding RNAs (ncRNAs constitute an important set of transcripts produced in the cells of organisms. Among them, there is a large amount of a particular class of long ncRNAs that are difficult to predict, the so-called long intergenic ncRNAs (lincRNAs, which might play essential roles in gene regulation and other cellular processes. Despite the importance of these lincRNAs, there is still a lack of biological knowledge and, currently, the few computational methods considered are so specific that they cannot be successfully applied to other species different from those that they have been originally designed to. Prediction of lncRNAs have been performed with machine learning techniques. Particularly, for lincRNA prediction, supervised learning methods have been explored in recent literature. As far as we know, there are no methods nor workflows specially designed to predict lincRNAs in plants. In this context, this work proposes a workflow to predict lincRNAs on plants, considering a workflow that includes known bioinformatics tools together with machine learning techniques, here a support vector machine (SVM. We discuss two case studies that allowed to identify novel lincRNAs, in sugarcane (Saccharum spp. and in maize (Zea mays. From the results, we also could identify differentially-expressed lincRNAs in sugarcane and maize plants submitted to pathogenic and beneficial microorganisms.

  9. Large Intergenic Non-coding RNA-RoR Inhibits Aerobic Glycolysis of Glioblastoma Cells via Akt Pathway.

    Science.gov (United States)

    Li, Yong; He, Zhi-Cheng; Liu, Qing; Zhou, Kai; Shi, Yu; Yao, Xiao-Hong; Zhang, Xia; Kung, Hsiang-Fu; Ping, Yi-Fang; Bian, Xiu-Wu

    2018-01-01

    Reprogramming energy metabolism is a hallmark of malignant tumors, including glioblastoma (GBM). Aerobic glycolysis is often utilized by tumor cells to maintain survival and proliferation. However, the underlying mechanisms of aerobic glycolysis in GBM remain elusive. Herein, we demonstrated that large intergenic non-coding RNA-RoR (LincRNA-RoR) functioned as a critical suppressor to inhibit the aerobic glycolysis and viability of GBM cells. We found that LincRNA-RoR was markedly reduced in GBM tissues compared with adjacent non-tumor tissues from 10 cases of GBM patients. Consistently, LincRNA-RoR expression in GBM cells was significantly lower than that in normal glial cells. The aerobic glycolysis of GBM cells, as determined by the measurement of glucose uptake and lactate production, was impaired by LincRNA-RoR overexpression. Mechanistically, LincRNA-RoR inhibited the expression of Rictor, the key component of mTORC2 (mammalian target of rapamycin complex 2), to suppress the activity of Akt pathway and impair the expression of glycolytic effectors, including Glut1, HK2, PKM2 and LDHA. Finally, enforced expression of LincRNA-RoR reduced the proliferation of GBM cells in vitro , restrained tumor growth in vivo, and repressed the expression of glycolytic molecules in GBM xenografts. Collectively, our results underscore LincRNA-RoR as a new suppressor of GBM aerobic glycolysis with therapeutic potential.

  10. Pan-Cancer Analyses Reveal Long Intergenic Non-Coding RNAs Relevant to Tumor Diagnosis, Subtyping and Prognosis

    Directory of Open Access Journals (Sweden)

    Travers Ching

    2016-05-01

    Full Text Available Long intergenic noncoding RNAs (lincRNAs are a relatively new class of non-coding RNAs that have the potential as cancer biomarkers. To seek a panel of lincRNAs as pan-cancer biomarkers, we have analyzed transcriptomes from over 3300 cancer samples with clinical information. Compared to mRNA, lincRNAs exhibit significantly higher tissue specificities that are then diminished in cancer tissues. Moreover, lincRNA clustering results accurately classify tumor subtypes. Using RNA-Seq data from thousands of paired tumor and adjacent normal samples in The Cancer Genome Atlas (TCGA, we identify six lincRNAs as potential pan-cancer diagnostic biomarkers (PCAN-1 to PCAN-6. These lincRNAs are robustly validated using cancer samples from four independent RNA-Seq data sets, and are verified by qPCR in both primary breast cancers and MCF-7 cell line. Interestingly, the expression levels of these six lincRNAs are also associated with prognosis in various cancers. We further experimentally explored the growth and migration dependence of breast and colon cancer cell lines on two of the identified lncRNAs. In summary, our study highlights the emerging role of lincRNAs as potentially powerful and biologically functional pan-cancer biomarkers and represents a significant leap forward in understanding the biological and clinical functions of lincRNAs in cancers.

  11. Large Intergenic Non-coding RNA-RoR Inhibits Aerobic Glycolysis of Glioblastoma Cells via Akt Pathway

    Science.gov (United States)

    Li, Yong; He, Zhi-Cheng; Liu, Qing; Zhou, Kai; Shi, Yu; Yao, Xiao-Hong; Zhang, Xia; Kung, Hsiang-Fu; Ping, Yi-Fang; Bian, Xiu-Wu

    2018-01-01

    Reprogramming energy metabolism is a hallmark of malignant tumors, including glioblastoma (GBM). Aerobic glycolysis is often utilized by tumor cells to maintain survival and proliferation. However, the underlying mechanisms of aerobic glycolysis in GBM remain elusive. Herein, we demonstrated that large intergenic non-coding RNA-RoR (LincRNA-RoR) functioned as a critical suppressor to inhibit the aerobic glycolysis and viability of GBM cells. We found that LincRNA-RoR was markedly reduced in GBM tissues compared with adjacent non-tumor tissues from 10 cases of GBM patients. Consistently, LincRNA-RoR expression in GBM cells was significantly lower than that in normal glial cells. The aerobic glycolysis of GBM cells, as determined by the measurement of glucose uptake and lactate production, was impaired by LincRNA-RoR overexpression. Mechanistically, LincRNA-RoR inhibited the expression of Rictor, the key component of mTORC2 (mammalian target of rapamycin complex 2), to suppress the activity of Akt pathway and impair the expression of glycolytic effectors, including Glut1, HK2, PKM2 and LDHA. Finally, enforced expression of LincRNA-RoR reduced the proliferation of GBM cells in vitro, restrained tumor growth in vivo, and repressed the expression of glycolytic molecules in GBM xenografts. Collectively, our results underscore LincRNA-RoR as a new suppressor of GBM aerobic glycolysis with therapeutic potential. PMID:29581766

  12. Identification and Functional Analysis of Long Intergenic Non-coding RNAs Underlying Intramuscular Fat Content in Pigs

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2018-03-01

    Full Text Available Intramuscular fat (IMF content is an important trait that can affect pork quality. Previous studies have identified many genes that can regulate IMF. Long intergenic non-coding RNAs (lincRNAs are emerging as key regulators in various biological processes. However, lincRNAs related to IMF in pig are largely unknown, and the mechanisms by which they regulate IMF are yet to be elucidated. Here we reconstructed 105,687 transcripts and identified 1,032 lincRNAs in pig longissimus dorsi muscle (LDM of four stages with different IMF contents based on published RNA-seq. These lincRNAs show typical characteristics such as shorter length and lower expression compared with protein-coding genes. Combined with methylation data, we found that both the promoter and genebody methylation of lincRNAs can negatively regulate lincRNA expression. We found that lincRNAs exhibit high correlation with their protein-coding neighbors in expression. Co-expression network analysis resulted in eight stage-specific modules, gene ontology and pathway analysis of them suggested that some lincRNAs were involved in IMF-related processes, such as fatty acid metabolism and peroxisome proliferator-activated receptor signaling pathway. Furthermore, we identified hub lincRNAs and found six of them may play important roles in IMF development. This work detailed some lincRNAs which may affect of IMF development in pig, and facilitated future research on these lincRNAs and molecular assisted breeding for pig.

  13. Sequence organization of the Acanthamoeba rRNA intergenic spacer: identification of transcriptional enhancers.

    Science.gov (United States)

    Yang, Q; Zwick, M G; Paule, M R

    1994-01-01

    The primary sequence of the entire 2330 bp intergenic spacer of the A.castellanii ribosomal RNA gene was determined. Repeated sequence elements averaging 140 bp were identified and found to bind a protein required for optimum initiation at the core promoter. These repeated elements were shown to stimulate rRNA transcription by RNA polymerase I in vitro. The repeats inhibited transcription when placed in trans, and stimulated transcription when in cis, in either orientation, but only when upstream of the core promoter. Thus, these repeated elements have characteristics similar to polymerase I enhancers found in higher eukaryotes. The number of rRNA repeats in Acanthamoeba cells was determined to be 24 per haploid genome, the lowest number so far identified in any eukaryote. However, because Acanthamoeba is polyploid, each cell contains approximately 600 rRNA genes. Images PMID:7984432

  14. Large intergenic non-coding RNA-ROR reverses gemcitabine-induced autophagy and apoptosis in breast cancer cells.

    Science.gov (United States)

    Chen, Yao-Min; Liu, Yu; Wei, Hai-Yan; Lv, Ke-Zhen; Fu, Pei-Fen

    2016-09-13

    The purpose of this study was to elucidate the potential role of long intergenic non-protein coding RNA, regulator of reprogramming (linc-ROR) in gemcitabine (Gem)-induced autophagy and apoptosis in breast cancer cells. MDA-MB-231 cells were treated with short hairpin RNA (shRNA) to knockdown Linc-ROR expression in the presence of Gem. Gem treatment alone decreased cell survival and increased both apoptosis and autophagy. Gem treatment also increased the expression of LC3-II, Beclin 1, NOTCH1 and Bcl-2, but decreased expression of p62 and p53. Untreated MDA-MB-231 cell lines strongly expressed linc-ROR, but linc-ROR knockdown decreased cell viability and expression of p62 and p53 while increasing apoptosis. Linc-ROR knockdown also increased LC3-II/β-actin, Beclin 1, NOTCH1, and Bcl-2 expression, as well as the number of autophagic vesicles in MDA-MB-231 cells. Linc-ROR negatively regulated miR-34a expression by inhibiting histone H3 acetylation in the miR-34a promoter. We conclude that linc-ROR suppresses Gem-induced autophagy and apoptosis in breast cancer cells by silencing miR-34a expression.

  15. Elevated expression of long intergenic non-coding RNA HOTAIR in a basal-like variant of MCF-7 breast cancer cells

    Science.gov (United States)

    Zhuang, Yan; Nguyen, Hong T.; Burow, Matthew E.; Zhuo, Ying; El-Dahr, Samir S.; Yao, Xiao; Cao, Subing; Flemington, Erik K.; Nephew, Kenneth P.; Fang, Fang; Collins-Burow, Bridgette; Rhodes, Lyndsay V.; Yu, Qiang; Jayawickramarajah, Janarthanan; Shan, Bin

    2015-01-01

    Epigenetic regulation of gene expression is critical to phenotypic maintenance and transition of human breast cancer cells. HOX antisense intergenic RNA (HOTAIR) is a long intergenic non-coding RNA that epigenetically represses gene expression via recruitment of enhancer of zeste homolog 2 (EZH2), a histone methyltransferase. Elevated expression of HOTAIR promotes progression of breast cancer. In the current study we examined the expression and function of HOTAIR in MCF-7-TNR cells, a derivative of the luminal-like breast cancer cell line MCF-7 that acquired resistance to TNF-α-induced cell death. The expression of HOTAIR, markers of the luminal-like and basal-like subtypes, and growth were compared between MCF-7 and MCF-7-TNR cells. These variables were further assessed upon inhibition of HOTAIR, EZH2, p38 MAPK, and SRC kinase in MCF-7-TNR cells. When compared with MCF-7 cells, MCF-7-TNR cells exhibited an increase in the expression of HOTAIR, which correlated with characteristics of a luminal-like to basal-like transition as evidenced by dysregulated gene expression and accelerated growth. MCF-7-TNR cells exhibited reduced suppressive histone H3 lysine27 trimethylation on the HOTAIR promoter. Inhibition of HOTAIR and EZH2 attenuated the luminal-like to basal-like transition in terms of gene expression and growth in MCF-7-TNR cells. Inhibition of p38 and SRC diminished HOTAIR expression and the basal-like phenotype in MCF-7-TNR cells. HOTAIR was robustly expressed in the native basal-like breast cancer cells and inhibition of HOTAIR reduced the basal-like gene expression and growth. Our findings suggest HOTAIR-mediated regulation of gene expression and growth associated with the basal-like phenotype of breast cancer cells. PMID:25328122

  16. Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays

    Directory of Open Access Journals (Sweden)

    Patenge Nadja

    2012-10-01

    Full Text Available Abstract Background Small non-coding RNAs (sRNAs have attracted attention as a new class of gene regulators in both eukaryotes and bacteria. Genome-wide screening methods have been successfully applied in Gram-negative bacteria to identify sRNA regulators. Many sRNAs are well characterized, including their target mRNAs and mode of action. In comparison, little is known about sRNAs in Gram-positive pathogens. In this study, we identified novel sRNAs in the exclusively human pathogen Streptococcus pyogenes M49 (Group A Streptococcus, GAS M49, employing a whole genome intergenic tiling array approach. GAS is an important pathogen that causes diseases ranging from mild superficial infections of the skin and mucous membranes of the naso-pharynx, to severe toxic and invasive diseases. Results We identified 55 putative sRNAs in GAS M49 that were expressed during growth. Of these, 42 were novel. Some of the newly-identified sRNAs belonged to one of the common non-coding RNA families described in the Rfam database. Comparison of the results of our screen with the outcome of two recently published bioinformatics tools showed a low level of overlap between putative sRNA genes. Previously, 40 potential sRNAs have been reported to be expressed in a GAS M1T1 serotype, as detected by a whole genome intergenic tiling array approach. Our screen detected 12 putative sRNA genes that were expressed in both strains. Twenty sRNA candidates appeared to be regulated in a medium-dependent fashion, while eight sRNA genes were regulated throughout growth in chemically defined medium. Expression of candidate genes was verified by reverse transcriptase-qPCR. For a subset of sRNAs, the transcriptional start was determined by 5′ rapid amplification of cDNA ends-PCR (RACE-PCR analysis. Conclusions In accord with the results of previous studies, we found little overlap between different screening methods, which underlines the fact that a comprehensive analysis of s

  17. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  18. Genome-wide characterization of long intergenic non-coding RNAs (lincRNAs) provides new insight into viral diseases in honey bees Apis cerana and Apis mellifera.

    Science.gov (United States)

    Jayakodi, Murukarthick; Jung, Je Won; Park, Doori; Ahn, Young-Joon; Lee, Sang-Choon; Shin, Sang-Yoon; Shin, Chanseok; Yang, Tae-Jin; Kwon, Hyung Wook

    2015-09-04

    Long non-coding RNAs (lncRNAs) are a class of RNAs that do not encode proteins. Recently, lncRNAs have gained special attention for their roles in various biological process and diseases. In an attempt to identify long intergenic non-coding RNAs (lincRNAs) and their possible involvement in honey bee development and diseases, we analyzed RNA-seq datasets generated from Asian honey bee (Apis cerana) and western honey bee (Apis mellifera). We identified 2470 lincRNAs with an average length of 1011 bp from A. cerana and 1514 lincRNAs with an average length of 790 bp in A. mellifera. Comparative analysis revealed that 5 % of the total lincRNAs derived from both species are unique in each species. Our comparative digital gene expression analysis revealed a high degree of tissue-specific expression among the seven major tissues of honey bee, different from mRNA expression patterns. A total of 863 (57 %) and 464 (18 %) lincRNAs showed tissue-dependent expression in A. mellifera and A. cerana, respectively, most preferentially in ovary and fat body tissues. Importantly, we identified 11 lincRNAs that are specifically regulated upon viral infection in honey bees, and 10 of them appear to play roles during infection with various viruses. This study provides the first comprehensive set of lincRNAs for honey bees and opens the door to discover lincRNAs associated with biological and hormone signaling pathways as well as various diseases of honey bee.

  19. Large intergenic non-coding RNA-ROR as a potential biomarker for the diagnosis and dynamic monitoring of breast cancer.

    Science.gov (United States)

    Zhao, Tianhe; Wu, Lichun; Li, Xinyang; Dai, Huangmei; Zhang, Zunzhen

    2017-08-23

    Recent study has revealed that large intergenic non-coding RNA-ROR (linc-ROR) is aberrantly expressed in a number of cancers including breast cancer. However, whether circulating linc-ROR in plasma could be used for breast cancer diagnosis and dynamic monitoring is not clear. The objective of this study is to determine if plasma linc-ROR could be applied as a biomarker for the diagnosis and dynamic monitoring of breast cancer. We tested the expression levels of linc-ROR in 24 pairs of tissue samples and 96 plasma samples from breast cancer patients by quantitative real time-polymerase chain reaction (qRT-PCR), and analyzed the correlation between plasma linc-ROR levels and clinico-pathological characteristics. Receiver operating characteristic (ROC) curve was used to assess the diagnostic power of plasma linc-ROR, carcinoembryonic antigen (CEA) and carbohydrate antigen (CA)153 for breast cancer. Furthermore, we explored the monitoring values of plasma linc-ROR for breast cancer by analyzing the preoperative and postoperative plasma linc-ROR levels of the same patients. The expression levels of linc-ROR were significantly higher in breast cancer tissues and plasma than the levels in the control (PROR expression levels in plasma were correlated with lymph node metastasis (PROR was 0.758 (sensitivity 80.0%; specificity 73.3%), which was higher than CEA and CA153 values from the same patients obtained. Combination of the linc-ROR with the conventional biomarkers might produce better diagnostic ability. Additionally, the linc-ROR expression levels of plasma in postoperative patients were lower than those in preoperative patients (PROR may be a potential biomarker for the diagnosis and dynamic monitoring of breast cancer.

  20. Molecular characterization of the non-coding promoter and leader regions and full-length 16S ribosomal RNA (rRNA) gene of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, A; Saito, S; Sekizuka, T; Murayama, O; Moore, J E; Millar, B C; Matsuda, M

    2007-06-01

    The 3,339 base pair (bp) sequences encoding a putative open reading frame (ORF), non-coding promoter and leader regions (approximately 320 bp), full-length 16S ribosomal RNA (rRNA) gene (approximate 1,540 bp) and part of the 16S-23S rDNA internal spacer region (ISR) were determined from genome DNA libraries of the Taylorella asinigenitalis (UK-1) isolate. The non-coding promoter and leader regions included antiterminators (boxB, boxA and boxC) immediately upstream of the 16S rRNA gene sequence. An approximately 680 bp region upstream of the non-coding promoter region appears to contain a putative ORF with high sequence similarity to GTP cyclohydrolase I. In addition, a typical order of intercistronic tRNA genes with the 48 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in a part of the 16S-23S rDNA ISR. The antiterminators of boxB and boxA were also identified in the ISR.A phylogenetic analysis based on the 16S rRNA gene sequence information clearly demonstrated that the five T. asinigenitalis isolates formed a cluster together with the three T. equigenitalis strains, more similar to Pelistega europaea than the other beta-Proteobacteria from the 13 species of 11 genera.

  1. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Science.gov (United States)

    Janezic, Sandra; Indra, Alexander; Rattei, Thomas; Weinmaier, Thomas; Rupnik, Maja

    2014-01-01

    PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR), has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp) were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp) and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  2. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Directory of Open Access Journals (Sweden)

    Sandra Janezic

    Full Text Available PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR, has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  3. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    Science.gov (United States)

    Hindenach, B R; Stafford, D W

    1984-02-10

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for 26S rRNA. The rRNA coding regions were identified by direct analysis of 3'-labeled 18S and 5.8S rRNA and 5'-labeled 5.8S rRNA, and by sequence homology of the 26S rDNA with yeast and vertebrate 26/28S rRNAs. The internal transcribed spacers are GC-rich, similar to those of vertebrates. The 5.8S and 5' 26S rDNA sequences support a proposed model for a structural domain of the yeast large subunit ribosomal RNA (Veldman et al. [1981] Nucleic Acids Res. 9, 6935-6952).

  4. Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

    Energy Technology Data Exchange (ETDEWEB)

    Li, W.M.; Sylvester, J.E. [Hahnemann Univ., Philadelphia, PA (United States)

    1994-09-01

    In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcription run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.

  5. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    OpenAIRE

    Hindenach, B R; Stafford, D W

    1984-01-01

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for...

  6. Variation of 16S-23S rRNA intergenic spacer regions (ISRs) in Acinetobacter baylyi (strain B2) isolated from activated sludge.

    Science.gov (United States)

    Carr, Emma L; Gürtler, Volker; Seviour, Robert J

    2004-08-01

    To determine the variability of the 16S-23S rRNA intergenic spacer region (ISR) of the newly described Acinetobacter baylyi, 88 clones containing ISR amplicons were screened and 14 chosen for further analysis. Two different sized 16S-23S rRNA ISRs were distinguished comprising five variable and four conserved nucleotide blocks. The major regions of heterogeneity between the different sized ISRs were due to blocks of substitutions with unique secondary structures interspersed with nucleotide substitutions, rather than differences caused by presence or absence of tRNA genes, which is often the case. Recombination events causing shuffling of nucleotide blocks are considered the most likely explanation for the mosaic structure observed between the different copies of the ISR. Single base differences present in the long ISR (LISR) were then exploited in attempts to detect possible heterogeneity between rrn copies in Acinetobacter baylyi but variability was not detected by RFLP analysis of LISR-specific PCR products. These primers were shown to be highly specific for 3 Acinetobacter baylyi strains based on LISR sequence homogeneity.

  7. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    International Nuclear Information System (INIS)

    Ananiev, E.; Abdulova, G.; Grozdanov, P.; Karagyozov, L.

    2003-01-01

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32 P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  8. Maternal oral origin of Fusobacterium nucleatum in adverse pregnancy outcomes as determined using the 16S-23S rRNA gene intergenic transcribed spacer region.

    Science.gov (United States)

    Gonzales-Marin, Cecilia; Spratt, David A; Allaker, Robert P

    2013-01-01

    Fusobacterium nucleatum, a common Gram-negative anaerobe prevalent in the oral cavity, possesses the ability to colonize the amniotic cavity and the fetus. However, F. nucleatum may also be part of the vaginal microbiota from where it could reach the amniotic tissues. Due to the heterogeneity of F. nucleatum, consisting of five subspecies, analysis at the subspecies/strain level is desirable to determine its precise origin. The aims of this study were: (i) to evaluate the use of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region as a tool to differentiate subspecies of F. nucleatum, and (ii) to design a simplified technique based on the ITS to determine the origin of F. nucleatum strains associated with adverse pregnancy outcomes. Amplified fragments of the 16S-23S rRNA gene ITS region corresponding to the five subspecies of F. nucleatum were subjected to cloning and sequencing to characterize the different ribosomal operons of the subspecies. Distinctive length and sequence patterns with potential to be used for identification of the subspecies/strain were identified. These were used to evaluate the origin of F. nucleatum identified in neonatal gastric aspirates (swallowed amniotic fluid) by sequence comparisons with the respective oral and vaginal maternal samples. A simplified technique using a strain-specific primer in a more sensitive nested PCR was subsequently developed to analyse ten paired neonatal-maternal samples. Analysing the variable fragment of the ITS region allowed the identification of F. nucleatum subsp. polymorphum from an oral origin as potentially being involved in neonatal infections. Using a strain-specific primer, the F. nucleatum subsp. polymorphum strain was detected in both neonatal gastric aspirates and maternal oral samples in cases of preterm birth from mothers presenting with localized periodontal pockets. Interestingly, the same strain was not present in the vaginal sample of any case investigated. The 16S-23S rRNA

  9. Non-coding RNA in Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Chen Zhongzhong; Wang Liangyan; Lin Jun; Tian Bing; Hua Yuejin

    2006-01-01

    Researches on DNA damage and repair pathways of Deinococcus radiodurans show its extreme resistance to ionizing radiation, ultraviolet radiation and reactive oxygen species. Non-coding (ncRNA) RNAs are involved in a variety of processes such as transcriptional regulations, RNA processing and modification, mRNA translation, protein transportation and stability. The conserved secondary structures of intergenic regions of Deinococcus radiodurans R1 were predicted using Stochastic Context Free Grammar (SCFG) scan strategy. Results showed that 28 ncRNA families were present in the non-coding regions of the genome of Deinococcus radiodurans R1. Among these families, IRE is the largest family, followed by Histone3, tRNA, SECIS. DicF, ctRNA-pGA1 and tmRNA are one discovered in bacteria. Results from the comparison with other organisms showed that these ncRNA can be applied to the study of biological function of Deinococcus radiodurans and supply reference for the further study of DNA damage and repair mechanisms of this bacterium. (authors)

  10. Detecting non-coding selective pressure in coding regions

    Directory of Open Access Journals (Sweden)

    Blanchette Mathieu

    2007-02-01

    Full Text Available Abstract Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements.

  11. The Intertwining of Transposable Elements and Non-Coding RNAs

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    2013-06-01

    Full Text Available Growing evidence shows a close association of transposable elements (TE with non-coding RNAs (ncRNA, and a significant number of small ncRNAs originate from TEs. Further, ncRNAs linked with TE sequences participate in a wide-range of regulatory functions. Alu elements in particular are critical players in gene regulation and molecular pathways. Alu sequences embedded in both long non-coding RNAs (lncRNA and mRNAs form the basis of targeted mRNA decay via short imperfect base-pairing. Imperfect pairing is prominent in most ncRNA/target RNA interactions and found throughout all biological kingdoms. The piRNA-Piwi complex is multifunctional, but plays a major role in protection against invasion by transposons. This is an RNA-based genetic immune system similar to the one found in prokaryotes, the CRISPR system. Thousands of long intergenic non-coding RNAs (lincRNAs are associated with endogenous retrovirus LTR transposable elements in human cells. These TEs can provide regulatory signals for lincRNA genes. A surprisingly large number of long circular ncRNAs have been discovered in human fibroblasts. These serve as “sponges” for miRNAs. Alu sequences, encoded in introns that flank exons are proposed to participate in RNA circularization via Alu/Alu base-pairing. Diseases are increasingly found to have a TE/ncRNA etiology. A single point mutation in a SINE/Alu sequence in a human long non-coding RNA leads to brainstem atrophy and death. On the other hand, genomic clusters of repeat sequences as well as lncRNAs function in epigenetic regulation. Some clusters are unstable, which can lead to formation of diseases such as facioscapulohumeral muscular dystrophy. The future may hold more surprises regarding diseases associated with ncRNAs andTEs.

  12. Non-coding sequence retrieval system for comparative genomic analysis of gene regulatory elements

    Directory of Open Access Journals (Sweden)

    Temple Matthew H

    2007-03-01

    Full Text Available Abstract Background Completion of the human genome sequence along with other species allows for greater understanding of the biochemical mechanisms and processes that govern healthy as well as diseased states. The large size of the genome sequences has made them difficult to study using traditional methods. There are many studies focusing on the protein coding sequences, however, not much is known about the function of non-coding regions of the genome. It has been demonstrated that parts of the non-coding region play a critical role as gene regulatory elements. Enhancers that regulate transcription processes have been found in intergenic regions. Furthermore, it is observed that regulatory elements found in non-coding regions are highly conserved across different species. However, the analysis of these regulatory elements is not as straightforward as it may first seem. The development of a centralized resource that allows for the quick and easy retrieval of non-coding sequences from multiple species and is capable of handing multi-gene queries is critical for the analysis of non-coding sequences. Here we describe the development of a web-based non-coding sequence retrieval system. Results This paper presents a Non-Coding Sequences Retrieval System (NCSRS. The NCSRS is a web-based bioinformatics tool that performs fast and convenient retrieval of non-coding and coding sequences from multiple species related to a specific gene or set of genes. This tool has compiled resources from multiple sources into one easy to use and convenient web based interface. With no software installation necessary, the user needs only internet access to use this tool. Conclusion The unique features of this tool will be very helpful for those studying gene regulatory elements that exist in non-coding regions. The web based application can be accessed on the internet at: http://cell.rutgers.edu/ncsrs/.

  13. Comparative phylogenetic analysis of intergenic spacers and small ...

    African Journals Online (AJOL)

    Two microsporidian isolates extracted from infected tasar silkworms (Antheraea mylitta) collected from forest area in Deoghar district, Jharkhand, India were subjected to PCR amplification using intergenic spacer (IGS) region and small subunit rRNA (SSU-rRNA) gene specific primers followed by cloning and sequencing.

  14. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals. © 2015 The Authors.

  15. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  17. Long non-coding RNA HOTAIR promotes glioblastoma cell cycle progression in an EZH2 dependent manner

    OpenAIRE

    Zhang, Kailiang; Sun, Xiaotian; Zhou, Xuan; Han, Lei; Chen, Luyue; Shi, Zhendong; Zhang, Anling; Ye, Minhua; Wang, Qixue; Liu, Chaoyong; Wei, Jianwei; Ren, Yu; Yang, Jingxuan; Zhang, Jianning; Pu, Peiyu

    2014-01-01

    The long non-coding RNA Hox transcript antisense intergenic RNA (HOTAIR) was recently implicated in breast cancer metastasis and is predictive of poor prognosis in colorectal and pancreatic cancers. We recently discovered that HOTAIR is a cell cycle-related lncRNA in human glioma, and its expression is closely associated with glioma staging and poor prognosis. Although lysine specific demethylase 1 (LSD1) and polycomb repressive complex 2 (PRC2) have been demonstrated to be functional targets...

  18. Sigma: multiple alignment of weakly-conserved non-coding DNA sequence

    Directory of Open Access Journals (Sweden)

    Siddharthan Rahul

    2006-03-01

    Full Text Available Abstract Background Existing tools for multiple-sequence alignment focus on aligning protein sequence or protein-coding DNA sequence, and are often based on extensions to Needleman-Wunsch-like pairwise alignment methods. We introduce a new tool, Sigma, with a new algorithm and scoring scheme designed specifically for non-coding DNA sequence. This problem acquires importance with the increasing number of published sequences of closely-related species. In particular, studies of gene regulation seek to take advantage of comparative genomics, and recent algorithms for finding regulatory sites in phylogenetically-related intergenic sequence require alignment as a preprocessing step. Much can also be learned about evolution from intergenic DNA, which tends to evolve faster than coding DNA. Sigma uses a strategy of seeking the best possible gapless local alignments (a strategy earlier used by DiAlign, at each step making the best possible alignment consistent with existing alignments, and scores the significance of the alignment based on the lengths of the aligned fragments and a background model which may be supplied or estimated from an auxiliary file of intergenic DNA. Results Comparative tests of sigma with five earlier algorithms on synthetic data generated to mimic real data show excellent performance, with Sigma balancing high "sensitivity" (more bases aligned with effective filtering of "incorrect" alignments. With real data, while "correctness" can't be directly quantified for the alignment, running the PhyloGibbs motif finder on pre-aligned sequence suggests that Sigma's alignments are superior. Conclusion By taking into account the peculiarities of non-coding DNA, Sigma fills a gap in the toolbox of bioinformatics.

  19. Single nucleotide polymorphisms with cis-regulatory effects on long non-coding transcripts in human primary monocytes.

    Directory of Open Access Journals (Sweden)

    Jonas Carlsson Almlöf

    Full Text Available We applied genome-wide allele-specific expression analysis of monocytes from 188 samples. Monocytes were purified from white blood cells of healthy blood donors to detect cis-acting genetic variation that regulates the expression of long non-coding RNAs. We analysed 8929 regions harboring genes for potential long non-coding RNA that were retrieved from data from the ENCODE project. Of these regions, 60% were annotated as intergenic, which implies that they do not overlap with protein-coding genes. Focusing on the intergenic regions, and using stringent analysis of the allele-specific expression data, we detected robust cis-regulatory SNPs in 258 out of 489 informative intergenic regions included in the analysis. The cis-regulatory SNPs that were significantly associated with allele-specific expression of long non-coding RNAs were enriched to enhancer regions marked for active or bivalent, poised chromatin by histone modifications. Out of the lncRNA regions regulated by cis-acting regulatory SNPs, 20% (n = 52 were co-regulated with the closest protein coding gene. We compared the identified cis-regulatory SNPs with those in the catalog of SNPs identified by genome-wide association studies of human diseases and traits. This comparison identified 32 SNPs in loci from genome-wide association studies that displayed a strong association signal with allele-specific expression of non-coding RNAs in monocytes, with p-values ranging from 6.7×10(-7 to 9.5×10(-89. The identified cis-regulatory SNPs are associated with diseases of the immune system, like multiple sclerosis and rheumatoid arthritis.

  20. Non-coding RNAs and gastric cancer

    Science.gov (United States)

    Li, Pei-Fei; Chen, Sheng-Can; Xia, Tian; Jiang, Xiao-Ming; Shao, Yong-Fu; Xiao, Bing-Xiu; Guo, Jun-Ming

    2014-01-01

    Non-coding RNAs (ncRNAs) play key roles in development, proliferation, differentiation and apoptosis. Altered ncRNA expression is associated with gastric cancer occurrence, invasion, and metastasis. Moreover, aberrant expression of microRNAs (miRNAs) is significantly related to gastric cancer tumor stage, size, differentiation and metastasis. MiRNAs interrupt cellular signaling pathways, inhibit the activity of tumor suppressor genes, and affect the cell cycle in gastric cancer cells. Some miRNAs, including miR-21, miR-106a and miR-421, could be potential markers for the diagnosis of gastric cancer. Long non-coding RNAs (lncRNAs), a new research hotspot among cancer-associated ncRNAs, play important roles in epigenetic, transcriptional and post-transcriptional regulation. Several gastric cancer-associated lncRNAs, such as CCAT1, GACAT1, H19, and SUMO1P3, have been explored. In addition, Piwi-interacting RNAs, another type of small ncRNA that is recognized by gastroenterologists, are involved in gastric carcinogenesis, and piR-651/823 represents an efficient diagnostic biomarker of gastric cancer that can be detected in the blood and gastric juice. Small interfering RNAs also function in post-transcriptional regulation in gastric cancer and might be useful in gastric cancer treatment. PMID:24833871

  1. The long non-coding RNA TUG1 indicates a poor prognosis for colorectal cancer and promotes metastasis by affecting epithelial-mesenchymal transition

    OpenAIRE

    Sun, Junfeng; Ding, Chaohui; Yang, Zhen; Liu, Tao; Zhang, Xiefu; Zhao, Chunlin; Wang, Jiaxiang

    2016-01-01

    Background Long intergenic non-coding RNAs (lncRNAs) are a class of non-coding RNAs that are involved in gene expression regulation. Taurine up-regulated gene 1 (TUG1) is a cancer progression related lncRNA in some tumor oncogenesis; however, its role in colorectal cancer (CRC) remains unclear. In this study, we determined the expression patterns of TUG1 in CRC patients and explored its effect on CRC cell metastasis using cultured representative CRC cell lines. Methods The expression levels o...

  2. Non-coding chloroplast regions analysis within the Orchidaceae family in Southern Ecuador

    Directory of Open Access Journals (Sweden)

    Ludeña Bertha

    2016-01-01

    Full Text Available Non-coding regions of the chloroplast genome offer interesting levels of nucleotide variation which are very useful for molecular genetics, population and phylogenetic analysis. The family Orchidaceae is represented by ca. 500 species in Southern Ecuador. In order to determine the genetic variability present in members of this family belonging to the genera Cyrtochilum, Masdevallia, Epidendrum, Polystachya, Stelis and Zelenchoa, we have analyzed four chloroplastic intergenic spacers: atpH - atpI, trnL - trnF, trnF- ndhJ and rps16 - trnQ. All these markers have shown high richness in simple sequence repeats (SSR, indels and substitutions. They resulted to be useful for species identification, phylogenetic analysis and population structure studies. Moreover the information provided by this analysis suggests that the endemic species Masdevallia deformis must be considered vulnerable and conservation strategies need to be adopted for its protection.

  3. Critical evaluation of the FANTOM3 non-coding RNA transcripts

    DEFF Research Database (Denmark)

    Nordström, Karl J V; Mirza, Majd A I; Almén, Markus Sällman

    2009-01-01

    We studied the genomic positions of 38,129 putative ncRNAs from the RIKEN dataset in relation to protein-coding genes. We found that the dataset has 41% sense, 6% antisense, 24% intronic and 29% intergenic transcripts. Interestingly, 17,678 (47%) of the FANTOM3 transcripts were found to potentially......-coding genes, did not contain ORFs longer than 100 residues and were not internally primed. This dataset contains 53% of the FANTOM3 transcripts associated to known ncRNA in RNAdb and expands previous similar efforts with 6523 novel transcripts. This bioinformatic filtering of the FANTOM3 non-coding dataset...... be internally primed from longer transcripts. The highest fraction of these transcripts was found among the intronic transcripts and as many as 77% or 6929 intronic transcripts were both internally primed and unspliced. We defined a filtered subset of 8535 transcripts that did not overlap with protein...

  4. Estradiol-Induced Transcriptional Regulation of Long Non-Coding RNA, HOTAIR.

    Science.gov (United States)

    Bhan, Arunoday; Mandal, Subhrangsu S

    2016-01-01

    HOTAIR (HOX antisense intergenic RNA) is a 2.2 kb long non-coding RNA (lncRNA), transcribed from the antisense strand of homeobox C (HOXC) gene locus in chromosome 12. HOTAIR acts as a scaffolding lncRNA. It interacts and guides various chromatin-modifying complexes such as PRC2 (polycomb-repressive complex 2) and LSD1 (lysine-specific demethylase 1) to the target gene promoters leading to their gene silencing. Various studies have demonstrated that HOTAIR overexpression is associated with breast cancer. Recent studies from our laboratory demonstrate that HOTAIR is required for viability of breast cancer cells and is transcriptionally regulated by estradiol (E2) in vitro and in vivo. This chapter describes protocols for analysis of the HOTAIR promoter, cloning, transfection and dual luciferase assays, knockdown of protein synthesis by antisense oligonucleotides, and chromatin immunoprecipitation (ChIP) assay. These protocols are useful for studying the estrogen-mediated transcriptional regulation of lncRNA HOTAIR, as well as other protein coding genes and non-coding RNAs.

  5. Behind the curtain of non-coding RNAs; long non-coding RNAs regulating hepatocarcinogenesis

    Science.gov (United States)

    El Khodiry, Aya; Afify, Menna; El Tayebi, Hend M

    2018-01-01

    Hepatocellular carcinoma (HCC) is one of the most common and aggressive cancers worldwide. HCC is the fifth common malignancy in the world and the second leading cause of cancer death in Asia. Long non-coding RNAs (lncRNAs) are RNAs with a length greater than 200 nucleotides that do not encode proteins. lncRNAs can regulate gene expression and protein synthesis in several ways by interacting with DNA, RNA and proteins in a sequence specific manner. They could regulate cellular and developmental processes through either gene inhibition or gene activation. Many studies have shown that dysregulation of lncRNAs is related to many human diseases such as cardiovascular diseases, genetic disorders, neurological diseases, immune mediated disorders and cancers. However, the study of lncRNAs is challenging as they are poorly conserved between species, their expression levels aren’t as high as that of mRNAs and have great interpatient variations. The study of lncRNAs expression in cancers have been a breakthrough as it unveils potential biomarkers and drug targets for cancer therapy and helps understand the mechanism of pathogenesis. This review discusses many long non-coding RNAs and their contribution in HCC, their role in development, metastasis, and prognosis of HCC and how to regulate and target these lncRNAs as a therapeutic tool in HCC treatment in the future. PMID:29434445

  6. Non-Coding RNAs in Pediatric Airway Diseases

    Directory of Open Access Journals (Sweden)

    Beata Narożna

    2017-11-01

    Full Text Available Non-coding RNAs (ncRNAs are involved in the regulation of numerous biological processes and pathways and therefore have been extensively studied in human diseases. Previous reports have shown that non-coding RNAs play a crucial role in the pathogenesis and aberrant regulation of respiratory diseases. The altered expression of microRNAs (miRNAs and long non-coding RNAs in blood and also locally in sputum or exhaled breath condensate influences lung function, immune response, and disease phenotype and may be used for the development of biomarkers specific for airway disease. In this review, we provide an overview of the recent works studying the non-coding RNAs in airway diseases, with a particular focus on chronic respiratory diseases of childhood. We have chosen the most common chronic respiratory condition—asthma—and the most severe, chronic disease of the airways—cystic fibrosis. Study of the altered expression of non-coding RNAs in these diseases may be key to better understanding their pathogenesis and improving diagnosis, while also holding promise for the development of therapeutic strategies using the regulatory potential of non-coding RNAs.

  7. Annotating pathogenic non-coding variants in genic regions.

    Science.gov (United States)

    Gelfman, Sahar; Wang, Quanli; McSweeney, K Melodi; Ren, Zhong; La Carpia, Francesca; Halvorsen, Matt; Schoch, Kelly; Ratzon, Fanni; Heinzen, Erin L; Boland, Michael J; Petrovski, Slavé; Goldstein, David B

    2017-08-09

    Identifying the underlying causes of disease requires accurate interpretation of genetic variants. Current methods ineffectively capture pathogenic non-coding variants in genic regions, resulting in overlooking synonymous and intronic variants when searching for disease risk. Here we present the Transcript-inferred Pathogenicity (TraP) score, which uses sequence context alterations to reliably identify non-coding variation that causes disease. High TraP scores single out extremely rare variants with lower minor allele frequencies than missense variants. TraP accurately distinguishes known pathogenic and benign variants in synonymous (AUC = 0.88) and intronic (AUC = 0.83) public datasets, dismissing benign variants with exceptionally high specificity. TraP analysis of 843 exomes from epilepsy family trios identifies synonymous variants in known epilepsy genes, thus pinpointing risk factors of disease from non-coding sequence data. TraP outperforms leading methods in identifying non-coding variants that are pathogenic and is therefore a valuable tool for use in gene discovery and the interpretation of personal genomes.While non-coding synonymous and intronic variants are often not under strong selective constraint, they can be pathogenic through affecting splicing or transcription. Here, the authors develop a score that uses sequence context alterations to predict pathogenicity of synonymous and non-coding genetic variants, and provide a web server of pre-computed scores.

  8. Long Non-coding RNA Linc-ROR Is Upregulated in Papillary Thyroid Carcinoma.

    Science.gov (United States)

    Zhang, Ranran; Hardin, Heather; Huang, Wei; Buehler, Darya; Lloyd, Ricardo V

    2018-03-01

    Long non-coding RNAs (lncRNAs) may contribute to carcinogenesis and tumor progression by regulating transcription and gene expression. The role of lncRNAs in the regulation of thyroid cancer progression is being extensively examined. Here, we analyzed three lncRNAs that were overexpressed in papillary thyroid carcinomas, long intergenic non-protein coding RNA, regulator of reprogramming (Linc-ROR, ROR) PVT1 oncogene (PVT1), and HOX transcript antisense intergenic RNA (HOTAIR) to determine their roles in thyroid tumor development and progression. ROR expression has not been previously examined in thyroid carcinomas. Tissue microarrays (TMAs) of formalin-fixed paraffin-embedded tissue sections from 129 thyroid cases of benign and malignant tissues were analyzed by in situ hybridization (ISH), automated image analysis, and real-time PCR. All three lncRNAs were most highly expressed in the nuclei of PTCs. SiRNA experiments with a PTC cell line, TPC1, showed inhibition of proliferation with siRNAs for all three lncRNAs while invasion was inhibited with siRNAs for ROR and HOTAIR. SiRNA experiments with ROR also led to increased expression of miR-145, supporting the role of ROR as an endogenous miR-145 sponge. After treatment with TGF-β, there was increased expression of ROR, PVT1, and HOTAIR in the PTC1 cell line compared to control groups, indicating an induction of their expression during epithelial to mesenchymal transition (EMT). These results indicate that ROR, PVT1, and HOTAIR have important regulatory roles during the development of PTCs.

  9. nocoRNAc: Characterization of non-coding RNAs in prokaryotes

    Directory of Open Access Journals (Sweden)

    Nieselt Kay

    2011-01-01

    Full Text Available Abstract Background The interest in non-coding RNAs (ncRNAs constantly rose during the past few years because of the wide spectrum of biological processes in which they are involved. This led to the discovery of numerous ncRNA genes across many species. However, for most organisms the non-coding transcriptome still remains unexplored to a great extent. Various experimental techniques for the identification of ncRNA transcripts are available, but as these methods are costly and time-consuming, there is a need for computational methods that allow the detection of functional RNAs in complete genomes in order to suggest elements for further experiments. Several programs for the genome-wide prediction of functional RNAs have been developed but most of them predict a genomic locus with no indication whether the element is transcribed or not. Results We present NOCORNAc, a program for the genome-wide prediction of ncRNA transcripts in bacteria. NOCORNAc incorporates various procedures for the detection of transcriptional features which are then integrated with functional ncRNA loci to determine the transcript coordinates. We applied RNAz and NOCORNAc to the genome of Streptomyces coelicolor and detected more than 800 putative ncRNA transcripts most of them located antisense to protein-coding regions. Using a custom design microarray we profiled the expression of about 400 of these elements and found more than 300 to be transcribed, 38 of them are predicted novel ncRNA genes in intergenic regions. The expression patterns of many ncRNAs are similarly complex as those of the protein-coding genes, in particular many antisense ncRNAs show a high expression correlation with their protein-coding partner. Conclusions We have developed NOCORNAc, a framework that facilitates the automated characterization of functional ncRNAs. NOCORNAc increases the confidence of predicted ncRNA loci, especially if they contain transcribed ncRNAs. NOCORNAc is not restricted to

  10. Roles of Non-Coding RNA in Sugarcane-Microbe Interaction.

    Science.gov (United States)

    Thiebaut, Flávia; Rojas, Cristian A; Grativol, Clícia; Calixto, Edmundo P da R; Motta, Mariana R; Ballesteros, Helkin G F; Peixoto, Barbara; de Lima, Berenice N S; Vieira, Lucas M; Walter, Maria Emilia; de Armas, Elvismary M; Entenza, Júlio O P; Lifschitz, Sergio; Farinelli, Laurent; Hemerly, Adriana S; Ferreira, Paulo C G

    2017-12-20

    Studies have highlighted the importance of non-coding RNA regulation in plant-microbe interaction. However, the roles of sugarcane microRNAs (miRNAs) in the regulation of disease responses have not been investigated. Firstly, we screened the sRNA transcriptome of sugarcane infected with Acidovorax avenae . Conserved and novel miRNAs were identified. Additionally, small interfering RNAs (siRNAs) were aligned to differentially expressed sequences from the sugarcane transcriptome. Interestingly, many siRNAs aligned to a transcript encoding a copper-transporter gene whose expression was induced in the presence of A. avenae , while the siRNAs were repressed in the presence of A. avenae . Moreover, a long intergenic non-coding RNA was identified as a potential target or decoy of miR408. To extend the bioinformatics analysis, we carried out independent inoculations and the expression patterns of six miRNAs were validated by quantitative reverse transcription-PCR (qRT-PCR). Among these miRNAs, miR408-a copper-microRNA-was downregulated. The cleavage of a putative miR408 target, a laccase, was confirmed by a modified 5'RACE (rapid amplification of cDNA ends) assay. MiR408 was also downregulated in samples infected with other pathogens, but it was upregulated in the presence of a beneficial diazotrophic bacteria. Our results suggest that regulation by miR408 is important in sugarcane sensing whether microorganisms are either pathogenic or beneficial, triggering specific miRNA-mediated regulatory mechanisms accordingly.

  11. Identification and functional characterization of small non-coding RNAs in Xanthomonas oryzae pathovar oryzae

    Directory of Open Access Journals (Sweden)

    Zhang Jie-Qiong

    2011-01-01

    Full Text Available Abstract Background Small non-coding RNAs (sRNAs are regarded as important regulators in prokaryotes and play essential roles in diverse cellular processes. Xanthomonas oryzae pathovar oryzae (Xoo is an important plant pathogenic bacterium which causes serious bacterial blight of rice. However, little is known about the number, genomic distribution and biological functions of sRNAs in Xoo. Results Here, we performed a systematic screen to identify sRNAs in the Xoo strain PXO99. A total of 850 putative non-coding RNA sequences originated from intergenic and gene antisense regions were identified by cloning, of which 63 were also identified as sRNA candidates by computational prediction, thus were considered as Xoo sRNA candidates. Northern blot hybridization confirmed the size and expression of 6 sRNA candidates and other 2 cloned small RNA sequences, which were then added to the sRNA candidate list. We further examined the expression profiles of the eight sRNAs in an hfq deletion mutant and found that two of them showed drastically decreased expression levels, and another exhibited an Hfq-dependent transcript processing pattern. Deletion mutants were obtained for seven of the Northern confirmed sRNAs, but none of them exhibited obvious phenotypes. Comparison of the proteomic differences between three of the ΔsRNA mutants and the wild-type strain by two-dimensional gel electrophoresis (2-DE analysis showed that these sRNAs are involved in multiple physiological and biochemical processes. Conclusions We experimentally verified eight sRNAs in a genome-wide screen and uncovered three Hfq-dependent sRNAs in Xoo. Proteomics analysis revealed Xoo sRNAs may take part in various metabolic processes. Taken together, this work represents the first comprehensive screen and functional analysis of sRNAs in rice pathogenic bacteria and facilitates future studies on sRNA-mediated regulatory networks in this important phytopathogen.

  12. Roles of Non-Coding RNA in Sugarcane-Microbe Interaction

    Directory of Open Access Journals (Sweden)

    Flávia Thiebaut

    2017-12-01

    Full Text Available Studies have highlighted the importance of non-coding RNA regulation in plant-microbe interaction. However, the roles of sugarcane microRNAs (miRNAs in the regulation of disease responses have not been investigated. Firstly, we screened the sRNA transcriptome of sugarcane infected with Acidovorax avenae. Conserved and novel miRNAs were identified. Additionally, small interfering RNAs (siRNAs were aligned to differentially expressed sequences from the sugarcane transcriptome. Interestingly, many siRNAs aligned to a transcript encoding a copper-transporter gene whose expression was induced in the presence of A. avenae, while the siRNAs were repressed in the presence of A. avenae. Moreover, a long intergenic non-coding RNA was identified as a potential target or decoy of miR408. To extend the bioinformatics analysis, we carried out independent inoculations and the expression patterns of six miRNAs were validated by quantitative reverse transcription-PCR (qRT-PCR. Among these miRNAs, miR408—a copper-microRNA—was downregulated. The cleavage of a putative miR408 target, a laccase, was confirmed by a modified 5′RACE (rapid amplification of cDNA ends assay. MiR408 was also downregulated in samples infected with other pathogens, but it was upregulated in the presence of a beneficial diazotrophic bacteria. Our results suggest that regulation by miR408 is important in sugarcane sensing whether microorganisms are either pathogenic or beneficial, triggering specific miRNA-mediated regulatory mechanisms accordingly.

  13. Non-coding RNAs in skin cancers: An update

    Directory of Open Access Journals (Sweden)

    Shivani B. Kaushik, MD

    2016-10-01

    Full Text Available Skin cancers are the most common form of cancer in humans. They can largely be categorized into Melanoma and Non-melanoma skin cancers. The latter mainly includes Squamous Cell Carcinoma (SCC and Basal Cell Carcinoma (BCC, and have a higher incidence than melanomas. There has been a recent emergence of interest in the role of non-coding RNA's in pathogenesis of skin cancers. The transcripts which lack any protein coding capacity are called non-coding RNA. These non-coding RNA are further classified based on their length; small non-coding RNA (200 nucleotides. ncRNA They are involved at multiple transcriptional, post transcriptional and epigenetic levels, modulating cell proliferation, angiogenesis, senescence and apoptosis. Their expression pattern has also been linked to metastases, drug resistance and long term prognosis. They have both diagnostic and prognostic significance for skin cancers, and can also be a target for future therapies for cutaneous malignancies. More research is needed to further utilize their potential as therapeutic targets. Keywords: Skin cancer, Non-coding RNA's, miRNA, Cell proliferation, Invasion, Metastasis

  14. Deregulation of the non-coding genome in leukemia.

    Science.gov (United States)

    Teppo, Susanna; Heinäniemi, Merja; Lohi, Olli

    2017-07-03

    Methodological advances that allow deeper characterization of non-coding elements in the genome have started to reveal the full spectrum of deregulation in cancer. We generated an inducible cell model to track transcriptional changes after induction of a well-known leukemia-inducing fusion gene, ETV6-RUNX1. Our data revealed widespread transcriptional alterations outside coding elements in the genome. This adds to the growing list of various alterations in the non-coding genome in cancer and pinpoints their role in diseased cellular state.

  15. CoRAL: predicting non-coding RNAs from small RNA-sequencing data.

    Science.gov (United States)

    Leung, Yuk Yee; Ryvkin, Paul; Ungar, Lyle H; Gregory, Brian D; Wang, Li-San

    2013-08-01

    The surprising observation that virtually the entire human genome is transcribed means we know little about the function of many emerging classes of RNAs, except their astounding diversities. Traditional RNA function prediction methods rely on sequence or alignment information, which are limited in their abilities to classify the various collections of non-coding RNAs (ncRNAs). To address this, we developed Classification of RNAs by Analysis of Length (CoRAL), a machine learning-based approach for classification of RNA molecules. CoRAL uses biologically interpretable features including fragment length and cleavage specificity to distinguish between different ncRNA populations. We evaluated CoRAL using genome-wide small RNA sequencing data sets from four human tissue types and were able to classify six different types of RNAs with ∼80% cross-validation accuracy. Analysis by CoRAL revealed that microRNAs, small nucleolar and transposon-derived RNAs are highly discernible and consistent across all human tissue types assessed, whereas long intergenic ncRNAs, small cytoplasmic RNAs and small nuclear RNAs show less consistent patterns. The ability to reliably annotate loci across tissue types demonstrates the potential of CoRAL to characterize ncRNAs using small RNA sequencing data in less well-characterized organisms.

  16. Increased pathogenicity of rabies virus due to modification of a non-coding region.

    Science.gov (United States)

    Virojanapirom, Phatthamon; Yamada, Kentaro; Khawplod, Pakamatz; Nishizono, Akira; Hemachudha, Thiravat

    2016-11-01

    Sub-passaging of QS-05, a street rabies virus (RABV) isolate, in non-neuronal cells resulted in a virus with higher pathogenicity, QS-BHK-P7. Four full-length cDNA plasmids were constructed and the corresponding recombinant viruses were recovered: rQS-05, rQS-BHK-P7 and rQS05-2475G/rQS-BHK-P7-2475A (made by switching of intergenic P-M between these two backbones). rQS-BHK-P7-2475 A virus had eight instead of seven adenosines in its poly(A) sequence. Interestingly, mutant viruses with 6 or 8 adenosines infected more neuroblastoma cells than their parental ones. Mice that were infected intracerebrally and intramuscularly with rQS05-2475G and rQS-BHK-P7 exhibited highest mortality. However, mice infected with rQS-BHK-P7-2475AA had the shortest survival time. This study demonstrates that modifications in the non-coding region may play a role in determining the virulence of RABV.

  17. An atlas of human long non-coding RNAs with accurate 5′ ends

    KAUST Repository

    Hon, Chung-Chau

    2017-02-28

    Long non-coding RNAs (lncRNAs) are largely heterogeneous and functionally uncharacterized. Here, using FANTOM5 cap analysis of gene expression (CAGE) data, we integrate multiple transcript collections to generate a comprehensive atlas of 27,919 human lncRNA genes with high-confidence 5′ ends and expression profiles across 1,829 samples from the major human primary cell types and tissues. Genomic and epigenomic classification of these lncRNAs reveals that most intergenic lncRNAs originate from enhancers rather than from promoters. Incorporating genetic and expression data, we show that lncRNAs overlapping trait-associated single nucleotide polymorphisms are specifically expressed in cell types relevant to the traits, implicating these lncRNAs in multiple diseases. We further demonstrate that lncRNAs overlapping expression quantitative trait loci (eQTL)-associated single nucleotide polymorphisms of messenger RNAs are co-expressed with the corresponding messenger RNAs, suggesting their potential roles in transcriptional regulation. Combining these findings with conservation data, we identify 19,175 potentially functional lncRNAs in the human genome.

  18. Non-coding RNAs in cancer brain metastasis

    Science.gov (United States)

    Wu, Kerui; Sharma, Sambad; Venkat, Suresh; Liu, Keqin; Zhou, Xiaobo; Watabe, Kounosuke

    2017-01-01

    More than 90% of cancer death is attributed to metastatic disease, and the brain is one of the major metastatic sites of melanoma, colon, renal, lung and breast cancers. Despite the recent advancement of targeted therapy for cancer, the incidence of brain metastasis is increasing. One reason is that most therapeutic drugs can’t penetrate blood-brain-barrier and tumor cells find the brain as sanctuary site. In this review, we describe the pathophysiology of brain metastases to introduce the latest understandings of metastatic brain malignancies. This review also particularly focuses on non-coding RNAs and their roles in cancer brain metastasis. Furthermore, we discuss the roles of the extracellular vesicles as they are known to transport information between cells to initiate cancer cell-microenvironment communication. The potential clinical translation of non-coding RNAs as a tool for diagnosis and for treatment is also discussed in this review. At the end, the computational aspects of non-coding RNA detection, the sequence and structure calculation and epigenetic regulation of non-coding RNA in brain metastasis are discussed. PMID:26709907

  19. Functional long non-coding RNA transcription in Schizosaccharomyces pombe

    OpenAIRE

    Ard, Ryan Anthony

    2016-01-01

    Eukaryotic genomes are pervasively transcribed and frequently generate long noncoding RNAs (lncRNAs). However, most lncRNAs remain uncharacterized. In this work, a set of positionally conserved intergenic lncRNAs in the fission yeast Schizosaccharomyces pombe genome are selected for further analysis. Deleting one of these lncRNA genes (ncRNA.1343) exhibited a clear phenotype: increased drug sensitivity. Further analyses revealed that deleting ncRNA.1343 also disrupted a prev...

  20. Therapeutic targeting of non-coding RNAs in cancer

    Czech Academy of Sciences Publication Activity Database

    Slabý, O.; Laga, Richard; Sedláček, Ondřej

    2017-01-01

    Roč. 474, č. 24 (2017), s. 4219-4251 ISSN 0264-6021 R&D Projects: GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61389013 Keywords : non-coding RNA * RNA delivery * polymer carriers Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemical research methods Impact factor: 3.797, year: 2016

  1. Non-coding RNAs in the Ovarian Follicle

    Directory of Open Access Journals (Sweden)

    Rosalia Battaglia

    2017-05-01

    Full Text Available The mammalian ovarian follicle is the complex reproductive unit comprising germ cell, somatic cells (Cumulus and Granulosa cells, and follicular fluid (FF: paracrine communication among the different cell types through FF ensures the development of a mature oocyte ready for fertilization. This paper is focused on non-coding RNAs in ovarian follicles and their predicted role in the pathways involved in oocyte growth and maturation. We determined the expression profiles of microRNAs in human oocytes and FF by high-throughput analysis and identified 267 microRNAs in FF and 176 in oocytes. Most of these were FF microRNAs, while 9 were oocyte specific. By bioinformatic analysis, independently performed on FF and oocyte microRNAs, we identified the most significant Biological Processes and the pathways regulated by their validated targets. We found many pathways shared between the two compartments and some specific for oocyte microRNAs. Moreover, we found 41 long non-coding RNAs able to interact with oocyte microRNAs and potentially involved in the regulation of folliculogenesis. These data are important in basic reproductive research and could also be useful for clinical applications. In fact, the characterization of non-coding RNAs in ovarian follicles could improve reproductive disease diagnosis, provide biomarkers of oocyte quality in Assisted Reproductive Treatment, and allow the development of therapies for infertility disorders.

  2. Incorporating Non-Coding Annotations into Rare Variant Analysis.

    Directory of Open Access Journals (Sweden)

    Tom G Richardson

    Full Text Available The success of collapsing methods which investigate the combined effect of rare variants on complex traits has so far been limited. The manner in which variants within a gene are selected prior to analysis has a crucial impact on this success, which has resulted in analyses conventionally filtering variants according to their consequence. This study investigates whether an alternative approach to filtering, using annotations from recently developed bioinformatics tools, can aid these types of analyses in comparison to conventional approaches.We conducted a candidate gene analysis using the UK10K sequence and lipids data, filtering according to functional annotations using the resource CADD (Combined Annotation-Dependent Depletion and contrasting results with 'nonsynonymous' and 'loss of function' consequence analyses. Using CADD allowed the inclusion of potentially deleterious intronic variants, which was not possible when filtering by consequence. Overall, different filtering approaches provided similar evidence of association, although filtering according to CADD identified evidence of association between ANGPTL4 and High Density Lipoproteins (P = 0.02, N = 3,210 which was not observed in the other analyses. We also undertook genome-wide analyses to determine how filtering in this manner compared to conventional approaches for gene regions. Results suggested that filtering by annotations according to CADD, as well as other tools known as FATHMM-MKL and DANN, identified association signals not detected when filtering by variant consequence and vice versa.Incorporating variant annotations from non-coding bioinformatics tools should prove to be a valuable asset for rare variant analyses in the future. Filtering by variant consequence is only possible in coding regions of the genome, whereas utilising non-coding bioinformatics annotations provides an opportunity to discover unknown causal variants in non-coding regions as well. This should allow

  3. Annotating non-coding regions of the genome.

    Science.gov (United States)

    Alexander, Roger P; Fang, Gang; Rozowsky, Joel; Snyder, Michael; Gerstein, Mark B

    2010-08-01

    Most of the human genome consists of non-protein-coding DNA. Recently, progress has been made in annotating these non-coding regions through the interpretation of functional genomics experiments and comparative sequence analysis. One can conceptualize functional genomics analysis as involving a sequence of steps: turning the output of an experiment into a 'signal' at each base pair of the genome; smoothing this signal and segmenting it into small blocks of initial annotation; and then clustering these small blocks into larger derived annotations and networks. Finally, one can relate functional genomics annotations to conserved units and measures of conservation derived from comparative sequence analysis.

  4. [Non-coding RNA in fungi--a review].

    Science.gov (United States)

    Li, Liping; Luo, Yuping; Li, Siguang

    2013-08-04

    Non-coding RNAs (ncRNAs) existing widely in many living organisms are functional RNA molecules, function directly as structural or regulatory RNAs in organisms. Although large and diverse populations of ncRNAs have been extensively studied and well understood in animals and plants, few reports could be found about ncRNAs in fungi. Recently, with the development of modern biological techniques, a number of ncRNAs have been identified in fungi, including snoRNA-derived RNAs, long non-coding RNAs, small interfering RNAs (siRNAs), dsRNA Killer viruses, and novel classes of ncRNAs discovered in filamentous fungi. These ncRNAs play important roles in gene transcription and translation, RNA processing and modifying, chromatin structure, and even fungal pathogenicity. Therefore, studies on ncRNAs in fungi may shed light on the regulatory system of gene expression and the characteristics of fungal growth, and even provide some clues towards understanding pathogenic mechanisms of pathogenic fungi, which will contribute to the treatment of fungal diseases. Here, we reviewed the discovery of fungal ncRNAs, their origins and processing, classification, and biological functions, aiming to establish a theoretical foundation and basis for deep understanding of fungal ncRNAs in future.

  5. Comprehensive reconstruction andvisualization of non-coding regulatorynetworks in human

    Directory of Open Access Journals (Sweden)

    Vincenzo eBonnici

    2014-12-01

    Full Text Available Research attention has been powered to understand the functional roles of non-coding RNAs (ncRNAs. Many studies have demonstrated their deregulation in cancer and other human disorders. ncRNAs are also present in extracellular human body fluids such as serum and plasma, giving them a great potential as non-invasive biomarkers. However, non-coding RNAs have been relatively recently discovered and a comprehensive database including all of them is still missing. Reconstructing and visualizing the network of ncRNAs interactions are important steps to understand their regulatory mechanism in complex systems. This work presents ncRNA-DB, a NoSQL database that integrates ncRNAs data interactions from a large number of well established online repositories. The interactions involve RNA, DNA, proteins and diseases. ncRNA-DB is available at http://ncrnadb.scienze.univr.it/ncrnadb/. It is equipped with three interfaces: web based, command line and a Cytoscape app called ncINetView. By accessing only one resource, users can search for ncRNAs and their interactions, build a network annotated with all known ncRNAs and associated diseases, and use all visual and mining features available in Cytoscape.

  6. Long non-coding RNAs in aging organs and tissues.

    Science.gov (United States)

    Xing, Wenmin; Gao, Wenyan; Mao, Genxiang; Zhang, Jing; Lv, Xiaoling; Wang, Guofu; Yan, Jing

    2017-12-01

    The aging process directly impacts bodily functions on multiple levels, including a reduced ability to resist stress, damage and disease. Besides changes in metabolic control, the aging process coincides with the altered long non-coding RNAs (lncRNAs) expression, which are ≥200nt long class of non-protein coding RNAs. The majority of non-coding transcripts of mammalian organs and tissues are expressed in developmentally regulated and cell-type specific manners. Specific altered lncRNA level has been involved in induction and maintenance of the whole human body aging with highly specific spatial andtemporal expression patterns. Furthermore, many lncRNAs are transcribed in sense, antisense and bidirectional manners in the mammalian genome. They play a vital role in regulating organ or tissue differentiation during aging by binding with miRNA or proteins to act as a decoy. Recently, the correlation between lncRNAs and aging has been studied intensely. Here, we have summarized some examples of known and novel lncRNAs that have been implicated in the aging process in the whole mammalian body and we discuss these patterns, conservation and characters during aging. This may further promote the development of research on lncRNAs and the aging process. © 2017 John Wiley & Sons Australia, Ltd.

  7. Chromatin, Non-Coding RNAs, and the Expression of HIV

    Directory of Open Access Journals (Sweden)

    Jessica N. Groen

    2013-06-01

    Full Text Available HIV is a chronic viral infection affecting an estimated 34 million people worldwide. Current therapies employ the use of a cocktail of antiretroviral medications to reduce the spread and effects of HIV, however complete eradication from an individual currently remains unattainable. Viral latency and regulation of gene expression is a key consideration when developing effective treatments. While our understanding of these processes remains incomplete new developments suggest that non-coding RNA (ncRNA mediated regulation may provide an avenue to controlling both viral expression and latency. Here we discuss the importance of known regulatory mechanisms and suggest directions for further study, in particular the use ncRNAs in controlling HIV expression.

  8. Long Non-coding RNAs and Drug Resistance.

    Science.gov (United States)

    Pan, Jing-Jing; Xie, Xiao-Juan; Li, Xu; Chen, Wei

    2015-01-01

    Long non-coding RNAs (lncRNAs) are emerging as key players in gene expression that govern cell developmental processes, and thus contributing to diseases, especially cancers. Many studies have suggested that aberrant expression of lncRNAs is responsible for drug resistance, a substantial obstacle for cancer therapy. Drug resistance not only results from individual variations in patients, but also from genetic and epigenetic differences in tumors. It is reported that drug resistance is tightly modulated by lncRNAs which change the stability and translation of mRNAs encoding factors involved in cell survival, proliferation, and drug metabolism. In this review, we summarize recent advances in research on lncRNAs associated with drug resistance and underlying molecular or cellular mechanisms, which may contribute helpful approaches for the development of new therapeutic strategies to overcome treatment failure.

  9. Evaluation of Agency Non-Code Layered Pressure Vessels (LPVs)

    Science.gov (United States)

    Prosser, William H.

    2014-01-01

    In coordination with the Office of Safety and Mission Assurance and the respective Center Pressure System Managers (PSMs), the NASA Engineering and Safety Center (NESC) was requested to formulate a consensus draft proposal for the development of additional testing and analysis methods to establish the technical validity, and any limitation thereof, for the continued safe operation of facility non-code layered pressure vessels. The PSMs from each NASA Center were asked to participate as part of the assessment team by providing, collecting, and reviewing data regarding current operations of these vessels. This report contains the outcome of the assessment and the findings, observations, and NESC recommendations to the Agency and individual NASA Centers.

  10. Non-coding RNAs Functioning in Colorectal Cancer Stem Cells.

    Science.gov (United States)

    Fanale, Daniele; Barraco, Nadia; Listì, Angela; Bazan, Viviana; Russo, Antonio

    In recent years, the hypothesis of the presence of tumor-initiating cancer stem cells (CSCs) has received a considerable support. This model suggested the existence of CSCs which, thanks to their self-renewal properties, are able to drive the expansion and the maintenance of malignant cell populations with invasive and metastatic potential in cancer. Increasing evidence showed the ability of such cells to acquire self-renewal, multipotency, angiogenic potential, immune evasion, symmetrical and asymmetrical divisions which, along with the presence of several DNA repair mechanisms, further enhance their oncogenic potential making them highly resistant to common anticancer treatments. The main signaling pathways involved in the homeostasis of colorectal (CRC) stem cells are the Wnt, Notch, Sonic Hedgehog, and Bone Morfogenic Protein (BMP) pathways, which are mostly responsible for all the features that have been widely referred to stem cells. The same pathways have been identified in colorectal cancer stem cells (CRCSCs), conferring a more aggressive phenotype compared to non-stem CRC cells. Recently, several evidences suggested that non-coding RNAs (ncRNAs) may play a crucial role in the regulation of different biological mechanisms in CRC, by modulating the expression of critical stem cell transcription factors that have been found active in CSCs. In this chapter, we will discuss the involvement of ncRNAs, especially microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), in stemness acquisition and maintenance by CRCSCs, through the regulation of pathways modulating the CSC phenotype and growth, carcinogenesis, differentiation, and epithelial to mesenchymal transition (EMT).

  11. Long non-coding RNAs as emerging regulators of differentiation, development, and disease.

    Science.gov (United States)

    Dey, Bijan K; Mueller, Adam C; Dutta, Anindya

    2014-01-01

    A significant portion of the mammalian genome encodes numerous transcripts that are not translated into proteins, termed long non-coding RNAs. Initial studies identifying long non-coding RNAs inferred these RNA sequences were a consequence of transcriptional noise or promiscuous RNA polymerase II activity. However, the last decade has seen a revolution in the understanding of regulation and function of long non-coding RNAs. Now it has become apparent that long non-coding RNAs play critical roles in a wide variety of biological processes. In this review, we describe the current understanding of long non-coding RNA-mediated regulation of cellular processes: differentiation, development, and disease.

  12. The Non-Coding RNA Ontology (NCRO): a comprehensive resource for the unification of non-coding RNA biology.

    Science.gov (United States)

    Huang, Jingshan; Eilbeck, Karen; Smith, Barry; Blake, Judith A; Dou, Dejing; Huang, Weili; Natale, Darren A; Ruttenberg, Alan; Huan, Jun; Zimmermann, Michael T; Jiang, Guoqian; Lin, Yu; Wu, Bin; Strachan, Harrison J; He, Yongqun; Zhang, Shaojie; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming

    2016-01-01

    In recent years, sequencing technologies have enabled the identification of a wide range of non-coding RNAs (ncRNAs). Unfortunately, annotation and integration of ncRNA data has lagged behind their identification. Given the large quantity of information being obtained in this area, there emerges an urgent need to integrate what is being discovered by a broad range of relevant communities. To this end, the Non-Coding RNA Ontology (NCRO) is being developed to provide a systematically structured and precisely defined controlled vocabulary for the domain of ncRNAs, thereby facilitating the discovery, curation, analysis, exchange, and reasoning of data about structures of ncRNAs, their molecular and cellular functions, and their impacts upon phenotypes. The goal of NCRO is to serve as a common resource for annotations of diverse research in a way that will significantly enhance integrative and comparative analysis of the myriad resources currently housed in disparate sources. It is our belief that the NCRO ontology can perform an important role in the comprehensive unification of ncRNA biology and, indeed, fill a critical gap in both the Open Biological and Biomedical Ontologies (OBO) Library and the National Center for Biomedical Ontology (NCBO) BioPortal. Our initial focus is on the ontological representation of small regulatory ncRNAs, which we see as the first step in providing a resource for the annotation of data about all forms of ncRNAs. The NCRO ontology is free and open to all users, accessible at: http://purl.obolibrary.org/obo/ncro.owl.

  13. Non-coding RNAs in endometriosis: a narrative review.

    Science.gov (United States)

    Panir, Kavita; Schjenken, John E; Robertson, Sarah A; Hull, M Louise

    2018-04-25

    Endometriosis is a benign gynaecological disorder, which affects 10% of reproductive-aged women and is characterized by endometrial cells from the lining of the uterus being found outside the uterine cavity. However, the pathophysiological mechanisms causing the development of this heterogeneous disease remain enigmatic, and a lack of effective biomarkers necessitates surgical intervention for diagnosis. There is international recognition that accurate non-invasive diagnostic tests and more effective therapies are urgently needed. Non-coding RNA (ncRNA) molecules, which are important regulators of cellular function, have been implicated in many chronic conditions. In endometriosis, transcriptome profiling of tissue samples and functional in vivo and in vitro studies demonstrate that ncRNAs are key contributors to the disease process. In this review, we outline the biogenesis of various ncRNAs relevant to endometriosis and then summarize the evidence indicating their roles in regulatory pathways that govern disease establishment and progression. Articles from 2000 to 2016 were selected for relevance, validity and quality, from results obtained in PubMed, MEDLINE and Google Scholar using the following search terms: ncRNA and reproduction; ncRNA and endometriosis; miRNA and endometriosis; lncRNA and endometriosis; siRNA and endometriosis; endometriosis; endometrial; cervical; ovary; uterus; reproductive tract. All articles were independently screened for eligibility by the authors. This review integrates extensive information from all relevant published studies focusing on microRNAs, long ncRNAs and short inhibitory RNAs in endometriosis. We outline the biological function and synthesis of microRNAs, long ncRNAs and short inhibitory RNAs and provide detailed findings from human research as well as functional studies carried out both in vitro and in vivo, including animal models. Although variability in findings between individual studies exists, collectively, the

  14. Long non-coding RNAs differentially expressed between normal versus primary breast tumor tissues disclose converse changes to breast cancer-related protein-coding genes.

    Directory of Open Access Journals (Sweden)

    Kristin Reiche

    Full Text Available Breast cancer, the second leading cause of cancer death in women, is a highly heterogeneous disease, characterized by distinct genomic and transcriptomic profiles. Transcriptome analyses prevalently assessed protein-coding genes; however, the majority of the mammalian genome is expressed in numerous non-coding transcripts. Emerging evidence supports that many of these non-coding RNAs are specifically expressed during development, tumorigenesis, and metastasis. The focus of this study was to investigate the expression features and molecular characteristics of long non-coding RNAs (lncRNAs in breast cancer. We investigated 26 breast tumor and 5 normal tissue samples utilizing a custom expression microarray enclosing probes for mRNAs as well as novel and previously identified lncRNAs. We identified more than 19,000 unique regions significantly differentially expressed between normal versus breast tumor tissue, half of these regions were non-coding without any evidence for functional open reading frames or sequence similarity to known proteins. The identified non-coding regions were primarily located in introns (53% or in the intergenic space (33%, frequently orientated in antisense-direction of protein-coding genes (14%, and commonly distributed at promoter-, transcription factor binding-, or enhancer-sites. Analyzing the most diverse mRNA breast cancer subtypes Basal-like versus Luminal A and B resulted in 3,025 significantly differentially expressed unique loci, including 682 (23% for non-coding transcripts. A notable number of differentially expressed protein-coding genes displayed non-synonymous expression changes compared to their nearest differentially expressed lncRNA, including an antisense lncRNA strongly anticorrelated to the mRNA coding for histone deacetylase 3 (HDAC3, which was investigated in more detail. Previously identified chromatin-associated lncRNAs (CARs were predominantly downregulated in breast tumor samples, including CARs

  15. Long Non-Coding RNAs in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Lucia Nobili

    2018-02-01

    Full Text Available Multiple myeloma (MM is an incurable disease caused by the malignant proliferation of bone marrow plasma cells, whose pathogenesis remains largely unknown. Although a large fraction of the genome is actively transcribed, most of the transcripts do not serve as templates for proteins and are referred to as non-coding RNAs (ncRNAs, broadly divided into short and long transcripts on the basis of a 200-nucleotide threshold. Short ncRNAs, especially microRNAs, have crucial roles in virtually all types of cancer, including MM, and have gained importance in cancer diagnosis and prognosis, predicting the response to therapy and, notably, as innovative therapeutic targets. Long ncRNAs (lncRNAs are a very heterogeneous group, involved in many physiological cellular and genomic processes as well as in carcinogenesis, cancer metastasis, and invasion. LncRNAs are aberrantly expressed in various types of cancers, including hematological malignancies, showing either oncogenic or tumor suppressive functions. However, the mechanisms of the related disease-causing events are not yet revealed in most cases. Besides emerging as key players in cancer initiation and progression, lncRNAs own many interesting features as biomarkers with diagnostic and prognostic importance and, possibly, for their utility in therapeutic terms as druggable molecules. This review focuses on the role of lncRNAs in the pathogenesis of MM and summarizes the recent literature.

  16. Non-Coding RNA in Brain Development and Disorder.

    Science.gov (United States)

    Subhramanyam, Charannya Sozheesvari; Hu, Qidong

    2017-01-01

    Although up to 90% of the eukaryotic genome can be transcribed, only 1-2% of the resultant transcripts encode for proteins, while the remaining can be classified as non-coding RNAs (ncRNAs) which mostly consist of long ncRNAs (lncRNAs) and small ncRNAs. In overall, they have been suggested to target specific regions in the genome and play multi-faceted roles in many important biological processes. Recent evidence has shown that ncRNAs are abundantly expressed in the brain and many of them are aberrantly regulated in neural disorders. Yet their functional relevance in related physiological and pathological processes has not been adequately understood. Thus, the elucidation of the role of ncRNAs in the brain would greatly enhance the current understanding of neural development and ultimately lead to novel strategies to treat neural diseases. In this report, we reviewed the structure and mechanism of lncRNAs and various classes of small ncRNAs in brain development and neural disorders. We hope that extensive studies of these ncRNAs would unravel and characterize novel molecular circuits in the brain, and facilitate the development of RNA-based therapeutics for people suffering from neural disorders. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. DNA watermarks in non-coding regulatory sequences

    Directory of Open Access Journals (Sweden)

    Pyka Martin

    2009-07-01

    Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

  18. On the classification of long non-coding RNAs

    KAUST Repository

    Ma, Lina

    2013-06-01

    Long non-coding RNAs (lncRNAs) have been found to perform various functions in a wide variety of important biological processes. To make easier interpretation of lncRNA functionality and conduct deep mining on these transcribed sequences, it is convenient to classify lncRNAs into different groups. Here, we summarize classification methods of lncRNAs according to their four major features, namely, genomic location and context, effect exerted on DNA sequences, mechanism of functioning and their targeting mechanism. In combination with the presently available function annotations, we explore potential relationships between different classification categories, and generalize and compare biological features of different lncRNAs within each category. Finally, we present our view on potential further studies. We believe that the classifications of lncRNAs as indicated above are of fundamental importance for lncRNA studies, helpful for further investigation of specific lncRNAs, for formulation of new hypothesis based on different features of lncRNA and for exploration of the underlying lncRNA functional mechanisms. © 2013 Landes Bioscience.

  19. Non-coding genomic regions possessing enhancer and silencer potential are associated with healthy aging and exceptional survival

    Science.gov (United States)

    Kim, Sangkyu; Welsh, David A.; Myers, Leann; Cherry, Katie E.; Wyckoff, Jennifer; Jazwinski, S. Michal

    2015-01-01

    We have completed a genome-wide linkage scan for healthy aging using data collected from a family study, followed by fine-mapping by association in a separate population, the first such attempt reported. The family cohort consisted of parents of age 90 or above and their children ranging in age from 50 to 80. As a quantitative measure of healthy aging, we used a frailty index, called FI34, based on 34 health and function variables. The linkage scan found a single significant linkage peak on chromosome 12. Using an independent cohort of unrelated nonagenarians, we carried out a fine-scale association mapping of the region suggestive of linkage and identified three sites associated with healthy aging. These healthy-aging sites (HASs) are located in intergenic regions at 12q13–14. HAS-1 has been previously associated with multiple diseases, and an enhancer was recently mapped and experimentally validated within the site. HAS-2 is a previously uncharacterized site possessing genomic features suggestive of enhancer activity. HAS-3 contains features associated with Polycomb repression. The HASs also contain variants associated with exceptional longevity, based on a separate analysis. Our results provide insight into functional genomic networks involving non-coding regulatory elements that are involved in healthy aging and longevity. PMID:25682868

  20. Genome-wide long non-coding RNA screening, identification and characterization in a model microorganism Chlamydomonas reinhardtii.

    Science.gov (United States)

    Li, Hui; Wang, Yuting; Chen, Meirong; Xiao, Peng; Hu, Changxing; Zeng, Zhiyong; Wang, Chaogang; Wang, Jiangxin; Hu, Zhangli

    2016-09-23

    Microalgae are regarded as the most promising biofuel candidates and extensive metabolic engineering were conducted but very few improvements were achieved. Long non-coding RNA (lncRNA) investigation and manipulation may provide new insights for this issue. LncRNAs refer to transcripts that are longer than 200 nucleotides, do not encode proteins but play important roles in eukaryotic gene regulation. However, no information of potential lncRNAs has been reported in eukaryotic alga. Recently, we performed RNA sequencing in Chlamydomonas reinhardtii, and obtained totally 3,574 putative lncRNAs. 1440 were considered as high-confidence lncRNAs, including 936 large intergenic, 310 intronic and 194 anti-sense lncRNAs. The average transcript length, ORF length and numbers of exons for lncRNAs are much less than for genes in this green alga. In contrast with human lncRNAs of which more than 98% are spliced, the percentage in C. reinhardtii is only 48.1%. In addition, we identified 367 lncRNAs responsive to sulfur deprivation, including 36 photosynthesis-related lncRNAs. This is the first time that lncRNAs were explored in the unicellular model organism C. reinhardtii. The lncRNA data could also provide new insights into C. reinhardtii hydrogen production under sulfur deprivation.

  1. RNA-Seq analysis of D. radiodurans find non coding RNAs expressed in response to radiation stress

    International Nuclear Information System (INIS)

    Gadewal, Nikhil; Mukhopadhyaya, Rita

    2015-01-01

    In bacteria discovery of functional RNA molecules that are not translated into protein, noncoding RNAs, became possible with advent of Next Generation Sequencing technology. Bacterial non coding RNAs are typically 50-300 nucleotides long and work as internal signals controlling various levels of gene expression. Deep sequencing of total cellular RNA captures all coding and noncoding transcripts with their differential levels of expression in the transcriptome. It provides a powerful approach to study bacterial gene expression and mechanisms of gene regulation. We subjected the 3 h transcriptome of Deinococcus radiodurans R1 cells post exposure to 6 KGy gamma radiation to 100 x 2 cycles of deep sequencing on the Illumina HiSeq 2000 to look for ncRNA transcripts. Bioinformatics pipeline for analysis and interpretation of RNA Seq data was done in house using Softwares available in public domains. Our sequence data aligned with 21 putative ncRNAs expressed in the intergenic regions of annotated genome of D radiodurans. Verification of 2 ncRNA candidates and 3 transcription factor genes by Real Time PCR confirmed presence of these transcripts in the 3 h transcriptome sequenced by us. Any relationship between ncRNAs and control of radiation induced gene expression in D radiodurans can be proved only after specific gene knock outs in future. (author)

  2. Novel classes of non-coding RNAs and cancer

    Directory of Open Access Journals (Sweden)

    Sana Jiri

    2012-05-01

    Full Text Available Abstract For the many years, the central dogma of molecular biology has been that RNA functions mainly as an informational intermediate between a DNA sequence and its encoded protein. But one of the great surprises of modern biology was the discovery that protein-coding genes represent less than 2% of the total genome sequence, and subsequently the fact that at least 90% of the human genome is actively transcribed. Thus, the human transcriptome was found to be more complex than a collection of protein-coding genes and their splice variants. Although initially argued to be spurious transcriptional noise or accumulated evolutionary debris arising from the early assembly of genes and/or the insertion of mobile genetic elements, recent evidence suggests that the non-coding RNAs (ncRNAs may play major biological roles in cellular development, physiology and pathologies. NcRNAs could be grouped into two major classes based on the transcript size; small ncRNAs and long ncRNAs. Each of these classes can be further divided, whereas novel subclasses are still being discovered and characterized. Although, in the last years, small ncRNAs called microRNAs were studied most frequently with more than ten thousand hits at PubMed database, recently, evidence has begun to accumulate describing the molecular mechanisms by which a wide range of novel RNA species function, providing insight into their functional roles in cellular biology and in human disease. In this review, we summarize newly discovered classes of ncRNAs, and highlight their functioning in cancer biology and potential usage as biomarkers or therapeutic targets.

  3. Function and Application Areas in Medicine of Non-Coding RNA

    Directory of Open Access Journals (Sweden)

    Figen Guzelgul

    2009-06-01

    Full Text Available RNA is the genetic material converting the genetic code that it gets from DNA into protein. While less than 2 % of RNA is converted into protein , more than 98 % of it can not be converted into protein and named as non-coding RNAs. 70 % of noncoding RNAs consists of introns , however, the rest part of them consists of exons. Non-coding RNAs are examined in two classes according to their size and functions. Whereas they are classified as long non-coding and small non-coding RNAs according to their size , they are grouped as housekeeping non-coding RNAs and regulating non-coding RNAs according to their function. For long years ,these non-coding RNAs have been considered as non-functional. However, today, it has been proved that these non-coding RNAs play role in regulating genes and in structural, functional and catalitic roles of RNAs converted into protein. Due to its taking a role in gene silencing mechanism, particularly in medical world , non-coding RNAs have led to significant developments. RNAi technolgy , which is used in designing drugs to be used in treatment of various diseases , is a ray of hope for medical world. [Archives Medical Review Journal 2009; 18(3.000: 141-155

  4. Sequence Variations in the Non-Coding Sequence of CTX Phages in Vibrio cholerae.

    Science.gov (United States)

    Kim, Eun Jin; Yu, Hyun Jin; Kim, Dong Wook

    2016-08-28

    This study focused on the variations in the non-coding sequences between ctxB and rstR of various CTX phages. The non-coding sequences of CTX-1 and CTX-cla are phage type-specific. The length of the non-coding region of CTX-1 and CTX-cla is 601 and 730 nucleotides, respectively. The non-coding sequence of CTX phage could be divided into three regions. There is a phage type-specific Variable region between two homologous Common regions (Common regions 1 and 2). The non-coding sequence of RS1 element is similar to CTX-1 except that Common region 1 is replaced by a short RS1-specific sequence. The non-coding sequences of CTX-2 and CTX-cla are homologous, indicating the non-coding sequence of CTX-2 is derived from CTX-cla. The non-coding region of CTX-O139 is similar to CTX-cla and CTX-2; however, it contains an extra phage type-specific sequence between Common region 2 and rstR. The variations in the non-coding sequences of CTX phages might be associated with the difference in the replication efficiency and the directionality in the integration into the V. cholerae chromosome.

  5. Long non-coding RNAs: Mechanism of action and functional utility

    OpenAIRE

    Bhat, Shakil Ahmad; Ahmad, Syed Mudasir; Mumtaz, Peerzada Tajamul; Malik, Abrar Ahad; Dar, Mashooq Ahmad; Urwat, Uneeb; Shah, Riaz Ahmad; Ganai, Nazir Ahmad

    2016-01-01

    Recent RNA sequencing studies have revealed that most of the human genome is transcribed, but very little of the total transcriptomes has the ability to encode proteins. Long non-coding RNAs (lncRNAs) are non-coding transcripts longer than 200 nucleotides. Members of the non-coding genome include microRNA (miRNA), small regulatory RNAs and other short RNAs. Most of long non-coding RNA (lncRNAs) are poorly annotated. Recent recognition about lncRNAs highlights their effects in many biological ...

  6. Intergenic and intragenic conjugal transfer of multiple antibiotic ...

    African Journals Online (AJOL)

    intragenic) in combination with sulphamethoxazole-trimethoprim (SXT), streptomycin and erythromycin as a self transposable tetracycline element. In intergenic transfer, conjugation frequency was more than intragenic transfer. Frequencies of ...

  7. Junk DNA and the long non-coding RNA twist in cancer genetics

    NARCIS (Netherlands)

    H. Ling (Hui); K. Vincent; M. Pichler; R. Fodde (Riccardo); I. Berindan-Neagoe (Ioana); F.J. Slack (Frank); G.A. Calin (George)

    2015-01-01

    textabstractThe central dogma of molecular biology states that the flow of genetic information moves from DNA to RNA to protein. However, in the last decade this dogma has been challenged by new findings on non-coding RNAs (ncRNAs) such as microRNAs (miRNAs). More recently, long non-coding RNAs

  8. Identification and characterization of long intergenic noncoding RNAs in bovine mammary glands.

    Science.gov (United States)

    Tong, Chao; Chen, Qiaoling; Zhao, Lili; Ma, Junfei; Ibeagha-Awemu, Eveline M; Zhao, Xin

    2017-06-19

    Mammary glands of dairy cattle produce milk for the newborn offspring and for human consumption. Long intergenic noncoding RNAs (lincRNAs) play various functions in eukaryotic cells. However, types and roles of lincRNAs in bovine mammary glands are still poorly understood. Using computational methods, 886 unknown intergenic transcripts (UITs) were identified from five RNA-seq datasets from bovine mammary glands. Their non-coding potentials were predicted by using the combination of four software programs (CPAT, CNCI, CPC and hmmscan), with 184 lincRNAs identified. By comparison to the NONCODE2016 database and a domestic-animal long noncoding RNA database (ALDB), 112 novel lincRNAs were revealed in bovine mammary glands. Many lincRNAs were found to be located in quantitative trait loci (QTL). In particular, 36 lincRNAs were found in 172 milk related QTLs, whereas one lincRNA was within clinical mastitis QTL region. In addition, targeted genes for 10 lincRNAs with the highest fragments per kilobase of transcript per million fragments mapped (FPKM) were predicted by LncTar for forecasting potential biological functions of these lincRNAs. Further analyses indicate involvement of lincRNAs in several biological functions and different pathways. Our study has provided a panoramic view of lincRNAs in bovine mammary glands and suggested their involvement in many biological functions including susceptibility to clinical mastitis as well as milk quality and production. This integrative annotation of mammary gland lincRNAs broadens and deepens our understanding of bovine mammary gland biology.

  9. Bistability in self-activating genes regulated by non-coding RNAs

    International Nuclear Information System (INIS)

    Miro-Bueno, Jesus

    2015-01-01

    Non-coding RNA molecules are able to regulate gene expression and play an essential role in cells. On the other hand, bistability is an important behaviour of genetic networks. Here, we propose and study an ODE model in order to show how non-coding RNA can produce bistability in a simple way. The model comprises a single gene with positive feedback that is repressed by non-coding RNA molecules. We show how the values of all the reaction rates involved in the model are able to control the transitions between the high and low states. This new model can be interesting to clarify the role of non-coding RNA molecules in genetic networks. As well, these results can be interesting in synthetic biology for developing new genetic memories and biomolecular devices based on non-coding RNAs

  10. The Function and Therapeutic Potential of Long Non-coding RNAs in Cardiovascular Development and Disease

    Directory of Open Access Journals (Sweden)

    Clarissa P.C. Gomes

    2017-09-01

    Full Text Available The popularization of genome-wide analyses and RNA sequencing led to the discovery that a large part of the human genome, while effectively transcribed, does not encode proteins. Long non-coding RNAs have emerged as critical regulators of gene expression in both normal and disease states. Studies of long non-coding RNAs expressed in the heart, in combination with gene association studies, revealed that these molecules are regulated during cardiovascular development and disease. Some long non-coding RNAs have been functionally implicated in cardiac pathophysiology and constitute potential therapeutic targets. Here, we review the current knowledge of the function of long non-coding RNAs in the cardiovascular system, with an emphasis on cardiovascular development and biology, focusing on hypertension, coronary artery disease, myocardial infarction, ischemia, and heart failure. We discuss potential therapeutic implications and the challenges of long non-coding RNA research, with directions for future research and translational focus.

  11. Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

    Science.gov (United States)

    Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

  12. Non-coding RNAs in schistosomes: an unexplored world

    Directory of Open Access Journals (Sweden)

    Katia C Oliveira

    2011-06-01

    Full Text Available Non-coding RNAs (ncRNAs were recently given much higher attention due to technical advances in sequencing which expanded the characterization of transcriptomes in different organisms. ncRNAs have different lengths (22 nt to >1, 000 nt and mechanisms of action that essentially comprise a sophisticated gene expression regulation network. Recent publication of schistosome genomes and transcriptomes has increased the description and characterization of a large number of parasite genes. Here we review the number of predicted genes and the coverage of genomic bases in face of the public ESTs dataset available, including a critical appraisal of the evidence and characterization of ncRNAs in schistosomes. We show expression data for ncRNAs in Schistosoma mansoni. We analyze three different microarray experiment datasets: (1 adult worms' large-scale expression measurements; (2 differentially expressed S. mansoni genes regulated by a human cytokine (TNF-α in a parasite culture; and (3 a stage-specific expression of ncRNAs. All these data point to ncRNAs involved in different biological processes and physiological responses that suggest functionality of these new players in the parasite's biology. Exploring this world is a challenge for the scientists under a new molecular perspective of host-parasite interactions and parasite development.RNAs não codificadores (ncRNAs têm sido recentemente objeto de atenção muito maior devido aos avanços técnicos no sequenciamento que expandiram a caracterização dos transcritomas em diferentes organismos. ncRNAs possuem diferentes comprimentos (22 nt a >1.000 nt e mecanismos de ação que essencialmente compreendem uma sofisticada rede de regulação de expressão gênica. A publicação recente dos genomas e transcritomas dos esquistossomos aumentou a descrição e caracterização de um grande número de genes do parasita. Aqui nós revisamos o número de genes preditos e a cobertura das bases do genoma em face

  13. Facts and updates about cardiovascular non-coding RNAs in heart failure.

    Science.gov (United States)

    Thum, Thomas

    2015-09-01

    About 11% of all deaths include heart failure as a contributing cause. The annual cost of heart failure amounts to US $34,000,000,000 in the United States alone. With the exception of heart transplantation, there is no curative therapy available. Only occasionally there are new areas in science that develop into completely new research fields. The topic on non-coding RNAs, including microRNAs, long non-coding RNAs, and circular RNAs, is such a field. In this short review, we will discuss the latest developments about non-coding RNAs in cardiovascular disease. MicroRNAs are short regulatory non-coding endogenous RNA species that are involved in virtually all cellular processes. Long non-coding RNAs also regulate gene and protein levels; however, by much more complicated and diverse mechanisms. In general, non-coding RNAs have been shown to be of great value as therapeutic targets in adverse cardiac remodelling and also as diagnostic and prognostic biomarkers for heart failure. In the future, non-coding RNA-based therapeutics are likely to enter the clinical reality offering a new treatment approach of heart failure.

  14. Genetic variation in the non-coding genome : Involvement of micro-RNAs and long non-coding RNAs in disease

    NARCIS (Netherlands)

    Hrdlickova, Barbara; de Almeida, Rodrigo Coutinho; Borek, Zuzanna; Withoff, Sebo

    2014-01-01

    It has been found that the majority of disease-associated genetic variants identified by genome-wide association studies are located outside of protein-coding regions, where they seem to affect regions that control transcription (promoters, enhancers) and non-coding RNAs that also can influence gene

  15. Toward understanding non-coding RNA roles in intracranial aneurysms and subarachnoid hemorrhage

    Directory of Open Access Journals (Sweden)

    Huang Fengzhen

    2017-05-01

    Full Text Available Subarachnoid hemorrhage (SAH is a common and frequently life-threatening cerebrovascular disease, which is mostly related with a ruptured intracranial aneurysm. Its complications include rebleeding, early brain injury, cerebral vasospasm, delayed cerebral ischemia, chronic hydrocephalus, and also non neurological problems. Non-coding RNAs (ncRNAs, comprising of microRNAs (miRNAs, small interfering RNAs (siRNAs and long non-coding RNAs (lncRNAs, play an important role in intracranial aneurysms and SAH. Here, we review the non-coding RNAs expression profile and their related mechanisms in intracranial aneurysms and SAH. Moreover, we suggest that these non-coding RNAs function as novel molecular biomarkers to predict intracranial aneurysms and SAH, and may yield new therapies after SAH in the future.

  16. Non-Coding Transcript Heterogeneity in Mesothelioma: Insights from Asbestos-Exposed Mice.

    Science.gov (United States)

    Felley-Bosco, Emanuela; Rehrauer, Hubert

    2018-04-11

    Mesothelioma is an aggressive, rapidly fatal cancer and a better understanding of its molecular heterogeneity may help with making more efficient therapeutic strategies. Non-coding RNAs represent a larger part of the transcriptome but their contribution to diseases is not fully understood yet. We used recently obtained RNA-seq data from asbestos-exposed mice and performed data mining of publicly available datasets in order to evaluate how non-coding RNA contribute to mesothelioma heterogeneity. Nine non-coding RNAs are specifically elevated in mesothelioma tumors and contribute to human mesothelioma heterogeneity. Because some of them have known oncogenic properties, this study supports the concept of non-coding RNAs as cancer progenitor genes.

  17. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  18. The HS2 enhancer of the beta-globin locus control region initiates synthesis of non-coding, polyadenylated RNAs independent of a cis-linked globin promoter.

    Science.gov (United States)

    Ling, Jianhua; Baibakov, Boris; Pi, Wenhu; Emerson, Beverly M; Tuan, Dorothy

    2005-07-29

    The HS2 enhancer in the beta-globin locus control region (LCR) regulates transcription of the globin genes 10-50 kb away. Earlier studies show that a transcription mechanism initiated by the HS2 enhancer through the intervening DNA in the direction of the cis-linked promoter and gene mediates long-range enhancer function. Here, we further analyzed the enhancer-initiated RNAs and their mode of transcription from the HS2 enhancer in the endogenous genome of erythroid K562 cells, in plasmids integrated into K562 cells and in purified DNA used as template in in vitro transcription reactions. We found that the HS2 enhancer was able to initiate transcription autonomously in the absence of a cis-linked globin promoter. The enhancer-initiated, intergenic RNAs were different from the mRNA synthesized at the promoter in several aspects. The enhancer RNAs were synthesized not from a defined site but from multiple sites both within and as far as 1 kb downstream of the enhancer. The enhancer RNAs did not appear to contain a normal cap structure at the 5' ends. They were polyadenylated at multiple sites within 3 kb downstream of their initiation sites and were therefore shorter than 3 kb in lengths. The enhancer RNAs remained in discrete spots within the nucleus and were not processed into mRNA or translated into proteins. These particular features of enhancer-initiated transcription indicate that the transcriptional complex assembled by the enhancer was different from the basal transcription complex assembled at the promoter. The results suggest that in synthesizing non-coding, intergenic RNAs, the enhancer-assembled transcription complex could track through the intervening DNA to reach the basal promoter complex and activate efficient mRNA synthesis from the promoter.

  19. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš

    2013-01-01

    Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

  20. The long non-coding RNA TUG1 indicates a poor prognosis for colorectal cancer and promotes metastasis by affecting epithelial-mesenchymal transition.

    Science.gov (United States)

    Sun, Junfeng; Ding, Chaohui; Yang, Zhen; Liu, Tao; Zhang, Xiefu; Zhao, Chunlin; Wang, Jiaxiang

    2016-02-08

    Long intergenic non-coding RNAs (lncRNAs) are a class of non-coding RNAs that are involved in gene expression regulation. Taurine up-regulated gene 1 (TUG1) is a cancer progression related lncRNA in some tumor oncogenesis; however, its role in colorectal cancer (CRC) remains unclear. In this study, we determined the expression patterns of TUG1 in CRC patients and explored its effect on CRC cell metastasis using cultured representative CRC cell lines. The expression levels of TUG1 in 120 CRC patients and CRC cells were determined using quantitative real-time PCR. HDACs and epithelial-mesenchymal transition (EMT)-related gene expression were determined using western blot. CRC cell metastasis was assessed by colony formation, migration assay and invasion assay. Our data showed that the levels of TUG1 were upregulated in both CRC cell lines and primary CRC clinical samples. TUG1 upregulation was closely correlated with the survival time of CRC patients. Overexpression of TUG1 in CRC cells increased their colony formation, migration, and invasion in vitro and promoted their metastatic potential in vivo, whereas knockdown of TUG1 inhibited the colony formation, migration, and invasion of CRC cells in vitro. It is also worth pointing out that TUG1 activated EMT-related gene expression. Our data suggest that tumor expression of lncRNA TUG1 plays a critical role in CRC metastasis. TUG1 may have potential roles as a biomarker and/or a therapeutic target in colorectal cancer.

  1. Accurate discrimination of conserved coding and non-coding regions through multiple indicators of evolutionary dynamics

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2009-09-01

    Full Text Available Abstract Background The conservation of sequences between related genomes has long been recognised as an indication of functional significance and recognition of sequence homology is one of the principal approaches used in the annotation of newly sequenced genomes. In the context of recent findings that the number non-coding transcripts in higher organisms is likely to be much higher than previously imagined, discrimination between conserved coding and non-coding sequences is a topic of considerable interest. Additionally, it should be considered desirable to discriminate between coding and non-coding conserved sequences without recourse to the use of sequence similarity searches of protein databases as such approaches exclude the identification of novel conserved proteins without characterized homologs and may be influenced by the presence in databases of sequences which are erroneously annotated as coding. Results Here we present a machine learning-based approach for the discrimination of conserved coding sequences. Our method calculates various statistics related to the evolutionary dynamics of two aligned sequences. These features are considered by a Support Vector Machine which designates the alignment coding or non-coding with an associated probability score. Conclusion We show that our approach is both sensitive and accurate with respect to comparable methods and illustrate several situations in which it may be applied, including the identification of conserved coding regions in genome sequences and the discrimination of coding from non-coding cDNA sequences.

  2. Two distinct types of rRNA operons in the Bacillus cereus group.

    Science.gov (United States)

    Candelon, Benjamin; Guilloux, Kévin; Ehrlich, S Dusko; Sorokin, Alexei

    2004-03-01

    The Bacillus cereus group includes insecticidal bacteria (B. thuringiensis), food-borne pathogens (B. cereus and B. weihenstephanensis) and B. anthracis, the causative agent of anthrax. The precise number of rRNA operons in 12 strains of the B. cereus group was determined. Most of the tested strains possess 13 operons and the tested psychrotolerant strains contain 14 operons, the highest number ever found in bacteria. The separate clustering of the tested psychrotolerant strains was confirmed by partial sequencing of several genes distributed over the chromosomes. Analysis of regions downstream of the 23S rRNA genes in the type strain B. cereus ATCC 14579 indicates that the rRNA operons can be divided into two classes, I and II, consisting respectively of eight and five operons. Class II operons exhibit multiple tRNA genes downstream of the 5S rRNA gene and a putative promoter sequence in the 23S-5S intergenic region, suggesting that 5S rRNA and the downstream tRNA genes can be transcribed independently of the 16S and 23S genes. Similar observations were made in the recently sequenced genome of B. anthracis strain Ames. The existence of these distinct types of rRNA operons suggests an unknown mechanism for regulation of rRNA and tRNA synthesis potentially related to the pool of amino acids available for protein synthesis.

  3. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  4. Intergenic spacer length variants in Old Portuguese bread wheat ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... and the termination of the transcription (McMullen et al. 1986; Suzuki et al. 1996; Abdulova and Ananiev 2003). The non-coding rDNA spacers (IGS and the internal transcribed spacer (ITS)) could be substantially variable in size due to differences in the number of repetitive elements among the closely ...

  5. Long Non-Coding RNA lincRNA-ROR Promotes the Progression of Colon Cancer and Holds Prognostic Value by Associating with miR-145.

    Science.gov (United States)

    Zhou, Peng; Sun, Lixia; Liu, Danfeng; Liu, Changkuo; Sun, Lei

    2016-10-01

    Large intergenic non-coding RNA ribonucleic acids-ROR (lincRNA-ROR) has been reported to exert impacts on the maintenance of induced pluripotent stem cells and embryonic stem cells, and play important roles in human hepatocellular cancer. It contributes to tumorigenesis and metastasis and functions as a competing endogenous RNA (ceRNA) by sponging miR-145 in breast cancer. However, its clinical significance and prognostic value in colon cancer remain unknown. The aim of the present study was to clarify the clinicopathological role and prognostic value of lincRNA-ROR and miR-145 in colon cancer. In the present study, qRT-PCR was performed to measure the expression levels of lincRNA-ROR in colon cancer tissues and cell lines. Then, the clinicopathological significance and prognostic value of lincRNA-ROR were analyzed. LincRNA-ROR expression correlated with pT stage, pN stage, AJCC stage and vascular invasion. Knockdown of lincRNA-ROR restored the expression of miR-145, and had a significant influence on colon cancer cell proliferation, migration and invasion. Patients of the high lincRNA-ROR/low miR-145 group had significantly poorer outcomes than those of the low lincRNA-ROR/high miR-145 group. Taken together, Overexpression of lincRNA-ROR combined with depletion of miR-145 may exert crucial impact on colon cancer prognosis evaluation and treatment.

  6. Plant viral intergenic DNA sequence repeats with transcription enhancing activity

    Directory of Open Access Journals (Sweden)

    Cazzonelli Christopher I

    2005-02-01

    Full Text Available Abstract Background The geminivirus and nanovirus families of DNA plant viruses have proved to be a fertile source of viral genomic sequences, clearly demonstrated by the large number of sequence entries within public DNA sequence databases. Due to considerable conservation in genome organization, these viruses contain easily identifiable intergenic regions that have been found to contain multiple DNA sequence elements important to viral replication and gene regulation. As a first step in a broad screen of geminivirus and nanovirus intergenic sequences for DNA segments important in controlling viral gene expression, we have 'mined' a large set of viral intergenic regions for transcriptional enhancers. Viral sequences that are found to act as enhancers of transcription in plants are likely to contribute to viral gene activity during infection. Results DNA sequences from the intergenic regions of 29 geminiviruses or nanoviruses were scanned for repeated sequence elements to be tested for transcription enhancing activity. 105 elements were identified and placed immediately upstream from a minimal plant-functional promoter fused to an intron-containing luciferase reporter gene. Transient luciferase activity was measured within Agrobacteria-infused Nicotiana tobacum leaf tissue. Of the 105 elements tested, 14 were found to reproducibly elevate reporter gene activity (>25% increase over that from the minimal promoter-reporter construct, p Conclusion Biological significance for the active DNA elements identified is supported by repeated isolation of a previously defined viral element (CLE, and the finding that two of three viral enhancer elements examined were markedly enriched within both geminivirus sequences and within Arabidopsis promoter regions. These data provide a useful starting point for virologists interested in undertaking more detailed analysis of geminiviral promoter function.

  7. Non-coding RNA may be associated with cytoplasmic male sterility in Silene vulgaris

    Czech Academy of Sciences Publication Activity Database

    Stone, James D.; Koloušková, Pavla; Sloan, D.B.; Štorchová, Helena

    2017-01-01

    Roč. 68, č. 7 (2017), s. 1599-1612 ISSN 0022-0957 R&D Projects: GA ČR(CZ) GA16-09220S Institutional support: RVO:61389030 Keywords : Cytoplasmic male sterility * Editing * Mitochondrion * Non-coding RNA * Silene vulgaris * Splicing * Transcriptome Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.830, year: 2016

  8. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

    2015-01-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  9. The Role of Non-coding RNAs and Isothiocyanates in Cancer.

    Science.gov (United States)

    Martin, Samantha L; Royston, Kendra J; Tollefsbol, Trygve O

    2018-03-12

    Cancer is the second leading cause of mortalities in the United States, only exceeded by heart disease. Current cancer treatments include chemotherapy, surgery and/or radiation. Due to the often harsh effects of current cancer therapies, investigators are focusing their efforts on cancer prevention mediated by dietary phytochemicals. Since the discovery that cancer can be initiated by and progress through both genetic and epigenetic pathways, there has been a significant surge in studies on epigenetic effects mediated by nutritive compounds. Isothiocyanates, naturally occurring molecules found in cruciferous vegetables, have been documented to exhibit many anticarcinogenic activities. Although isothiocyanates have been extensively documented as key players in epigenetic processes such as DNA methylation and histone modifications, their effects on non-coding RNAs is understudied. Non-coding RNAs are molecules that target mRNA production and repress protein translation and are known to be dysregulated in various human malignancies. Studies have used non-coding RNAs as novel targets for exploration in cancer therapy. This review focuses on the exploration of isothiocyanates and their effect on non-coding RNAs in cancer prevention and therapy. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Extracellular vesicle associated long non-coding RNAs functionally enhance cell viability

    Directory of Open Access Journals (Sweden)

    Chris Hewson

    2016-10-01

    Full Text Available Cells communicate with one another to create microenvironments and share resources. One avenue by which cells communicate is through the action of exosomes. Exosomes are extracellular vesicles that are released by one cell and taken up by neighbouring cells. But how exosomes instigate communication between cells has remained largely unknown. We present evidence here that particular long non-coding RNA molecules are preferentially packaged into exosomes. We also find that a specific class of these exosome associated non-coding RNAs functionally modulate cell viability by direct interactions with l-lactate dehydrogenase B (LDHB, high-mobility group protein 17 (HMG-17, and CSF2RB, proteins involved in metabolism, nucleosomal architecture and cell signalling respectively. Knowledge of this endogenous cell to cell pathway, those proteins interacting with exosome associated non-coding transcripts and their interacting domains, could lead to a better understanding of not only cell to cell interactions but also the development of exosome targeted approaches in patient specific cell-based therapies. Keywords: Non-coding RNA, Extracellular RNA, Exosomes, Retroelement, Pseudogene

  11. The non-coding RNA BC1 regulates experience-dependent structural plasticity and learning

    NARCIS (Netherlands)

    Briz, Victor; Restivo, Leonardo; Pasciuto, Emanuela; Juczewski, Konrad; Mercaldo, Valentina; Lo, Adrian C; Baatsen, Pieter; Gounko, Natalia V; Borreca, Antonella; Girardi, Tiziana; Luca, Rossella; Nys, Julie; Poorthuis, Rogier B; Mansvelder, Huibert D; Fisone, Gilberto; Ammassari-Teule, Martine; Arckens, Lutgarde; Krieger, Patrik; Meredith, Rhiannon; Bagni, Claudia

    2017-01-01

    The brain cytoplasmic (BC1) RNA is a non-coding RNA (ncRNA) involved in neuronal translational control. Absence of BC1 is associated with altered glutamatergic transmission and maladaptive behavior. Here, we show that pyramidal neurons in the barrel cortex of BC1 knock out (KO) mice display larger

  12. Uncovering the roles of long non-coding RNAs in cancer stem cells

    Directory of Open Access Journals (Sweden)

    Xiaoxing Huang

    2017-02-01

    Full Text Available Abstract Cancer has been a major public health problem that has threatened human life worldwide throughout history. The main causes that contribute to the poor prognosis of cancer are metastasis and recurrence. Cancer stem cells are a group of tumor cells that possess self-renewal and differentiation ability, which is a vital cause of cancer metastasis and recurrence. Long non-coding RNAs refer to a class of RNAs that are longer than 200 nt and have no potential to code proteins, some of which can be specifically expressed in different tissues and different tumors. Long non-coding RNAs have great biological significance in the occurrence and progression of cancers. However, how long non-coding RNAs interact with cancer stem cells and then affect cancer metastasis and recurrence is not yet clear. Therefore, this review aims to summarize recent studies that focus on how long non-coding RNAs impact tumor occurrence and progression by affecting cancer stem cell self-renewal and differentiation in liver cancer, prostate cancer, breast cancer, and glioma.

  13. Progressive changes in non-coding RNA profile in leucocytes with age

    Science.gov (United States)

    Muñoz-Culla, Maider; Irizar, Haritz; Gorostidi, Ana; Alberro, Ainhoa; Osorio-Querejeta, Iñaki; Ruiz-Martínez, Javier; Olascoaga, Javier; de Munain, Adolfo López; Otaegui, David

    2017-01-01

    It has been observed that immune cell deterioration occurs in the elderly, as well as a chronic low-grade inflammation called inflammaging. These cellular changes must be driven by numerous changes in gene expression and in fact, both protein-coding and non-coding RNA expression alterations have been observed in peripheral blood mononuclear cells from elder people. In the present work we have studied the expression of small non-coding RNA (microRNA and small nucleolar RNA -snoRNA-) from healthy individuals from 24 to 79 years old. We have observed that the expression of 69 non-coding RNAs (56 microRNAs and 13 snoRNAs) changes progressively with chronological age. According to our results, the age range from 47 to 54 is critical given that it is the period when the expression trend (increasing or decreasing) of age-related small non-coding RNAs is more pronounced. Furthermore, age-related miRNAs regulate genes that are involved in immune, cell cycle and cancer-related processes, which had already been associated to human aging. Therefore, human aging could be studied as a result of progressive molecular changes, and different age ranges should be analysed to cover the whole aging process. PMID:28448962

  14. The Long Non-coding RNA HOTTIP Enhances Pancreatic Cancer Cell Proliferation, Survival and Migration

    Science.gov (United States)

    ABSTRACTHOTTIP is a long non-coding RNA (lncRNA) transcribed from the 5' tip of the HOXA locus and is associated with the polycomb repressor complex 2 (PRC2) and WD repeat containing protein 5 (WDR5)/mixed lineage leukemia 1 (MLL1) chromatin modifying complexes. HOTTIP is expres...

  15. Long non-coding RNAs: Mechanism of action and functional utility

    Directory of Open Access Journals (Sweden)

    Shakil Ahmad Bhat

    2016-10-01

    Full Text Available Recent RNA sequencing studies have revealed that most of the human genome is transcribed, but very little of the total transcriptomes has the ability to encode proteins. Long non-coding RNAs (lncRNAs are non-coding transcripts longer than 200 nucleotides. Members of the non-coding genome include microRNA (miRNA, small regulatory RNAs and other short RNAs. Most of long non-coding RNA (lncRNAs are poorly annotated. Recent recognition about lncRNAs highlights their effects in many biological and pathological processes. LncRNAs are dysfunctional in a variety of human diseases varying from cancerous to non-cancerous diseases. Characterization of these lncRNA genes and their modes of action may allow their use for diagnosis, monitoring of progression and targeted therapies in various diseases. In this review, we summarize the functional perspectives as well as the mechanism of action of lncRNAs. Keywords: LncRNA, X-chromosome inactivation, Genome imprinting, Transcription regulation, Cancer, Immunity

  16. Diversity of insect trypanosomatids assessed from the spliced leader RNA and 5S rRNA genes and intergenic regions

    Czech Academy of Sciences Publication Activity Database

    Podlipaev, Sergei; Sturm, N. R.; Fiala, Ivan; Fernandes, O.; Westenberger, S. J.; Dollet, M.; Campbell, D. A.; Lukeš, Julius

    2004-01-01

    Roč. 51, č. 3 (2004), s. 283-290 ISSN 1066-5234 Grant - others:European Community(XE) QLK 2-CT-2001-01810 Institutional research plan: CEZ:AV0Z6022909 Keywords : Kinetoplastida * phylogeny * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  17. Estimating the Fraction of Non-Coding RNAs in Mammalian Transcriptomes

    Directory of Open Access Journals (Sweden)

    Tamar Schlick

    2008-01-01

    Full Text Available Recent studies of mammalian transcriptomes have identified numerous RNA transcripts that do not code for proteins; their identity, however, is largely unknown. Here we explore an approach based on sequence randomness patterns to discern different RNA classes. The relative z-score we use helps identify the known ncRNA class from the genome, intergene and intron classes. This leads us to a fractional ncRNA measure of putative ncRNA datasets which we model as a mixture of genuine ncRNAs and other transcripts derived from genomic, intergenic and intronic sequences. We use this model to analyze six representative datasets identified by the FANTOM3 project and two computational approaches based on comparative analysis (RNAz and EvoFold. Our analysis suggests fewer ncRNAs than estimated by DNA sequencing and comparative analysis, but the verity of our approach and its prediction requires more extensive experimental RNA data.

  18. Isolation and characterization of an unusual repeated sequence from the ribosomal intergenic spacer of the crucifer Sisymbrium irio.

    Science.gov (United States)

    Grellet, F; Delcasso-Tremousaygue, D; Delseny, M

    1989-06-01

    A recombinant plasmid containing a 433 base pair (bp) Bam HI fragment from Sisymbrium irio genomic DNA was isolated and characterized. This fragment was shown to be a ribosomal intergenic spacer (IGS) sequence which is reiterated up to six times in the IGS and extends close to the 5' end of the 18S rRNA gene. The nucleotide sequence of the cloned element is composed of 10-11 40 bp blocks that are probably derived from a common ancestor. The presence of a similar sequence can be detected in the DNA of another Sisymbrium species and in Matthiola incana. Homology was also found with the last 43 nucleotides of the radish IGS 3' end, suggesting that there is possibly a common ancestral nucleotide motif in cruciferous IGS sequences. The cloned element hybridises to RNA transcripts, indicating that the S. irio IGS repetitive sequence is at least partially transcribed during the pre-rRNA transcription process.

  19. Homology-based annotation of non-coding RNAs in the genomes of Schistosoma mansoni and Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    Santana Clara

    2009-10-01

    Full Text Available Abstract Background Schistosomes are trematode parasites of the phylum Platyhelminthes. They are considered the most important of the human helminth parasites in terms of morbidity and mortality. Draft genome sequences are now available for Schistosoma mansoni and Schistosoma japonicum. Non-coding RNA (ncRNA plays a crucial role in gene expression regulation, cellular function and defense, homeostasis, and pathogenesis. The genome-wide annotation of ncRNAs is a non-trivial task unless well-annotated genomes of closely related species are already available. Results A homology search for structured ncRNA in the genome of S. mansoni resulted in 23 types of ncRNAs with conserved primary and secondary structure. Among these, we identified rRNA, snRNA, SL RNA, SRP, tRNAs and RNase P, and also possibly MRP and 7SK RNAs. In addition, we confirmed five miRNAs that have recently been reported in S. japonicum and found two additional homologs of known miRNAs. The tRNA complement of S. mansoni is comparable to that of the free-living planarian Schmidtea mediterranea, although for some amino acids differences of more than a factor of two are observed: Leu, Ser, and His are overrepresented, while Cys, Meth, and Ile are underrepresented in S. mansoni. On the other hand, the number of tRNAs in the genome of S. japonicum is reduced by more than a factor of four. Both schistosomes have a complete set of minor spliceosomal snRNAs. Several ncRNAs that are expected to exist in the S. mansoni genome were not found, among them the telomerase RNA, vault RNAs, and Y RNAs. Conclusion The ncRNA sequences and structures presented here represent the most complete dataset of ncRNA from any lophotrochozoan reported so far. This data set provides an important reference for further analysis of the genomes of schistosomes and indeed eukaryotic genomes at large.

  20. Non-Coding RNAs are Differentially Expressed by Nocardia brasiliensis in Vitro and in Experimental Actinomycetoma.

    Science.gov (United States)

    Cruz-Rabadán, Josué S; Miranda-Ríos, Juan; Espín-Ocampo, Guadalupe; Méndez-Tovar, Luis J; Maya-Pineda, Héctor Rubén; Hernández-Hernández, Francisca

    2017-01-01

    Nocardia spp. are common soil-inhabiting bacteria that frequently infect humans through traumatic injuries or inhalation routes and cause infections, such as actinomycetoma and nocardiosis, respectively. Nocardia brasiliensis is the main aetiological agent of actinomycetoma in various countries. Many bacterial non-coding RNAs are regulators of genes associated with virulence factors. The aim of this work was to identify non-coding RNAs (ncRNAs) expressed during infection conditions and in free-living form ( in vitro ) in Nocardia brasiliensis . The N. brasiliensis transcriptome (predominately brasiliensis infection compared with the in vitro conditions. The results of this work suggest a possible role for these transcripts in the regulation of virulence genes in actinomycetoma pathogenesis.

  1. Non-Coding RNAs are Differentially Expressed by Nocardia brasiliensis in Vitro and in Experimental Actinomycetoma

    Science.gov (United States)

    Cruz-Rabadán, Josué S.; Miranda-Ríos, Juan; Espín-Ocampo, Guadalupe; Méndez-Tovar, Luis J.; Maya-Pineda, Héctor Rubén; Hernández-Hernández, Francisca

    2017-01-01

    Introduction: Nocardia spp. are common soil-inhabiting bacteria that frequently infect humans through traumatic injuries or inhalation routes and cause infections, such as actinomycetoma and nocardiosis, respectively. Nocardia brasiliensis is the main aetiological agent of actinomycetoma in various countries. Many bacterial non-coding RNAs are regulators of genes associated with virulence factors. Objective: The aim of this work was to identify non-coding RNAs (ncRNAs) expressed during infection conditions and in free-living form (in vitro) in Nocardia brasiliensis. Methods and Result: The N. brasiliensis transcriptome (predominately brasiliensis infection compared with the in vitro conditions. Conclusion: The results of this work suggest a possible role for these transcripts in the regulation of virulence genes in actinomycetoma pathogenesis. PMID:28839491

  2. Mammalian hibernation and regulation of lipid metabolism: a focus on non-coding RNAs.

    Science.gov (United States)

    Lang-Ouellette, D; Richard, T G; Morin, P

    2014-11-01

    Numerous species will confront severe environmental conditions by undergoing significant metabolic rate reduction. Mammalian hibernation is one such natural model of hypometabolism. Hibernators experience considerable physiological, metabolic, and molecular changes to survive the harsh challenges associated with winter. Whether as fuel source or as key signaling molecules, lipids are of primary importance for a successful bout of hibernation and their careful regulation throughout this process is essential. In recent years, a plethora of non-coding RNAs has emerged as potential regulators of targets implicated in lipid metabolism in diverse models. In this review, we introduce the general characteristics associated with mammalian hibernation, present the importance of lipid metabolism prior to and during hibernation, as well as discuss the potential relevance of non-coding RNAs such as miRNAs and lncRNAs during this process.

  3. Long intervening non-coding RNA 00320 is human brain-specific and highly expressed in the cortical white matter

    NARCIS (Netherlands)

    Mills, James D.; Chen, Jieqiong; Kim, Woojin S.; Waters, Paul D.; Prabowo, Avanita S.; Aronica, Eleonora; Halliday, Glenda M.; Janitz, Michael

    2015-01-01

    Pervasive transcription of the genome produces a diverse array of functional non-coding RNAs (ncRNAs). One particular class of ncRNAs, long intervening non-coding RNAs (lincRNAs) are thought to play a role in regulating gene expression and may be a major contributor to organism and tissue

  4. New neurons in aging brains: molecular control by small non-coding RNAs

    Directory of Open Access Journals (Sweden)

    Marijn eSchouten

    2012-02-01

    Full Text Available Adult neurogenesis is a process that continues in the adult and also aging brain. It generates functional neurons from neural stem cells present in specific brain regions. This phenomenon is largely confined to two main regions: the subventricular zone of the lateral ventricle, and the subgranular zone of the dentate gyrus, in the hippocampus. With age, the hippocampus and particularly the dentate gyrus are affected. For instance, adult neurogenesis is decreased with aging, in both the number of proliferating cells as well as their neuronal differentiation, while in parallel an age-associated decline in cognitive performance is often seen. Surprisingly, the synaptogenic potential of adult-born neurons appears unaffected by aging. Therefore, although proliferation, differentiation, survival and synaptogenesis of adult-born new neurons in the dentate gyrus are closely related to each other, they appear differentially regulated with aging. In this review we discuss the crucial role of a novel class of recently discovered regulators of gene expression, i.e. the small non-coding RNAs, in the development of adult neurogenesis from neural stem cells to functionally integrated neurons. In particular, a subgroup of the small non-coding RNAs, the microRNAs, fine-tune many events during adult neurogenesis progression. Moreover, multiple small non-coding RNAs are differentially expressed in the aged hippocampus. This makes small non-coding RNAs appealing candidates to orchestrate, and possibly correct or prevent, the functional alterations in adult neurogenesis and cognition associated with aging. Finally, we briefly summarize observations that link changes in circulating levels of steroid hormones with alterations in adult neurogenesis and subsequent vulnerability to psychopathology in advanced age, and discuss a possible role of microRNAs in stress-associated alterations in adult neurogenesis during aging.

  5. Transcriptional dynamics reveal critical roles for non-coding RNAs in the immediate-early response.

    Directory of Open Access Journals (Sweden)

    Stuart Aitken

    2015-04-01

    Full Text Available The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset.

  6. Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Chen Xie

    2012-09-01

    Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.

  7. The role of non-coding RNAs in cytoplasmic male sterility in flowering plants

    Czech Academy of Sciences Publication Activity Database

    Štorchová, Helena

    2017-01-01

    Roč. 18, č. 11 (2017), č. článku 2429. E-ISSN 1422-0067 R&D Projects: GA ČR GA16-09220S Institutional support: RVO:61389030 Keywords : Cytoplasmic male sterility * Gene expression * Global transcriptome * Non-coding RNA * Pollen development Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 3.226, year: 2016

  8. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    Energy Technology Data Exchange (ETDEWEB)

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  9. Methods for Using Small Non-Coding RNAs to Improve Recombinant Protein Expression in Mammalian Cells

    Directory of Open Access Journals (Sweden)

    Sarah Inwood

    2018-01-01

    Full Text Available The ability to produce recombinant proteins by utilizing different “cell factories” revolutionized the biotherapeutic and pharmaceutical industry. Chinese hamster ovary (CHO cells are the dominant industrial producer, especially for antibodies. Human embryonic kidney cells (HEK, while not being as widely used as CHO cells, are used where CHO cells are unable to meet the needs for expression, such as growth factors. Therefore, improving recombinant protein expression from mammalian cells is a priority, and continuing effort is being devoted to this topic. Non-coding RNAs are RNA segments that are not translated into a protein and often have a regulatory role. Since their discovery, major progress has been made towards understanding their functions. Non-coding RNA has been investigated extensively in relation to disease, especially cancer, and recently they have also been used as a method for engineering cells to improve their protein expression capability. In this review, we provide information about methods used to identify non-coding RNAs with the potential of improving recombinant protein expression in mammalian cell lines.

  10. Long non-coding RNAs-towards precision medicine in diabetic kidney disease?

    Science.gov (United States)

    Panchapakesan, Usha; Pollock, Carol

    2016-09-01

    Diabetic kidney disease (DKD) is escalating and is the major cause of end stage kidney failure. There is increasing evidence to support the role of epigenetic factors and metabolic memory in linking the environmental and genetic causes of this disease. Although our understanding of this disease has improved, there has been no significant efficacious therapeutic translation in the last decade. Current sequencing technology has allowed interrogation of the human transcriptome. It is evident that although approximately 80% of the genome is transcribed, only 1-2% is read and coded into protein. The remaining non-coding RNA, historically assumed to be 'junk', is now known to have key roles in regulating gene function and orchestrate how and when coding genes are expressed. This largest subset of non-coding RNAs called long non-coding RNAs (LNCRNAs) drives epigenetic changes and has functional relevance best characterized in cancers and cardiovascular disease. This understanding, coupled with the availability and affordability of RNA sequencing, has shifted our therapeutic strategies towards genomic therapy in DKD. The role of LNCRNAs with respect to DKD is only just emerging. In this review we summarize the role of LNCRNAs in DKD and the existing antisense oligonucleotide therapy that may provide precise and targeted medicine to treat DKD in this postgenomic era. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  11. A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

    Science.gov (United States)

    Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-01-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

  12. The architecture of the chloroplast trnH-psbA non-coding region in angiosperms

    Czech Academy of Sciences Publication Activity Database

    Štorchová, Helena; Olson, M.S.

    2007-01-01

    Roč. 268, 1-4 (2007), s. 235-256 ISSN 0378-2697 R&D Projects: GA MŠk(CZ) LC06004 Grant - others:ESPSCor Visiting Scholar Research Grant(US) NSF DEB 0317115 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje Keywords : Chloroplast DNA * psbA-trnH intergenic region * Silene * deletions * insertions and inversions in stem-loop region * psbA 3´untranslated region * RNA secondary structure Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.492, year: 2007

  13. The long non-coding RNA HOTAIR indicates a poor prognosis and promotes metastasis in non-small cell lung cancer

    International Nuclear Information System (INIS)

    Liu, Xiang-hua; Liu, Zhi-li; Sun, Ming; Liu, Jing; Wang, Zhao-xia; De, Wei

    2013-01-01

    The identification of cancer-associated long non-coding RNAs and the investigation of their molecular and biological functions are important for understanding the molecular biology and progression of cancer. HOTAIR (HOX transcript antisense intergenic RNA) has been implicated in several cancers; however, its role in non-small cell lung cancer (NSCLC) is unknown. The aim of the present study was to examine the expression pattern of HOTAIR in NSCLC and to evaluate its biological role and clinical significance in tumor progression. Expression of HOTAIR was analyzed in 42 NSCLC tissues and four NSCLC cell lines by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Over-expression and RNA interference (RNAi) approaches were used to investigate the biological functions of HOTAIR. The effect of HOTAIR on proliferation was evaluated by MTT and colony formation assays, and cell migration and invasion were evaluated by transwell assays. Tail vein injection of cells was used to study metastasis in nude mice. Protein levels of HOTAIR targets were determined by western blot analysis. Differences between groups were tested for significance using Student’s t-test (two-tailed). HOTAIR was highly expressed both in NSCLC samples and cell lines compared with corresponding normal counterparts. HOTAIR upregulation was correlated with NSCLC advanced pathological stage and lymph-node metastasis. Moreover, patients with high levels of HOTAIR expression had a relatively poor prognosis. Inhibition of HOTAIR by RNAi decreased the migration and invasion of NSCLC cells in vitro and impeded cell metastasis in vivo. HOXA5 levels were affected by HOTAIR knockdown or over-expression in vitro. Our findings indicate that HOTAIR is significantly up-regulated in NSCLC tissues, and regulates NSCLC cell invasion and metastasis, partially via the down-regulation of HOXA5. Thus, HOTAIR may represent a new marker of poor prognosis and is a potential therapeutic target for NSCLC

  14. Identification of maize long non-coding RNAs responsive to drought stress.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    Full Text Available Long non-coding RNAs (lncRNAs represent a class of riboregulators that either directly act in long form or are processed to shorter miRNAs and siRNAs. Emerging evidence shows that lncRNAs participate in stress responsive regulation. In this study, to identify the putative maize lncRNAs responsive to drought stress, 8449 drought responsive transcripts were first uploaded to the Coding Potential Calculator website for classification as protein coding or non-coding RNAs, and 1724 RNAs were identified as potential non-coding RNAs. A Perl script was written to screen these 1724 ncRNAs and 664 transcripts were ultimately identified as drought-responsive lncRNAs. Of these 664 transcripts, 126 drought-responsive lncRNAs were highly similar to known maize lncRNAs; the remaining 538 transcripts were considered as novel lncRNAs. Among the 664 lncRNAs identified as drought responsive, 567 were upregulated and 97 were downregulated in drought-stressed leaves of maize. 8 lncRNAs were identified as miRNA precursor lncRNAs, 62 were classified as both shRNA and siRNA precursors, and 279 were classified as siRNA precursors. The remaining 315 lncRNAs were classified as other lncRNAs that are likely to function as longer molecules. Among these 315 lncRNAs, 10 are identified as antisense lncRNAs and 7 could pair with 17 CDS sequences with near-perfect matches. Finally, RT-qPCR results confirmed that all selected lncRNAs could respond to drought stress. These findings extend the current view on lncRNAs as ubiquitous regulators under stress conditions.

  15. Involvement of Host Non-Coding RNAs in the Pathogenesis of the Influenza Virus

    Directory of Open Access Journals (Sweden)

    Yanmei Ma

    2016-12-01

    Full Text Available Non-coding RNAs (ncRNAs are a new type of regulators that play important roles in various cellular processes, including cell growth, differentiation, survival, and apoptosis. ncRNAs, including small non-coding RNAs (e.g., microRNAs, small interfering RNAs and long non-coding RNAs (lncRNAs, are pervasively transcribed in human and mammalian cells. Recently, it has been recognized that these ncRNAs are critically implicated in the virus–host interaction as key regulators of transcription or post-transcription during viral infection. Influenza A virus (IAV is still a major threat to human health. Hundreds of ncRNAs are differentially expressed in response to infection with IAV, such as infection by pandemic H1N1 and highly pathogenic avian strains. There is increasing evidence demonstrating functional involvement of these regulatory microRNAs, vault RNAs (vtRNAs and lncRNAs in pathogenesis of influenza virus, including a variety of host immune responses. For example, it has been shown that ncRNAs regulate activation of pattern recognition receptor (PRR-associated signaling and transcription factors (nuclear factor κ-light-chain-enhancer of activated B cells, NF-κB, as well as production of interferons (IFNs and cytokines, and expression of critical IFN-stimulated genes (ISGs. The vital functions of IAV-regulated ncRNAs either to against defend viral invasion or to promote progeny viron production are summarized in this review. In addition, we also highlight the potentials of ncRNAs as therapeutic targets and diagnostic biomarkers.

  16. Involvement of Host Non-Coding RNAs in the Pathogenesis of the Influenza Virus.

    Science.gov (United States)

    Ma, Yanmei; Ouyang, Jing; Wei, Jingyun; Maarouf, Mohamed; Chen, Ji-Long

    2016-12-27

    Non-coding RNAs (ncRNAs) are a new type of regulators that play important roles in various cellular processes, including cell growth, differentiation, survival, and apoptosis. ncRNAs, including small non-coding RNAs (e.g., microRNAs, small interfering RNAs) and long non-coding RNAs (lncRNAs), are pervasively transcribed in human and mammalian cells. Recently, it has been recognized that these ncRNAs are critically implicated in the virus-host interaction as key regulators of transcription or post-transcription during viral infection. Influenza A virus (IAV) is still a major threat to human health. Hundreds of ncRNAs are differentially expressed in response to infection with IAV, such as infection by pandemic H1N1 and highly pathogenic avian strains. There is increasing evidence demonstrating functional involvement of these regulatory microRNAs, vault RNAs (vtRNAs) and lncRNAs in pathogenesis of influenza virus, including a variety of host immune responses. For example, it has been shown that ncRNAs regulate activation of pattern recognition receptor (PRR)-associated signaling and transcription factors (nuclear factor κ-light-chain-enhancer of activated B cells, NF-κB), as well as production of interferons (IFNs) and cytokines, and expression of critical IFN-stimulated genes (ISGs). The vital functions of IAV-regulated ncRNAs either to against defend viral invasion or to promote progeny viron production are summarized in this review. In addition, we also highlight the potentials of ncRNAs as therapeutic targets and diagnostic biomarkers.

  17. Quantification of non-coding RNA target localization diversity and its application in cancers.

    Science.gov (United States)

    Cheng, Lixin; Leung, Kwong-Sak

    2018-01-30

    Subcellular localization is pivotal for RNAs and proteins to implement biological functions. The localization diversity of protein interactions has been studied as a crucial feature of proteins, considering the protein-protein interactions take place in various subcellular locations. Nevertheless, the localization diversity of non-coding RNA (ncRNA) target proteins has not been systematically studied, especially its characteristics in cancers. In this study, we provide a new algorithm, non-coding RNA target localization coefficient (ncTALENT), to quantify the target localization diversity of ncRNAs based on the ncRNA-protein interaction and protein subcellular localization data. ncTALENT can be used to calculate the target localization coefficient of ncRNAs and measure how diversely their targets are distributed among the subcellular locations in various scenarios. We focus our study on long non-coding RNAs (lncRNAs), and our observations reveal that the target localization diversity is a primary characteristic of lncRNAs in different biotypes. Moreover, we found that lncRNAs in multiple cancers, differentially expressed cancer lncRNAs, and lncRNAs with multiple cancer target proteins are prone to have high target localization diversity. Furthermore, the analysis of gastric cancer helps us to obtain a better understanding that the target localization diversity of lncRNAs is an important feature closely related to clinical prognosis. Overall, we systematically studied the target localization diversity of the lncRNAs and uncovered its association with cancer. © The Author(s) (2018). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  18. Emerging role of non-coding RNA in neural plasticity, cognitive function, and neuropsychiatric disorders

    Directory of Open Access Journals (Sweden)

    Paola eSpadaro

    2012-07-01

    Full Text Available Non-coding RNAs have emerged as critical regulators of transcription, epigenetic processes, and gene silencing, which make them ideal candidates for insight into molecular evolution and a better understanding of the molecular pathways of neuropsychiatric disease. Here we provide an overview of the current state of knowledge regarding various classes of ncRNAs and their role in neural plasticity and cognitive function, and highlight the potential contribution they may make to the development of a variety of neuropsychiatric disorders, including schizophrenia, addiction and fear-related anxiety disorders.

  19. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  20. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    Directory of Open Access Journals (Sweden)

    Kamila Maliszewska-Olejniczak

    2015-07-01

    Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

  1. Evaluation of Agency Non-Code Layered Pressure Vessels (LPVs) . Volume 2; Appendices

    Science.gov (United States)

    Prosser, William H.

    2014-01-01

    In coordination with the Office of Safety and Mission Assurance and the respective Center Pressure System Managers (PSMs), the NASA Engineering and Safety Center (NESC) was requested to formulate a consensus draft proposal for the development of additional testing and analysis methods to establish the technical validity, and any limitation thereof, for the continued safe operation of facility non-code layered pressure vessels. The PSMs from each NASA Center were asked to participate as part of the assessment team by providing, collecting, and reviewing data regarding current operations of these vessels. This document contains the appendices to the main report.

  2. In silico discovery and modeling of non-coding RNA structure in viruses.

    Science.gov (United States)

    Moss, Walter N; Steitz, Joan A

    2015-12-01

    This review covers several computational methods for discovering structured non-coding RNAs in viruses and modeling their putative secondary structures. Here we will use examples from two target viruses to highlight these approaches: influenza A virus-a relatively small, segmented RNA virus; and Epstein-Barr virus-a relatively large DNA virus with a complex transcriptome. Each system has unique challenges to overcome and unique characteristics to exploit. From these particular cases, generically useful approaches can be derived for the study of additional viral targets. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Challenges of CRISPR/Cas9 applications for long non-coding RNA genes

    OpenAIRE

    Goyal, Ashish; Myacheva, Ksenia; Gro?, Matthias; Klingenberg, Marcel; Duran?Arqu?, Berta; Diederichs, Sven

    2016-01-01

    Abstract The CRISPR/Cas9 system provides a revolutionary genome editing tool for all areas of molecular biology. In long non-coding RNA (lncRNA) research, the Cas9 nuclease can delete lncRNA genes or introduce RNA-destabilizing elements into their locus. The nuclease-deficient dCas9 mutant retains its RNA-dependent DNA-binding activity and can modulate gene expression when fused to transcriptional repressor or activator domains. Here, we systematically analyze whether CRISPR approaches are su...

  4. Roles, Functions, and Mechanisms of Long Non-coding RNAs in Cancer

    Directory of Open Access Journals (Sweden)

    Yiwen Fang

    2016-02-01

    Full Text Available Long non-coding RNAs (lncRNAs play important roles in cancer. They are involved in chromatin remodeling, as well as transcriptional and post-transcriptional regulation, through a variety of chromatin-based mechanisms and via cross-talk with other RNA species. lncRNAs can function as decoys, scaffolds, and enhancer RNAs. This review summarizes the characteristics of lncRNAs, including their roles, functions, and working mechanisms, describes methods for identifying and annotating lncRNAs, and discusses future opportunities for lncRNA-based therapies using antisense oligonucleotides.

  5. The prognostic potential and carcinogenesis of long non-coding RNA TUG1 in human cholangiocarcinoma

    OpenAIRE

    Xu, Yi; Leng, Kaiming; Li, Zhenglong; Zhang, Fumin; Zhong, Xiangyu; Kang, Pengcheng; Jiang, Xingming; Cui, Yunfu

    2017-01-01

    Cholangiocarcinoma (CCA) is a fatal disease with increasing worldwide incidence and is characterized by poor prognosis due to its poor response to conventional chemotherapy or radiotherapy. Long non-coding RNAs (lncRNAs) play key roles in multiple human cancers, including CCA. Cancer progression related lncRNA taurine-up-regulated gene 1 (TUG1) was reported to be involved in human carcinomas. However, the impact of TUG1 in CCA is unclear. The aim of this study was to explore the expression pa...

  6. The beginning of the road for non-coding RNAs in normal hematopoiesis and hematologic malignancies

    Directory of Open Access Journals (Sweden)

    Elisabeth eHeuston

    2011-12-01

    Full Text Available The field of non-coding RNAs (ncRNAs encompasses a wide array of RNA classes that are indispensible for the regulation of cellular activities. However, deregulation of these ncRNAs can also play key roles in malignant transformation and cancer cell behavior. In this article we survey a select group of microRNAs and long ncRNAs that appear critical in the development of acute and chronic leukemias, as well as contribute to their diagnosis, prognosis, and potentially, the treatment of disease.

  7. An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome.

    Science.gov (United States)

    Ferlaino, Michael; Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin

    2017-10-06

    Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome.

  8. Long Non-Coding RNAs Associated with Metabolic Traits in Human White Adipose Tissue

    Directory of Open Access Journals (Sweden)

    Hui Gao

    2018-04-01

    Full Text Available Long non-coding RNAs (lncRNAs belong to a recently discovered class of molecules proposed to regulate various cellular processes. Here, we systematically analyzed their expression in human subcutaneous white adipose tissue (WAT and found that a limited set was differentially expressed in obesity and/or the insulin resistant state. Two lncRNAs herein termed adipocyte-specific metabolic related lncRNAs, ASMER-1 and ASMER-2 were enriched in adipocytes and regulated by both obesity and insulin resistance. Knockdown of either ASMER-1 or ASMER-2 by antisense oligonucleotides in in vitro differentiated human adipocytes revealed that both genes regulated adipogenesis, lipid mobilization and adiponectin secretion. The observed effects could be attributed to crosstalk between ASMERs and genes within the master regulatory pathways for adipocyte function including PPARG and INSR. Altogether, our data demonstrate that lncRNAs are modulators of the metabolic and secretory functions in human fat cells and provide an emerging link between WAT and common metabolic conditions. Keywords: White adipose tissue, Adipocytes, Long non-coding RNAs, Metabolic traits, Lipolysis, Adiponectin

  9. Keeping Abreast with long non-coding RNAs in mammary gland development and breast cancer

    Directory of Open Access Journals (Sweden)

    Herah eHansji

    2014-10-01

    Full Text Available The majority of the human genome is transcribed, even though only 2% of transcripts encode proteins. Non-coding transcripts were originally dismissed as evolutionary junk or transcriptional noise, but with the development of whole genome technologies, these ncRNAs are emerging as molecules with vital roles in regulating gene expression. While shorter ncRNAs have been extensively studied, the functional roles of long non-coding RNAs are still being elucidated. Studies over the last decade show that lncRNAs are emerging as new players in a number of diseases including cancer. Potential roles in both oncogenic and tumour suppressive pathways in cancer have been elucidated, but the biological functions of the majority of lncRNAs remain to be identified. Accumulated data are identifying the molecular mechanisms by which lncRNA mediates both structural and functional roles. LncRNA can regulate gene expression at both transcriptional and post-transcriptional levels, including splicing and regulating mRNA processing, transport and translation. Much current research is aimed at elucidating the function of lncRNAs in breast cancer and mammary gland development, and at identifying the cellular processes influenced by lncRNAs. In this paper we review current knowledge of lncRNAs contributing to these processes and present lncRNA as a new paradigm in breast cancer development.

  10. Comprehensive reconstruction and visualization of non-coding regulatory networks in human.

    Science.gov (United States)

    Bonnici, Vincenzo; Russo, Francesco; Bombieri, Nicola; Pulvirenti, Alfredo; Giugno, Rosalba

    2014-01-01

    Research attention has been powered to understand the functional roles of non-coding RNAs (ncRNAs). Many studies have demonstrated their deregulation in cancer and other human disorders. ncRNAs are also present in extracellular human body fluids such as serum and plasma, giving them a great potential as non-invasive biomarkers. However, non-coding RNAs have been relatively recently discovered and a comprehensive database including all of them is still missing. Reconstructing and visualizing the network of ncRNAs interactions are important steps to understand their regulatory mechanism in complex systems. This work presents ncRNA-DB, a NoSQL database that integrates ncRNAs data interactions from a large number of well established on-line repositories. The interactions involve RNA, DNA, proteins, and diseases. ncRNA-DB is available at http://ncrnadb.scienze.univr.it/ncrnadb/. It is equipped with three interfaces: web based, command-line, and a Cytoscape app called ncINetView. By accessing only one resource, users can search for ncRNAs and their interactions, build a network annotated with all known ncRNAs and associated diseases, and use all visual and mining features available in Cytoscape.

  11. The roles of non-coding RNAs in cardiac regenerative medicine

    Directory of Open Access Journals (Sweden)

    Oi Kuan Choong

    2017-06-01

    Full Text Available The emergence of non-coding RNAs (ncRNAs has challenged the central dogma of molecular biology that dictates that the decryption of genetic information starts from transcription of DNA to RNA, with subsequent translation into a protein. Large numbers of ncRNAs with biological significance have now been identified, suggesting that ncRNAs are important in their own right and their roles extend far beyond what was originally envisaged. ncRNAs do not only regulate gene expression, but are also involved in chromatin architecture and structural conformation. Several studies have pointed out that ncRNAs participate in heart disease; however, the functions of ncRNAs still remain unclear. ncRNAs are involved in cellular fate, differentiation, proliferation and tissue regeneration, hinting at their potential therapeutic applications. Here, we review the current understanding of both the biological functions and molecular mechanisms of ncRNAs in heart disease and describe some of the ncRNAs that have potential heart regeneration effects. Keywords: Non-coding RNAs, Cardiac regeneration, Cardiac fate, Proliferation, Differentiation, Reprograming

  12. Genome-wide identification of non-coding RNAs interacted with microRNAs in soybean

    Directory of Open Access Journals (Sweden)

    Chuyu eYe

    2014-12-01

    Full Text Available A wide range of RNA species interacting with microRNAs (miRNAs form a complex gene regulation network and play vital roles in diverse biological processes. In this study, we performed a genome-wide identification of endogenous target mimics (eTMs for miRNAs and phased-siRNA-producing loci (PHAS in soybean with a focus on those involved in lipid metabolism. The results showed that a large number of eTMs and PHAS genes could be found in soybean. Additionally, we found that lipid metabolism related genes were potentially regulated by 28 miRNAs, and nine of them were potentially further regulated by a number of eTMs with expression evidence. Thirty-three miRNAs were found to trigger production of phasiRNAs from 49 PHAS genes, which were able to target lipid metabolism related genes. Degradome data supported miRNA- and/or phasiRNA-mediated cleavage of genes involved in lipid metabolism. Most eTMs for miRNAs involved in lipid metabolism and phasiRNAs targeting lipid metabolism related genes showed a tissue-specific expression pattern. Our bioinformatical evidences suggested that lipid metabolism in soybean is potentially regulated by a complex non-coding network, including miRNAs, eTMs and phasiRNAs, and the results extended our knowledge on functions of non-coding RNAs.

  13. The regulatory roles of non-coding RNAs in nerve injury and regeneration.

    Science.gov (United States)

    Yu, Bin; Zhou, Songlin; Yi, Sheng; Gu, Xiaosong

    2015-11-01

    Non-coding RNAs (ncRNAs), especially microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), have attracted much attention since their regulatory roles in diverse cell processes were recognized. Emerging studies demonstrate that many ncRNAs are differentially expressed after injury to the nervous system, significantly affecting nerve regeneration. In this review, we compile the miRNAs and lncRNAs that have been reported to be dysregulated following a variety of central and peripheral nerve injuries, including acquired brain injury, spinal cord injury, and peripheral nerve injury. We also list investigations on how these miRNAs and lncRNAs exert the regulatory actions in neurodegenerative and neuroregenerative processes through different mechanisms involving their interaction with target coding genes. We believe that comprehension of the expression profiles and the possible functions of ncRNAs during the processes of nerve injury and regeneration will help understand the molecular mechanisms responsible for post-nerve-injury changes, and may contribute to the potential use of ncRNAs as a diagnostic marker and therapeutic target for nerve injury. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Genomic context analysis reveals dense interaction network between vertebrate ultraconserved non-coding elements.

    Science.gov (United States)

    Dimitrieva, Slavica; Bucher, Philipp

    2012-09-15

    Genomic context analysis, also known as phylogenetic profiling, is widely used to infer functional interactions between proteins but rarely applied to non-coding cis-regulatory DNA elements. We were wondering whether this approach could provide insights about utlraconserved non-coding elements (UCNEs). These elements are organized as large clusters, so-called gene regulatory blocks (GRBs) around key developmental genes. Their molecular functions and the reasons for their high degree of conservation remain enigmatic. In a special setting of genomic context analysis, we analyzed the fate of GRBs after a whole-genome duplication event in five fish genomes. We found that in most cases all UCNEs were retained together as a single block, whereas the corresponding target genes were often retained in two copies, one completely devoid of UCNEs. This 'winner-takes-all' pattern suggests that UCNEs of a GRB function in a highly cooperative manner. We propose that the multitude of interactions between UCNEs is the reason for their extreme sequence conservation. Supplementary data are available at Bioinformatics online and at http://ccg.vital-it.ch/ucne/

  15. Ameloblastoma RNA profiling uncovers a distinct non-coding RNA signature.

    Science.gov (United States)

    Davanian, Haleh; Balasiddaiah, Anangi; Heymann, Robert; Sundström, Magnus; Redenström, Poppy; Silfverberg, Mikael; Brodin, David; Sällberg, Matti; Lindskog, Sven; Kruger Weiner, Carina; Chen, Margaret

    2017-01-17

    Ameloblastoma of the jaws remains the top difficult to treat odontogenic tumour and has a high recurrence rate. New evidence suggests that non-coding RNAs (ncRNAs) play a critical role in tumourgenesis and prognosis of cancer. However, ameloblastoma ncRNA expression data is lacking. Here we present the first report of ameloblastoma ncRNA signatures. A total of 95 ameloblastoma cases and a global array transcriptome technology covering > 285.000 full-length transcripts were used in this two-step analysis. The analysis first identified in a test cohort 31 upregulated ameloblastoma-associated ncRNAs accompanied by signalling pathways of cancer, spliceosome, mRNA surveillance and Wnt. Further validation in an independent cohort points out the long non-coding (lncRNAs) and small nucleolar RNA (snoRNAs): LINC340, SNORD116-25, SNORA11, SNORA21, SNORA47 and SNORA65 as a distinct ncRNA signature of ameloblastoma. Importantly, the presence of these ncRNAs was independent of BRAF-V600E and SMO-L412F mutations, histology type or tumour location, but was positively correlated with the tumour size. Taken together, this study shows a systematic investigation of ncRNA expression of ameloblastoma, and illuminates new diagnostic and therapeutic targets for this invasive odontogenic tumour.

  16. The interplay of long non-coding RNAs and MYC in cancer

    Directory of Open Access Journals (Sweden)

    Michael J. Hamilton

    2015-12-01

    Full Text Available Long non-coding RNAs (lncRNAs are a class of RNA molecules that are changing how researchers view eukaryotic gene regulation. Once considered to be non-functional products of low-level aberrant transcription from non-coding regions of the genome, lncRNAs are now viewed as important epigenetic regulators and several lncRNAs have now been demonstrated to be critical players in the development and/or maintenance of cancer. Similarly, the emerging variety of interactions between lncRNAs and MYC, a well-known oncogenic transcription factor linked to most types of cancer, have caught the attention of many biomedical researchers. Investigations exploring the dynamic interactions between lncRNAs and MYC, referred to as the lncRNA-MYC network, have proven to be especially complex. Genome-wide studies have shown that MYC transcriptionally regulates many lncRNA genes. Conversely, recent reports identified lncRNAs that regulate MYC expression both at the transcriptional and post-transcriptional levels. These findings are of particular interest because they suggest roles of lncRNAs as regulators of MYC oncogenic functions and the possibility that targeting lncRNAs could represent a novel avenue to cancer treatment. Here, we briefly review the current understanding of how lncRNAs regulate chromatin structure and gene transcription, and then focus on the new developments in the emerging field exploring the lncRNA-MYC network in cancer.

  17. BlastR—fast and accurate database searches for non-coding RNAs

    Science.gov (United States)

    Bussotti, Giovanni; Raineri, Emanuele; Erb, Ionas; Zytnicki, Matthias; Wilm, Andreas; Beaudoing, Emmanuel; Bucher, Philipp; Notredame, Cedric

    2011-01-01

    We present and validate BlastR, a method for efficiently and accurately searching non-coding RNAs. Our approach relies on the comparison of di-nucleotides using BlosumR, a new log-odd substitution matrix. In order to use BlosumR for comparison, we recoded RNA sequences into protein-like sequences. We then showed that BlosumR can be used along with the BlastP algorithm in order to search non-coding RNA sequences. Using Rfam as a gold standard, we benchmarked this approach and show BlastR to be more sensitive than BlastN. We also show that BlastR is both faster and more sensitive than BlastP used with a single nucleotide log-odd substitution matrix. BlastR, when used in combination with WU-BlastP, is about 5% more accurate than WU-BlastN and about 50 times slower. The approach shown here is equally effective when combined with the NCBI-Blast package. The software is an open source freeware available from www.tcoffee.org/blastr.html. PMID:21624887

  18. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)

    2014-11-07

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  19. ncRNA-class Web Tool: Non-coding RNA feature extraction and pre-miRNA classification web tool

    KAUST Repository

    Kleftogiannis, Dimitrios A.

    2012-01-01

    Until recently, it was commonly accepted that most genetic information is transacted by proteins. Recent evidence suggests that the majority of the genomes of mammals and other complex organisms are in fact transcribed into non-coding RNAs (ncRNAs), many of which are alternatively spliced and/or processed into smaller products. Non coding RNA genes analysis requires the calculation of several sequential, thermodynamical and structural features. Many independent tools have already been developed for the efficient calculation of such features but to the best of our knowledge there does not exist any integrative approach for this task. The most significant amount of existing work is related to the miRNA class of non-coding RNAs. MicroRNAs (miRNAs) are small non-coding RNAs that play a significant role in gene regulation and their prediction is a challenging bioinformatics problem. Non-coding RNA feature extraction and pre-miRNA classification Web Tool (ncRNA-class Web Tool) is a publicly available web tool ( http://150.140.142.24:82/Default.aspx ) which provides a user friendly and efficient environment for the effective calculation of a set of 58 sequential, thermodynamical and structural features of non-coding RNAs, plus a tool for the accurate prediction of miRNAs. © 2012 IFIP International Federation for Information Processing.

  20. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

    Directory of Open Access Journals (Sweden)

    Kiwoung Yang

    2015-12-01

    Full Text Available Ribosomal DNA (rDNA of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS. The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2, and the intergenic spacer 45S-IGS (25S-18S. This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies variation of the 45S IGS in B. oleracea.

  1. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata.

    Science.gov (United States)

    Yang, Kiwoung; Robin, Arif Hasan Khan; Yi, Go-Eun; Lee, Jonghoon; Chung, Mi-Young; Yang, Tae-Jin; Nou, Ill-Sup

    2015-12-03

    Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F₁s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea.

  2. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  3. Primate-specific Long Non-coding RNAs and MicroRNAs

    Directory of Open Access Journals (Sweden)

    Hassaan Mehboob Awan

    2017-06-01

    Full Text Available Non-coding RNAs (ncRNAs are critical regulators of gene expression in essentially all life forms. Long ncRNAs (lncRNAs and microRNAs (miRNAs are two important RNA classes possessing regulatory functions. Up to date, many primate-specific ncRNAs have been identified and investigated. Their expression specificity to primate lineage suggests primate-specific roles. It is thus critical to elucidate the biological significance of primate or even human-specific ncRNAs, and to develop potential ncRNA-based therapeutics. Here, we have summarized the studies regarding regulatory roles of some key primate-specific lncRNAs and miRNAs.

  4. Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer

    DEFF Research Database (Denmark)

    Martens-Uzunova, E S; Jalava, S E; Dits, N F

    2011-01-01

    Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA...... signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar...... RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly...

  5. An Emerging Role for Long Non-Coding RNA Dysregulation in Neurological Disorders

    Directory of Open Access Journals (Sweden)

    Elio Scarpini

    2013-10-01

    Full Text Available A novel class of transcripts, long non coding RNAs (lncRNAs, has recently emerged as key players in several biological processes, including dosage compensation, genomic imprinting, chromatin regulation, embryonic development and segmentation, stem cell pluripotency, cell fate determination and potentially many other biological processes, which still are to be elucidated. LncRNAs are pervasively transcribed in the genome and several lines of evidence correlate dysregulation of different lncRNAs to human diseases including neurological disorders. Although their mechanisms of action are yet to be fully elucidated, evidence suggests lncRNA contributions to the pathogenesis of a number of diseases. In this review, the current state of knowledge linking lncRNAs to different neurological disorders is discussed and potential future directions are considered.

  6. An Emerging Role for Long Non-Coding RNA Dysregulation in Neurological Disorders

    Science.gov (United States)

    Fenoglio, Chiara; Ridolfi, Elisa; Galimberti, Daniela; Scarpini, Elio

    2013-01-01

    A novel class of transcripts, long non coding RNAs (lncRNAs), has recently emerged as key players in several biological processes, including dosage compensation, genomic imprinting, chromatin regulation, embryonic development and segmentation, stem cell pluripotency, cell fate determination and potentially many other biological processes, which still are to be elucidated. LncRNAs are pervasively transcribed in the genome and several lines of evidence correlate dysregulation of different lncRNAs to human diseases including neurological disorders. Although their mechanisms of action are yet to be fully elucidated, evidence suggests lncRNA contributions to the pathogenesis of a number of diseases. In this review, the current state of knowledge linking lncRNAs to different neurological disorders is discussed and potential future directions are considered. PMID:24129177

  7. Role of Non-Coding RNAs in the Transgenerational Epigenetic Transmission of the Effects of Reprotoxicants

    Directory of Open Access Journals (Sweden)

    Eduardo Larriba

    2016-03-01

    Full Text Available Non-coding RNAs (ncRNAs are regulatory elements of gene expression and chromatin structure. Both long and small ncRNAs can also act as inductors and targets of epigenetic programs. Epigenetic patterns can be transmitted from one cell to the daughter cell, but, importantly, also through generations. Diversity of ncRNAs is emerging with new and surprising roles. Functional interactions among ncRNAs and between specific ncRNAs and structural elements of the chromatin are drawing a complex landscape. In this scenario, epigenetic changes induced by environmental stressors, including reprotoxicants, can explain some transgenerationally-transmitted phenotypes in non-Mendelian ways. In this review, we analyze mechanisms of action of reprotoxicants upon different types of ncRNAs and epigenetic modifications causing transgenerationally transmitted characters through germ cells but affecting germ cells and reproductive systems. A functional model of epigenetic mechanisms of transgenerational transmission ncRNAs-mediated is also proposed.

  8. A Looking-Glass of Non-Coding RNAs in Oral Cancer

    Directory of Open Access Journals (Sweden)

    Alexandra Iulia Irimie

    2017-12-01

    Full Text Available Oral cancer is a multifactorial pathology and is characterized by the lack of efficient treatment and accurate diagnostic tools. This is mainly due the late diagnosis; therefore, reliable biomarkers for the timely detection of the disease and patient stratification are required. Non-coding RNAs (ncRNAs are key elements in the physiological and pathological processes of various cancers, which is also reflected in oral cancer development and progression. A better understanding of their role could give a more thorough perspective on the future treatment options for this cancer type. This review offers a glimpse into the ncRNA involvement in oral cancer, which can help the medical community tap into the world of ncRNAs and lay the ground for more powerful diagnostic, prognostic and treatment tools for oral cancer that will ultimately help build a brighter future for these patients.

  9. Mechanisms of Long Non-Coding RNAs in the Assembly and Plasticity of Neural Circuitry.

    Science.gov (United States)

    Wang, Andi; Wang, Junbao; Liu, Ying; Zhou, Yan

    2017-01-01

    The mechanisms underlying development processes and functional dynamics of neural circuits are far from understood. Long non-coding RNAs (lncRNAs) have emerged as essential players in defining identities of neural cells, and in modulating neural activities. In this review, we summarized latest advances concerning roles and mechanisms of lncRNAs in assembly, maintenance and plasticity of neural circuitry, as well as lncRNAs' implications in neurological disorders. We also discussed technical advances and challenges in studying functions and mechanisms of lncRNAs in neural circuitry. Finally, we proposed that lncRNA studies would advance our understanding on how neural circuits develop and function in physiology and disease conditions.

  10. The functional role of long non-coding RNA in digestive system carcinomas.

    Science.gov (United States)

    Wang, Guang-Yu; Zhu, Yuan-Yuan; Zhang, Yan-Qiao

    2014-09-01

    In recent years, long non-coding RNAs (lncRNAs) are emerging as either oncogenes or tumor suppressor genes. Recent evidences suggest that lncRNAs play a very important role in digestive system carcinomas. However, the biological function of lncRNAs in the vast majority of digestive system carcinomas remains unclear. Recently, increasing studies has begun to explore their molecular mechanisms and regulatory networks that they are implicated in tumorigenesis. In this review, we highlight the emerging functional role of lncRNAs in digestive system carcinomas. It is becoming clear that lncRNAs will be exciting and potentially useful for diagnosis and treatment of digestive system carcinomas, some of these lncRNAs might function as both diagnostic markers and the treatment targets of digestive system carcinomas.

  11. Evaluation of Agency Non-Code Layered Pressure Vessels (LPVs). Corrected Copy, Aug. 25, 2014

    Science.gov (United States)

    Prosser, William H.

    2014-01-01

    In coordination with the Office of Safety and Mission Assurance and the respective Center Pressure System Managers (PSMs), the NASA Engineering and Safety Center (NESC) was requested to formulate a consensus draft proposal for the development of additional testing and analysis methods to establish the technical validity, and any limitation thereof, for the continued safe operation of facility non-code layered pressure vessels. The PSMs from each NASA Center were asked to participate as part of the assessment team by providing, collecting, and reviewing data regarding current operations of these vessels. This report contains the outcome of the assessment and the findings, observations, and NESC recommendations to the Agency and individual NASA Centers.

  12. New technologies accelerate the exploration of non-coding RNAs in horticultural plants

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Degao; Mewalal, Ritesh; Hu, Rongbin; Tuskan, Gerald A.; Yang, Xiaohan

    2017-07-05

    Non-coding RNAs (ncRNAs), that is, RNAs not translated into proteins, are crucial regulators of a variety of biological processes in plants. While protein-encoding genes have been relatively well-annotated in sequenced genomes, accounting for a small portion of the genome space in plants, the universe of plant ncRNAs is rapidly expanding. Recent advances in experimental and computational technologies have generated a great momentum for discovery and functional characterization of ncRNAs. Here we summarize the classification and known biological functions of plant ncRNAs, review the application of next-generation sequencing (NGS) technology and ribosome profiling technology to ncRNA discovery in horticultural plants and discuss the application of new technologies, especially the new genome-editing tool clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) systems, to functional characterization of plant ncRNAs.

  13. A-to-I editing of coding and non-coding RNAs by ADARs

    Science.gov (United States)

    Nishikura, Kazuko

    2016-01-01

    Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

  14. Non-coding Transcripts from Enhancers: New Insights into Enhancer Activity and Gene Expression Regulation

    Directory of Open Access Journals (Sweden)

    Hongjun Chen

    2017-06-01

    Full Text Available Long non-coding RNAs (lncRNAs have gained widespread interest in the past decade owing to their enormous amount and surprising functions implicated in a variety of biological processes. Some lncRNAs exert function as enhancers, i.e., activating gene transcription by serving as the cis-regulatory molecules. Furthermore, recent studies have demonstrated that many enhancer elements can be transcribed and produce RNA molecules, which are termed as enhancer RNAs (eRNAs. The eRNAs are not merely the by-product of the enhancer transcription. In fact, many of them directly exert or regulate enhancer activity in gene activation through diverse mechanisms. Here, we provide an overview of enhancer activity, transcription of enhancer itself, characteristics of eRNAs, as well as their roles in regulating enhancer activity and gene expression.

  15. Long non-coding RNA-MIAT promotes neurovascular remodeling in the eye and brain.

    Science.gov (United States)

    Jiang, Qin; Shan, Kun; Qun-Wang, Xiao; Zhou, Rong-Mei; Yang, Hong; Liu, Chang; Li, Yu-Jie; Yao, Jin; Li, Xiu-Miao; Shen, Yi; Cheng, Hong; Yuan, Jun; Zhang, Yang-Yang; Yan, Biao

    2016-08-02

    Although nervous and vascular systems are functionally different, they usually share similar mechanisms for function maintenance. Neurovascular dysfunction has became the pathogenesis of several vascular and nervous disorders. Here we show that long non-coding RNA-MIAT is aberrantly expressed under neurovascular dysfunction condition. MIAT is shown as a regulator of vascular dysfunction, including retinal angiogenesis, corneal angiogenesis, and vascular permeability. MIAT is also shown as a regulator of retinal neurodegeneration under diabetic condition. Mechanistically, MIAT regulates neural and vascular cell function via MIAT/miR-150-5p/VEGF network. The eye is a valuable model to study central nervous system (CNS) disorders. We show that MIAT knockdown leads to cerebral microvascular degeneration, progressive neuronal loss and neurodegeneration, and behavioral deficits in a CNS neurovascular disorder, Alzheimer's disease. MIAT may represent a pharmacological target for treating neurovascular-related disorders.

  16. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells.

    Science.gov (United States)

    Autour, Alexis; C Y Jeng, Sunny; D Cawte, Adam; Abdolahzadeh, Amir; Galli, Angela; Panchapakesan, Shanker S S; Rueda, David; Ryckelynck, Michael; Unrau, Peter J

    2018-02-13

    Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.

  17. Epigenetics and Vascular Diseases: Influence of Non-coding RNAs and Their Clinical Implications.

    Science.gov (United States)

    Elia, Leonardo; Quintavalle, Manuela

    2017-01-01

    Epigenetics refers to heritable mechanisms able to modulate gene expression that do not involve alteration of the genomic DNA sequence. Classically, mechanisms such as DNA methylation and histone modifications were part of this classification. Today, this field of study has been expanded and includes also the large class of non-coding RNAs (ncRNAs). Indeed, with the extraordinary possibilities introduced by the next-generation sequencing approaches, our knowledge of the mammalian transcriptome has greatly improved. Today, we have identifying thousands of ncRNAs, and unsurprisingly, a direct association between ncRNA dysregulation and development of cardiovascular pathologies has been identified. This class of gene modulators is further divided into short-ncRNAs and long-non-coding RNAs (lncRNAs). Among the short-ncRNA sub-group, the best-characterized players are represented by highly conserved RNAs named microRNAs (miRNAs). miRNAs principally inhibit gene expression, and their involvement in cardiovascular diseases has been largely studied. On the other hand, due to the different roles played by lncRNAs, their involvement in cardiovascular pathology development is still limited, and further studies are needed. For instance, in order to define their roles in the cellular processes associated with the development of diseases, we need to better characterize the details of their mechanisms of action; only then might we be able to develop innovative therapeutic strategies. In this review, we would like to give an overview of the current knowledge on the function of ncRNAs and their involvement in the development of vascular diseases.

  18. Epigenetics and Vascular Diseases: Influence of Non-coding RNAs and Their Clinical Implications

    Directory of Open Access Journals (Sweden)

    Leonardo Elia

    2017-04-01

    Full Text Available Epigenetics refers to heritable mechanisms able to modulate gene expression that do not involve alteration of the genomic DNA sequence. Classically, mechanisms such as DNA methylation and histone modifications were part of this classification. Today, this field of study has been expanded and includes also the large class of non-coding RNAs (ncRNAs. Indeed, with the extraordinary possibilities introduced by the next-generation sequencing approaches, our knowledge of the mammalian transcriptome has greatly improved. Today, we have identifying thousands of ncRNAs, and unsurprisingly, a direct association between ncRNA dysregulation and development of cardiovascular pathologies has been identified. This class of gene modulators is further divided into short-ncRNAs and long-non-coding RNAs (lncRNAs. Among the short-ncRNA sub-group, the best-characterized players are represented by highly conserved RNAs named microRNAs (miRNAs. miRNAs principally inhibit gene expression, and their involvement in cardiovascular diseases has been largely studied. On the other hand, due to the different roles played by lncRNAs, their involvement in cardiovascular pathology development is still limited, and further studies are needed. For instance, in order to define their roles in the cellular processes associated with the development of diseases, we need to better characterize the details of their mechanisms of action; only then might we be able to develop innovative therapeutic strategies. In this review, we would like to give an overview of the current knowledge on the function of ncRNAs and their involvement in the development of vascular diseases.

  19. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  20. Long non-coding RNA expression profiling of mouse testis during postnatal development.

    Directory of Open Access Journals (Sweden)

    Jin Sun

    Full Text Available Mammalian testis development and spermatogenesis play critical roles in male fertility and continuation of a species. Previous research into the molecular mechanisms of testis development and spermatogenesis has largely focused on the role of protein-coding genes and small non-coding RNAs, such as microRNAs and piRNAs. Recently, it has become apparent that large numbers of long (>200 nt non-coding RNAs (lncRNAs are transcribed from mammalian genomes and that lncRNAs perform important regulatory functions in various developmental processes. However, the expression of lncRNAs and their biological functions in post-natal testis development remain unknown. In this study, we employed microarray technology to examine lncRNA expression profiles of neonatal (6-day-old and adult (8-week-old mouse testes. We found that 8,265 lncRNAs were expressed above background levels during post-natal testis development, of which 3,025 were differentially expressed. Candidate lncRNAs were identified for further characterization by an integrated examination of genomic context, gene ontology (GO enrichment of their associated protein-coding genes, promoter analysis for epigenetic modification, and evolutionary conservation of elements. Many lncRNAs overlapped or were adjacent to key transcription factors and other genes involved in spermatogenesis, such as Ovol1, Ovol2, Lhx1, Sox3, Sox9, Plzf, c-Kit, Wt1, Sycp2, Prm1 and Prm2. Most differentially expressed lncRNAs exhibited epigenetic modification marks similar to protein-coding genes and tend to be expressed in a tissue-specific manner. In addition, the majority of differentially expressed lncRNAs harbored evolutionary conserved elements. Taken together, our findings represent the first systematic investigation of lncRNA expression in the mammalian testis and provide a solid foundation for further research into the molecular mechanisms of lncRNAs function in mammalian testis development and spermatogenesis.

  1. Characterization of Sus scrofa small non-coding RNAs present in both female and male gonads.

    Directory of Open Access Journals (Sweden)

    Dorota Kowalczykiewicz

    Full Text Available Small non-coding RNAs (sncRNAs are indispensable for proper germ cell development, emphasizing the need for greater elucidation of the mechanisms of germline development and regulation of this process by sncRNAs. We used deep sequencing to characterize three families of small non-coding RNAs (piRNAs, miRNAs, and tRFs present in Sus scrofa gonads and focused on the small RNA fraction present in both male and female gonads. Although similar numbers of reads were obtained from both types of gonads, the number of unique RNA sequences in the ovaries was several times lower. Of the sequences detected in the testes, 2.6% of piRNAs, 9% of miRNAs, and 10% of tRFs were also present in the ovaries. Notably, the majority of the shared piRNAs mapped to ribosomal RNAs and were derived from clustered loci. In addition, the most abundant miRNAs present in the ovaries and testes are conserved and are involved in many biological processes such as the regulation of homeobox genes, the control of cell proliferation, and carcinogenesis. Unexpectedly, we detected a novel sncRNA type, the tRFs, which are 30-36-nt RNA fragments derived from tRNA molecules, in gonads. Analysis of S. scrofa piRNAs show that testes specific piRNAs are biased for 5' uracil but both testes and ovaries specific piRNAs are not biased for adenine at the 10th nucleotide position. These observations indicate that adult porcine piRNAs are predominantly produced by a primary processing pathway or other mechanisms and secondary piRNAs generated by ping-pong mechanism are absent.

  2. A comprehensive catalogue of the coding and non-coding transcripts of the human inner ear

    Science.gov (United States)

    Corneveaux, Jason J.; Ohmen, Jeffrey; White, Cory; Allen, April N.; Lusis, Aldons J.; Van Camp, Guy; Huentelman, Matthew J.; Friedman, Rick A.

    2015-01-01

    The mammalian inner ear consists of the cochlea and the vestibular labyrinth (utricle, saccule, and semicircular canals), which participate in both hearing and balance. Proper development and life-long function of these structures involves a highly complex coordinated system of spatial and temporal gene expression. The characterization of the inner ear transcriptome is likely important for the functional study of auditory and vestibular components, yet, primarily due to tissue unavailability, detailed expression catalogues of the human inner ear remain largely incomplete. We report here, for the first time, comprehensive transcriptome characterization of the adult human cochlea, ampulla, saccule and utricle of the vestibule obtained from patients without hearing abnormalities. Using RNA-Seq, we measured the expression of >50,000 predicted genes corresponding to approximately 200,000 transcripts, in the adult inner ear and compared it to 32 other human tissues. First, we identified genes preferentially expressed in the inner ear, and unique either to the vestibule or cochlea. Next, we examined expression levels of specific groups of potentially interesting RNAs, such as genes implicated in hearing loss, long non-coding RNAs, pseudogenes and transcripts subject to nonsense mediated decay (NMD). We uncover the spatial specificity of expression of these RNAs in the hearing/balance system, and reveal evidence of tissue specific NMD. Lastly, we investigated the non-syndromic deafness loci to which no gene has been mapped, and narrow the list of potential candidates for each locus. These data represent the first high-resolution transcriptome catalogue of the adult human inner ear. A comprehensive identification of coding and non-coding RNAs in the inner ear will enable pathways of auditory and vestibular function to be further defined in the study of hearing and balance. Expression data are freely accessible at https://www.tgen.org/home/research

  3. Identification of novel long non-coding RNAs deregulated in hepatocellular carcinoma using RNA-sequencing.

    Science.gov (United States)

    Esposti, Davide Degli; Hernandez-Vargas, Hector; Voegele, Catherine; Fernandez-Jimenez, Nora; Forey, Nathalie; Bancel, Brigitte; Le Calvez-Kelm, Florence; McKay, James; Merle, Philippe; Herceg, Zdenko

    2016-05-31

    Functional characterization of long non-coding RNAs (lncRNAs) and their pathological relevance is still a challenging task. Abnormal expression of a few long non-coding RNAs have been found associated with hepatocellular carcinoma, with potential implications to both improve our understanding of molecular mechanism of liver carcinogenesis and to discover biomarkers for early diagnosis or therapy. However, the understanding of the global role of lncRNAs during HCC development is still in its infancy. In this study, we produced RNA-Seq data from 23 liver tissues (controls, cirrhotic and HCCs) and applied statistical and gene network analysis approaches to identify and characterize expressed lncRNAs. We detected 5,525 lncRNAs across different tissue types and identified 57 differentially expressed lncRNAs in HCC compared with adjacent non-tumour tissues using stringent criteria (FDR2). Using weighted gene co-expression network analysis (WGCNA), we found that differentially expressed lncRNAs are co-expressed with genes involved in cell cycle regulation, TGF-β signalling and liver metabolism. Furthermore, we found that more than 20% of differentially expressed lncRNAs are associated to actively transcribed enhancers and that the co-expression patterns with their closest genes change dramatically during HCC development. Our study provides the most comprehensive compendium of lncRNAs expressed in HCC, as well as in control or cirrhotic livers. Our results identified both known oncogenic lncRNAs (such as H19 and CRNDE) and novel lncRNAs involved in cell cycle deregulation and liver metabolism deficits occurring during HCC development.

  4. Transcriptator: An Automated Computational Pipeline to Annotate Assembled Reads and Identify Non Coding RNA.

    Directory of Open Access Journals (Sweden)

    Kumar Parijat Tripathi

    Full Text Available RNA-seq is a new tool to measure RNA transcript counts, using high-throughput sequencing at an extraordinary accuracy. It provides quantitative means to explore the transcriptome of an organism of interest. However, interpreting this extremely large data into biological knowledge is a problem, and biologist-friendly tools are lacking. In our lab, we developed Transcriptator, a web application based on a computational Python pipeline with a user-friendly Java interface. This pipeline uses the web services available for BLAST (Basis Local Search Alignment Tool, QuickGO and DAVID (Database for Annotation, Visualization and Integrated Discovery tools. It offers a report on statistical analysis of functional and Gene Ontology (GO annotation's enrichment. It helps users to identify enriched biological themes, particularly GO terms, pathways, domains, gene/proteins features and protein-protein interactions related informations. It clusters the transcripts based on functional annotations and generates a tabular report for functional and gene ontology annotations for each submitted transcript to the web server. The implementation of QuickGo web-services in our pipeline enable the users to carry out GO-Slim analysis, whereas the integration of PORTRAIT (Prediction of transcriptomic non coding RNA (ncRNA by ab initio methods helps to identify the non coding RNAs and their regulatory role in transcriptome. In summary, Transcriptator is a useful software for both NGS and array data. It helps the users to characterize the de-novo assembled reads, obtained from NGS experiments for non-referenced organisms, while it also performs the functional enrichment analysis of differentially expressed transcripts/genes for both RNA-seq and micro-array experiments. It generates easy to read tables and interactive charts for better understanding of the data. The pipeline is modular in nature, and provides an opportunity to add new plugins in the future. Web application is

  5. CVD-associated non-coding RNA, ANRIL, modulates expression of atherogenic pathways in VSMC

    Energy Technology Data Exchange (ETDEWEB)

    Congrains, Ada; Kamide, Kei [Department of Geriatric Medicine and Nephrology, Osaka University Graduate School of Medicine (Japan); Katsuya, Tomohiro [Clinical Gene Therapy, Osaka University Graduate School of Medicine (Japan); Yasuda, Osamu [Department of Cardiovascular Clinical and Translational Research, Kumamoto University Hospital (Japan); Oguro, Ryousuke; Yamamoto, Koichi [Department of Geriatric Medicine and Nephrology, Osaka University Graduate School of Medicine (Japan); Ohishi, Mitsuru, E-mail: ohishi@geriat.med.osaka-u.ac.jp [Department of Geriatric Medicine and Nephrology, Osaka University Graduate School of Medicine (Japan); Rakugi, Hiromi [Department of Geriatric Medicine and Nephrology, Osaka University Graduate School of Medicine (Japan)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer ANRIL maps in the strongest susceptibility locus for cardiovascular disease. Black-Right-Pointing-Pointer Silencing of ANRIL leads to altered expression of tissue remodeling-related genes. Black-Right-Pointing-Pointer The effects of ANRIL on gene expression are splicing variant specific. Black-Right-Pointing-Pointer ANRIL affects progression of cardiovascular disease by regulating proliferation and apoptosis pathways. -- Abstract: ANRIL is a newly discovered non-coding RNA lying on the strongest genetic susceptibility locus for cardiovascular disease (CVD) in the chromosome 9p21 region. Genome-wide association studies have been linking polymorphisms in this locus with CVD and several other major diseases such as diabetes and cancer. The role of this non-coding RNA in atherosclerosis progression is still poorly understood. In this study, we investigated the implication of ANRIL in the modulation of gene sets directly involved in atherosclerosis. We designed and tested siRNA sequences to selectively target two exons (exon 1 and exon 19) of the transcript and successfully knocked down expression of ANRIL in human aortic vascular smooth muscle cells (HuAoVSMC). We used a pathway-focused RT-PCR array to profile gene expression changes caused by ANRIL knock down. Notably, the genes affected by each of the siRNAs were different, suggesting that different splicing variants of ANRIL might have distinct roles in cell physiology. Our results suggest that ANRIL splicing variants play a role in coordinating tissue remodeling, by modulating the expression of genes involved in cell proliferation, apoptosis, extra-cellular matrix remodeling and inflammatory response to finally impact in the risk of cardiovascular disease and other pathologies.

  6. Analysis of intergenic spacer transcripts suggests ‘read-around’ transcription of the extrachromosomal circular rDNA in Euglena gracilis

    Science.gov (United States)

    Greenwood, Spencer J.; Schnare, Murray N.; Cook, James R.; Gray, Michael W.

    2001-01-01

    We report here the sequence of the 1743 bp intergenic spacer (IGS) that separates the 3′-end of the large subunit ribosomal RNA (rRNA) gene from the 5′-end of the small subunit (SSU) rRNA gene in the circular, extrachromosomal ribosomal DNA (rDNA) of Euglena gracilis. The IGS contains a 277 nt stretch of sequence that is related to a sequence found in ITS 1, an internal transcribed spacer between the SSU and 5.8S rRNA genes. Primer extension analysis of IGS transcripts identified three abundant reverse transcriptase stops that may be analogous to the transcription initiation site (TIS) and two processing sites (A′ and A0) that are found in this region in other eukaryotes. Features that could influence processing at these sites include an imperfect palindrome near site A0 and a sequence near site A′ that could potentially base pair with U3 small nucleolar RNA. Our identification of the TIS (verified by mung bean nuclease analysis) is considered tentative because we also detected low-abundance transcripts upstream of this site throughout the entire IGS. This result suggests the possibility of ‘read-around’ transcription, i.e. transcription that proceeds multiple times around the rDNA circle without termination. PMID:11353089

  7. Evolutionary modeling and prediction of non-coding RNAs in Drosophila.

    Directory of Open Access Journals (Sweden)

    Robert K Bradley

    2009-08-01

    Full Text Available We performed benchmarks of phylogenetic grammar-based ncRNA gene prediction, experimenting with eight different models of structural evolution and two different programs for genome alignment. We evaluated our models using alignments of twelve Drosophila genomes. We find that ncRNA prediction performance can vary greatly between different gene predictors and subfamilies of ncRNA gene. Our estimates for false positive rates are based on simulations which preserve local islands of conservation; using these simulations, we predict a higher rate of false positives than previous computational ncRNA screens have reported. Using one of the tested prediction grammars, we provide an updated set of ncRNA predictions for D. melanogaster and compare them to previously-published predictions and experimental data. Many of our predictions show correlations with protein-coding genes. We found significant depletion of intergenic predictions near the 3' end of coding regions and furthermore depletion of predictions in the first intron of protein-coding genes. Some of our predictions are colocated with larger putative unannotated genes: for example, 17 of our predictions showing homology to the RFAM family snoR28 appear in a tandem array on the X chromosome; the 4.5 Kbp spanned by the predicted tandem array is contained within a FlyBase-annotated cDNA.

  8. Supporting data for characterization of non-coding RNAs associated with the Neuronal growth regulator 1 (NEGR1 adhesion protein

    Directory of Open Access Journals (Sweden)

    Prameet Kaur

    2016-06-01

    Full Text Available Long non-coding RNAs and microRNAs control gene expression to determine central nervous system development and function. Neuronal growth regulator 1 (NEGR1 is a cell adhesion molecule that plays an important role in neurite outgrowth during neuronal development and its precise expression is crucial for correct brain development. The data described here is related to the research article titled “A long non-coding RNA, BC048612 and a microRNA, miR-203 coordinate the gene expression of Neuronal growth regulator 1 (NEGR1 adhesion protein” [1]. This data article contains detailed bioinformatics analysis of genetic signatures at the Negr1 gene locus retrieved from the UCSC genome browser. This approach could be adopted to identify putative regulatory non-coding RNAs in other tissues and diseases.

  9. Orion: Detecting regions of the human non-coding genome that are intolerant to variation using population genetics.

    Science.gov (United States)

    Gussow, Ayal B; Copeland, Brett R; Dhindsa, Ryan S; Wang, Quanli; Petrovski, Slavé; Majoros, William H; Allen, Andrew S; Goldstein, David B

    2017-01-01

    There is broad agreement that genetic mutations occurring outside of the protein-coding regions play a key role in human disease. Despite this consensus, we are not yet capable of discerning which portions of non-coding sequence are important in the context of human disease. Here, we present Orion, an approach that detects regions of the non-coding genome that are depleted of variation, suggesting that the regions are intolerant of mutations and subject to purifying selection in the human lineage. We show that Orion is highly correlated with known intolerant regions as well as regions that harbor putatively pathogenic variation. This approach provides a mechanism to identify pathogenic variation in the human non-coding genome and will have immediate utility in the diagnostic interpretation of patient genomes and in large case control studies using whole-genome sequences.

  10. microRNA-9 targets the long non-coding RNA MALAT1 for degradation in the nucleus

    DEFF Research Database (Denmark)

    Leucci, Eleonora; Patella, Francesca; Waage, Johannes

    2013-01-01

    microRNAs regulate the expression of over 60% of protein coding genes by targeting their mRNAs to AGO2-containing complexes in the cytoplasm and promoting their translational inhibition and/or degradation. There is little evidence so far for microRNA-mediated regulation of other classes of non......-coding RNAs. Here we report that microRNA-9 (miR-9) regulates the expression of the Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT-1), one of the most abundant and conserved long non-coding RNAs. Intriguingly, we find that miR-9 targets AGO2-mediated regulation of MALAT1 in the nucleus. Our...... findings reveal a novel direct regulatory link between two important classes of non-coding RNAs, miRs and lncRNAs, and advance our understanding of microRNA functions....

  11. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    LENUS (Irish Health Repository)

    Weissenmayer, Barbara A

    2011-01-01

    Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.

  12. Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Barbara A Weissenmayer

    2011-03-01

    Full Text Available Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen's interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank's Gene Expression Omnibus (GEO database under the series accession GSE27232.

  13. Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies

    Directory of Open Access Journals (Sweden)

    Giulia Frisso

    2016-11-01

    Full Text Available Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants (MYBPC3-c.506-2A>C, MYBPC3-c.906-7G>T, MYBPC3-c.2308+3G>C, SCN5A-c.393-5C>A, and ACTC1-c.617-7T>C found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3-c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 (MYBPC3-G169AfsX14. In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3-c.2308+3G>C and SCN5A-c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3-c.906-7G>T or ACTC1-c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.

  14. Inhibition of long non-coding RNA ROR reverses resistance to Tamoxifen by inducing autophagy in breast cancer.

    Science.gov (United States)

    Li, Yuehua; Jiang, Baohong; Zhu, Hongbo; Qu, Xiaofei; Zhao, Liqin; Tan, Yeru; Jiang, Yiling; Liao, Mingchu; Wu, Xiaoping

    2017-06-01

    This study explored the mechanism underlying long non-coding RNA ROR regulating autophagy on Tamoxifen resistance in breast cancer. Cancer tissues and adjacent normal tissues were collected from 74 breast cancer patients. Human breast cancer BT474 cells were assigned into blank, phosphate buffered saline, Tamoxifen, negative control + Tamoxifen, siROR + Tamoxifen, 3-methyladenine + Tamoxifen, and siROR + 3-methyladenine + TA groups. The expression of long non-coding RNA ROR and expressions of multi-drug resistance-associated P-glycoprotein and glutathione S-transferase-π messenger RNA were detected using quantitative real-time polymerase chain reaction. The expressions of light chain 3, Beclin 1, multi-drug resistance-associated P-glycoprotein, and glutathione S-transferase-π protein were determined using western blotting. Cell proliferation, invasion, and migration abilities were measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, Transwell assay, and scratch test, respectively. The long non-coding RNA ROR expression was higher in the breast cancer tissues than that in the adjacent normal tissues. Compared with the blank group, light chain 3 and Beclin 1 expressions were increased in the siROR + Tamoxifen group but decreased in the 3-methyladenine + Tamoxifen group; these data indicated that downregulated long non-coding RNA ROR promoted autophagy. In comparison with the blank group, multi-drug resistance-associated P-glycoprotein and glutathione S-transferase-π messenger RNA and protein expressions were reduced in the siROR + Tamoxifen group but elevated in the 3-methyladenine + Tamoxifen group, suggesting that downregulated long non-coding RNA ROR suppressed the drug resistance to Tamoxifen and the inhibition of autophagy reversed the effect of long non-coding RNA ROR on drug resistance. Compared with the Tamoxifen, negative control, and siROR + 3-methyladenine + Tamoxifen groups, the cell

  15. Exploration of Deregulated Long Non-Coding RNAs in Association with Hepatocarcinogenesis and Survival

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Jing, E-mail: js2182@cumc.columbia.edu [Department of Environmental Health Sciences, Mailman School of Public Health, Columbia University Medical Center, New York, NY 10032 (United States); Herbert Irving Comprehensive Cancer Center, Columbia University Medical Center, New York, NY 10032 (United States); Siegel, Abby B. [Herbert Irving Comprehensive Cancer Center, Columbia University Medical Center, New York, NY 10032 (United States); Department of Medicine, Columbia University Medical Center, New York, NY 10032 (United States); Remotti, Helen [Department of Pathology and Cell Biology, Columbia University Medical Center, New York, NY 10032 (United States); Wang, Qiao; Shen, Yueyue [Department of Environmental Health Sciences, Mailman School of Public Health, Columbia University Medical Center, New York, NY 10032 (United States); Santella, Regina M. [Department of Environmental Health Sciences, Mailman School of Public Health, Columbia University Medical Center, New York, NY 10032 (United States); Herbert Irving Comprehensive Cancer Center, Columbia University Medical Center, New York, NY 10032 (United States)

    2015-09-10

    Long non-coding RNAs (lncRNAs) are larger than 200 nucleotides in length and pervasively expressed across the genome. An increasing number of studies indicate that lncRNA transcripts play integral regulatory roles in cellular growth, division, differentiation and apoptosis. Deregulated lncRNAs have been observed in a variety of human cancers, including hepatocellular carcinoma (HCC). We determined the expression profiles of 90 lncRNAs for 65 paired HCC tumor and adjacent non-tumor tissues, and 55 lncRNAs were expressed in over 90% of samples. Eight lncRNAs were significantly down-regulated in HCC tumor compared to non-tumor tissues (p < 0.05), but no lncRNA achieved statistical significance after Bonferroni correction for multiple comparisons. Within tumor tissues, carrying more aberrant lncRNAs (6–7) was associated with a borderline significant reduction in survival (HR = 8.5, 95% CI: 1.0–72.5). The predictive accuracy depicted by the AUC was 0.93 for HCC survival when using seven deregulated lncRNAs (likelihood ratio test p = 0.001), which was similar to that combining the seven lncRNAs with tumor size and treatment (AUC = 0.96, sensitivity = 87%, specificity = 87%). These data suggest the potential association of deregulated lncRNAs with hepatocarcinogenesis and HCC survival.

  16. Structural basis of the non-coding RNA RsmZ acting as a protein sponge.

    Science.gov (United States)

    Duss, Olivier; Michel, Erich; Yulikov, Maxim; Schubert, Mario; Jeschke, Gunnar; Allain, Frédéric H-T

    2014-05-29

    MicroRNA and protein sequestration by non-coding RNAs (ncRNAs) has recently generated much interest. In the bacterial Csr/Rsm system, which is considered to be the most general global post-transcriptional regulatory system responsible for bacterial virulence, ncRNAs such as CsrB or RsmZ activate translation initiation by sequestering homodimeric CsrA-type proteins from the ribosome-binding site of a subset of messenger RNAs. However, the mechanism of ncRNA-mediated protein sequestration is not understood at the molecular level. Here we show for Pseudomonas fluorescens that RsmE protein dimers assemble sequentially, specifically and cooperatively onto the ncRNA RsmZ within a narrow affinity range. This assembly yields two different native ribonucleoprotein structures. Using a powerful combination of nuclear magnetic resonance and electron paramagnetic resonance spectroscopy we elucidate these 70-kilodalton solution structures, thereby revealing the molecular mechanism of the sequestration process and how RsmE binding protects the ncRNA from RNase E degradation. Overall, our findings suggest that RsmZ is well-tuned to sequester, store and release RsmE and therefore can be viewed as an ideal protein 'sponge'.

  17. Long non-coding RNA ROR promotes proliferation, migration and chemoresistance of nasopharyngeal carcinoma.

    Science.gov (United States)

    Li, Li; Gu, Miao; You, Bo; Shi, Si; Shan, Ying; Bao, Lili; You, Yiwen

    2016-09-01

    Nasopharyngeal carcinoma (NPC) is one of the most common malignancies of the head and neck. It arises from the nasopharynx epithelium and is associated with high morbidity and mortality. Long non-coding RNA (lncRNA) have been reported to regulate gene interaction and play critical roles in carcinogenesis and progression. LncRNA-ROR, a recently identified lncRNA, has been shown to be involved in initiation, progression and metastasis of several tumors, including hepatocellular carcinoma, breast cancer and glioma. However, whether lncRNA-ROR is associated with the progression of NPC remains unknown. Resistance to radiotherapy and chemotherapy is the primary cause of NPC patients' death. In this study, we found that lncRNA-ROR was significantly upregulated in NPC tissues compared with normal tissues. Next, our study proved that lncRNA-ROR was highly associated with the proliferation, metastasis and apoptosis of NPC. The enrichment of lncRNA-ROR played a critucal functional role in chemoresistance. The mechanism by which NPC resists chemotherapy might be that lncRNA-ROR suppress p53 signal pathway. Taken together, these data suggested that lncRNA-ROR played an important role in the progression of NPC; thereby it might become a therapeutic target and reduce chemoresistance for NPC. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  18. Long non-coding RNA ROR decoys gene-specific histone methylation to promote tumorigenesis.

    Science.gov (United States)

    Fan, Jiayan; Xing, Yue; Wen, Xuyang; Jia, Renbin; Ni, Hongyan; He, Jie; Ding, Xia; Pan, Hui; Qian, Guanxiang; Ge, Shengfang; Hoffman, Andrew R; Zhang, He; Fan, Xianqun

    2015-07-14

    Long non-coding RNAs (lncRNAs) are not translated into proteins and were initially considered to be part of the 'dark matter' of the genome. Recently, it has been shown that lncRNAs play a role in the recruitment of chromatin modifying complexes and can influence gene expression. However, it is unknown if lncRNAs function in a similar way in cancer. Here, we show that the lncRNA ROR occupies and activates the TESC promoter by repelling the histone G9A methyltransferase and promoting the release of histone H3K9 methylation. Suppression of ROR in tumors results in silencing of TESC expression, and G9A-mediated histone H3K9 methylation in the TESC promoter is restored, which significantly reduces tumor growth and metastasis. Without ROR silencing, TESC knockdown presents consistent and significant reductions in tumor progression. Our results reveal a novel mechanism by which ROR may serve as a decoy oncoRNA that blocks binding surfaces, preventing the recruitment of histone modifying enzymes, thereby specifying a new pattern of histone modifications that promote tumorigenesis.

  19. Long Non-Coding RNA-ROR Mediates the Reprogramming in Cardiac Hypertrophy.

    Directory of Open Access Journals (Sweden)

    Feng Jiang

    Full Text Available Cardiac hypertrophy associated with various cardiovascular diseases results in heart failure and sudden death. A clear understanding of the mechanisms of hypertrophy will benefit the development of novel therapies. Long non-coding RNAs (lncRNAs have been shown to play essential roles in many biological process, however, whether lncRNA-ROR plays functional roles in the reprogramming of cardiomyocyte remains unclear.Here we show that lncRNA-ROR plays important roles in the pathogenesis of cardiac hypertrophy. In hypertrophic heart and cardiomyocytes, the expression of lncRNA-ROR is dramatically increased, downregulation of which attenuates the hypertrophic responses. Furthermore, the expression of lncRNA-ROR negatively correlates with miR-133, whose expression is increased when lncRNA-ROR is knocked down. In line with this, overexpression of miR-133 prevents the elevation of lncRNA-ROR and re-expression of ANP and BNP in cardiomyocytes subject to phenylephrine treatment.Taken together, our study demonstrates that lncRNA-ROR promotes cardiac hypertrophy via interacting with miR-133, indicating that lncRNA-ROR could be targeted for developing novel antihypertrophic therapeutics.

  20. Long Non-Coding RNA-ROR Mediates the Reprogramming in Cardiac Hypertrophy.

    Science.gov (United States)

    Jiang, Feng; Zhou, Xiangyu; Huang, Jing

    2016-01-01

    Cardiac hypertrophy associated with various cardiovascular diseases results in heart failure and sudden death. A clear understanding of the mechanisms of hypertrophy will benefit the development of novel therapies. Long non-coding RNAs (lncRNAs) have been shown to play essential roles in many biological process, however, whether lncRNA-ROR plays functional roles in the reprogramming of cardiomyocyte remains unclear. Here we show that lncRNA-ROR plays important roles in the pathogenesis of cardiac hypertrophy. In hypertrophic heart and cardiomyocytes, the expression of lncRNA-ROR is dramatically increased, downregulation of which attenuates the hypertrophic responses. Furthermore, the expression of lncRNA-ROR negatively correlates with miR-133, whose expression is increased when lncRNA-ROR is knocked down. In line with this, overexpression of miR-133 prevents the elevation of lncRNA-ROR and re-expression of ANP and BNP in cardiomyocytes subject to phenylephrine treatment. Taken together, our study demonstrates that lncRNA-ROR promotes cardiac hypertrophy via interacting with miR-133, indicating that lncRNA-ROR could be targeted for developing novel antihypertrophic therapeutics.

  1. Missing Links in Epithelial-Mesenchymal Transition: Long Non-Coding RNAs Enter the Arena

    Directory of Open Access Journals (Sweden)

    Lei Wang

    2017-12-01

    Full Text Available Cancer metastasis occurs through a series of sequential steps, which involves dissemination of tumor cells from a primary site and colonization in distant tissues. To promote the invasion-metastasis cascade, carcinoma cells usually initiate a cell-biological program called epithelial-mesenchymal transition (EMT, which is orchestrated by a set of master regulators, including TGF-β, Snail, ZEB and Twist families. The biological activities of these molecules are tightly regulated by a variety of cell-intrinsic pathways as well as extracellular cues. Recently, accumulating evidence indicates that long non-coding RNAs (lncRNAs represent some of the most differentially expressed transcripts between primary and metastatic cancers. LncRNAs including MALAT1, HOTAIR, H19, LncRNA-ATB, and LincRNA-ROR have been reported to be involved in the process of EMT, mainly through cross-talking with master regulators of EMT. Thus, understanding the different and precise molecular mechanisms by which functional lncRNAs switch EMT on and off is important for opening up new avenues in lncRNA-directed diagnosis, prognosis, and therapeutic intervention against cancer.

  2. The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression

    Directory of Open Access Journals (Sweden)

    Linna Lu

    2017-01-01

    Full Text Available Increasing evidence suggests that aberrant long non-coding RNAs (lncRNAs are significantly correlated with the pathogenesis, development and metastasis of cancers. RHPN1 antisense RNA 1 (RHPN1-AS1 is a 2030-bp transcript originating from human chromosome 8q24. However, the role of RHPN1-AS1 in uveal melanoma (UM remains to be clarified. In this study, we aimed to elucidate the molecular function of RHPN1-AS1 in UM. The RNA levels of RHPN1-AS1 in UM cell lines were examined using the quantitative real-time polymerase chain reaction (qRT-PCR. Short interfering RNAs (siRNAs were designed to quench RHPN1-AS1 expression, and UM cells stably expressing short hairpin (sh RHPN1-AS1 were established. Next, the cell proliferation and migration abilities were determined using a colony formation assay and a transwell migration/invasion assay. A tumor xenograft model in nude mice was established to confirm the function of RHPN1-AS1 in vivo. RHPN1-AS1 was significantly upregulated in a number of UM cell lines compared with the normal human retinal pigment epithelium (RPE cell line. RHPN1-AS1 knockdown significantly inhibited UM cell proliferation and migration in vitro and in vivo. Our data suggest that RHPN1-AS1 could be an oncoRNA in UM, which may serve as a candidate prognostic biomarker and target for new therapies in malignant UM.

  3. To Wnt or Lose: The Missing Non-Coding Linc in Colorectal Cancer.

    Science.gov (United States)

    Shen, Peng; Pichler, Martin; Chen, Meng; Calin, George A; Ling, Hui

    2017-09-20

    Colorectal cancer (CRC) is the third most frequent cancer and one of the leading causes for cancer-related mortality. Aberrant activation of the Wnt signaling is an essential initiating factor in colon carcinogenesis, and a driving force of CRC progression. Recently, long non-coding RNAs (lncRNAs) have emerged as significant players in CRC pathogenesis through diversified mechanisms. Although both Wnt signaling and lncRNAs represent interesting research areas for CRC, an effort of directly connecting these two areas is lacking. To fill in the knowledge gap, we focus on the reported findings of lncRNAs that regulate Wnt signaling or essential Wnt signaling targets. These include several newly discovered lncRNAs originated from the amplified cancer-associated chromosome 8q24 region that surrounds the essential Wnt target MYC gene, lncRNAs reported to be involved in CRC stem cells, and several individual lncRNAs connected to Wnt signaling through other mechanisms. This review will provide essential information that assists in understanding the missing link of lncRNAs to the classical Wnt signaling in CRC.

  4. Long non-coding RNA ZFAS1 correlates with clinical progression and prognosis in cancer patients.

    Science.gov (United States)

    Liu, Fangteng; Gao, Hui; Li, Siyu; Ni, Xiaolin; Zhu, Zhengming

    2017-09-22

    Dysregulation of long non-coding RNA zinc finger antisense 1 (ZFAS1) has been reported in many types of cancers. We performed a synthetic analysis to clarify its prognostic significance as a cancer molecular-marker. Several databases (including PubMed, Web of Science, Embase together with Wanfang and China National Knowledge Internet database) were retrieved to identify ZFAS1-related articles. A total of eight articles were included in this meta-analysis. Hazard ratios (HR) and 95% confidence intervals (CI) were applied to assess the association between ZFAS1 expression level and overall survival (OS). Odds ratios (OR) were calculated with RevMan 5.3 software to determine the relationship between ZFAS1 expression and clinicopathologic features. The pooled results of the meta-analysis indicated that high ZFAS1 expression level was positively correlated with poor OS (HR = 1.87, 95% CI: 1.38-2.36, p< 0.001) in human solid cancers. The statistical significance was also observed in subgroup analysis stratified by the cancer type, analysis method, sample size and follow-up time. Furthermore, the elevated ZFAS1 expression was significantly related to positive lymph node metastasis (OR = 4.18, 95% CI: 2.70-6.48, p< 0.001). The present results suggest that ZFAS1 might be served as a novel promising biomarker for prognosis in Chinese patients with solid cancers.

  5. Prognostic value of long non-coding RNA MALAT1 in cancer patients.

    Science.gov (United States)

    Wu, Yihua; Lu, Wei; Xu, Jinming; Shi, Yu; Zhang, Honghe; Xia, Dajing

    2016-01-01

    Metastasis associated in lung adenocarcinoma transcript 1 (MALAT1) was identified to be the first long non-coding RNA as a biomarker of independent prognostic value for early stage non-small cell lung cancer patient survival. In recent years, the association between upregulated tissue MALAT1 level and incidence of various cancers including bladder cancer, colorectal cancer, and renal cancer has been widely discussed. The aim of our present study was to assess the potential prognostic value of MALAT1 in various human cancers. PubMed, Embase, Ovid, and Cochrane Library databases were systematically searched, and eligible studies evaluating the prognostic value of MALAT1 in various cancers were included. Finally, 11 studies encompassing 1216 participants reporting with sufficient data were enrolled in the current meta-analysis. The pooled hazard ratio (HR) was 2.05 (95 % confidence interval (CI) 1.64-2.55, p < 0.01) for overall survival (OS) and 2.66 (95 % CI 1.86-3.80, p < 0.01) for disease-free survival (DFS). In conclusion, high tissue MALAT1 level was associated with an inferior clinical outcome in various cancers, suggesting that MALAT1 might serve as a potential prognostic biomarker for various cancers.

  6. Non-Coding RNAs in Saliva: Emerging Biomarkers for Molecular Diagnostics

    Directory of Open Access Journals (Sweden)

    Blanca Majem

    2015-04-01

    Full Text Available Saliva is a complex body fluid that comprises secretions from the major and minor salivary glands, which are extensively supplied by blood. Therefore, molecules such as proteins, DNA, RNA, etc., present in plasma could be also present in saliva. Many studies have reported that saliva body fluid can be useful for discriminating several oral diseases, but also systemic diseases including cancer. Most of these studies revealed messenger RNA (mRNA and proteomic biomarker signatures rather than specific non-coding RNA (ncRNA profiles. NcRNAs are emerging as new regulators of diverse biological functions, playing an important role in oncogenesis and tumor progression. Indeed, the small size of these molecules makes them very stable in different body fluids and not as susceptible as mRNAs to degradation by ribonucleases (RNases. Therefore, the development of a non-invasive salivary test, based on ncRNAs profiles, could have a significant applicability to clinical practice, not only by reducing the cost of the health system, but also by benefitting the patient. Here, we summarize the current status and clinical implications of the ncRNAs present in human saliva as a source of biological information.

  7. Recent advances in extracellular vesicles enriched with non-coding RNAs related to cancers

    Directory of Open Access Journals (Sweden)

    Song Yang

    2018-03-01

    Full Text Available As membrane-bound structures that could be shedded by a parental cell, and fuse with others after shedding, and then release its contents, extracellular vesicles (EVs are considered as an indispensable part of intercellular communication system. The EV contents might be all kinds of bioactive molecules including non-coding RNAs (ncRNAs, a large and complex group of RNAs with various subtypes that function to regulate biological events but classically do not code for proteins. In this review we covered the recently published works that validated the underlying molecular mechanisms regulating EV-associated ncRNAs' biogenesis, signaling, and particularly the systemic bio-effects related mostly to any stage of cancer progression, and the clinical potential of ncRNA-carrying EVs as diagnostic biomarkers and drug-delivery system that is being engineered for better loading and targeting capacity. Our views on the future direction of basic research and applications of EVs containing ncRNAs have also been shared.

  8. Expression of a novel non-coding mitochondrial RNA in human proliferating cells.

    Science.gov (United States)

    Villegas, Jaime; Burzio, Veronica; Villota, Claudio; Landerer, Eduardo; Martinez, Ronny; Santander, Marcela; Martinez, Rodrigo; Pinto, Rodrigo; Vera, María I; Boccardo, Enrique; Villa, Luisa L; Burzio, Luis O

    2007-01-01

    Previously, we reported the presence in mouse cells of a mitochondrial RNA which contains an inverted repeat (IR) of 121 nucleotides (nt) covalently linked to the 5' end of the mitochondrial 16S RNA (16S mtrRNA). Here, we report the structure of an equivalent transcript of 2374 nt which is over-expressed in human proliferating cells but not in resting cells. The transcript contains a hairpin structure comprising an IR of 815 nt linked to the 5' end of the 16S mtrRNA and forming a long double-stranded structure or stem and a loop of 40 nt. The stem is resistant to RNase A and can be detected and isolated after digestion with the enzyme. This novel transcript is a non-coding RNA (ncRNA) and several evidences suggest that the transcript is synthesized in mitochondria. The expression of this transcript can be induced in resting lymphocytes stimulated with phytohaemagglutinin (PHA). Moreover, aphidicolin treatment of DU145 cells reversibly blocks proliferation and expression of the transcript. If the drug is removed, the cells re-assume proliferation and over-express the ncmtRNA. These results suggest that the expression of the ncmtRNA correlates with the replicative state of the cell and it may play a role in cell proliferation.

  9. Long Non-Coding RNAs: The Key Players in Glioma Pathogenesis

    Directory of Open Access Journals (Sweden)

    Karrie Mei-Yee Kiang

    2015-07-01

    Full Text Available Long non-coding RNAs (LncRNAs represent a novel class of RNAs with no functional protein-coding ability, yet it has become increasingly clear that interactions between lncRNAs with other molecules are responsible for important gene regulatory functions in various contexts. Given their relatively high expressions in the brain, lncRNAs are now thought to play important roles in normal brain development as well as diverse disease processes including gliomagenesis. Intriguingly, certain lncRNAs are closely associated with the initiation, differentiation, progression, recurrence and stem-like characteristics in glioma, and may therefore be exploited for the purposes of sub-classification, diagnosis and prognosis. LncRNAs may also serve as potential therapeutic targets as well as a novel biomarkers in the treatment of glioma. In this article, the functional aspects of lncRNAs, particularly within the central nervous system (CNS, will be briefly discussed, followed by highlights of the important roles of lncRNAs in mediating critical steps during glioma development. In addition, the key lncRNA players and their possible mechanistic pathways associated with gliomagenesis will be addressed.

  10. Non coding RNA: sequence-specific guide for chromatin modification and DNA damage signaling

    Directory of Open Access Journals (Sweden)

    Sofia eFrancia

    2015-11-01

    Full Text Available Chromatin conformation shapes the environment in which our genome is transcribed into RNA. Transcription is a source of DNA damage, thus it often occurs concomitantly to DNA damage signaling. Growing amounts of evidence suggest that different types of RNAs can, independently from their protein-coding properties, directly affect chromatin conformation, transcription and splicing, as well as promote the activation of the DNA damage response (DDR and DNA repair. Therefore, transcription paradoxically functions to both threaten and safeguard genome integrity. On the other hand, DNA damage signaling is known to modulate chromatin to suppress transcription of the surrounding genetic unit. It is thus intriguing to understand how transcription can modulate DDR signaling while, in turn, DDR signaling represses transcription of chromatin around the DNA lesion. An unexpected player in this field is the RNA interference (RNAi machinery, which play roles in transcription, splicing and chromatin modulation in several organisms. Non-coding RNAs (ncRNAs and several protein factors involved in the RNAi pathway are well known master regulators of chromatin while only recent reports suggest that ncRNAs are involved in DDR signaling and homology-mediated DNA repair. Here, we discuss the experimental evidence supporting the idea that ncRNAs act at the genomic loci from which they are transcribed to modulate chromatin, DDR signaling and DNA repair.

  11. Long Non-Coding RNAs: The Key Players in Glioma Pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Kiang, Karrie Mei-Yee; Zhang, Xiao-Qin; Leung, Gilberto Ka-Kit, E-mail: gilberto@hku.hk [Department of Surgery, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Queen Mary Hospital, Hong Kong (China)

    2015-07-29

    Long non-coding RNAs (LncRNAs) represent a novel class of RNAs with no functional protein-coding ability, yet it has become increasingly clear that interactions between lncRNAs with other molecules are responsible for important gene regulatory functions in various contexts. Given their relatively high expressions in the brain, lncRNAs are now thought to play important roles in normal brain development as well as diverse disease processes including gliomagenesis. Intriguingly, certain lncRNAs are closely associated with the initiation, differentiation, progression, recurrence and stem-like characteristics in glioma, and may therefore be exploited for the purposes of sub-classification, diagnosis and prognosis. LncRNAs may also serve as potential therapeutic targets as well as a novel biomarkers in the treatment of glioma. In this article, the functional aspects of lncRNAs, particularly within the central nervous system (CNS), will be briefly discussed, followed by highlights of the important roles of lncRNAs in mediating critical steps during glioma development. In addition, the key lncRNA players and their possible mechanistic pathways associated with gliomagenesis will be addressed.

  12. Non-coding RNA and pseudogenes in neurodegenerative diseases: "The (un)Usual Suspects".

    Science.gov (United States)

    Costa, Valerio; Esposito, Roberta; Aprile, Marianna; Ciccodicola, Alfredo

    2012-01-01

    Neurodegenerative disorders and cancer are severe diseases threatening human health. The glaring differences between neurons and cancer cells mask the processes involved in their pathogenesis. Defects in cell cycle, DNA repair, and cell differentiation can determine unlimited proliferation in cancer, or conversely, compromise neuronal plasticity, leading to cell death and neurodegeneration. Alteration in regulatory networks affecting gene expression contribute to human diseases onset, including neurodegenerative disorders, and deregulation of non-coding RNAs - particularly microRNAs (miRNAs) - is supposed to have a significant impact. Recently, competitive endogenous RNAs (ceRNAs) - acting as sponges - have been identified in cancer, indicating a new and intricate regulatory network. Given that neurodegenerative disorders and cancer share altered genes and pathways, and considering the emerging role of miRNAs in neurogenesis, we hypothesize ceRNAs may be implicated in neurodegenerative diseases. Here we propose, and computationally predict, such regulatory mechanism may be shared between the diseases. It is predictable that similar regulation occurs in other complex diseases, and further investigation is needed.

  13. CRNDE: a long non-coding RNA involved in CanceR, Neurobiology and DEvelopment

    Directory of Open Access Journals (Sweden)

    Blake C. Ellis

    2012-11-01

    Full Text Available CRNDE is the gene symbol for Colorectal Neoplasia Differentially Expressed (non protein-coding, a long non-coding RNA (lncRNA gene that expresses multiple splice variants and displays a very tissue-specific pattern of expression. CRNDE was initially identified as a lncRNA whose expression is highly elevated in colorectal cancer, but it is also upregulated in many other solid tumors and in leukemias. Indeed, CRNDE is the most upregulated lncRNA in gliomas and here, as in other cancers, it is associated with a stemness signature. CRNDE is expressed in specific regions within the human and mouse brain; the mouse ortholog is high in induced pluripotent stem cells and increases further during neuronal differentiation. We suggest that CRNDE is a multifunctional lncRNA whose different splice forms provide specific functional scaffolds for regulatory complexes, such as the polycomb repressive complex 2 (PRC2 and CoREST chromatin-modifying complexes, which CRNDE helps pilot to target genes.

  14. Molecular Evolution of the non-coding Eosinophil Granule Ontogeny Transcript EGOT

    Directory of Open Access Journals (Sweden)

    Dominic eRose

    2011-10-01

    Full Text Available Eukaryotic genomes are pervasively transcribed. A large fraction of the transcriptional output consists of long, mRNA-like, non-protein-coding transcripts (mlncRNAs. The evolutionary history of mlncRNAs is still largely uncharted territory.In this contribution, we explore in detail the evolutionary traces of the eosinophil granule ontogeny transcript (EGOT, an experimentally confirmed representative of an abundant class of totally intronic non-coding transcripts (TINs. EGOT is located antisense to an intron of the ITPR1 gene. We computationally identify putative EGOT orthologs in the genomes of 32 different amniotes, including orthologs from primates, rodents, ungulates, carnivores, afrotherians, and xenarthrans, as well as putative candidates from basal amniotes, such as opossum or platypus. We investigate the EGOT gene phylogeny, analyse patterns of sequence conservation, and the evolutionary conservation of the EGOT gene structure. We show that EGO-B, the spliced isoform, may be present throughout the placental mammals, but most likely dates back even further. We demonstrat here for the first time that the whole EGOT locus is highly structured, containing several evolutionary conserved and thermodynamic stable secondary structures.Our analyses allow us to postulate novel functional roles of a hitherto poorly understood region at the intron of EGO-B which is highly conserved at the sequence level. The region contains a novel ITPR1 exon and also conserved RNA secondary structures together with a conserved TATA-like element, which putatively acts as a promoter of an independent regulatory element.

  15. Classification of non-coding RNA using graph representations ofsecondary structure

    Energy Technology Data Exchange (ETDEWEB)

    Karklin, Yan; Meraz, Richard F.; Holbrook, Stephen R.

    2004-06-07

    Some genes produce transcripts that function directly in regulatory, catalytic, or structural roles in the cell. These non-coding RNAs are prevalent in all living organisms, and methods that aid the understanding of their functional roles are essential. RNA secondary structure, the pattern of base-pairing, contains the critical information for determining the three dimensional structure and function of the molecule. In this work we examine whether the basic geometric and topological properties of secondary structure are sufficient to distinguish between RNA families in a learning framework. First, we develop a labeled dual graph representation of RNA secondary structure by adding biologically meaningful labels to the dual graphs proposed by Gan et al [1]. Next, we define a similarity measure directly on the labeled dual graphs using the recently developed marginalized kernels [2]. Using this similarity measure, we were able to train Support Vector Machine classifiers to distinguish RNAs of known families from random RNAs with similar statistics. For 22 of the 25 families tested, the classifier achieved better than 70% accuracy, with much higher accuracy rates for some families. Training a set of classifiers to automatically assign family labels to RNAs using a one vs. all multi-class scheme also yielded encouraging results. From these initial learning experiments, we suggest that the labeled dual graph representation, together with kernel machine methods, has potential for use in automated analysis and classification of uncharacterized RNA molecules or efficient genome-wide screens for RNA molecules from existing families.

  16. Long non-coding RNAs as regulators of the endocrine system.

    Science.gov (United States)

    Knoll, Marko; Lodish, Harvey F; Sun, Lei

    2015-03-01

    Long non-coding RNAs (lncRNAs) are a large and diverse group of RNAs that are often lineage-specific and that regulate multiple biological functions. Many are nuclear and are essential parts of ribonucleoprotein complexes that modify chromatin segments and establish active or repressive chromatin states; others are cytosolic and regulate the stability of mRNA or act as microRNA sponges. This Review summarizes the current knowledge of lncRNAs as regulators of the endocrine system, with a focus on the identification and mode of action of several endocrine-important lncRNAs. We highlight lncRNAs that have a role in the development and function of pancreatic β cells, white and brown adipose tissue, and other endocrine organs, and discuss the involvement of these molecules in endocrine dysfunction (for example, diabetes mellitus). We also address the associations of lncRNAs with nuclear receptors involved in major hormonal signalling pathways, such as estrogen and androgen receptors, and the relevance of these associations in certain endocrine cancers.

  17. Long non-coding RNA PVT1: Emerging biomarker in digestive system cancer.

    Science.gov (United States)

    Zhou, Dan-Dan; Liu, Xiu-Fen; Lu, Cheng-Wei; Pant, Om Prakash; Liu, Xiao-Dong

    2017-12-01

    The digestive system cancers are leading cause of cancer-related death worldwide, and have high risks of morbidity and mortality. More and more long non-coding RNAs (lncRNAs) have been studied to be abnormally expressed in cancers and play a key role in the process of digestive system tumour progression. Plasmacytoma variant translocation 1 (PVT1) seems fairly novel. Since 1984, PVT1 was identified to be an activator of MYC in mice. Its role in human tumour initiation and progression has long been a subject of interest. The expression of PVT1 is elevated in digestive system cancers and correlates with poor prognosis. In this review, we illustrate the various functions of PVT1 during the different stages in the complex process of digestive system tumours (including oesophageal cancer, gastric cancer, colorectal cancer, hepatocellular carcinoma and pancreatic cancer). The growing evidence shows the involvement of PVT1 in both proliferation and differentiation process in addition to its involvement in epithelial to mesenchymal transition (EMT). These findings lead us to conclude that PVT1 promotes proliferation, survival, invasion, metastasis and drug resistance in digestive system cancer cells. We will also discuss PVT1's potential in diagnosis and treatment target of digestive system cancer. There was a great probability PVT1 could be a novel biomarker in screening tumours, prognosis biomarkers and future targeted therapy to improve the survival rate in cancer patients. © 2017 John Wiley & Sons Ltd.

  18. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  19. Emerging Roles of Small Epstein-Barr Virus Derived Non-Coding RNAs in Epithelial Malignancy

    Directory of Open Access Journals (Sweden)

    Ka-Fai To

    2013-08-01

    Full Text Available Latent Epstein-Barr virus (EBV infection is an etiological factor in the progression of several human epithelial malignancies such as nasopharyngeal carcinoma (NPC and a subset of gastric carcinoma. Reports have shown that EBV produces several viral oncoproteins, yet their pathological roles in carcinogenesis are not fully elucidated. Studies on the recently discovered of EBV-encoded microRNAs (ebv-miRNAs showed that these small molecules function as post-transcriptional gene regulators and may play a role in the carcinogenesis process. In NPC and EBV positive gastric carcinoma (EBVaGC, 22 viral miRNAs which are located in the long alternative splicing EBV transcripts, named BamH1 A rightward transcripts (BARTs, are abundantly expressed. The importance of several miR-BARTs in carcinogenesis has recently been demonstrated. These novel findings enhance our understanding of the oncogenic properties of EBV and may lead to a more effective design of therapeutic regimens to combat EBV-associated malignancies. This article will review the pathological roles of miR-BARTs in modulating the expression of cancer-related genes in both host and viral genomes. The expression of other small non-coding RNAs in NPC and the expression pattern of miR-BARTs in rare EBV-associated epithelial cancers will also be discussed.

  20. Non-coding RNA and pseudogenes in neurodegenerative diseases: "The (unUsual Suspects"

    Directory of Open Access Journals (Sweden)

    Valerio eCosta

    2012-10-01

    Full Text Available Neurodegenerative disorders and cancer are severe diseases threatening human health. The glaring differences between neurons and cancer cells mask the processes involved in their pathogenesis. Defects in cell cycle, DNA repair and cell differentiation can determine unlimited proliferation in cancer, or conversely, compromise neuronal plasticity, leading to cell death and neurodegeneration.Alteration in regulatory networks affecting gene expression contribute to human diseases' onset, including neurodegenerative disorders, and deregulation of non-coding RNAs - particularly microRNAs - is supposed to have a significant impact.Recently, competitive endogenous RNAs - acting as sponges - have been identified in cancer, indicating a new and intricate regulatory network. Given that neurodegenerative disorders and cancer share altered genes and pathways, and considering the emerging role of microRNAs in neurogenesis, we hypothesize competitive endogenous RNAs may be implicated in neurodegenerative diseases. Here we propose, and computationally predict, such regulatory mechanism may be shared between the diseases. It is predictable that similar regulation occurs in other complex diseases, and further investigation is needed.

  1. Long Non-Coding RNA MEG3 Inhibits Cell Proliferation and Induces Apoptosis in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Gang Luo

    2015-11-01

    Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs play important roles in diverse biological processes, such as cell growth, apoptosis and migration. Although downregulation of lncRNA maternally expressed gene 3 (MEG3 has been identified in several cancers, little is known about its role in prostate cancer progression. The aim of this study was to detect MEG3 expression in clinical prostate cancer tissues, investigate its biological functions in the development of prostate cancer and the underlying mechanism. Methods: MEG3 expression levels were detected by qRT-PCR in both tumor tissues and adjacent non-tumor tissues from 21 prostate cancer patients. The effects of MEG3 on PC3 and DU145 cells were assessed by MTT assay, colony formation assay, western blot and flow cytometry. Transfected PC3 cells were transplanted into nude mice, and the tumor growth curves were determined. Results: MEG3 decreased significantly in prostate cancer tissues relative to adjacent normal tissues. MEG3 inhibited intrinsic cell survival pathway in vitro and in vivo by reducing the protein expression of Bcl-2, enhancing Bax and activating caspase 3. We further demonstrated that MEG3 inhibited the expression of cell cycle regulatory protein Cyclin D1 and induced cell cycle arrest in G0/G1 phase. Conclusions: Our study presents an important role of MEG3 in the molecular etiology of prostate cancer and implicates the potential application of MEG3 in prostate cancer therapy.

  2. A Novel Non-coding RNA Regulates Drought Stress Tolerance in Arabidopsis thaliana

    KAUST Repository

    Albesher, Nour H.

    2014-05-01

    Drought (soil water deficit) as a major adverse environmental condition can result in serious reduction in plant growth and crop production. Plants respond and adapt to drought stresses by triggering various signalling pathways leading to physiological, metabolic and developmental changes that may ultimately contribute to enhanced tolerance to the stress. Here, a novel non-coding RNA (ncRNA) involved in plant drought stress tolerance was identified. We showed that increasing the expression of this ncRNA led to enhanced sensitivity during seed germination and seedling growth to the phytohormone abscisic acid. The mutant seedlings are also more sensitive to osmotic stress inhibition of lateral root growth. Consistently, seedlings with enhanced expression of this ncRNA exhibited reduced transiprational water loss and were more drought-tolerant than the wild type. Future analyses of the mechanism for its role in drought tolerance may help us to understand how plant drought tolerance could be further regulated by this novel ncRNA.

  3. Long non-coding RNAHOTAIRregulates proliferation and invasion via activating Notch signalling pathway in retinoblastoma.

    Science.gov (United States)

    Dong, Changxia; Liu, Shaoyi; Lv, Yongbin; Zhang, Chunping; Gao, Heying; Tan, Lixia; Wang, Hong

    2016-12-01

    Retinoblastoma is the most frequently occurring tumour in the eyes in early childhood. Novel targets that are important for the diagnosis or treatment of retinoblastoma could be valuable in increasing the survival rate of patients affected by this disease. Long non-coding RNAs (lncRNAs) are a recently discovered type of RNAs with no proteincoding function; yet it has become increasingly clear that lncRNAs are responsible for important gene regulatory functions in various diseases. In this study, the expression of lncRNA HOTAIR was measured by qRT-PCR, and HOTAIR expression was found to be significantly upregulated in human retinoblastomas tissues as compared with that in paracancerous tissues. Knockdown of HOTAIR restricted the proliferation and invasion of the more invasive retinoblastoma Y79 cells, and led to G0/G1 arrest, possibly through inhibiting phospho-RB1, RB1 and CCNE. Furthermore, we found that the Notch signalling pathway was activated abnormally in retinoblastoma cell lines, while knockdown of HOTAIR attenuated the endogenous Notch signalling pathway in vitro and in vivo. In addition, knockdown of HOTAIR could inhibit the tumour progression in a xenograft model of retinoblastoma. In summary, our findings indicate that HOTAIR may play important roles in retinoblastoma progression via Notch pathway. HOTAIR has the potential to enhance the development of novel targeted diagnostic and therapeutic approaches for retinoblastoma.

  4. Mycoplasma non-coding RNA: identification of small RNAs and targets

    Directory of Open Access Journals (Sweden)

    Franciele Maboni Siqueira

    2016-10-01

    Full Text Available Abstract Background Bacterial non-coding RNAs act by base-pairing as regulatory elements in crucial biological processes. We performed the identification of trans-encoded small RNAs (sRNA from the genomes of Mycoplama hyopneumoniae, Mycoplasma flocculare and Mycoplasma hyorhinis, which are Mycoplasma species that have been identified in the porcine respiratory system. Results A total of 47, 15 and 11 putative sRNAs were predicted in M. hyopneumoniae, M. flocculare and M. hyorhinis, respectively. A comparative genomic analysis revealed the presence of species or lineage specific sRNA candidates. Furthermore, the expression profile of some M. hyopneumoniae sRNAs was determined by a reverse transcription amplification approach, in three different culture conditions. All tested sRNAs were transcribed in at least one condition. A detailed investigation revealed a differential expression profile for two M. hyopneumoniae sRNAs in response to oxidative and heat shock stress conditions, suggesting that their expression is influenced by environmental signals. Moreover, we analyzed sRNA-mRNA hybrids and accessed putative target genes for the novel sRNA candidates. The majority of the sRNAs showed interaction with multiple target genes, some of which could be linked to pathogenesis and cell homeostasis activity. Conclusion This study contributes to our knowledge of Mycoplasma sRNAs and their response to environmental changes. Furthermore, the mRNA target prediction provides a perspective for the characterization and comprehension of the function of the sRNA regulatory mechanisms.

  5. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells.

    Science.gov (United States)

    Ortega, Alvaro D; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles is regulated in both space and time. Non-coding small RNAs (sRNAs) are post-transcriptional regulatory molecules that fine-tune important processes in bacterial physiology including cell envelope architecture, intermediate metabolism, bacterial communication, biofilm formation, and virulence. Recent studies have shown production of defined sRNA species by intracellular bacteria located inside eukaryotic cells. The molecules targeted by these sRNAs and their expression dynamics along the intracellular infection cycle remain, however, poorly characterized. Technical difficulties linked to the isolation of "intact" intracellular bacteria from infected host cells might explain why sRNA regulation in these specialized pathogens is still a largely unexplored field. Transition from the extracellular to the intracellular lifestyle provides an ideal scenario in which regulatory sRNAs are intended to participate; so much work must be done in this direction. This review focuses on sRNAs expressed by intracellular bacterial pathogens during the infection of eukaryotic cells, strategies used with these pathogens to identify sRNAs required for virulence, and the experimental technical challenges associated to this type of studies. We also discuss varied techniques for their potential application to study RNA regulation in intracellular bacterial infections.

  6. Non-coding Transcripts from Enhancers: New Insights into Enhancer Activity and Gene Expression Regulation.

    Science.gov (United States)

    Chen, Hongjun; Du, Guangshi; Song, Xu; Li, Ling

    2017-06-01

    Long non-coding RNAs (lncRNAs) have gained widespread interest in the past decade owing to their enormous amount and surprising functions implicated in a variety of biological processes. Some lncRNAs exert function as enhancers, i.e., activating gene transcription by serving as the cis-regulatory molecules. Furthermore, recent studies have demonstrated that many enhancer elements can be transcribed and produce RNA molecules, which are termed as enhancer RNAs (eRNAs). The eRNAs are not merely the by-product of the enhancer transcription. In fact, many of them directly exert or regulate enhancer activity in gene activation through diverse mechanisms. Here, we provide an overview of enhancer activity, transcription of enhancer itself, characteristics of eRNAs, as well as their roles in regulating enhancer activity and gene expression. Copyright © 2017 Beijing Institute of Genomics, Chinese Academy of Sciences and Genetics Society of China. Production and hosting by Elsevier B.V. All rights reserved.

  7. RNA exosome-regulated long non-coding RNA transcription controls super-enhancer activity.

    Science.gov (United States)

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Kazadi, David; Sun, Jianbo; Federation, Alexander; Chao, Jaime; Elliott, Oliver; Liu, Zhi-Ping; Economides, Aris N; Bradner, James E; Rabadan, Raul; Basu, Uttiya

    2015-05-07

    We have ablated the cellular RNA degradation machinery in differentiated B cells and pluripotent embryonic stem cells (ESCs) by conditional mutagenesis of core (Exosc3) and nuclear RNase (Exosc10) components of RNA exosome and identified a vast number of long non-coding RNAs (lncRNAs) and enhancer RNAs (eRNAs) with emergent functionality. Unexpectedly, eRNA-expressing regions accumulate R-loop structures upon RNA exosome ablation, thus demonstrating the role of RNA exosome in resolving deleterious DNA/RNA hybrids arising from active enhancers. We have uncovered a distal divergent eRNA-expressing element (lncRNA-CSR) engaged in long-range DNA interactions and regulating IgH 3' regulatory region super-enhancer function. CRISPR-Cas9-mediated ablation of lncRNA-CSR transcription decreases its chromosomal looping-mediated association with the IgH 3' regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. RNA exosome regulated long non-coding RNA transcription controls super-enhancer activity

    Science.gov (United States)

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Kazadi, David; Sun, Jianbo; Federation, Alexander; Chao, Jaime; Elliott, Oliver; Liu, Zhi-Ping; Economides, Aris N.; Bradner, James E.; Rabadan, Raul; Basu, Uttiya

    2015-01-01

    We have ablated the cellular RNA degradation machinery in differentiated B cells and pluripotent embryonic stem (ES) cells by conditional mutagenesis of core (Exosc3) and nuclear RNase (Exosc10) components of RNA exosome and identified a vast number of long non-coding RNAs (lncRNAs) and enhancer RNAs (eRNAs) with emergent functionality. Unexpectedly, eRNA-expressing regions accumulate R-loop structures upon RNA exosome ablation, thus demonstrating the role of RNA exosome in resolving deleterious DNA/RNA hybrids arising from active enhancers. We have uncovered a distal divergent eRNA-expressing element (lncRNA-CSR) engaged in long-range DNA interactions and regulating IgH 3′ regulatory region super-enhancer function. CRISPR-Cas9 mediated ablation of lncRNA-CSR transcription decreases its chromosomal looping-mediated association with the IgH 3′regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers, by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function. PMID:25957685

  9. Long non-coding RNA LINC00261 sensitizes human colon cancer cells to cisplatin therapy.

    Science.gov (United States)

    Wang, Z K; Yang, L; Wu, L L; Mao, H; Zhou, Y H; Zhang, P F; Dai, G H

    2017-12-11

    Colon cancer is one of the most common digestive tumors. The present study aimed to explore the functional role, as well as the underlying mechanism of long non-coding RNA LINC00261 in colon cancer. Expression of LINC00261 was analyzed in colon cancer cell lines and human normal cell lines. Acquired resistance cell lines were then built and the acquired resistance efficiency was detected by evaluating cell viability. Thereafter, the effects of LINC00261 overexpression on cisplatin-resistant colon cancer cells were measured, as well as cell apoptosis, viability, migration, and invasion. Subsequently, we investigated the interaction of LINC00261 and β-catenin. The results showed that the LINC00261 gene was down-regulated in colon cancer cell lines and tissues, and in cisplatin-resistant cells. LINC00261 overexpression might relieve cisplatin resistance of colon cancer cells via promoting cell apoptosis, and inhibiting cell viability, migration, and invasion. Moreover, LINC00261 might down-regulate nuclear β-catenin through restraining β-catenin from cytoplasm into nuclei or it could also promote β-catenin degradation and inhibit activation of Wnt pathway. Finally, LINC00261 reduced cisplatin resistance of colon cancer in vivo and enhanced the anti-colon cancer effect of cisplatin through reducing tumor volume and weight.

  10. Dysregulation of the long non-coding RNA transcriptome in a Rett syndrome mouse model.

    Science.gov (United States)

    Petazzi, Paolo; Sandoval, Juan; Szczesna, Karolina; Jorge, Olga C; Roa, Laura; Sayols, Sergi; Gomez, Antonio; Huertas, Dori; Esteller, Manel

    2013-07-01

    Mecp2 is a transcriptional repressor protein that is mutated in Rett syndrome, a neurodevelopmental disorder that is the second most common cause of mental retardation in women. It has been shown that the loss of the Mecp2 protein in Rett syndrome cells alters the transcriptional silencing of coding genes and microRNAs. Herein, we have studied the impact of Mecp2 impairment in a Rett syndrome mouse model on the global transcriptional patterns of long non-coding RNAs (lncRNAs). Using a microarray platform that assesses 41,232 unique lncRNA transcripts, we have identified the aberrant lncRNA transcriptome that is present in the brain of Rett syndrome mice. The study of the most relevant lncRNAs altered in the assay highlighted the upregulation of the AK081227 and AK087060 transcripts in Mecp2-null mice brains. Chromatin immunoprecipitation demonstrated the Mecp2 occupancy in the 5'-end genomic loci of the described lncRNAs and its absence in Rett syndrome mice. Most importantly, we were able to show that the overexpression of AK081227 mediated by the Mecp2 loss was associated with the downregulation of its host coding protein gene, the gamma-aminobutyric acid receptor subunit Rho 2 (Gabrr2). Overall, our findings indicate that the transcriptional dysregulation of lncRNAs upon Mecp2 loss contributes to the neurological phenotype of Rett syndrome and highlights the complex interaction between ncRNAs and coding-RNAs.

  11. From structure prediction to genomic screens for novel non-coding RNAs.

    Science.gov (United States)

    Gorodkin, Jan; Hofacker, Ivo L

    2011-08-01

    Non-coding RNAs (ncRNAs) are receiving more and more attention not only as an abundant class of genes, but also as regulatory structural elements (some located in mRNAs). A key feature of RNA function is its structure. Computational methods were developed early for folding and prediction of RNA structure with the aim of assisting in functional analysis. With the discovery of more and more ncRNAs, it has become clear that a large fraction of these are highly structured. Interestingly, a large part of the structure is comprised of regular Watson-Crick and GU wobble base pairs. This and the increased amount of available genomes have made it possible to employ structure-based methods for genomic screens. The field has moved from folding prediction of single sequences to computational screens for ncRNAs in genomic sequence using the RNA structure as the main characteristic feature. Whereas early methods focused on energy-directed folding of single sequences, comparative analysis based on structure preserving changes of base pairs has been efficient in improving accuracy, and today this constitutes a key component in genomic screens. Here, we cover the basic principles of RNA folding and touch upon some of the concepts in current methods that have been applied in genomic screens for de novo RNA structures in searches for novel ncRNA genes and regulatory RNA structure on mRNAs. We discuss the strengths and weaknesses of the different strategies and how they can complement each other.

  12. Understanding Epistatic Interactions between Genes Targeted by Non-coding Regulatory Elements in Complex Diseases

    Directory of Open Access Journals (Sweden)

    Min Kyung Sung

    2014-12-01

    Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.

  13. Functional implications of long non-coding RNAs in the pancreatic islets of Langerhans

    Directory of Open Access Journals (Sweden)

    Lena eEliasson

    2014-07-01

    Full Text Available Type-2 diabetes (T2D is a complex disease characterized by insulin resistance in target tissues and impaired insulin release from pancreatic beta cells. As central tissue of glucose homeostasis, the pancreatic islet continues to be an important focus of research to understand the pathophysiology of the disease. The increased access to human pancreatic islets has resulted in improved knowledge of islet function, and together with advances in RNA sequencing and related technologies, revealed the transcriptional and epigenetic landscape of human islet cells. The discovery of thousands of long non-coding RNA (lncRNA transcripts highly enriched in the pancreatic islet and/or specifically-expressed in the beta-cells, points to yet another layer of gene regulation of many hitherto unknown mechanistic principles governing islet cell functions. Here we review fundamental islet physiology and propose functional implications of the lncRNAs in islet development and endocrine cell functions. We also take into account important differences between rodent and human islets in terms of morphology and function, and suggest how species-specific lncRNAs may partly influence gene regulation to define the unique phenotypic identity of an organism and the functions of its constituent cells. The implication of primate-specific lncRNAs in diabetes will be far-reaching in all aspects of diabetes research, but most importantly in the identification and development of novel targets to improve pancreatic islet cell functions as a therapeutic approach to treat T2D.

  14. Non-coding RNAs in homeostasis, disease and stress responses: an evolutionary perspective.

    Science.gov (United States)

    Amaral, Paulo P; Dinger, Marcel E; Mattick, John S

    2013-05-01

    Cells and organisms are subject to challenges and perturbations in their environment and physiology in all stages of life. The molecular response to such changes, including insulting conditions such as pathogen infections, involves coordinated modulation of gene expression programmes and has not only homeostatic but also ecological and evolutionary importance. Although attention has been primarily focused on signalling pathways and protein networks, non-coding RNAs (ncRNAs), which comprise a significant output of the genomes of prokaryotes and especially eukaryotes, are increasingly implicated in the molecular mechanisms of these responses. Long and short ncRNAs not only regulate development and cell physiology, they are also involved in disease states, including cancers, in host-pathogen interactions, and in a variety of stress responses. Indeed, regulatory RNAs are part of genetically encoded response networks and also underpin epigenetic processes, which are emerging as key mechanisms of adaptation and transgenerational inheritance. Here we present the growing evidence that ncRNAs are intrinsically involved in cellular and organismal adaptation processes, in both robustness and protection to stresses, as well as in mechanisms generating evolutionary change.

  15. Conservation and losses of non-coding RNAs in avian genomes.

    Directory of Open Access Journals (Sweden)

    Paul P Gardner

    Full Text Available Here we present the results of a large-scale bioinformatics annotation of non-coding RNA loci in 48 avian genomes. Our approach uses probabilistic models of hand-curated families from the Rfam database to infer conserved RNA families within each avian genome. We supplement these annotations with predictions from the tRNA annotation tool, tRNAscan-SE and microRNAs from miRBase. We identify 34 lncRNA-associated loci that are conserved between birds and mammals and validate 12 of these in chicken. We report several intriguing cases where a reported mammalian lncRNA, but not its function, is conserved. We also demonstrate extensive conservation of classical ncRNAs (e.g., tRNAs and more recently discovered ncRNAs (e.g., snoRNAs and miRNAs in birds. Furthermore, we describe numerous "losses" of several RNA families, and attribute these to either genuine loss, divergence or missing data. In particular, we show that many of these losses are due to the challenges associated with assembling avian microchromosomes. These combined results illustrate the utility of applying homology-based methods for annotating novel vertebrate genomes.

  16. LncRNAWiki: harnessing community knowledge in collaborative curation of human long non-coding RNAs

    KAUST Repository

    Ma, L.

    2014-11-15

    Long non-coding RNAs (lncRNAs) perform a diversity of functions in numerous important biological processes and are implicated in many human diseases. In this report we present lncRNAWiki (http://lncrna.big.ac.cn), a wiki-based platform that is open-content and publicly editable and aimed at community-based curation and collection of information on human lncRNAs. Current related databases are dependent primarily on curation by experts, making it laborious to annotate the exponentially accumulated information on lncRNAs, which inevitably requires collective efforts in community-based curation of lncRNAs. Unlike existing databases, lncRNAWiki features comprehensive integration of information on human lncRNAs obtained from multiple different resources and allows not only existing lncRNAs to be edited, updated and curated by different users but also the addition of newly identified lncRNAs by any user. It harnesses community collective knowledge in collecting, editing and annotating human lncRNAs and rewards community-curated efforts by providing explicit authorship based on quantified contributions. LncRNAWiki relies on the underling knowledge of scientific community for collective and collaborative curation of human lncRNAs and thus has the potential to serve as an up-to-date and comprehensive knowledgebase for human lncRNAs.

  17. Targeting long non-coding RNA-TUG1 inhibits tumor growth and angiogenesis in hepatoblastoma.

    Science.gov (United States)

    Dong, R; Liu, G-B; Liu, B-H; Chen, G; Li, K; Zheng, S; Dong, K-R

    2016-06-30

    Hepatoblastoma is the most common liver tumor of early childhood, which is usually characterized by unusual hypervascularity. Recently, long non-coding RNAs (lncRNA) have emerged as gene regulators and prognostic markers in several cancers, including hepatoblastoma. We previously reveal that lnRNA-TUG1 is upregulated in hepatoblastoma specimens by microarray analysis. In this study, we aim to elucidate the biological and clinical significance of TUG1 upregulation in hepatoblastoma. We show that TUG1 is significantly upregulated in human hepatoblastoma specimens and metastatic hepatoblastoma cell lines. TUG1 knockdown inhibits tumor growth and angiogenesis in vivo, and decreases hepatoblastoma cell viability, proliferation, migration, and invasion in vitro. TUG1, miR-34a-5p, and VEGFA constitutes to a regulatory network, and participates in regulating hepatoblastoma cell function, tumor progression, and tumor angiogenesis. Overall, our findings indicate that TUG1 upregulation contributes to unusual hypervascularity of hepatoblastoma. TUG1 is a promising therapeutic target for aggressive, recurrent, or metastatic hepatoblastoma.

  18. The prognostic potential and carcinogenesis of long non-coding RNA TUG1 in human cholangiocarcinoma.

    Science.gov (United States)

    Xu, Yi; Leng, Kaiming; Li, Zhenglong; Zhang, Fumin; Zhong, Xiangyu; Kang, Pengcheng; Jiang, Xingming; Cui, Yunfu

    2017-09-12

    Cholangiocarcinoma (CCA) is a fatal disease with increasing worldwide incidence and is characterized by poor prognosis due to its poor response to conventional chemotherapy or radiotherapy. Long non-coding RNAs (lncRNAs) play key roles in multiple human cancers, including CCA. Cancer progression related lncRNA taurine-up-regulated gene 1 (TUG1) was reported to be involved in human carcinomas. However, the impact of TUG1 in CCA is unclear. The aim of this study was to explore the expression pattern of TUG1 and evaluate its clinical significance as well as prognostic potential in CCA. In addition, the functional roles of TUG1 including cell proliferation, apoptosis, migration, invasion and epithelial-mesenchymal transition (EMT), were evaluated after TUG1 silencing. Our data demonstrated up-regulation of TUG1 in both CCA tissues and cell lines. Moreover, overexpression of TUG1 is linked to tumor size ( p =0.005), TNM stage ( p =0.013), postoperative recurrence ( p =0.036) and overall survival ( p =0.010) of CCA patients. Furthermore, down-regulation of TUG1 following RNA silencing reduced cell growth and increased apoptosis in CCA cells. Additionally, TUG1 suppression inhibited metastasis potential in vitro by reversing EMT. Overall, our results suggest that TUG1 may be a rational CCA-related prognostic factor and therapeutic target.

  19. TUG1: a pivotal oncogenic long non-coding RNA of human cancers.

    Science.gov (United States)

    Li, Zheng; Shen, Jianxiong; Chan, Matthew T V; Wu, William Ka Kei

    2016-08-01

    Long non-coding RNAs (lncRNAs) are a group greater than 200 nucleotides in length. An increasing number of studies has shown that lncRNAs play important roles in diverse cellular processes, including proliferation, differentiation, apoptosis, invasion and chromatin remodelling. In this regard, deregulation of lncRNAs has been documented in human cancers. TUG1 is a recently identified oncogenic lncRNA whose aberrant upregulation has been detected in different types of cancer, including B-cell malignancies, oesophageal squamous cell carcinoma, bladder cancer, hepatocellular carcinoma and osteosarcoma. In these malignancies, knock-down of TUG1 has been shown to suppress cell proliferation, invasion and/or colony formation. Interestingly, TUG1 has been found to be downregulated in non-small cell lung carcinoma, indicative of its tissue-specific function in tumourigenesis. Pertinent to clinical practice, TUG1 may act as a prognostic biomarker for tumours. In this review, we summarize current knowledge concerning the role of TUG1 in tumour progression and discuss mechanisms associated with it. © 2016 John Wiley & Sons Ltd.

  20. Prognostic value of long non-coding RNA TUG1 in various tumors.

    Science.gov (United States)

    Li, Na; Shi, Ke; Kang, Xinmei; Li, Wei

    2017-09-12

    Taurine up-regulated gene 1 (TUG1) is a long non-coding RNA (lncRNA), has been reported that be dysregulated in various tumors, involved in proliferation and apoptosis in a variety of tumor cells. To detect the clinical significance of TUG1 expression in tumor patients, we carried out current systematic review and meta-analysis investigating its relation with the prognosis and clinicopathological features of cancers. A total of 15 studies comprise 1560 patients were analyzed. The pooled results showed that no significant relationship between high TUG1 expression and overall survival (OS) (HR = 1.28, 95% CI: 0.96-1.69, P = 0.091) in various tumors. In the subgroup analysis by cancer type, elevated TUG1 expression was associated with poorer survival in cancer patients with high TUG1 expression subgroup but better survival in patients with low TUG1 expression subgroup. Over-expression of TUG1 associated with significantly unfavorable survival for bladder cancer (HR=2.67, 95% CI: 1.47-4.87, P = 0.001). Up-regulation of TUG1 correlated with distant metastasis (DM) (OR = 4.22, 95% CI: 2.66-6.70, P TUG1 may be a useful prognostic biomarker in cancer patients.

  1. Expression Profile of Long Non-Coding RNAs in Serum of Patients with Multiple Sclerosis.

    Science.gov (United States)

    Santoro, Massimo; Nociti, Viviana; Lucchini, Matteo; De Fino, Chiara; Losavio, Francesco Antonio; Mirabella, Massimiliano

    2016-05-01

    Multiple sclerosis (MS) is a chronic progressive inflammatory disease of the central nervous system (CNS) that leads to severe neurological disability. There is an interest in potential biomarkers that could provide information predicting disease activity and progression. Long non-coding RNAs (lncRNAs) have been reported to be involved in the pathogenesis of various human disorders, such as oncologic, cardiovascular, and neurodegenerative diseases. No studies have so far explored a potential link between lncRNAs and MS pathology. We screened 84 lncRNAs, involved in autoimmunity and human inflammatory response, in the serum of relapsing-remitting MS (RR-MS) patients (n = 12), age-matched controls (n = 12), and in patients with idiopathic inflammatory myopathy (IIM) (n = 12). We used the following criteria for lncRNAs analysis: fold change >2 and p TUG1), and 7SK small nuclear (RN7SK RNA). Literature data showed that NEAT1, TUG1, and RN7SK RNA play an important role in neurodegenerative processes. Our results indicate that these lncRNAs may be involved in MS pathogenesis. Additional experimental data are needed to clarify the molecular mechanisms through which lncRNAs up-regulation may have a role in MS.

  2. Long non-coding RNA TUG1 promotes cell proliferation and metastasis in human breast cancer.

    Science.gov (United States)

    Li, Teng; Liu, Yun; Xiao, Haifeng; Xu, Guanghui

    2017-07-01

    Long non-coding RNAs (LncRNAs) utilize a wide variety of mechanisms to regulate RNAs or proteins on the transcriptional or post-transcriptional levels. Accumulating studies have identified numerous LncRNAs to exert critical effects on different physiological processes, genetic disorders, and human diseases. Both clinical tissues from breast cancer patients and cultured cells were used for the qRT-PCR analysis. Specific siRNAs were included to assess the roles of TUG1 with cell viability assay, transwell assay, and cell apoptosis assay, respectively. The expression of TUG1 was enhanced in breast cancerous tissues and in highly invasive breast cancer cell lines and was associated with clinical variables, including tumor size, distant metastasis and TNM staging. Knockdown of TUG1 significantly slowed down cell proliferation, cell migration, and invasion in breast cancer cell lines MDA-MB-231 and MDA-MB-436. In addition, cell apoptotic rate was shown to increase upon siTUG1 treatment as evidenced by increases of the activities of caspase-3 and caspase-9. The identification of TUG1 as a critical mediator of breast cancer progression implied that it might serve as a biomarker for the diagnosis and treatment of breast cancer in clinic.

  3. Non-coding RNAs as epigenetic regulator of glioma stem-like cell differentiation

    Directory of Open Access Journals (Sweden)

    Keisuke eKatsushima

    2014-02-01

    Full Text Available Glioblastomas show heterogeneous histological features. These distinct phenotypic states are thought to be associated with the presence of glioma stem cells (GSCs, which are highly tumorigenic and self-renewing sub-population of tumor cells that have different functional characteristics. Differentiation of GSCs may be regulated by multi-tiered epigenetic mechanisms that orchestrate the expression of thousands of genes. One such regulatory mechanism involves functional non-coding RNAs (ncRNAs, such as microRNAs (miRNAs; a large number of ncRNAs have been identified and shown to regulate the expression of genes associated with cell differentiation programs. Given the roles of miRNAs in cell differentiation, it is possible they are involved in the regulation of gene expression networks in GSCs that are important for the maintenance of the pluripotent state and for directing differentiation. Here, we review recent findings on ncRNAs associated with GSC differentiation and discuss how these ncRNAs contribute to the establishment of tissue heterogeneity during glioblastoma tumor formation.

  4. Dysregulation of the long non-coding RNA transcriptome in a Rett syndrome mouse model

    Science.gov (United States)

    Petazzi, Paolo; Sandoval, Juan; Szczesna, Karolina; Jorge, Olga C.; Roa, Laura; Sayols, Sergi; Gomez, Antonio; Huertas, Dori; Esteller, Manel

    2013-01-01

    Mecp2 is a transcriptional repressor protein that is mutated in Rett syndrome, a neurodevelopmental disorder that is the second most common cause of mental retardation in women. It has been shown that the loss of the Mecp2 protein in Rett syndrome cells alters the transcriptional silencing of coding genes and microRNAs. Herein, we have studied the impact of Mecp2 impairment in a Rett syndrome mouse model on the global transcriptional patterns of long non-coding RNAs (lncRNAs). Using a microarray platform that assesses 41,232 unique lncRNA transcripts, we have identified the aberrant lncRNA transcriptome that is present in the brain of Rett syndrome mice. The study of the most relevant lncRNAs altered in the assay highlighted the upregulation of the AK081227 and AK087060 transcripts in Mecp2-null mice brains. Chromatin immunoprecipitation demonstrated the Mecp2 occupancy in the 5′-end genomic loci of the described lncRNAs and its absence in Rett syndrome mice. Most importantly, we were able to show that the overexpression of AK081227 mediated by the Mecp2 loss was associated with the downregulation of its host coding protein gene, the gamma-aminobutyric acid receptor subunit Rho 2 (Gabrr2). Overall, our findings indicate that the transcriptional dysregulation of lncRNAs upon Mecp2 loss contributes to the neurological phenotype of Rett syndrome and highlights the complex interaction between ncRNAs and coding-RNAs. PMID:23611944

  5. Long Non-Coding RNAs: Emerging and Versatile Regulators in Host–Virus Interactions

    Directory of Open Access Journals (Sweden)

    Xing-Yu Meng

    2017-11-01

    Full Text Available Long non-coding RNAs (lncRNAs are a class of non-protein-coding RNA molecules, which are involved in various biological processes, including chromatin modification, cell differentiation, pre-mRNA transcription and splicing, protein translation, etc. During the last decade, increasing evidence has suggested the involvement of lncRNAs in both immune and antiviral responses as positive or negative regulators. The immunity-associated lncRNAs modulate diverse and multilayered immune checkpoints, including activation or repression of innate immune signaling components, such as interleukin (IL-8, IL-10, retinoic acid inducible gene I, toll-like receptors 1, 3, and 8, and interferon (IFN regulatory factor 7, transcriptional regulation of various IFN-stimulated genes, and initiation of the cell apoptosis pathways. Additionally, some virus-encoded lncRNAs facilitate viral replication through individually or synergistically inhibiting the host antiviral responses or regulating multiple steps of the virus life cycle. Moreover, some viruses are reported to hijack host-encoded lncRNAs to establish persistent infections. Based on these amazing discoveries, lncRNAs are an emerging hotspot in host–virus interactions. In this review, we summarized the current findings of the host- or virus-encoded lncRNAs and the underlying mechanisms, discussed their impacts on immune responses and viral replication, and highlighted their critical roles in host–virus interactions.

  6. Towards a therapy for Angelman syndrome by targeting a long non-coding RNA.

    Science.gov (United States)

    Meng, Linyan; Ward, Amanda J; Chun, Seung; Bennett, C Frank; Beaudet, Arthur L; Rigo, Frank

    2015-02-19

    Angelman syndrome is a single-gene disorder characterized by intellectual disability, developmental delay, behavioural uniqueness, speech impairment, seizures and ataxia. It is caused by maternal deficiency of the imprinted gene UBE3A, encoding an E3 ubiquitin ligase. All patients carry at least one copy of paternal UBE3A, which is intact but silenced by a nuclear-localized long non-coding RNA, UBE3A antisense transcript (UBE3A-ATS). Murine Ube3a-ATS reduction by either transcription termination or topoisomerase I inhibition has been shown to increase paternal Ube3a expression. Despite a clear understanding of the disease-causing event in Angelman syndrome and the potential to harness the intact paternal allele to correct the disease, no gene-specific treatment exists for patients. Here we developed a potential therapeutic intervention for Angelman syndrome by reducing Ube3a-ATS with antisense oligonucleotides (ASOs). ASO treatment achieved specific reduction of Ube3a-ATS and sustained unsilencing of paternal Ube3a in neurons in vitro and in vivo. Partial restoration of UBE3A protein in an Angelman syndrome mouse model ameliorated some cognitive deficits associated with the disease. Although additional studies of phenotypic correction are needed, we have developed a sequence-specific and clinically feasible method to activate expression of the paternal Ube3a allele.

  7. Selective expression of long non-coding RNAs in a breast cancer cell progression model.

    Science.gov (United States)

    Tracy, Kirsten M; Tye, Coralee E; Page, Natalie A; Fritz, Andrew J; Stein, Janet L; Lian, Jane B; Stein, Gary S

    2018-02-01

    Long non-coding RNAs (lncRNAs) are acknowledged as regulators of cancer biology and pathology. Our goal was to perform a stringent profiling of breast cancer cell lines that represent disease progression. We used the MCF-10 series, which includes the normal-like MCF-10A, HRAS-transformed MCF-10AT1 (pre-malignant), and MCF-10CA1a (malignant) cells, to perform transcriptome wide sequencing. From these data, we have identified 346 lncRNAs with dysregulated expression across the progression series. By comparing lncRNAs from these datasets to those from an additional set of cell lines that represent different disease stages and subtypes, MCF-7 (early stage, luminal), and MDA-MB-231 (late stage, basal), 61 lncRNAs that are associated with breast cancer progression were identified. Querying breast cancer patient data from The Cancer Genome Atlas, we selected a lncRNA, IGF-like family member 2 antisense RNA 1 (IGFL2-AS1), of potential clinical relevance for functional characterization. Among the 61 lncRNAs, IGFL2-AS1 was the most significantly decreased. Our results indicate that this lncRNA plays a role in downregulating its nearest neighbor, IGFL1, and affects migration of breast cancer cells. Furthermore, the lncRNAs we identified provide a valuable resource to mechanistically and clinically understand the contribution of lncRNAs in breast cancer progression. © 2017 Wiley Periodicals, Inc.

  8. FARNA: knowledgebase of inferred functions of non-coding RNA transcripts

    KAUST Repository

    Alam, Tanvir

    2016-10-12

    Non-coding RNA (ncRNA) genes play a major role in control of heterogeneous cellular behavior. Yet, their functions are largely uncharacterized. Current available databases lack in-depth information of ncRNA functions across spectrum of various cells/tissues. Here, we present FARNA, a knowledgebase of inferred functions of 10,289 human ncRNA transcripts (2,734 microRNA and 7,555 long ncRNA) in 119 tissues and 177 primary cells of human. Since transcription factors (TFs) and TF co-factors (TcoFs) are crucial components of regulatory machinery for activation of gene transcription, cellular processes and diseases in which TFs and TcoFs are involved suggest functions of the transcripts they regulate. In FARNA, functions of a transcript are inferred from TFs and TcoFs whose genes co-express with the transcript controlled by these TFs and TcoFs in a considered cell/tissue. Transcripts were annotated using statistically enriched GO terms, pathways and diseases across cells/tissues based on guilt-by-association principle. Expression profiles across cells/tissues based on Cap Analysis of Gene Expression (CAGE) are provided. FARNA, having the most comprehensive function annotation of considered ncRNAs across widest spectrum of human cells/tissues, has a potential to greatly contribute to our understanding of ncRNA roles and their regulatory mechanisms in human. FARNA can be accessed at: http://cbrc.kaust.edu.sa/farna

  9. The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase.

    Science.gov (United States)

    Redon, Sophie; Reichenbach, Patrick; Lingner, Joachim

    2010-09-01

    Telomeres, the physical ends of eukaryotes chromosomes are transcribed into telomeric repeat containing RNA (TERRA), a large non-coding RNA of unknown function, which forms an integral part of telomeric heterochromatin. TERRA molecules resemble in sequence the telomeric DNA substrate as they contain 5'-UUAGGG-3' repeats near their 3'-end which are complementary to the template sequence of telomerase RNA. Here we demonstrate that endogenous TERRA is bound to human telomerase in cell extracts. Using in vitro reconstituted telomerase and synthetic TERRA molecules we demonstrate that the 5'-UUAGGG-3' repeats of TERRA base pair with the RNA template of the telomerase RNA moiety (TR). In addition TERRA contacts the telomerase reverse transcriptase (TERT) protein subunit independently of hTR. In vitro studies further demonstrate that TERRA is not used as a telomerase substrate. Instead, TERRA acts as a potent competitive inhibitor for telomeric DNA in addition to exerting an uncompetitive mode of inhibition. Our data identify TERRA as a telomerase ligand and natural direct inhibitor of human telomerase. Telomerase regulation by the telomere substrate may be mediated via its transcription.

  10. Understanding the Functions of Long Non-Coding RNAs through Their Higher-Order Structures

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-05-01

    Full Text Available Although thousands of long non-coding RNAs (lncRNAs have been discovered in eukaryotes, very few molecular mechanisms have been characterized due to an insufficient understanding of lncRNA structure. Therefore, investigations of lncRNA structure and subsequent elucidation of the regulatory mechanisms are urgently needed. However, since lncRNA are high molecular weight molecules, which makes their crystallization difficult, obtaining information about their structure is extremely challenging, and the structures of only several lncRNAs have been determined so far. Here, we review the structure–function relationships of the widely studied lncRNAs found in the animal and plant kingdoms, focusing on the principles and applications of both in vitro and in vivo technologies for the study of RNA structures, including dimethyl sulfate-sequencing (DMS-seq, selective 2′-hydroxyl acylation analyzed by primer extension-sequencing (SHAPE-seq, parallel analysis of RNA structure (PARS, and fragmentation sequencing (FragSeq. The aim of this review is to provide a better understanding of lncRNA biological functions by studying them at the structural level.

  11. Identification of genes for small non-coding RNAs that belong to the regulon of the two-component regulatory system CiaRH in Streptococcus

    Directory of Open Access Journals (Sweden)

    Hakenbeck Regine

    2010-11-01

    Full Text Available Abstract Background Post-transcriptional regulation by small RNAs (sRNAs in bacteria is now recognized as a wide-spread regulatory mechanism modulating a variety of physiological responses including virulence. In Streptococcus pneumoniae, an important human pathogen, the first sRNAs to be described were found in the regulon of the CiaRH two-component regulatory system. Five of these sRNAs were detected and designated csRNAs for cia-dependent small RNAs. CiaRH pleiotropically affects β-lactam resistance, autolysis, virulence, and competence development by yet to be defined molecular mechanisms. Since CiaRH is highly conserved among streptococci, it is of interest to determine if csRNAs are also included in the CiaRH regulon in this group of organisms consisting of commensal as well as pathogenic species. Knowledge on the participation of csRNAs in CiaRH-dependent regulatory events will be the key to define the physiological role of this important control system. Results Genes for csRNAs were predicted in streptococcal genomes and data base entries other than S. pneumoniae by searching for CiaR-activated promoters located in intergenic regions that are followed by a transcriptional terminator. 61 different candidate genes were obtained specifying csRNAs ranging in size from 51 to 202 nt. Comparing these genes among each other revealed 40 different csRNA types. All streptococcal genomes harbored csRNA genes, their numbers varying between two and six. To validate these predictions, S. mitis, S. oralis, and S. sanguinis were subjected to csRNA-specific northern blot analysis. In addition, a csRNA gene from S. thermophilus plasmid pST0 introduced into S. pneumoniae was also tested. Each of the csRNAs was detected on these blots and showed the anticipated sizes. Thus, the method applied here is able to predict csRNAs with high precision. Conclusions The results of this study strongly suggest that genes for small non-coding RNAs, csRNAs, are part of

  12. Emerging putative associations between non-coding RNAs and protein-coding genes in Neuropathic Pain. Added value from re-using microarray data.

    Directory of Open Access Journals (Sweden)

    Enrico Capobianco

    2016-10-01

    Full Text Available Regeneration of injured nerves is likely occurring in the peripheral nervous system, but not in the central nervous system. Although protein-coding gene expression has been assessed during nerve regeneration, little is currently known about the role of non-coding RNAs (ncRNAs. This leaves open questions about the potential effects of ncRNAs at transcriptome level. Due to the limited availability of human neuropathic pain data, we have identified the most comprehensive time-course gene expression profile referred to sciatic nerve injury, and studied in a rat model, using two neuronal tissues, namely dorsal root ganglion (DRG and sciatic nerve (SN. We have developed a methodology to identify differentially expressed bioentities starting from microarray probes, and re-purposing them to annotate ncRNAs, while analyzing the expression profiles of protein-coding genes. The approach is designed to reuse microarray data and perform first profiling and then meta-analysis through three main steps. First, we used contextual analysis to identify what we considered putative or potential protein coding targets for selected ncRNAs. Relevance was therefore assigned to differential expression of neighbor protein-coding genes, with neighborhood defined by a fixed genomic distance from long or antisense ncRNA loci, and of parent genes associated with pseudogenes. Second, connectivity among putative targets was used to build networks, in turn useful to conduct inference at interactomic scale. Last, network paths were annotated to assess relevance to neuropathic pain. We found significant differential expression in long-intergenic ncRNAs (32 lincRNAs in SN, and 8 in DRG, antisense RNA (31 asRNA in SN, and 12 in DRG and pseudogenes (456 in SN, 56 in DRG. In particular, contextual analysis centered on pseudogenes revealed some targets with known association to neurodegeneration and/or neurogenesis processes. While modules of the olfactory receptors were clearly

  13. Expression profiling of long non-coding RNA identifies linc-RoR as a prognostic biomarker in oral cancer.

    Science.gov (United States)

    Arunkumar, Ganesan; Deva Magendhra Rao, Arunagiri Kuha; Manikandan, Mayakannan; Arun, Kanagaraj; Vinothkumar, Vilvanathan; Revathidevi, Sundaramoorthy; Rajkumar, Kottayasamy Seenivasagam; Rajaraman, Ramamurthy; Munirajan, Arasambattu Kannan

    2017-04-01

    Oral squamous cell carcinoma is the most aggressive cancer that is associated with high recurrence, metastasis, and poor treatment outcome. Dysregulation of long non-coding RNAs has been shown to promote tumor growth and metastasis in several cancers. In this study, we investigated the expression of 11 selected long non-coding RNAs that are associated with cell proliferation, metastasis, and tumor suppression in oral squamous cell carcinomas and normal tissues by quantitative real-time polymerase chain reaction. Out of the 11 long non-coding RNAs profiled, 9 were significantly overexpressed in tumors with tobacco chewing history. Moreover, the long non-coding RNA profile was similar to the head and neck cancer datasets of The Cancer Genome Atlas database. Linc-RoR, a regulator of reprogramming, implicated in tumorigenesis was found to be overexpressed in undifferentiated tumors and showed strong association with tumor recurrence and poor therapeutic response. In oral squamous cell carcinomas, for the first time, we observed linc-RoR overexpression, downregulation of miR-145-5p, and overexpression of c-Myc, Klf4, Oct4, and Sox2, suggesting the existence of linc-RoR-mediated competing endogenous RNA network in undifferentiated tumors. Taken together, this study demonstrated the association of linc-RoR overexpression in undifferentiated oral tumors and its prognostic value to predict the therapeutic response.

  14. Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

    Science.gov (United States)

    There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

  15. Overview of long non-coding RNA and mRNA expression in response to methamphetamine treatment in vitro

    NARCIS (Netherlands)

    Xiong, Kun; Long, Lingling; Zhang, Xudong; Qu, Hongke; Deng, Haixiao; Ding, Yanjun; Cai, Jifeng; Wang, Shuchao; Wang, Mi; Liao, Lvshuang; Huang, Jufang; Yi, Chun-Xia; Yan, Jie

    2017-01-01

    Long non-coding RNAs (IncRNAs) display multiple functions including regulation of neuronal injury. However, their impact in methamphetamine (METH)-induced neurotoxicity has rarely been reported. Here, using microarray analysis, we investigated the expression profiling of lncRNAs and mRNAs in primary

  16. RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

    Science.gov (United States)

    Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

    2004-11-01

    RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

  17. Crosstalk between long non-coding RNAs and Wnt/β-catenin signalling in cancer.

    Science.gov (United States)

    Yang, Gang; Shen, Tianyi; Yi, Xiaoming; Zhang, Zhengyu; Tang, Chaopeng; Wang, Longxin; Zhou, Yulin; Zhou, Wenquan

    2018-04-01

    Long non-coding RNAs (lncRNAs) are non-protein-coding transcripts in the human genome which perform crucial functions in diverse biological processes. The abnormal expression of some lncRNAs has been found in tumorigenesis, development and therapy resistance of cancers. They may act as oncogenes or tumour suppressors and can be used as diagnostic or prognostic markers, prompting their therapeutic potentials in cancer treatments. Studies have indicated that many lncRNAs are involved in the regulation of several signal pathways, including Wnt/β-catenin signalling pathway, which has been reported to play a significant role in regulating embryogenesis, cell proliferation and controlling tumour biology. Emerging evidences have suggested that lncRNAs can interact with several components of the Wnt/β-catenin signalling pathway to regulate the expression of Wnt target genes in cancer. Moreover, the expression of lncRNAs can also be influenced by the pathway. Nevertheless, Wnt/β-catenin signalling pathway-related lncRNAs and their interactions in cancer are not systematically analysed before. Considering these, this review emphasized the associations between lncRNAs and Wnt/β-catenin signalling pathway in cancer initiation, progression and their therapeutic influence. We also provided an overview on characteristics of lncRNAs and Wnt/β-catenin signalling pathway and discussed their functions in tumour biology. Finally, targeting lncRNAs or/and molecules associated with the Wnt/β-catenin signalling pathway may be a feasible therapeutic method in the future. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  18. Systematic review regulatory principles of non-coding RNAs in cardiovascular diseases.

    Science.gov (United States)

    Li, Yongsheng; Huo, Caiqin; Pan, Tao; Li, Lili; Jin, Xiyun; Lin, Xiaoyu; Chen, Juan; Zhang, Jinwen; Guo, Zheng; Xu, Juan; Li, Xia

    2017-08-16

    Cardiovascular diseases (CVDs) continue to be a major cause of morbidity and mortality, and non-coding RNAs (ncRNAs) play critical roles in CVDs. With the recent emergence of high-throughput technologies, including small RNA sequencing, investigations of CVDs have been transformed from candidate-based studies into genome-wide undertakings, and a number of ncRNAs in CVDs were discovered in various studies. A comprehensive review of these ncRNAs would be highly valuable for researchers to get a complete picture of the ncRNAs in CVD. To address these knowledge gaps and clinical needs, in this review, we first discussed dysregulated ncRNAs and their critical roles in cardiovascular development and related diseases. Moreover, we reviewed >28 561 published papers and documented the ncRNA-CVD association benchmarking data sets to summarize the principles of ncRNA regulation in CVDs. This data set included 13 249 curated relationships between 9503 ncRNAs and 139 CVDs in 12 species. Based on this comprehensive resource, we summarized the regulatory principles of dysregulated ncRNAs in CVDs, including the complex associations between ncRNA and CVDs, tissue specificity and ncRNA synergistic regulation. The highlighted principles are that CVD microRNAs (miRNAs) are highly expressed in heart tissue and that they play central roles in miRNA-miRNA functional synergistic network. In addition, CVD-related miRNAs are close to one another in the functional network, indicating the modular characteristic features of CVD miRNAs. We believe that the regulatory principles summarized here will further contribute to our understanding of ncRNA function and dysregulation mechanisms in CVDs. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Long non-coding RNA expression profiles in gallbladder carcinoma identified using microarray analysis.

    Science.gov (United States)

    Wang, Jiwen; Liu, Han; Shen, Xiaokun; Wang, Yueqi; Zhang, Dexiang; Shen, Sheng; Suo, Tao; Pan, Hongtao; Ming, Yue; Ding, Kan; Liu, Houbao

    2017-05-01

    Gallbladder carcinoma (GBC) is the most common biliary tract cancer and exhibits poor patient prognosis. Previous studies have identified that long non-coding RNAs (lncRNAs) serve important regulatory roles in cancer biology. Alterations in lncRNAs are associated with several types of cancer. However, the contribution of lncRNAs to GBC remains unclear. To investigate the lncRNAs that are potentially involved in GBC, lncRNA profiles were identified in three pairs of human GBC and corresponding peri-carcinomatous tissue samples using microarray analysis. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to validate the microarray data. In order to elucidate potential functions, Gene Ontology, Kyoto Encyclopedia of Genes and Genomes analysis, and network analysis were used to determine relevant signaling pathways. Abundant RNA probes were used, and 1,758 lncRNAs and 1,254 mRNAs were detected to be differentially expressed by the microarray. Compared with para-carcinoma tissue, numerous lncRNAs were markedly upregulated or downregulated in GBC. The results demonstrated that the lncRNAs that were downregulated in GBC were more numerous compared with the lncRNAs that were upregulated. Among them, RP11-152P17.2-006 was the most upregulated, whereas CTA-941F9.9 was the most downregulated. The RT-qPCR results were consistent with the microarray data. Pathway analysis indicated that five pathways corresponded to the differentially expressed transcripts. It was demonstrated that lncRNA expression in GBC was markedly altered, and a series of novel lncRNAs associated with GBC were identified. The results of the present study suggest that the functions of lncRNAs are important in GBC development and progression.

  20. Time-dependent differential expression of long non-coding RNAs following peripheral nerve injury.

    Science.gov (United States)

    Pan, Bin; Zhou, Heng-Xing; Liu, Yi; Yan, Jia-Yin; Wang, Yao; Yao, Xue; Deng, Yan-Qiu; Chen, Shu-Yi; Lu, Lu; Wei, Zhi-Jian; Kong, Xiao-Hong; Feng, Shi-Qing

    2017-06-01

    Long non-coding RNAs (lncRNAs) are widely accepted as key players in various biological processes. However, the roles of lncRNA in peripheral nerve regeneration remain completely unknown. Thus, in this study, we performed microarray analysis to measure lncRNA expression in the distal segment of the sciatic nerve at 0, 3, 7 and 14 days following injury. We identified 5,354 lncRNAs that were differentially expressed: 3,788 lncRNAs were differentially expressed between days 0 and 3; 3,314 lncRNAs were differentially expressed between days 0 and 7; and 2,400 lncRNAs were differentially expressed between days 0 and 14. The results of RT-qPCR of two dysregulated lncRNAs were consistent with those of microarray analysis. Bioinformatics approaches, including lncRNA classification, gene ontology (GO) analysis and target prediction, were utilized to investigate the functions of these dysregulated lncRNAs in peripheral nerve damage. Importantly, we predicted that several lncRNA-mRNA pairs may participate in biological processes related to peripheral nerve injury. RT-qPCR was performed for the preliminary verification of three lncRNA‑mRNA pairs. The overexpression of NONMMUG014387 promoted the proliferation of mouse Schwann cells. Thus, the findings of our study may enhance our knowledge of the role of lncRNAs in nerve injury.

  1. The role of Ctk1 kinase in termination of small non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Tineke L Lenstra

    Full Text Available Transcription termination in Saccharomyces cerevisiae can be performed by at least two distinct pathways and is influenced by the phosphorylation status of the carboxy-terminal domain (CTD of RNA polymerase II (Pol II. Late termination of mRNAs is performed by the CPF/CF complex, the recruitment of which is dependent on CTD-Ser2 phosphorylation (Ser2P. Early termination of shorter cryptic unstable transcripts (CUTs and small nucleolar/nuclear RNAs (sno/snRNAs is performed by the Nrd1-Nab3-Sen1 (NNS complex that binds phosphorylated CTD-Ser5 (Ser5P via the CTD-interacting domain (CID of Nrd1p. In this study, mutants of the different termination pathways were compared by genome-wide expression analysis. Surprisingly, the expression changes observed upon loss of the CTD-Ser2 kinase Ctk1p are more similar to those derived from alterations in the Ser5P-dependent NNS pathway, than from loss of CTD-Ser2P binding factors. Tiling array analysis of ctk1Δ cells reveals readthrough at snoRNAs, at many cryptic unstable transcripts (CUTs and stable uncharacterized transcripts (SUTs, but only at some mRNAs. Despite the suggested predominant role in termination of mRNAs, we observed that a CTK1 deletion or a Pol II CTD mutant lacking all Ser2 positions does not result in a global mRNA termination defect. Rather, termination defects in these strains are widely observed at NNS-dependent genes. These results indicate that Ctk1p and Ser2 CTD phosphorylation have a wide impact in termination of small non-coding RNAs but only affect a subset of mRNA coding genes.

  2. Non-coding RNA detection methods combined to improve usability, reproducibility and precision

    Directory of Open Access Journals (Sweden)

    Kreikemeyer Bernd

    2010-09-01

    Full Text Available Abstract Background Non-coding RNAs gain more attention as their diverse roles in many cellular processes are discovered. At the same time, the need for efficient computational prediction of ncRNAs increases with the pace of sequencing technology. Existing tools are based on various approaches and techniques, but none of them provides a reliable ncRNA detector yet. Consequently, a natural approach is to combine existing tools. Due to a lack of standard input and output formats combination and comparison of existing tools is difficult. Also, for genomic scans they often need to be incorporated in detection workflows using custom scripts, which decreases transparency and reproducibility. Results We developed a Java-based framework to integrate existing tools and methods for ncRNA detection. This framework enables users to construct transparent detection workflows and to combine and compare different methods efficiently. We demonstrate the effectiveness of combining detection methods in case studies with the small genomes of Escherichia coli, Listeria monocytogenes and Streptococcus pyogenes. With the combined method, we gained 10% to 20% precision for sensitivities from 30% to 80%. Further, we investigated Streptococcus pyogenes for novel ncRNAs. Using multiple methods--integrated by our framework--we determined four highly probable candidates. We verified all four candidates experimentally using RT-PCR. Conclusions We have created an extensible framework for practical, transparent and reproducible combination and comparison of ncRNA detection methods. We have proven the effectiveness of this approach in tests and by guiding experiments to find new ncRNAs. The software is freely available under the GNU General Public License (GPL, version 3 at http://www.sbi.uni-rostock.de/moses along with source code, screen shots, examples and tutorial material.

  3. Long Non-Coding RNA: Potential Diagnostic and Therapeutic Biomarker for Major Depressive Disorder.

    Science.gov (United States)

    Cui, Xuelian; Sun, Xinyang; Niu, Wei; Kong, Lingming; He, Mingjun; Zhong, Aifang; Chen, Shengdong; Jiang, Kunhong; Zhang, Liyi; Cheng, Zaohuo

    2016-12-31

    BACKGROUND The criteria for diagnosing depression are based on behavioral observation and self-reporting of symptoms by the patients or guardians without any biological validation of the disease. This study aimed to identify long non-coding RNAs (lncRNAs) in peripheral blood mononuclear cells (PBMCs) as robust and predictive biomarkers for diagnosis and therapy response in major depressive disorder (MDD). MATERIAL AND METHODS We used human lncRNA 3.0 microarray profiling (which covers 30,586 human lncRNAs), using PBMCs from five MDD patients and five controls. Differentially expressed lncRNAs in the PBMCs of MDD patients were identified, of which 10 candidate lncRNAs were selected for real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in a larger cohort of 138 MDD patients and 63 healthy controls. Then among the 138 MDD patients who received standard antidepressant treatment, 30 were randomly selected for lncRNAs expression retesting and symptomatology assessments after three-weeks and six-weeks of antidepressant treatment. RESULTS Six lncRNAs (TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, and NONHSAT142707) were significantly downregulated in MDD patients compared to control patients, and the area under the receiver operator curve (ROC) of these six lncRNAs cases, combined, was 0.719 (95% confidence interval (CI): 0.617-0.821). There was no difference in the expression of these six lncRNAs based on gender (p>0.05) or age (p>0.05). CONCLUSIONS These results suggest that the combined expression of six lncRNAs in PBMCs may serve as a potential biomarker for diagnosis and therapy response of MDD in the clinical setting.

  4. Fast and accurate search for non-coding RNA pseudoknot structures in genomes.

    Science.gov (United States)

    Huang, Zhibin; Wu, Yong; Robertson, Joseph; Feng, Liang; Malmberg, Russell L; Cai, Liming

    2008-10-15

    Searching genomes for non-coding RNAs (ncRNAs) by their secondary structure has become an important goal for bioinformatics. For pseudoknot-free structures, ncRNA search can be effective based on the covariance model and CYK-type dynamic programming. However, the computational difficulty in aligning an RNA sequence to a pseudoknot has prohibited fast and accurate search of arbitrary RNA structures. Our previous work introduced a graph model for RNA pseudoknots and proposed to solve the structure-sequence alignment by graph optimization. Given k candidate regions in the target sequence for each of the n stems in the structure, we could compute a best alignment in time O(k(t)n) based upon a tree width t decomposition of the structure graph. However, to implement this method to programs that can routinely perform fast yet accurate RNA pseudoknot searches, we need novel heuristics to ensure that, without degrading the accuracy, only a small number of stem candidates need to be examined and a tree decomposition of a small tree width can always be found for the structure graph. The current work builds on the previous one with newly developed preprocessing algorithms to reduce the values for parameters k and t and to implement the search method into a practical program, called RNATOPS, for RNA pseudoknot search. In particular, we introduce techniques, based on probabilistic profiling and distance penalty functions, which can identify for every stem just a small number k (e.g. k algorithm that can yield tree decomposition of small tree width t (e.g. t search prokaryotic and eukaryotic genomes for specific RNA structures of medium to large sizes, including pseudoknots, with high sensitivity and high specificity, and in a reasonable amount of time.

  5. From structure prediction to genomic screens for novel non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Jan Gorodkin

    2011-08-01

    Full Text Available Non-coding RNAs (ncRNAs are receiving more and more attention not only as an abundant class of genes, but also as regulatory structural elements (some located in mRNAs. A key feature of RNA function is its structure. Computational methods were developed early for folding and prediction of RNA structure with the aim of assisting in functional analysis. With the discovery of more and more ncRNAs, it has become clear that a large fraction of these are highly structured. Interestingly, a large part of the structure is comprised of regular Watson-Crick and GU wobble base pairs. This and the increased amount of available genomes have made it possible to employ structure-based methods for genomic screens. The field has moved from folding prediction of single sequences to computational screens for ncRNAs in genomic sequence using the RNA structure as the main characteristic feature. Whereas early methods focused on energy-directed folding of single sequences, comparative analysis based on structure preserving changes of base pairs has been efficient in improving accuracy, and today this constitutes a key component in genomic screens. Here, we cover the basic principles of RNA folding and touch upon some of the concepts in current methods that have been applied in genomic screens for de novo RNA structures in searches for novel ncRNA genes and regulatory RNA structure on mRNAs. We discuss the strengths and weaknesses of the different strategies and how they can complement each other.

  6. Long non coding RNAs (lncRNAs are dysregulated in Malignant Pleural Mesothelioma (MPM.

    Directory of Open Access Journals (Sweden)

    Casey M Wright

    Full Text Available Malignant Pleural Mesothelioma (MPM is an aggressive cancer that is often diagnosed at an advanced stage and is characterized by a long latency period (20-40 years between initial exposure and diagnosis and prior exposure to asbestos. Currently accurate diagnosis of MPM is difficult due to the lack of sensitive biomarkers and despite minor improvements in treatment, median survival rates do not exceed 12 months. Accumulating evidence suggests that aberrant expression of long non-coding RNAs (lncRNAs play an important functional role in cancer biology. LncRNAs are a class of recently discovered non-protein coding RNAs >200 nucleotides in length with a role in regulating transcription. Here we used NCode long noncoding microarrays to identify differentially expressed lncRNAs potentially involved in MPM pathogenesis. High priority candidate lncRNAs were selected on the basis of statistical (P3-fold difference. Expression levels of 9 candidate lncRNAs were technically validated using RT-qPCR, and biologically validated in three independent test sets: (1 57 archived MPM tissues obtained from extrapleural pneumonectomy patients, (2 15 cryopreserved MPM and 3 benign pleura, and (3 an extended panel of 10 MPM cell lines. RT-qPCR analysis demonstrated consistent up-regulation of these lncRNAs in independent datasets. ROC curve analysis showed that two candidates were able to separate benign pleura and MPM with high sensitivity and specificity, and were associated with nodal metastases and survival following induction chemotherapy. These results suggest that lncRNAs have potential to serve as biomarkers in MPM.

  7. A Nucleus-localized Long Non-Coding RNA Enhances Drought and Salt Stress Tolerance

    KAUST Repository

    Qin, Tao

    2017-09-09

    Long non-coding RNAs (lncRNAs) affect gene expression through a wide range of mechanisms and are considered as important regulators in many essential biological processes. A large number of lncRNA transcripts have been predicted or identified in plants in recent years. However, the biological functions for most of them are still unknown. In this study, we identified an Arabidopsis thaliana lncRNA, Drought induced RNA (DRIR), as a novel positive regulator of plant response to drought and salt stress. DRIR was expressed at a low level under non-stress conditions but can be significantly activated by drought and salt stress as well as by abscisic acid (ABA) treatment. We identified a T-DNA insertion mutant, drirD, which had higher expression of the DRIR gene than the wild type plants. The drirD mutant exhibits increased tolerance to drought and salt stress. Overexpressing DRIR in Arabidopsis also increased tolerance to drought and salt stress of the transgenic plants. The drirD mutant and the overexpressing seedlings are more sensitive to ABA than the wild type in stomata closure and seedling growth. Genome-wide transcriptome analysis demonstrated that the expression of a large number of genes was altered in drirD and the overexpressing plants. These include genes involved in ABA signaling, water transport and other stress-relief processes. Our study reveals a mechanism whereby DRIR regulates plant response to abiotic stress by modulating the expression of a series of genes involved in stress response.

  8. Specific long non-coding RNAs response to occupational PAHs exposure in coke oven workers

    Directory of Open Access Journals (Sweden)

    Chen Gao

    Full Text Available To explore whether the alteration of lncRNA expression is correlated with polycyclic aromatic hydrocarbons (PAHs exposure and DNA damage, we examined PAHs external and internal exposure, DNA damage and lncRNAs (HOTAIR, MALAT1, TUG1 and GAS5 expression in peripheral blood lymphocytes (PBLCs of 150 male coke oven workers and 60 non-PAHs exposure workers. We found the expression of HOTAIR, MALAT1, and TUG1 were enhanced in PBLCs of coke oven workers and positively correlated with the levels of external PAHs exposure (adjusted Ptrend < 0.001 for HOTAIR and MALAT1, adjusted Ptrend = 0.006 for TUG1. However, only HOTAIR and MALAT1 were significantly associated with the level of internal PAHs exposure (urinary 1-hydroxypyrene with adjusted β = 0.298, P = 0.024 for HOTAIR and β = 0.090, P = 0.034 for MALAT1. In addition, the degree of DNA damage was positively associated with MALAT1 and HOTAIR expression in PBLCs of all subjects (adjusted β = 0.024, P = 0.002 for HOTAIR and β = 0.007, P = 0.003 for MALAT1. Moreover, we revealed that the global histone 3 lysine 27 trimethylation (H3K27me3 modification was positively associated with the degree of genetic damage (β = 0.061, P < 0.001 and the increase of HOTAIR expression (β = 0.385, P = 0.018. Taken together, our findings suggest that altered HOTAIR and MALAT1 expression might be involved in response to PAHs-induced DNA damage. Keywords: Polycyclic aromatic hydrocarbons, Long non-coding RNA, Peripheral blood lymphocytes, DNA damage response, HOTAIR, MALAT

  9. Modeling post-transcriptional regulation activity of small non-coding RNAs in Escherichia coli.

    Science.gov (United States)

    Wang, Rui-Sheng; Jin, Guangxu; Zhang, Xiang-Sun; Chen, Luonan

    2009-04-29

    Transcriptional regulation is a fundamental process in biological systems, where transcription factors (TFs) have been revealed to play crucial roles. In recent years, in addition to TFs, an increasing number of non-coding RNAs (ncRNAs) have been shown to mediate post-transcriptional processes and regulate many critical pathways in both prokaryotes and eukaryotes. On the other hand, with more and more high-throughput biological data becoming available, it is possible and imperative to quantitatively study gene regulation in a systematic and detailed manner. Most existing studies for inferring transcriptional regulatory interactions and the activity of TFs ignore the possible post-transcriptional effects of ncRNAs. In this work, we propose a novel framework to infer the activity of regulators including both TFs and ncRNAs by exploring the expression profiles of target genes and (post)transcriptional regulatory relationships. We model the integrated regulatory system by a set of biochemical reactions which lead to a log-bilinear problem. The inference process is achieved by an iterative algorithm, in which two linear programming models are efficiently solved. In contrast to available related studies, the effects of ncRNAs on transcription process are considered in this work, and thus more reasonable and accurate reconstruction can be expected. In addition, the approach is suitable for large-scale problems from the viewpoint of computation. Experiments on two synthesized data sets and a model system of Escherichia coli (E. coli) carbon source transition from glucose to acetate illustrate the effectiveness of our model and algorithm. Our results show that incorporating the post-transcriptional regulation of ncRNAs into system model can mine the hidden effects from the regulation activity of TFs in transcription processes and thus can uncover the biological mechanisms in gene regulation in a more accurate manner. The software for the algorithm in this paper is available

  10. Long non-coding RNA HOTAIR promotes carcinogenesis and invasion of gastric adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Na Keum; Lee, Jung Hwa; Park, Chan Hyuk; Yu, Dayeon; Lee, Yong Chan [Division of Gastroenterology, Department of Internal Medicine, Yonsei Institute of Gastroenterology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Cheong, Jae-Ho; Noh, Sung Hoon [Department of Surgery, Yonsei University College of Medicine (Korea, Republic of); Lee, Sang Kil, E-mail: sklee@yuhs.ac [Division of Gastroenterology, Department of Internal Medicine, Yonsei Institute of Gastroenterology, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2014-08-22

    Highlights: • HOTAIR expression was tested in fifty patients with gastric cancer. • Cell proliferation was measured after HOTAIR silencing in gastric cancer cell line. • siRNA–HOTAIR suppresses cell invasiveness and capacity of migration. • Knock down of HOTAR leads to decreased expression of EMT markers. • Inhibition of HOTAIR induces apoptosis and cell cycle arrest. - Abstract: Gastric cancer is one of the major causes of cancer death worldwide; however, the mechanism of carcinogenesis is complex and poorly understood. Long non-coding RNA HOTAIR (HOX transcript antisense RNA) recently emerged as a promoter of metastasis in various cancers including gastric cancer. Here we investigated the impact of HOTAIR on apoptosis, cell proliferation and cell cycle to dissect the carcinogenesis of gastric cancer. We examined the mechanism of invasion and metastasis and analyzed the clinical significance of HOTAIR. Downregulation of HOTAIR was confirmed by two different siRNAs. The expression of HOTAIR was significantly elevated in various gastric cancer cell lines and tissues compared to normal control. si-HOTAIR significantly reduced viability in MKN 28, MKN 74, and KATO III cells but not in AGS cells. si-HOTAIR induced apoptosis in KATO III cells. Lymphovascular invasion and lymph node metastasis were more common in the high level of HOTAIR group. si-HOTAIR significantly decreased invasiveness and migration. si-HOTAIR led to differential expression of epithelial to mesenchymal transition markers. We found that HOTAIR was involved in inhibition of apoptosis and promoted invasiveness, supporting a role for HOTAIR in carcinogenesis and progression of gastric cancer.

  11. Adenovirus VA RNA: An essential pro-viral non-coding RNA.

    Science.gov (United States)

    Vachon, Virginia K; Conn, Graeme L

    2016-01-02

    Adenovirus (AdV) 'virus-associated' RNAs (VA RNAs) are exceptionally abundant (up to 10(8)copies/cell), heterogeneous, non-coding RNA transcripts (∼ 150-200 nucleotides). The predominant species, VA RNAI, is best recognized for its essential function in relieving the cellular anti-viral blockade of protein synthesis through inhibition of the double-stranded RNA-activated protein kinase (PKR). More recent evidence has revealed that VA RNAs also interfere with several other host cell processes, in part by virtue of the high level to which they accumulate. Following transcription by cellular RNA polymerase III, VA RNAs saturate the nuclear export protein Exportin 5 (Exp5) and the cellular endoribonculease Dicer, interfering with pre-micro (mi)RNA export and miRNA biogenesis, respectively. Dicer-processed VA RNA fragments are incorporated into the RNA-induced silencing complex (RISC) as 'mivaRNAs', where they may specifically target cellular genes. VA RNAI also interacts with other innate immune proteins, including OAS1. While intact VA RNAI has the paradoxical effect of activating OAS1, a non-natural VA RNAI construct lacking the entire Terminal Stem has been reported to be a pseudoinhibitor of OAS1. Here, we show that a VA RNAI construct corresponding to an authentic product of Dicer processing similarly fails to activate OAS1 but also retains only a modest level of inhibitory activity against PKR in contrast to the non-natural deletion construct. These findings underscore the complexity of the arms race between virus and host, and highlight the need for further exploration of the impact of VA RNAI interactions with host defenses on the outcome of AdV infection beyond that of well-established PKR inhibition. Additional contributions of VA RNAI heterogeneity resulting from variations in transcription initiation and termination to each of these functions remain open questions that are discussed here. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Type I Interferon Regulates the Expression of Long Non-Coding RNAs

    Science.gov (United States)

    Carnero, Elena; Barriocanal, Marina; Segura, Victor; Guruceaga, Elizabeth; Prior, Celia; Börner, Kathleen; Grimm, Dirk; Fortes, Puri

    2014-01-01

    Interferons (IFNs) are key players in the antiviral response. IFN sensing by the cell activates transcription of IFN-stimulated genes (ISGs) able to induce an antiviral state by affecting viral replication and release. IFN also induces the expression of ISGs that function as negative regulators to limit the strength and duration of IFN response. The ISGs identified so far belong to coding genes. However, only a small proportion of the transcriptome corresponds to coding transcripts and it has been estimated that there could be as many coding as long non-coding RNAs (lncRNAs). To address whether IFN can also regulate the expression of lncRNAs, we analyzed the transcriptome of HuH7 cells treated or not with IFNα2 by expression arrays. Analysis of the arrays showed increased levels of several well-characterized coding genes that respond to IFN both at early or late times. Furthermore, we identified several IFN-stimulated or -downregulated lncRNAs (ISRs and IDRs). Further validation showed that ISR2, 8, and 12 expression mimics that of their neighboring genes GBP1, IRF1, and IL6, respectively, all related to the IFN response. These genes are induced in response to different doses of IFNα2 in different cell lines at early (ISR2 or 8) or later (ISR12) time points. IFNβ also induced the expression of these lncRNAs. ISR2 and 8 were also induced by an influenza virus unable to block the IFN response but not by other wild-type lytic viruses tested. Surprisingly, both ISR2 and 8 were significantly upregulated in cultured cells and livers from patients infected with HCV. Increased levels of ISR2 were also detected in patients chronically infected with HIV. This is relevant as genome-wide guilt-by-association studies predict that ISR2, 8, and 12 may function in viral processes, in the IFN pathway and the antiviral response. Therefore, we propose that these lncRNAs could be induced by IFN to function as positive or negative regulators of the antiviral response. PMID:25414701

  13. Role of long non-coding RNA SNHG1 in occurrence and progression of ovarian carcinoma.

    Science.gov (United States)

    Ge, J; Wu, X-M; Yang, X-T; Gao, J-M; Wang, F; Ye, K-F

    2018-01-01

    To investigate the expression of human long non-coding ribonucleic acid (lncRNA) small nucleolar RNA host gene 1 (SNHG1) in epithelial ovarian carcinoma tissues and its effects on the in vitro proliferation, apoptosis, invasion and metastasis of ovarian carcinoma cells, and to investigate its possible mechanism. The expressions of SNHG1 in 20 pairs of epithelial ovarian carcinoma tissues and para-carcinoma normal tissues were detected by Real-time fluorescence quantitative polymerase chain reaction (qRT-PCR). The expressions of SNHG1 in normal ovarian epithelial cells (IOSE25) and ovarian carcinoma cells (CAOV-3, SKOV-3, ES2 and A2780) were further detected. The knockdown efficiency of SNHG1 small interfering RNA (siRNA) in SKOV-3 cells was detected via qRT-PCR. Moreover, the effects of SNHG1 knockdown on proliferation, migration and apoptosis of SKOV-3 cells were detected by cell counting kit 8 (CCK8) proliferation assay, clone formation assay, transwell migration assay and flow cytometry. Finally, the expressions of apoptosis-related proteins, epithelial-mesenchymal transition (EMT)-related proteins and matrix metalloproteinases (MMPs) in control group and interference group were detected by Western blotting. The expression level of lncRNA SNHG1 in ovarian carcinoma tissues was significantly higher than that in para-carcinoma normal tissues. After lncRNA SNHG1 knockdown in SKOV-3 cells, the cell proliferation and clone formation abilities were significantly inhibited. The apoptosis assay proved that inhibiting lncRNA SNHG1 could promote the apoptosis of SKOV-3 cells. Besides, Western blotting revealed that the expressions of pro-apoptotic proteins in interference group were significantly upregulated compared with those in control group. Wound-healing assay and transwell migration assay showed that the down-regulation of lncRNA SNHG1 could inhibit the invasion and metastasis of SKOV-3 cells, whose mechanism was related to the inhibition of EMT process and down

  14. A six-long non-coding RNA signature predicts prognosis in melanoma patients

    Science.gov (United States)

    Yang, Shuocheng; Xu, Jianguo; Zeng, Xuan

    2018-01-01

    The aim of this study was to identify long non-coding RNAs (lncRNAs) which may prove useful for risk-classifying patients with melanoma. For this purpose, based on a dataset from The Cancer Genome Atlas (TCGA), we selected and analyzed samples from melanoma stages I, II, III and IV, from which differentially expressed lncRNAs were identified. The lncRNAs were classified using two-way hierarchical clustering analysis and analysis of support vector machine (SVM), followed by Kaplan-Meier survival analysis. The prognostic capacity of the signature was verified on an independent dataset. lncRNA-mRNA networks were built using signature lncRNAs and corresponding target genes. The Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis was conducted on the target genes. A total of 48 differentially expressed lncRNAs were identified, from which 6 signature lncRNAs (AL050303 and LINC00707, LINC01324, RP11-85G21, RP4-794I6.4 and RP5-855F16) were identified. Two-way hierarchical clustering analysis revealed that the accuracy of the six-lncRNA signature in risk-stratifying samples was 84.84%, and the accuracy of the SVM classifier was 85.9%. This predictive signature performed well on the validation dataset [accuracy, 86.76; area under the ROC curve (AUROC), 0.816]. A total of 720 target genes of the 6 lncRNAs were selected for the lncRNA-mRNA networks. These genes were significantly related to mitogen-activated protein kinase (MAPK), the neurotrophin signaling pathway, focal adhesion pathways, and several immune and inflammation-related pathways. On the whole, we identified a six-lncRNA prognostic signature for risk-stratifying patients with melanoma. These lncRNAs may affect prognosis by regulating the MAPK pathway, immune and inflammation-related pathways, the neurotrophin signaling pathway and focal adhesion pathways. PMID:29436619

  15. Computational Approaches Reveal New Insights into Regulation and Function of Non; coding RNAs and their Targets

    KAUST Repository

    Alam, Tanvir

    2016-11-28

    Regulation and function of protein-coding genes are increasingly well-understood, but no comparable evidence exists for non-coding RNA (ncRNA) genes, which appear to be more numerous than protein-coding genes. We developed a novel machine-learning model to distinguish promoters of long ncRNA (lncRNA) genes from those of protein-coding genes. This represents the first attempt to make this distinction based on properties of the associated gene promoters. From our analyses, several transcription factors (TFs), which are known to be regulated by lncRNAs, also emerged as potential global regulators of lncRNAs, suggesting that lncRNAs and TFs may participate in bidirectional feedback regulatory network. Our results also raise the possibility that, due to the historical dependence on protein-coding gene in defining the chromatin states of active promoters, an adjustment of these chromatin signature profiles to incorporate lncRNAs is warranted in the future. Secondly, we developed a novel method to infer functions for lncRNA and microRNA (miRNA) transcripts based on their transcriptional regulatory networks in 119 tissues and 177 primary cells of human. This method for the first time combines information of cell/tissueVspecific expression of a transcript and the TFs and transcription coVfactors (TcoFs) that control activation of that transcript. Transcripts were annotated using statistically enriched GO terms, pathways and diseases across cells/tissues and associated knowledgebase (FARNA) is developed. FARNA, having the most comprehensive function annotation of considered ncRNAs across the widest spectrum of cells/tissues, has a potential to contribute to our understanding of ncRNA roles and their regulatory mechanisms in human. Thirdly, we developed a novel machine-learning model to identify LD motif (a protein interaction motif) of paxillin, a ncRNA target that is involved in cell motility and cancer metastasis. Our recognition model identified new proteins not

  16. Long Non-Coding RNA and Alternative Splicing Modulations in Parkinson's Leukocytes Identified by RNA Sequencing

    Science.gov (United States)

    Soreq, Lilach; Guffanti, Alessandro; Salomonis, Nathan; Simchovitz, Alon; Israel, Zvi; Bergman, Hagai; Soreq, Hermona

    2014-01-01

    The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD) patients' leukocytes pre- and post- Deep Brain Stimulation (DBS) treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5′-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs) via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia

  17. Dietary Intervention by Phytochemicals and Their Role in Modulating Coding and Non-Coding Genes in Cancer.

    Science.gov (United States)

    Budisan, Liviuta; Gulei, Diana; Zanoaga, Oana Mihaela; Irimie, Alexandra Iulia; Sergiu, Chira; Braicu, Cornelia; Gherman, Claudia Diana; Berindan-Neagoe, Ioana

    2017-06-01

    Phytochemicals are natural compounds synthesized as secondary metabolites in plants, representing an important source of molecules with a wide range of therapeutic applications. These natural agents are important regulators of key pathological processes/conditions, including cancer, as they are able to modulate the expression of coding and non-coding transcripts with an oncogenic or tumour suppressor role. These natural agents are currently exploited for the development of therapeutic strategies alone or in tandem with conventional treatments for cancer. The aim of this paper is to review the recent studies regarding the role of these natural phytochemicals in different processes related to cancer inhibition, including apoptosis activation, angiogenesis and metastasis suppression. From the large palette of phytochemicals we selected epigallocatechin gallate (EGCG), caffeic acid phenethyl ester (CAPE), genistein, morin and kaempferol, due to their increased activity in modulating multiple coding and non-coding genes, targeting the main hallmarks of cancer.

  18. Dietary Intervention by Phytochemicals and Their Role in Modulating Coding and Non-Coding Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Liviuta Budisan

    2017-06-01

    Full Text Available Phytochemicals are natural compounds synthesized as secondary metabolites in plants, representing an important source of molecules with a wide range of therapeutic applications. These natural agents are important regulators of key pathological processes/conditions, including cancer, as they are able to modulate the expression of coding and non-coding transcripts with an oncogenic or tumour suppressor role. These natural agents are currently exploited for the development of therapeutic strategies alone or in tandem with conventional treatments for cancer. The aim of this paper is to review the recent studies regarding the role of these natural phytochemicals in different processes related to cancer inhibition, including apoptosis activation, angiogenesis and metastasis suppression. From the large palette of phytochemicals we selected epigallocatechin gallate (EGCG, caffeic acid phenethyl ester (CAPE, genistein, morin and kaempferol, due to their increased activity in modulating multiple coding and non-coding genes, targeting the main hallmarks of cancer.

  19. Dietary Intervention by Phytochemicals and Their Role in Modulating Coding and Non-Coding Genes in Cancer

    OpenAIRE

    Budisan, Liviuta; Gulei, Diana; Zanoaga, Oana Mihaela; Irimie, Alexandra Iulia; Chira, Sergiu; Braicu, Cornelia; Gherman, Claudia Diana; Berindan-Neagoe, Ioana

    2017-01-01

    Phytochemicals are natural compounds synthesized as secondary metabolites in plants, representing an important source of molecules with a wide range of therapeutic applications. These natural agents are important regulators of key pathological processes/conditions, including cancer, as they are able to modulate the expression of coding and non-coding transcripts with an oncogenic or tumour suppressor role. These natural agents are currently exploited for the development of therapeutic strateg...

  20. Overexpression of long non-coding RNAs following exposure to xenobiotics in the aquatic midge Chironomus riparius

    Energy Technology Data Exchange (ETDEWEB)

    Martinez-Guitarte, Jose-Luis, E-mail: jlmartinez@ccia.uned.es [Grupo de Biologia y Toxicologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, UNED, Senda del Rey 9, 28040 Madrid (Spain); Planello, Rosario; Morcillo, Gloria [Grupo de Biologia y Toxicologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, UNED, Senda del Rey 9, 28040 Madrid (Spain)

    2012-04-15

    Non-coding RNAs (ncRNAs) represent an important transcriptional output of eukaryotic genomes. In addition to their functional relevance as housekeeping and regulatory elements, recent studies have suggested their involvement in rather unexpected cellular functions. The aim of this work was to analyse the transcriptional behaviour of non-coding RNAs in the toxic response to pollutants in Chironomus riparius, a reference organism in aquatic toxicology. Three well-characterized long non-coding sequences were studied: telomeric repeats, Cla repetitive elements and the SINE CTRT1. Transcription levels were evaluated by RT-PCR after 24-h exposures to three current aquatic contaminants: bisphenol A (BPA), benzyl butyl phthalate (BBP) and the heavy metal cadmium (Cd). Upregulation of telomeric transcripts was found after BPA treatments. Moreover, BPA significantly activated Cla transcription, which also appeared to be increased by cadmium, whereas BBP did not affect the transcription levels of these sequences. Transcription of SINE CTRT1 was not altered by any of the chemicals tested. These data are discussed in the light of previous studies that have shown a response by long ncRNAS (lncRNAs) to cellular stressors, indicating a relationship with environmental stimuli. Our results demonstrated for the first time the ability of bisphenol A to activate non-coding sequences mainly located at telomeres and centromeres. Overall, this study provides evidence that xenobiotics can induce specific responses in ncRNAs derived from repetitive sequences that could be relevant in the toxic response, and also suggests that ncRNAs could represent a novel class of potential biomarkers in toxicological assessment.

  1. Long Non-Coding RNAs in Hepatitis B Virus-Related Hepatocellular Carcinoma: Regulation, Functions, and Underlying Mechanisms

    OpenAIRE

    Qiu, Lipeng; Wang, Tao; Xu, Xiuquan; Wu, Yihang; Tang, Qi; Chen, Keping

    2017-01-01

    Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third leading cause of cancer death in the world. Hepatitis B virus (HBV) and its X gene-encoded protein (HBx) play important roles in the progression of HCC. Although long non-coding RNAs (lncRNAs) cannot encode proteins, growing evidence indicates that they play essential roles in HCC progression, and contribute to cell proliferation, invasion and metastasis, autophagy, and apoptosis by targeting a large number of pivota...

  2. Overexpression of long non-coding RNAs following exposure to xenobiotics in the aquatic midge Chironomus riparius

    International Nuclear Information System (INIS)

    Martínez-Guitarte, José-Luis; Planelló, Rosario; Morcillo, Gloria

    2012-01-01

    Non-coding RNAs (ncRNAs) represent an important transcriptional output of eukaryotic genomes. In addition to their functional relevance as housekeeping and regulatory elements, recent studies have suggested their involvement in rather unexpected cellular functions. The aim of this work was to analyse the transcriptional behaviour of non-coding RNAs in the toxic response to pollutants in Chironomus riparius, a reference organism in aquatic toxicology. Three well-characterized long non-coding sequences were studied: telomeric repeats, Cla repetitive elements and the SINE CTRT1. Transcription levels were evaluated by RT-PCR after 24-h exposures to three current aquatic contaminants: bisphenol A (BPA), benzyl butyl phthalate (BBP) and the heavy metal cadmium (Cd). Upregulation of telomeric transcripts was found after BPA treatments. Moreover, BPA significantly activated Cla transcription, which also appeared to be increased by cadmium, whereas BBP did not affect the transcription levels of these sequences. Transcription of SINE CTRT1 was not altered by any of the chemicals tested. These data are discussed in the light of previous studies that have shown a response by long ncRNAS (lncRNAs) to cellular stressors, indicating a relationship with environmental stimuli. Our results demonstrated for the first time the ability of bisphenol A to activate non-coding sequences mainly located at telomeres and centromeres. Overall, this study provides evidence that xenobiotics can induce specific responses in ncRNAs derived from repetitive sequences that could be relevant in the toxic response, and also suggests that ncRNAs could represent a novel class of potential biomarkers in toxicological assessment.

  3. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  4. RFLP of analyses of an intergenic spacer region of chloroplast DNA ...

    African Journals Online (AJOL)

    Several studies are being made to get high productive wheats throughout the world because they provide the most of human energy and protein needs. In this study, 11 wheat species of Triticum and. Aegilops were investigated. One of the intergenic regions of cpDNA was studied. This region was amplified with PCR and ...

  5. Identification and Characterization of Long Non-Coding RNAs Related to Mouse Embryonic Brain Development from Available Transcriptomic Data

    Science.gov (United States)

    He, Hongjuan; Xiu, Youcheng; Guo, Jing; Liu, Hui; Liu, Qi; Zeng, Tiebo; Chen, Yan; Zhang, Yan; Wu, Qiong

    2013-01-01

    Long non-coding RNAs (lncRNAs) as a key group of non-coding RNAs have gained widely attention. Though lncRNAs have been functionally annotated and systematic explored in higher mammals, few are under systematical identification and annotation. Owing to the expression specificity, known lncRNAs expressed in embryonic brain tissues remain still limited. Considering a large number of lncRNAs are only transcribed in brain tissues, studies of lncRNAs in developmental brain are therefore of special interest. Here, publicly available RNA-sequencing (RNA-seq) data in embryonic brain are integrated to identify thousands of embryonic brain lncRNAs by a customized pipeline. A significant proportion of novel transcripts have not been annotated by available genomic resources. The putative embryonic brain lncRNAs are shorter in length, less spliced and show less conservation than known genes. The expression of putative lncRNAs is in one tenth on average of known coding genes, while comparable with known lncRNAs. From chromatin data, putative embryonic brain lncRNAs are associated with active chromatin marks, comparable with known lncRNAs. Embryonic brain expressed lncRNAs are also indicated to have expression though not evident in adult brain. Gene Ontology analysis of putative embryonic brain lncRNAs suggests that they are associated with brain development. The putative lncRNAs are shown to be related to possible cis-regulatory roles in imprinting even themselves are deemed to be imprinted lncRNAs. Re-analysis of one knockdown data suggests that four regulators are associated with lncRNAs. Taken together, the identification and systematic analysis of putative lncRNAs would provide novel insights into uncharacterized mouse non-coding regions and the relationships with mammalian embryonic brain development. PMID:23967161

  6. Global Intersection of Long Non-Coding RNAs with Processed and Unprocessed Pseudogenes in the Human Genome

    Directory of Open Access Journals (Sweden)

    Michael John Milligan

    2016-03-01

    Full Text Available Pseudogenes are abundant in the human genome and had long been thought of purely as nonfunctional gene fossils. Recent observations point to a role for pseudogenes in regulating genes transcriptionally and post-transcriptionally in human cells. To computationally interrogate the network space of integrated pseudogene and long non-coding RNA regulation in the human transcriptome, we developed and implemented an algorithm to identify all long non-coding RNA (lncRNA transcripts that overlap the genomic spans, and specifically the exons, of any human pseudogenes in either sense or antisense orientation. As inputs to our algorithm, we imported three public repositories of pseudogenes: GENCODE v17 (processed and unprocessed, Ensembl 72; Retroposed Pseudogenes V5 (processed only and Yale Pseudo60 (processed and unprocessed, Ensembl 60; two public lncRNA catalogs: Broad Institute, GENCODE v17; NCBI annotated piRNAs; and NHGRI clinical variants. The data sets were retrieved from the UCSC Genome Database using the UCSC Table Browser. We identified 2277 loci containing exon-to-exon overlaps between pseudogenes, both processed and unprocessed, and long non-coding RNA genes. Of these loci we identified 1167 with Genbank EST and full-length cDNA support providing direct evidence of transcription on one or both strands with exon-to-exon overlaps. The analysis converged on 313 pseudogene-lncRNA exon-to-exon overlaps that were bidirectionally supported by both full-length cDNAs and ESTs. In the process of identifying transcribed pseudogenes, we generated a comprehensive, positionally non-redundant encyclopedia of human pseudogenes, drawing upon multiple, and formerly disparate public pseudogene repositories. Collectively, these observations suggest that pseudogenes are pervasively transcribed on both strands and are common drivers of gene regulation.

  7. Identification and preliminary characterization of a SigB regulated small non-coding RNA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Olsen, Anders Steno; Bonde, Mette

    During the past decade, small non-coding regulatory RNAs (sRNAs) have been identified in several bacterial species. In many cases, the sRNAs are only transiently transcribed in response to a particular stress or growth condition, reflecting the fact that many sRNAs regulate genes that are important...... characterized. We thought it likely that L. monocytogenes might encode sRNAs that were specifically regulated by alternative sigma factors. To approach this issue, we are in the process of developing a bioinformatics tool that allows us to predict candidate sRNA genes that are likely to be regulated...

  8. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs

    Directory of Open Access Journals (Sweden)

    Valentina Iadevaia

    2015-09-01

    Full Text Available Post-transcriptional control of gene expression is mediated by RNA-binding proteins (RBPs and small non-coding RNAs (e.g., microRNAs that bind to distinct elements in their mRNA targets. Here, we review recent examples describing the synergistic and/or antagonistic effects mediated by RBPs and miRNAs to determine the localisation, stability and translation of mRNAs in mammalian cells. From these studies, it is becoming increasingly apparent that dynamic rearrangements of RNA-protein complexes could have profound implications in human cancer, in synaptic plasticity, and in cellular differentiation.

  9. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  10. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape.

    Science.gov (United States)

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; De Waele, Kathleen; De Schepper, Jean; François, Inge; Menten, Björn; Heath, Karen E; Gómez-Skarmeta, José Luis; De Baere, Elfride

    2015-12-03

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements.

  11. Natural genetic variation impacts expression levels of coding, non-coding, and antisense transcripts in fission yeast

    DEFF Research Database (Denmark)

    Clément-Ziza, Mathieu; Marsellach, Francesc X.; Codlin, Sandra

    2014-01-01

    the first recombinant strain library for fission yeast and conducted an RNA-seq-based QTL study of the coding, non-coding, and antisense transcriptomes. We show that the frequency of distal effects (trans-eQTLs) greatly exceeds the number of local effects (cis-eQTLs) and that non-coding RNAs are as likely......Our current understanding of how natural genetic variation affects gene expression beyond well-annotated coding genes is still limited. The use of deep sequencing technologies for the study of expression quantitative trait loci (eQTLs) has the potential to close this gap. Here, we generated...... to be affected by eQTLs as protein-coding RNAs. We identified a genetic variation of swc5 that modifies the levels of 871 RNAs, with effects on both sense and antisense transcription, and show that this effect most likely goes through a compromised deposition of the histone variant H2A.Z. The strains, methods...

  12. Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis.

    Directory of Open Access Journals (Sweden)

    Valentina Tosetti

    Full Text Available The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA Sox2 overlapping transcript (Sox2OT plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE, and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.

  13. Long non-coding RNAs and enhancer RNAs regulate the lipopolysaccharide-induced inflammatory response in human monocytes.

    Science.gov (United States)

    IIott, Nicholas E; Heward, James A; Roux, Benoit; Tsitsiou, Eleni; Fenwick, Peter S; Lenzi, Luca; Goodhead, Ian; Hertz-Fowler, Christiane; Heger, Andreas; Hall, Neil; Donnelly, Louise E; Sims, David; Lindsay, Mark A

    2014-06-09

    Early reports indicate that long non-coding RNAs (lncRNAs) are novel regulators of biological responses. However, their role in the human innate immune response, which provides the initial defence against infection, is largely unexplored. To address this issue, here we characterize the long non-coding RNA transcriptome in primary human monocytes using RNA sequencing. We identify 76 enhancer RNAs (eRNAs), 40 canonical lncRNAs, 65 antisense lncRNAs and 35 regions of bidirectional transcription (RBT) that are differentially expressed in response to bacterial lipopolysaccharide (LPS). Crucially, we demonstrate that knockdown of nuclear-localized, NF-κB-regulated, eRNAs (IL1β-eRNA) and RBT (IL1β-RBT46) surrounding the IL1β locus, attenuates LPS-induced messenger RNA transcription and release of the proinflammatory mediators, IL1β and CXCL8. We predict that lncRNAs can be important regulators of the human innate immune response.

  14. Recent advances in the involvement of long non-coding RNAs in neural stem cell biology and brain pathophysiology

    Directory of Open Access Journals (Sweden)

    Daphne eAntoniou

    2014-04-01

    Full Text Available Exploration of non-coding genome has recently uncovered a growing list of formerly unknown regulatory long non-coding RNAs (lncRNAs with important functions in stem cell pluripotency, development and homeostasis of several tissues. Although thousands of lncRNAs are expressed in mammalian brain in a highly patterned manner, their roles in brain development have just begun to emerge. Recent data suggest key roles for these molecules in gene regulatory networks controlling neuronal and glial cell differentiation. Analysis of the genomic distribution of genes encoding for lncRNAs indicates a physical association of these regulatory RNAs with transcription factors (TFs with well-established roles in neural differentiation, suggesting that lncRNAs and TFs may form coherent regulatory networks with important functions in neural stem cells (NSCs. Additionally, many studies show that lncRNAs are involved in the pathophysiology of brain-related diseases/disorders. Here we discuss these observations and investigate the links between lncRNAs, brain development and brain-related diseases. Understanding the functions of lncRNAs in NSCs and brain organogenesis could revolutionize the basic principles of developmental biology and neuroscience.

  15. De novo ORFs in Drosophila are important to organismal fitness and evolved rapidly from previously non-coding sequences.

    Directory of Open Access Journals (Sweden)

    Josephine A Reinhardt

    Full Text Available How non-coding DNA gives rise to new protein-coding genes (de novo genes is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs, while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important.

  16. Up-regulation of Long Non-coding RNA TUG1 in Hibernating Thirteen-lined Ground Squirrels

    Directory of Open Access Journals (Sweden)

    Jacques J. Frigault

    2016-04-01

    Full Text Available Mammalian hibernation is associated with multiple physiological, biochemical, and molecular changes that allow animals to endure colder temperatures. We hypothesize that long non-coding RNAs (lncRNAs, a group of non-coding transcripts with diverse functions, are differentially expressed during hibernation. In this study, expression levels of lncRNAs H19 and TUG1 were assessed via qRT-PCR in liver, heart, and skeletal muscle tissues of the hibernating thirteen-lined ground squirrels (Ictidomys tridecemlineatus. TUG1 transcript levels were significantly elevated 1.94-fold in skeletal muscle of hibernating animals when compared with euthermic animals. Furthermore, transcript levels of HSF2 also increased 2.44-fold in the skeletal muscle in hibernating animals. HSF2 encodes a transcription factor that can be negatively regulated by TUG1 levels and that influences heat shock protein expression. Thus, these observations support the differential expression of the TUG1–HSF2 axis during hibernation. To our knowledge, this study provides the first evidence for differential expression of lncRNAs in torpid ground squirrels, adding lncRNAs as another group of transcripts modulated in this mammalian species during hibernation.

  17. Up-regulation of Long Non-coding RNA TUG1 in Hibernating Thirteen-lined Ground Squirrels.

    Science.gov (United States)

    Frigault, Jacques J; Lang-Ouellette, Daneck; Morin, Pier

    2016-04-01

    Mammalian hibernation is associated with multiple physiological, biochemical, and molecular changes that allow animals to endure colder temperatures. We hypothesize that long non-coding RNAs (lncRNAs), a group of non-coding transcripts with diverse functions, are differentially expressed during hibernation. In this study, expression levels of lncRNAsH19 and TUG1 were assessed via qRT-PCR in liver, heart, and skeletal muscle tissues of the hibernating thirteen-lined ground squirrels (Ictidomys tridecemlineatus). TUG1 transcript levels were significantly elevated 1.94-fold in skeletal muscle of hibernating animals when compared with euthermic animals. Furthermore, transcript levels of HSF2 also increased 2.44-fold in the skeletal muscle in hibernating animals. HSF2 encodes a transcription factor that can be negatively regulated by TUG1 levels and that influences heat shock protein expression. Thus, these observations support the differential expression of the TUG1-HSF2 axis during hibernation. To our knowledge, this study provides the first evidence for differential expression of lncRNAs in torpid ground squirrels, adding lncRNAs as another group of transcripts modulated in this mammalian species during hibernation. Copyright © 2016 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  18. Evaluation of Long Stress-Induced Non-coding Transcripts 5 Polymorphism in Iranian Patients with Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Mahla Nazari

    2016-07-01

    Full Text Available Background: Bladder cancer (BC is the most commonly diagnosed genitourinary cancer in Iran, presented in both men and women. BC is a multifactorial trait resulting from the complex interaction between several genes and environmental factors. Long stress-induced non-coding transcript 5 (LSINCT5, a member of the long non-coding RNAs, is abundantly expressed in high proliferative cells, as well as the cells vulnerable to cellular stress in response to chemical carcinogens. This case-control study aimed to determine any association between LSINCT5 rs2962586 polymorphism and bladder cancer. Materials and Methods: A group of 150 patients with BC were compared with 143 subjects as a control group. Genotyping of the rs2962586 polymorphism was done using tetra- primer amplification refractory mutation system-polymerase chain reaction (T-ARMS PCR method. Results: Genotype and allele distribution were not significantly different between the case and control groups. Smoking was found to be the confounding risk factor for bladder cancer. Conclusion: Considering the result of our analyses, it seems that LSINCT5 could not affect individual susceptibility to BC among Iranian patients, however, it can be considered as a disease predictor among smokers.

  19. A Novel Long Non-coding RNA, durga Modulates Dendrite Density and Expression of kalirin in Zebrafish

    Science.gov (United States)

    Sarangdhar, Mayuresh A.; Chaubey, Divya; Bhatt, Abhishek; KM, Monisha; Kumar, Manish; Ranjan, Shashi; Pillai, Beena

    2017-01-01

    Kalirin, a key player in axonal development, nerve growth and synaptic re-modeling, is implicated in many pathological conditions like schizophrenia and autism-spectrum disorders. Alternative promoters and splicing lead to functionally distinct isoforms, but the post-transcriptional regulation of Kalirin has not been studied. Here, we report a novel non-coding RNA, which we name durga, arising from the first exon of kalirin a (kalrna) in the antisense orientation in zebrafish. The kalrna and durga transcripts are barely detectable during early development, but steadily increase by 24 hours post-fertilization (hpf) as the brain develops. Over-expression of durga in the zebrafish embryo led to an increase in kalrna expression. The morphology of the neurons cultured from durga injected embryos had significantly fewer and shorter dendrites. Although durga has no apparent sequence homolog in mammals, based on gene synteny, we found a non-coding RNA arising from the 5′ end of the human Kalrn gene and expressed in the human neuronal cell line, SH-SY5Y. We propose that the zebrafish lncRNA durga maintains dendritic length and density through regulation of kalrna expression and this may have further implications in mammalian systems. PMID:28442991

  20. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    Science.gov (United States)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-03-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  1. Intergenic and repeat transcription in human, chimpanzee and macaque brains measured by RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Augix Guohua Xu

    Full Text Available Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20-28% of non-ribosomal transcripts correspond to annotated exons and 20-23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40-48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20% represents 3'UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits.

  2. Associating disease-related genetic variants in intergenic regions to the genes they impact

    Directory of Open Access Journals (Sweden)

    Geoff Macintyre

    2014-10-01

    Full Text Available We present a method to assist in interpretation of the functional impact of intergenic disease-associated SNPs that is not limited to search strategies proximal to the SNP. The method builds on two sources of external knowledge: the growing understanding of three-dimensional spatial relationships in the genome, and the substantial repository of information about relationships among genetic variants, genes, and diseases captured in the published biomedical literature. We integrate chromatin conformation capture data (HiC with literature support to rank putative target genes of intergenic disease-associated SNPs. We demonstrate that this hybrid method outperforms a genomic distance baseline on a small test set of expression quantitative trait loci, as well as either method individually. In addition, we show the potential for this method to uncover relationships between intergenic SNPs and target genes across chromosomes. With more extensive chromatin conformation capture data becoming readily available, this method provides a way forward towards functional interpretation of SNPs in the context of the three dimensional structure of the genome in the nucleus.

  3. Complex organisation and structure of the ghrelin antisense strand gene GHRLOS, a candidate non-coding RNA gene

    Directory of Open Access Journals (Sweden)

    Herington Adrian C

    2008-10-01

    Full Text Available Abstract Background The peptide hormone ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH release, appetite regulation, gut motility and proliferation of cancer cells. We previously identified a gene on the opposite strand of the ghrelin gene, ghrelinOS (GHRLOS, which spans the promoter and untranslated regions of the ghrelin gene (GHRL. Here we further characterise GHRLOS. Results We have described GHRLOS mRNA isoforms that extend over 1.4 kb of the promoter region and 106 nucleotides of exon 4 of the ghrelin gene, GHRL. These GHRLOS transcripts initiate 4.8 kb downstream of the terminal exon 4 of GHRL and are present in the 3' untranslated exon of the adjacent gene TATDN2 (TatD DNase domain containing 2. Interestingly, we have also identified a putative non-coding TATDN2-GHRLOS chimaeric transcript, indicating that GHRLOS RNA biogenesis is extremely complex. Moreover, we have discovered that the 3' region of GHRLOS is also antisense, in a tail-to-tail fashion to a novel terminal exon of the neighbouring SEC13 gene, which is important in protein transport. Sequence analyses revealed that GHRLOS is riddled with stop codons, and that there is little nucleotide and amino-acid sequence conservation of the GHRLOS gene between vertebrates. The gene spans 44 kb on 3p25.3, is extensively spliced and harbours multiple variable exons. We have also investigated the expression of GHRLOS and found evidence of differential tissue expression. It is highly expressed in tissues which are emerging as major sites of non-coding RNA expression (the thymus, brain, and testis, as well as in the ovary and uterus. In contrast, very low levels were found in the stomach where sense, GHRL derived RNAs are highly expressed. Conclusion GHRLOS RNA transcripts display several distinctive features of non-coding (ncRNA genes, including 5' capping, polyadenylation, extensive splicing and short open reading

  4. Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli

    DEFF Research Database (Denmark)

    Boysen, Anders; Møller-Jensen, Jakob; Kallipolitis, Birgitte H.

    2010-01-01

    of at least one sRNA regulator. Here, we extend this view by the identification and characterization of a highly conserved, anaerobically induced small sRNA in E. coli, whose expression is strictly dependent on the anaerobic transcriptional fumarate and nitrate reductase regulator (FNR). The sRNA, named Fnr......Small non-coding RNAs (sRNA) have emerged as important elements of gene regulatory circuits. In enterobacteria such as Escherichia coli and Salmonella many of these sRNAs interact with the Hfq protein, an RNA chaperone similar to mammalian Sm-like proteins and act in the post....... Furthermore, in previous work most of the potential target genes have been shown to be repressed by FNR through an undetermined mechanism. Collectively, our results provide insight into the mechanism by which FNR negatively regulates genes such as sodA, sodB, cydDC, and metE, thereby demonstrating...

  5. Evaluation of fluorescence in situ hybridization techniques to study long non-coding RNA expression in cultured cells

    DEFF Research Database (Denmark)

    Soares, Ricardo J; Maglieri, Giulia; Gutschner, Tony

    2018-01-01

    approach with or without enzymatic signal amplification, a branched-DNA (bDNA) probe and an LNA-modified probe with enzymatic signal amplification. All four methods adequately stained MALAT1 in the nucleus in all of three cell lines investigated, HeLa, NHDF and T47D, and three of the methods detected......Deciphering the functions of long non-coding RNAs (lncRNAs) is facilitated by visualization of their subcellular localization using in situ hybridization (ISH) techniques. We evaluated four different ISH methods for detection of MALAT1 and CYTOR in cultured cells: a multiple probe detection...... the less expressed CYTOR. The sensitivity of the four ISH methods was evaluated by image analysis. In all three cell lines, the two methods involving enzymatic amplification gave the most intense MALAT1 signal, but the signal-to-background ratios were not different. CYTOR was best detected using the b...

  6. A Tumor Surveillance Model: A Non-Coding RNA Senses Neoplastic Cells and Its Protein Partner Signals Cell Death

    Directory of Open Access Journals (Sweden)

    Yong Sun Lee

    2012-10-01

    Full Text Available nc886 (= pre-miR-886 or vtRNA2-1 is a non-coding RNA that has been recently identified as a natural repressor for the activity of PKR (Protein Kinase R. The suppression of nc886 activates PKR and thereby provokes a cell death pathway. When combined with the fact that nc886 is suppressed in a wide range of cancer cells, the nc886-PKR relationship suggests a tumor surveillance model. When neoplastic cells develop and nc886 decreases therein, PKR is released from nc886 and becomes the active phosphorylated form, which initiates an apoptotic cascade to eliminate those cells. The nc886-PKR pathway is distinct from conventional mechanisms, such as the immune surveillance hypothesis or intrinsic mechanisms that check/proofread the genomic integrity, and thus represents a novel example of tumor surveillance.

  7. Long Non-Coding RNAs in Hepatitis B Virus-Related Hepatocellular Carcinoma: Regulation, Functions, and Underlying Mechanisms

    Directory of Open Access Journals (Sweden)

    Lipeng Qiu

    2017-11-01

    Full Text Available Hepatocellular carcinoma (HCC is the fifth most common cancer and the third leading cause of cancer death in the world. Hepatitis B virus (HBV and its X gene-encoded protein (HBx play important roles in the progression of HCC. Although long non-coding RNAs (lncRNAs cannot encode proteins, growing evidence indicates that they play essential roles in HCC progression, and contribute to cell proliferation, invasion and metastasis, autophagy, and apoptosis by targeting a large number of pivotal protein-coding genes, miRNAs, and signaling pathways. In this review, we briefly outline recent findings of differentially expressed lncRNAs in HBV-related HCC, with particular focus on several key lncRNAs, and discuss their regulation by HBV/HBx, their functions, and their underlying molecular mechanisms in the progression of HCC.

  8. Small non-coding RNAs: new insights in modulation of host immune response by intracellular bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Waqas Ahmed

    2016-10-01

    Full Text Available Pathogenic bacteria possess intricate regulatory networks that temporally control the production of virulence factors, and enable the bacteria to survive and proliferate within host cell. Small non-coding RNAs (sRNAs have been identified as important regulators of gene expression in diverse biological contexts. Recent research has shown bacterial sRNAs involved in growth and development, cell proliferation, differentiation, metabolism, cell signaling and immune response through regulating protein–protein interactions or via their ability to base pair with RNA and DNA. In this review, we provide a brief overview of mechanism of action employed by immune-related sRNAs, their known functions in immunity, and how they can be integrated into regulatory circuits that govern virulence, which will facilitates to understand pathogenesis and the development of novel, more effective therapeutic approaches to treat infections caused by intracellular bacterial pathogens.

  9. Over Expression of Long Non-Coding RNA PANDA Promotes Hepatocellular Carcinoma by Inhibiting Senescence Associated Inflammatory Factor IL8.

    Science.gov (United States)

    Peng, Chuanhui; Hu, Wendi; Weng, Xiaoyu; Tong, Rongliang; Cheng, Shaobing; Ding, Chaofeng; Xiao, Heng; Lv, Zhen; Xie, Haiyang; Zhou, Lin; Wu, Jian; Zheng, Shusen

    2017-06-23

    It has been reported that long non-coding RNA PANDA was disregulated in varieties types of tumor, but its expression level and biological role in hepatocellular carcinoma (HCC) remains contradictory. We detected PANDA expression in two independent cohorts (48 HCC patients following liver transplantation and 84 HCC patients following liver resection), and found that PANDA was down-regulated in HCC. Thereafter we explored its function in cancer biology by inversing its low expression. Surprisingly, overexpression of PANDA promoted HCC proliferation and carcinogenesis in vitro and in vivo. Mechanistically, PANDA repressed transcriptional activity of senescence associated inflammatory factor IL8, which leaded to inhibition of cellular senescence. Therefore, our research help to better understand the complex role of PANDA in HCC, and suggest more thoughtful strategies should be applied before it can be treated as a potential therapeutic target.

  10. Targeting non-coding RNAs in Plants with the CRISPR-Cas technology is a challenge yet worth accepting

    Directory of Open Access Journals (Sweden)

    Jolly eBasak

    2015-11-01

    Full Text Available Non-coding RNAs (ncRNAs have emerged as versatile master regulator of biological functions in recent years. MicroRNAs (miRNAs are small endogenous ncRNAs of 18-24 nucleotides in length that originates from long self-complementary precursors. Besides their direct involvement in developmental processes, plant miRNAs play key roles in gene regulatory networks and varied biological processes. Alternatively, long ncRNAs (lncRNAs are a large and diverse class of transcribed ncRNAs whose length exceed that of 200 nucleotides. Plant lncRNAs are transcribed by different RNA polymerases, showing diverse structural features. Plant lncRNAs also are important regulators of gene expression in diverse biological processes. There has been a breakthrough in the technology of genome editing, the CRISPR-Cas9 (clustered regulatory interspaced short palindromic repeats/CRISPR-associated protein 9 technology, in the last decade. CRISPR loci are transcribed into ncRNA and eventually form a functional complex with Cas9 and further guide the complex to cleave complementary invading DNA. The CRISPR-Cas technology has been successfully applied in model plants such as Arabidopsis and tobacco and important crops like wheat, maize and rice. However, all these studies are focused on protein coding genes. Information about targeting non-coding genes is scarce. Hitherto, the CRISPR-Cas technology has been exclusively used in vertebrate systems to engineer miRNA/lncRNAs, but it is still relatively unexplored in plants. While briefing miRNAs, lncRNAs and applications of the CRISPR-Cas technology in human and animals, this review essentially elaborates several strategies to overcome the challenges of applying the CRISPR-Cas technology in editing ncRNAs in plants and the future perspective of this field.

  11. Altered expression of long non-coding RNAs during genotoxic stress-induced cell death in human glioma cells.

    Science.gov (United States)

    Liu, Qian; Sun, Shanquan; Yu, Wei; Jiang, Jin; Zhuo, Fei; Qiu, Guoping; Xu, Shiye; Jiang, Xuli

    2015-04-01

    Long non-coding RNAs (lncRNAs), a recently discovered class of non-coding genes, are transcribed throughout the genome. Emerging evidence suggests that lncRNAs may be involved in modulating various aspects of tumor biology, including regulating gene activity in response to external stimuli or DNA damage. No data are available regarding the expression of lncRNAs during genotoxic stress-induced apoptosis and/or necrosis in human glioma cells. In this study, we detected a change in the expression of specific candidate lncRNAs (neat1, GAS5, TUG1, BC200, Malat1, MEG3, MIR155HG, PAR5, and ST7OT1) during DNA damage-induced apoptosis in human glioma cell lines (U251 and U87) using doxorubicin (DOX) and resveratrol (RES). We also detected the expression pattern of these lncRNAs in human glioma cell lines under necrosis induced using an increased dose of DOX. Our results reveal that the lncRNA expression patterns are distinct between genotoxic stress-induced apoptosis and necrosis in human glioma cells. The sets of lncRNA expressed during genotoxic stress-induced apoptosis were DNA-damaging agent-specific. Generally, MEG3 and ST7OT1 are up-regulated in both cell lines under apoptosis induced using both agents. The induction of GAS5 is only clearly detected during DOX-induced apoptosis, whereas the up-regulation of neat1 and MIR155HG is only found during RES-induced apoptosis in both cell lines. However, TUG1, BC200 and MIR155HG are down regulated when necrosis is induced using a high dose of DOX in both cell lines. In conclusion, our findings suggest that the distinct regulation of lncRNAs may possibly involve in the process of cellular defense against genotoxic agents.

  12. PARN and TOE1 Constitute a 3′ End Maturation Module for Nuclear Non-coding RNAs

    Directory of Open Access Journals (Sweden)

    Ahyeon Son

    2018-04-01

    Full Text Available Summary: Poly(A-specific ribonuclease (PARN and target of EGR1 protein 1 (TOE1 are nuclear granule-associated deadenylases, whose mutations are linked to multiple human diseases. Here, we applied mTAIL-seq and RNA sequencing (RNA-seq to systematically identify the substrates of PARN and TOE1 and elucidate their molecular functions. We found that PARN and TOE1 do not modulate the length of mRNA poly(A tails. Rather, they promote the maturation of nuclear small non-coding RNAs (ncRNAs. PARN and TOE1 act redundantly on some ncRNAs, most prominently small Cajal body-specific RNAs (scaRNAs. scaRNAs are strongly downregulated when PARN and TOE1 are compromised together, leading to defects in small nuclear RNA (snRNA pseudouridylation. They also function redundantly in the biogenesis of telomerase RNA component (TERC, which shares sequence motifs found in H/ACA box scaRNAs. Our findings extend the knowledge of nuclear ncRNA biogenesis, and they provide insights into the pathology of PARN/TOE1-associated genetic disorders whose therapeutic treatments are currently unavailable. : By analyzing the 3′ termini of transcriptome, Son et al. reveal the targets of PARN and TOE1, two nuclear deadenylases with disease associations. Both deadenylases are involved in nuclear small non-coding RNA maturation, but not in mRNA deadenylation. Their combined activity is particularly important for biogenesis of scaRNAs and TERC. Keywords: PARN, TOE1, CAF1Z, deadenylase, 3′ end maturation, adenylation, deadenylation, scaRNA, TERC

  13. Low DNA Sequence Diversity of the Intergenic Spacer 1 Region in the Human Skin Commensal Fungi Malassezia sympodialis and M. dermatis Isolated from Patients with Malassezia-Associated Skin Diseases and Healthy Subjects.

    Science.gov (United States)

    Cho, Otomi; Sugita, Takashi

    2016-12-01

    As DNA sequences of the intergenic spacer (IGS) region in the rRNA gene show remarkable intraspecies diversity compared with the small subunit, large subunit, and internal transcribed spacer region, the IGS region has been used as an epidemiological tool in studies on Malassezia globosa and M. restricta, which are responsible for the exacerbation of atopic dermatitis (AD) and seborrheic dermatitis (SD). However, the IGS regions of M. sympodialis and M. dermatis obtained from the skin of patients with AD and SD, as well as healthy subjects, lacked sequence diversity. Of the 105 M. sympodialis strains and the 40 M. dermatis strains, the sequences of 103 (98.1 %) and 39 (97.5 %), respectively, were identical. Thus, given the lack of intraspecies diversity in the IGS regions of M. sympodialis and M. dermatis, studies of the diversity of these species should be performed using appropriate genes and not the IGS.

  14. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    Science.gov (United States)

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  15. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  16. A systematic search for new mammalian noncoding RNAs indicates little conserved intergenic transcription

    Directory of Open Access Journals (Sweden)

    Blencowe Benjamin J

    2005-08-01

    Full Text Available Abstract Background Systematic identification and functional characterization of novel types of noncoding (ncRNA in genomes is more difficult than it is for protein coding mRNAs, since ncRNAs typically do not possess sequence features such as splicing or translation signals, or long open reading frames. Recent "tiling" microarray studies have reported that a surprisingly larger proportion of mammalian genomes is transcribed than was previously anticipated. However, these non-genic transcripts often appear to be low in abundance, and their functional significance is not known. Results To systematically search for functional ncRNAs, we designed microarrays to detect 3,478 intergenic and intronic sequences that are conserved between the human, mouse, and rat genomes, and that score highly by other criteria that characterize ncRNAs. We probed these arrays with total RNA isolated from 16 wild-type mouse tissues. Among 55 candidates for highly-expressed novel ncRNAs tested by northern blotting, eight were confirmed as small, highly-and ubiquitously-expressed RNAs in mouse. Of the eight, five were also detected in rat tissues, but none were detected at appreciable levels in human tissues or cultured cells. Conclusion Since the sequence and expression of most known coding transcripts and functional ncRNAs is conserved between human and mouse, the lack of northern-detectable expression in human cells and tissues of the novel mouse and rat ncRNAs that we identified suggests that they are not functional or possibly have rodent-specific functions. Our results confirm that relatively little of the intergenic sequence conserved between human, mouse and rat is transcribed at high levels in mammalian tissues, possibly suggesting a limited role for transcribed intergenic and intronic sequences as independent functional elements.

  17. Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression.

    Science.gov (United States)

    Qu, C-H; Sun, Q-Y; Zhang, F-M; Jia, Y-M

    2017-09-01

    The aim of the present study was to determine the expression levels of long intergenic non-protein coding RNA, regulator of reprogramming (linc-ROR) in non-small-cell lung cancer (NSCLC) patients and to further explore the prognostic value of this lncRNA. In our investigation, we determined the expression of linc-ROR in human NSCLC tissues and matched normal lung tissues by quantitative Real-time-PCR analysis. Also, correlations between linc-ROR expression and the clinicopathological features were evaluated. Survival curves were plotted using the Kaplan-Meier method and differences in survival rates were analyzed using the log-rank test. Cox regression analyses were performed to explore the effect of linc-ROR as an independent predictor of survival. We found that linc-ROR had high expression in NSCLC specimens than that in matched adjacent normal lung tissues (p ROR expression levels were positively correlated with advanced TNM stage (p = 0.007), positive distant metastasis (p = 0.001) and LN metastasis (p = 0.011). Furthermore, significantly shorter 5-year overall survival (OS) and disease-free survival (DFS) were observed in patients with higher expression of linc-ROR (both p ROR expression was an independent prognostic factor for both 5-years OS (p = 0.001) and 5-year DFS (p = 0.001) in NSCLC. Our findings indicate that linc-ROR plays an oncogenic role in NSCLC development and may function as a prognostic and predictive biomarker for NSCLC.

  18. Transcriptional regulation of an evolutionary conserved intergenic region of CDT2-INTS7.

    Directory of Open Access Journals (Sweden)

    Hiroki Nakagawa

    2008-01-01

    Full Text Available In the mammalian genome, a substantial number of gene pairs (approximately 10% are arranged head-to-head on opposite strands within 1,000 base pairs, and separated by a bidirectional promoter(s that generally drives the co-expression of both genes and results in functional coupling. The significance of unique genomic configuration remains elusive.Here we report on the identification of an intergenic region of non-homologous genes, CDT2, a regulator of DNA replication, and an integrator complex subunit 7 (INTS7, an interactor of the largest subunit of RNA polymerase II. The CDT2-INTS7 intergenic region is 246 and 245 base pairs long in human and mouse respectively and is evolutionary well-conserved among several mammalian species. By measuring the luciferase activity in A549 cells, the intergenic human sequence was shown to be able to drive the reporter gene expression in either direction and notably, among transcription factors E2F, E2F1 approximately E2F4, but not E2F5 and E2F6, this sequence clearly up-regulated the reporter gene expression exclusively in the direction of the CDT2 gene. In contrast, B-Myb, c-Myb, and p53 down-regulated the reporter gene expression in the transcriptional direction of the INTS7 gene. Overexpression of E2F1 by adenoviral-mediated gene transfer resulted in an increased CDT2, but not INTS7, mRNA level. Real-time polymerase transcription (RT-PCR analyses of the expression pattern for CDT2 and INTS7 mRNA in human adult and fetal tissues and cell lines revealed that transcription of these two genes are asymmetrically regulated. Moreover, the abundance of mRNA between mouse and rat tissues was similar, but these patterns were quite different from the results obtained from human tissues.These findings add a unique example and help to understand the mechanistic insights into the regulation of gene expression through an evolutionary conserved intergenic region of the mammalian genome.

  19. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Directory of Open Access Journals (Sweden)

    Ai-bing Zhang

    Full Text Available Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish and two representing non-coding ITS barcodes (rust fungi and brown algae. Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ and Maximum likelihood (ML methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40% for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37% for 1094 brown algae queries, both using ITS barcodes.

  20. Exploration of small RNA-seq data for small non-coding RNAs in Human Colorectal Cancer.

    Science.gov (United States)

    Koduru, Srinivas V; Tiwari, Amit K; Hazard, Sprague W; Mahajan, Milind; Ravnic, Dino J

    2017-01-01

    Background: Improved healthcare and recent breakthroughs in technology have substantially reduced cancer mortality rates worldwide. Recent advancements in next-generation sequencing (NGS) have allowed genomic analysis of the human transcriptome. Now, using NGS we can further look into small non-coding regions of RNAs (sncRNAs) such as microRNAs (miRNAs), Piwi-interacting-RNAs (piRNAs), long non-coding RNAs (lncRNAs), and small nuclear/nucleolar RNAs (sn/snoRNAs) among others. Recent studies looking at sncRNAs indicate their role in important biological processes such as cancer progression and predict their role as biomarkers for disease diagnosis, prognosis, and therapy. Results: In the present study, we data mined publically available small RNA sequencing data from colorectal tissue samples of eight matched patients (benign, tumor, and metastasis) and remapped the data for various small RNA annotations. We identified aberrant expression of 13 miRNAs in tumor and metastasis specimens [tumor vs benign group (19 miRNAs) and metastasis vs benign group (38 miRNAs)] of which five were upregulated, and eight were downregulated, during disease progression. Pathway analysis of aberrantly expressed miRNAs showed that the majority of miRNAs involved in colon cancer were also involved in other cancers. Analysis of piRNAs revealed six to be over-expressed in the tumor vs benign cohort and 24 in the metastasis vs benign group. Only two piRNAs were shared between the two cohorts. Examining other types of small RNAs [sn/snoRNAs, mt_rRNA, miscRNA, nonsense mediated decay (NMD), and rRNAs] identified 15 sncRNAs in the tumor vs benign group and 104 in the metastasis vs benign group, with only four others being commonly expressed. Conclusion: In summary, our comprehensive analysis on publicly available small RNA-seq data identified multiple differentially expressed sncRNAs during colorectal cancer progression at different stages compared to normal colon tissue. We speculate that

  1. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Directory of Open Access Journals (Sweden)

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  2. Long non-coding RNA MVIH is associated with poor prognosis and malignant biological behavior in breast cancer.

    Science.gov (United States)

    Lei, Bo; Xu, Shou-Ping; Liang, Xiao-Shuan; Li, Yi-Wen; Zhang, Jin-Feng; Zhang, Guo-Qiang; Pang, Da

    2016-04-01

    In recent years, with the development of transcriptomics, the effect of long non-coding RNAs (LncRNAs) on the regulation of biological processes is being elucidated. LncRNAs play an important role in tumor occurrence and development. LncRNA associated with microvascular invasion in hepatocellular carcinoma (LncRNA MVIH) was first identified in hepatocellular carcinoma and is associated with angiogenesis, tumor growth and metastasis upregulation, and poor recurrence-free survival. MVIH has an important role in non-small cell lung cancer, in which it promotes cell proliferation and metastasis, and high MVIH expression indicates poor overall survival. However, the involvement of MVIH in breast cancer is unclear. Our research revealed that the expression levels of MVIH in breast cancer tissues were higher than in adjacent noncancerous tissues, and high MVIH expression was correlated with Ki67 expression. Moreover, breast cancer patients with high MVIH expression levels showed poor overall survival and disease-free survival. Multivariate analysis results indicated that MVIH was an independent prognostic factor in breast cancer. In addition, upregulated MVIH expression levels promoted cell proliferation and cell cycle, and inhibited cell apoptosis, while reduced MVIH expression showed the converse. In summary, our findings suggest that MVIH may have an important role in breast cancer and may serve as a new biomarker and a potential therapeutic target.

  3. Hypothalamic transcriptomes of 99 mouse strains reveal trans eQTL hotspots, splicing QTLs and novel non-coding genes

    Energy Technology Data Exchange (ETDEWEB)

    Hasin-Brumshtein, Yehudit; Khan, Arshad H.; Hormozdiari, Farhad; Pan, Calvin; Parks, Brian W.; Petyuk, Vladislav A.; Piehowski, Paul D.; Brümmer, Anneke; Pellegrini, Matteo; Xiao, Xinshu; Eskin, Eleazar; Smith, Richard D.; Lusis, Aldons J.; Smith, Desmond J.

    2016-09-13

    Previous studies had shown that the integration of genome wide expression profiles, in metabolic tissues, with genetic and phenotypic variance, provided valuable insight into the underlying molecular mechanisms. We used RNA-Seq to characterize hypothalamic transcriptome in 99 inbred strains of mice from the Hybrid Mouse Diversity Panel (HMDP), a reference resource population for cardiovascular and metabolic traits. We report numerous novel transcripts supported by proteomic analyses, as well as novel non coding RNAs. High resolution genetic mapping of transcript levels in HMDP, reveals bothlocalandtransexpression Quantitative Trait Loci (eQTLs) demonstrating 2transeQTL 'hotspots' associated with expression of hundreds of genes. We also report thousands of alternative splicing events regulated by genetic variants. Finally, comparison with about 150 metabolic and cardiovascular traits revealed many highly significant associations. Our data provide a rich resource for understanding the many physiologic functions mediated by the hypothalamus and their genetic regulation.

  4. Mutations of conserved non-coding elements of PITX2 in patients with ocular dysgenesis and developmental glaucoma.

    Science.gov (United States)

    Protas, Meredith E; Weh, Eric; Footz, Tim; Kasberger, Jay; Baraban, Scott C; Levin, Alex V; Katz, L Jay; Ritch, Robert; Walter, Michael A; Semina, Elena V; Gould, Douglas B

    2017-09-15

    Mutations in FOXC1 and PITX2 constitute the most common causes of ocular anterior segment dysgenesis (ASD), and confer a high risk for secondary glaucoma. The genetic causes underlying ASD in approximately half of patients remain unknown, despite many of them being screened by whole exome sequencing. Here, we performed whole genome sequencing on DNA from two affected individuals from a family with dominantly inherited ASD and glaucoma to identify a 748-kb deletion in a gene desert that contains conserved putative PITX2 regulatory elements. We used CRISPR/Cas9 to delete the orthologous region in zebrafish in order to test the pathogenicity of this structural variant. Deletion in zebrafish reduced pitx2 expression during development and resulted in shallow anterior chambers. We screened additional patients for copy number variation of the putative regulatory elements and found an overlapping deletion in a second family and in a potentially-ancestrally-related index patient with ASD and glaucoma. These data suggest that mutations affecting conserved non-coding elements of PITX2 may constitute an important class of mutations in patients with ASD for whom the molecular cause of their disease have not yet been identified. Improved functional annotation of the human genome and transition to sequencing of patient genomes instead of exomes will be required before the magnitude of this class of mutations is fully understood. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. A Bipartite Network-based Method for Prediction of Long Non-coding RNA–protein Interactions

    Directory of Open Access Journals (Sweden)

    Mengqu Ge

    2016-02-01

    Full Text Available As one large class of non-coding RNAs (ncRNAs, long ncRNAs (lncRNAs have gained considerable attention in recent years. Mutations and dysfunction of lncRNAs have been implicated in human disorders. Many lncRNAs exert their effects through interactions with the corresponding RNA-binding proteins. Several computational approaches have been developed, but only few are able to perform the prediction of these interactions from a network-based point of view. Here, we introduce a computational method named lncRNA–protein bipartite network inference (LPBNI. LPBNI aims to identify potential lncRNA–interacting proteins, by making full use of the known lncRNA–protein interactions. Leave-one-out cross validation (LOOCV test shows that LPBNI significantly outperforms other network-based methods, including random walk (RWR and protein-based collaborative filtering (ProCF. Furthermore, a case study was performed to demonstrate the performance of LPBNI using real data in predicting potential lncRNA–interacting proteins.

  6. Long non-coding RNA HOTTIP is able to predict poor prognosis in various neoplasms: A meta-analysis.

    Science.gov (United States)

    Jin, Ning; Yang, Ling-Yun; Xu, Zi-Peng

    2017-08-01

    HOXA distal transcript antisense RNA (HOTTIP), a critical oncogenic long non-coding RNA, has been reported to be aberrantly regulated in various cancer types. The present meta-analysis aimed to investigate HOTTIP as a potential clinical applicable prognostic biomarker in malignant neoplasms. Literature collections were performed by searching the electronic databases, PubMed and Web of Science (up to July 20, 2016). All the relevant searches were conducted to identify the association of HOTTIP with the overall survival (OS) rate. A total of six articles consisting of 508 patients were included in the present meta-analysis. The results suggested that the overexpression of HOTTIP is closely correlated with poor OS (hazard ratio=2.28; 95% confidence interval=1.71-3.04; P=0.000). In conclusion, the present meta-analysis has demonstrated that an increased expression level of HOTTIP is correlated with poor OS in different types of cancer, suggesting that HOTTIP potentially serves as a reliable prognostic biomarker in different types of cancer.

  7. Expression of long non-coding RNAs in autoimmunity and linkage to enhancer function and autoimmune disease risk genetic variants.

    Science.gov (United States)

    Aune, T M; Crooke, P S; Patrick, A E; Tossberg, J T; Olsen, N J; Spurlock, C F

    2017-07-01

    Genome-wide association studies have identified numerous genetic variants conferring autoimmune disease risk. Most of these genetic variants lie outside protein-coding genes hampering mechanistic explorations. Numerous mRNAs are also differentially expressed in autoimmune disease but their regulation is also unclear. The majority of the human genome is transcribed yet its biologic significance is incompletely understood. We performed whole genome RNA-sequencing [RNA-seq] to categorize expression of mRNAs, known and novel long non-coding RNAs [lncRNAs] in leukocytes from subjects with autoimmune disease and identified annotated and novel lncRNAs differentially expressed across multiple disorders. We found that loci transcribing novel lncRNAs were not randomly distributed across the genome but co-localized with leukocyte transcriptional enhancers, especially super-enhancers, and near genetic variants associated with autoimmune disease risk. We propose that alterations in enhancer function, including lncRNA expression, produced by genetics and environment, change cellular phenotypes contributing to disease risk and pathogenesis and represent attractive therapeutic targets. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Fact or fiction: updates on how protein-coding genes might emergede novofrom previously non-coding DNA.

    Science.gov (United States)

    Schmitz, Jonathan F; Bornberg-Bauer, Erich

    2017-01-01

    Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo -emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes.

  9. Expression of Mitochondrial Non-coding RNAs (ncRNAs) Is Modulated by High Risk Human Papillomavirus (HPV) Oncogenes*

    Science.gov (United States)

    Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A.; Varas, Manuel; Villegas, Jaime; Villa, Luisa L.; Valenzuela, Pablo D. T.; Socías, Miguel; Roberts, Sally; Burzio, Luis O.

    2012-01-01

    The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis. PMID:22539350

  10. Expression of mitochondrial non-coding RNAs (ncRNAs) is modulated by high risk human papillomavirus (HPV) oncogenes.

    Science.gov (United States)

    Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A; Varas, Manuel; Villegas, Jaime; Villa, Luisa L; Valenzuela, Pablo D T; Socías, Miguel; Roberts, Sally; Burzio, Luis O

    2012-06-15

    The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis.

  11. Identification of long non-coding RNAs in two anthozoan species and their possible implications for coral bleaching.

    Science.gov (United States)

    Huang, Chen; Morlighem, Jean-Étienne R L; Cai, Jing; Liao, Qiwen; Perez, Carlos Daniel; Gomes, Paula Braga; Guo, Min; Rádis-Baptista, Gandhi; Lee, Simon Ming-Yuen

    2017-07-13

    Long non-coding RNAs (lncRNAs) have been shown to play regulatory roles in a diverse range of biological processes and are associated with the outcomes of various diseases. The majority of studies about lncRNAs focus on model organisms, with lessened investigation in non-model organisms to date. Herein, we have undertaken an investigation on lncRNA in two zoanthids (cnidarian): Protolpalythoa varibilis and Palythoa caribaeorum. A total of 11,206 and 13,240 lncRNAs were detected in P. variabilis and P. caribaeorum transcriptome, respectively. Comparison using NONCODE database indicated that the majority of these lncRNAs is taxonomically species-restricted with no identifiable orthologs. Even so, we found cases in which short regions of P. caribaeorum's lncRNAs were similar to vertebrate species' lncRNAs, and could be associated with lncRNA conserved regulatory functions. Consequently, some high-confidence lncRNA-mRNA interactions were predicted based on such conserved regions, therefore revealing possible involvement of lncRNAs in posttranscriptional processing and regulation in anthozoans. Moreover, investigation of differentially expressed lncRNAs, in healthy colonies and colonial individuals undergoing natural bleaching, indicated that some up-regulated lncRNAs in P. caribaeorum could posttranscriptionally regulate the mRNAs encoding proteins of Ras-mediated signal transduction pathway and components of innate immune-system, which could contribute to the molecular response of coral bleaching.

  12. Vesiculated Long Non-Coding RNAs: Offshore Packages Deciphering Trans-Regulation between Cells, Cancer Progression and Resistance to Therapies

    Directory of Open Access Journals (Sweden)

    Farah Fatima

    2017-02-01

    Full Text Available Extracellular vesicles (EVs are nanosized vesicles secreted from virtually all cell types and are thought to transport proteins, lipids and nucleic acids including non-coding RNAs (ncRNAs between cells. Since, ncRNAs are central to transcriptional regulation during developmental processes; eukaryotes might have evolved novel means of post-transcriptional regulation by trans-locating ncRNAs between cells. EV-mediated transportation of regulatory elements provides a novel source of trans-regulation between cells. In the last decade, studies were mainly focused on microRNAs; however, functions of long ncRNA (lncRNA have been much less studied. Here, we review the regulatory roles of EV-linked ncRNAs, placing a particular focus on lncRNAs, how they can foster dictated patterns of trans-regulation in recipient cells. This refers to envisaging novel mechanisms of epigenetic regulation, cellular reprogramming and genomic instability elicited in recipient cells, ultimately permitting the generation of cancer initiating cell phenotypes, senescence and resistance to chemotherapies. Conversely, such trans-regulation may introduce RNA interference in recipient cancer cells causing the suppression of oncogenes and anti-apoptotic proteins; thus favoring tumor inhibition. Collectively, understanding these mechanisms could be of great value to EV-based RNA therapeutics achieved through gene manipulation within cancer cells, whereas the ncRNA content of EVs from cancer patients could serve as non-invasive source of diagnostic biomarkers and prognostic indicators in response to therapies.

  13. lncRNA-screen: an interactive platform for computationally screening long non-coding RNAs in large genomics datasets.

    Science.gov (United States)

    Gong, Yixiao; Huang, Hsuan-Ting; Liang, Yu; Trimarchi, Thomas; Aifantis, Iannis; Tsirigos, Aristotelis

    2017-06-05

    Long non-coding RNAs (lncRNAs) have emerged as a class of factors that are important for regulating development and cancer. Computational prediction of lncRNAs from ultra-deep RNA sequencing has been successful in identifying candidate lncRNAs. However, the complexity of handling and integrating different types of genomics data poses significant challenges to experimental laboratories that lack extensive genomics expertise. To address this issue, we have developed lncRNA-screen, a comprehensive pipeline for computationally screening putative lncRNA transcripts over large multimodal datasets. The main objective of this work is to facilitate the computational discovery of lncRNA candidates to be further examined by functional experiments. lncRNA-screen provides a fully automated easy-to-run pipeline which performs data download, RNA-seq alignment, assembly, quality assessment, transcript filtration, novel lncRNA identification, coding potential estimation, expression level quantification, histone mark enrichment profile integration, differential expression analysis, annotation with other type of segmented data (CNVs, SNPs, Hi-C, etc.) and visualization. Importantly, lncRNA-screen generates an interactive report summarizing all interesting lncRNA features including genome browser snapshots and lncRNA-mRNA interactions based on Hi-C data. lncRNA-screen provides a comprehensive solution for lncRNA discovery and an intuitive interactive report for identifying promising lncRNA candidates. lncRNA-screen is available as open-source software on GitHub.

  14. C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation.

    Science.gov (United States)

    Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen

    2018-05-05

    Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.

  15. Impediment of Replication Forks by Long Non-coding RNA Provokes Chromosomal Rearrangements by Error-Prone Restart

    Directory of Open Access Journals (Sweden)

    Takaaki Watanabe

    2017-11-01

    Full Text Available Naturally stalled replication forks are considered to cause structurally abnormal chromosomes in tumor cells. However, underlying mechanisms remain speculative, as capturing naturally stalled forks has been a challenge. Here, we captured naturally stalled forks in tumor cells and delineated molecular processes underlying the structural evolution of circular mini-chromosomes (double-minute chromosomes; DMs. Replication forks stalled on the DM by the co-directional collision with the transcription machinery for long non-coding RNA. RPA, BRCA2, and DNA polymerase eta (Polη were recruited to the stalled forks. The recruitment of Polη was critical for replication to continue, as Polη knockdown resulted in DM loss. Rescued stalled forks were error-prone and switched replication templates repeatedly to create complex fusions of multiple short genomic segments. In mice, such complex fusions circularized the genomic region surrounding MYC to create a DM during tumorigenesis. Our results define a molecular path that guides stalled replication forks to complex chromosomal rearrangements.

  16. Recent advances on the role of long non-coding RNA H19 in regulating mammalian muscle growth and development.

    Science.gov (United States)

    Qin, Chen Yu; Cai, He; Qing, Han Rui; Li, Li; Zhang, Hong Ping

    2017-12-20

    As one of the first identified long non-coding RNAs (lncRNAs), H19 plays a wide range of roles in vivo, including not only as a tumor suppressor and oncogene involved in disease process, but also as a regulator of growth and development of multiple tissues in mammalian embryos. The function of H19 in muscles (both skeletal and cardiac muscle) draws widespread attention due to the following two reasons. On one hand, H19 promotes myogenic differentiation and myogenesis of skeletal muscle satellite cells (SMSCs) via regulating Igf2 in cis. On the other hand, H19 also modulates the target genes in trans, including sponging let-7, miR-106 or miR-29 to mediate myocyte glucose uptake, cardiomyocyte proliferation and tendon repair, as well as promote embryonic development and muscle regeneration through binding to MBD1 as a chromatin modifier. In this review, we summarize the role of H19 in mammalian muscles, which will provide a reference for further research to unveil the molecular mechanism of muscle growth and development.

  17. Trans-acting GC-rich non-coding RNA at var expression site modulates gene counting in malaria parasite.

    Science.gov (United States)

    Guizetti, Julien; Barcons-Simon, Anna; Scherf, Artur

    2016-11-16

    Monoallelic expression of the var multigene family enables immune evasion of the malaria parasite Plasmodium falciparum in its human host. At a given time only a single member of the 60-member var gene family is expressed at a discrete perinuclear region called the 'var expression site'. However, the mechanism of var gene counting remains ill-defined. We hypothesize that activation factors associating specifically with the expression site play a key role in this process. Here, we investigate the role of a GC-rich non-coding RNA (ncRNA) gene family composed of 15 highly homologous members. GC-rich genes are positioned adjacent to var genes in chromosome-central gene clusters but are absent near subtelomeric var genes. Fluorescence in situ hybridization demonstrates that GC-rich ncRNA localizes to the perinuclear expression site of central and subtelomeric var genes in trans. Importantly, overexpression of distinct GC-rich ncRNA members disrupts the gene counting process at the single cell level and results in activation of a specific subset of var genes in distinct clones. We identify the first trans-acting factor targeted to the elusive perinuclear var expression site and open up new avenues to investigate ncRNA function in antigenic variation of malaria and other protozoan pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Association of Long Non-Coding RNA HOTAIR Polymorphisms with Cervical Cancer Risk in a Chinese Population.

    Directory of Open Access Journals (Sweden)

    Liangsheng Guo

    Full Text Available Long non-coding RNAs (lncRNAs, HOTAIR has been reported to be upregulated in cervical cancer development and progression. However, SNPs (single nucleotide polymorphisms in the lncRNAs and their associations with cervical cancer susceptibility have not been reported. In the current study, we hypothesized that SNPs within the lncRNA HOTAIR may influence the risk of cervical cancer. We performed a case-control study including 510 cervical cancer patients (cases and 713 cancer-free individuals (controls to investigate the association between three haplotype-tagging SNPs (rs920778, rs1899663 and rs4759314 in the lncRNA HOTAIR and the risk of cervical cancer. We found a strong association between the SNP rs920778 in the intronic enhancer of the HOTAIR and cervical cancer (P<10-4. Moreover, the cervical cancer patients with homozygous TT genotype were significantly associated with tumor-node-metastasis (TNM stage. In vitro assays with allele-specific reporter constructs indicated that the reporter constructs bearing rs920778T allele conferred elevated reporter gene transcriptional activity when compared to the reporter constructs containing rs920778C allele. Furthermore, HOTAIR expression was higher in cervical cancer tissues than that in corresponding normal tissues, and the high expression was associated with the risk-associated allele T. In summary, our studies provide strong functional evidence that functional SNP rs920778 regulates HOTAIR expression, and may ultimately influence the predisposition for cervical cancer.

  19. A class of circadian long non-coding RNAs mark enhancers modulating long-range circadian gene regulation.

    Science.gov (United States)

    Fan, Zenghua; Zhao, Meng; Joshi, Parth D; Li, Ping; Zhang, Yan; Guo, Weimin; Xu, Yichi; Wang, Haifang; Zhao, Zhihu; Yan, Jun

    2017-06-02

    Circadian rhythm exerts its influence on animal physiology and behavior by regulating gene expression at various levels. Here we systematically explored circadian long non-coding RNAs (lncRNAs) in mouse liver and examined their circadian regulation. We found that a significant proportion of circadian lncRNAs are expressed at enhancer regions, mostly bound by two key circadian transcription factors, BMAL1 and REV-ERBα. These circadian lncRNAs showed similar circadian phases with their nearby genes. The extent of their nuclear localization is higher than protein coding genes but less than enhancer RNAs. The association between enhancer and circadian lncRNAs is also observed in tissues other than liver. Comparative analysis between mouse and rat circadian liver transcriptomes showed that circadian transcription at lncRNA loci tends to be conserved despite of low sequence conservation of lncRNAs. One such circadian lncRNA termed lnc-Crot led us to identify a super-enhancer region interacting with a cluster of genes involved in circadian regulation of metabolism through long-range interactions. Further experiments showed that lnc-Crot locus has enhancer function independent of lnc-Crot's transcription. Our results suggest that the enhancer-associated circadian lncRNAs mark the genomic loci modulating long-range circadian gene regulation and shed new lights on the evolutionary origin of lncRNAs. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Enhancer-associated long non-coding RNA LEENE regulates endothelial nitric oxide synthase and endothelial function.

    Science.gov (United States)

    Miao, Yifei; Ajami, Nassim E; Huang, Tse-Shun; Lin, Feng-Mao; Lou, Chih-Hong; Wang, Yun-Ting; Li, Shuai; Kang, Jian; Munkacsi, Hannah; Maurya, Mano R; Gupta, Shakti; Chien, Shu; Subramaniam, Shankar; Chen, Zhen

    2018-01-18

    The optimal expression of endothelial nitric oxide synthase (eNOS), the hallmark of endothelial homeostasis, is vital to vascular function. Dynamically regulated by various stimuli, eNOS expression is modulated at transcriptional, post-transcriptional, and post-translational levels. However, epigenetic modulations of eNOS, particularly through long non-coding RNAs (lncRNAs) and chromatin remodeling, remain to be explored. Here we identify an enhancer-associated lncRNA that enhances eNOS expression (LEENE). Combining RNA-sequencing and chromatin conformation capture methods, we demonstrate that LEENE is co-regulated with eNOS and that its enhancer resides in proximity to eNOS promoter in endothelial cells (ECs). Gain- and Loss-of-function of LEENE differentially regulate eNOS expression and EC function. Mechanistically, LEENE facilitates the recruitment of RNA Pol II to the eNOS promoter to enhance eNOS nascent RNA transcription. Our findings unravel a new layer in eNOS regulation and provide novel insights into cardiovascular regulation involving endothelial function.

  1. Long non-coding RNA MALAT1 promotes gastric cancer tumorigenicity and metastasis by regulating vasculogenic mimicry and angiogenesis.

    Science.gov (United States)

    Li, Yue; Wu, Zhenzhen; Yuan, Jia; Sun, Li; Lin, Li; Huang, Na; Bin, Jianping; Liao, Yulin; Liao, Wangjun

    2017-06-01

    MALAT1 is an oncogenic long non-coding RNA that has been found to promote the proliferation of many malignant cell types and non-malignant human umbilical vein endothelial cells (HUVECs). However, the functions of MALAT1 in vasculogenic mimicry (VM) and angiogenesis and the potential mechanisms responsible have not yet been investigated in any malignancy. Here, in situ hybridization and CD31/periodic acid-Schiff double staining of 150 gastric cancer (GC) clinical specimens revealed that MALAT1 expression was tightly associated with densities of VM and endothelial vessels. MALAT1 knockdown markedly reduced GC cell migration, invasion, tumorigenicity, metastasis, and VM, while restricting HUVEC angiogenesis and increasing vascular permeability. Moreover, MALAT1 was found to regulate expression of VE-cadherin, β-catenin, MMPs 2 and 9, MT1-MMP, p-ERK, p-FAK, and p-paxillin, which have been established as classical markers of VM and angiogenesis and components of associated signaling pathways. Consistent with this, the p-ERK inhibitors U0126 and PD98059 both effectively blocked GC cell VM. In conclusion, MALAT1 can promote tumorigenicity and metastasis in GC by facilitating VM and angiogenesis via the VE-cadherin/β-catenin complex and ERK/MMP and FAK/paxillin signaling pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Long Non-Coding RNA TUG1 Expression Is Associated with Different Subtypes in Human Breast Cancer.

    Science.gov (United States)

    Gradia, Daniela F; Mathias, Carolina; Coutinho, Rodrigo; Cavalli, Iglenir J; Ribeiro, Enilze M S F; de Oliveira, Jaqueline C

    2017-12-20

    Taurine upregulated 1 gene ( TUG1 ) is a long non-coding RNA associated with several types of cancer. Recently, differential expression of TUG1 was found in cancerous breast tissues and associated with breast cancer malignancy features. Although this is evidence of a potential role in breast cancer, TUG1 expression could not be associated with different subtypes, possibly due to the small number of samples analyzed. Breast cancer is a heterogeneous disease and, based on molecular signatures, may be classified into different subtypes with prognostic implications. In the present study, we include analysis of TUG1 expression in 796 invasive breast carcinoma and 105 normal samples of RNA sequencing (RNA-seq) datasets from The Cancer Genome Atlas (TCGA) and describe that TUG1 expression is increased in HER2-enriched and basal-like subtypes compared to luminal A. Additionally, TUG1 expression is associated with survival in HER2-enriched patients. These results reinforce the importance of TUG1 in breast cancer and outline its potential impact on specific subtypes.

  3. Long non-coding RNA TUG1 regulates ovarian cancer proliferation and metastasis via affecting epithelial-mesenchymal transition.

    Science.gov (United States)

    Kuang, Defeng; Zhang, Xiaoping; Hua, Shaofang; Dong, Wei; Li, Zhiguo

    2016-10-01

    Ovarian cancer is the fifth leading cause of cancer-related death in women worldwide, and recent studies have highlighted the role of long non-coding RNAs (lncRNAs) in cancer development. However, the role of lncRNAs in ovarian cancer is largely unclear. In this study, we focused on the taurine up-regulated gene 1 (TUG1) and examined its molecular mechanism in ovarian cancer. Here, we reported that TUG1 was up-regulated in ovarian cancer tissues and ovarian cancer cells, and TUG1 expression was positively correlated with tumor grade and FIGO stage. In vitro functional assays (CCK-8 assay, colony formation assay, and cell invasion assay) revealed that knock-down of TUG1 by small RNA inference significantly inhibited cell proliferation, colony formation and cell invasion in ovarian cancer cells. Further experiment showed that knock-down of TUG1 induced cell apoptosis and altered the protein expression levels of apoptosis-related mediators in ovarian cancer cells. More importantly, knock-down of TUG1 also reversed epithelial-mesenchymal transition in ovarian cancer. In summary, our results suggest that knock-down of TUG1 may represent a novel therapeutic strategy for the treatment of ovarian cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Long Non-Coding RNA TUG1 Expression Is Associated with Different Subtypes in Human Breast Cancer

    Directory of Open Access Journals (Sweden)

    Daniela F. Gradia

    2017-12-01

    Full Text Available Taurine upregulated 1 gene (TUG1 is a long non-coding RNA associated with several types of cancer. Recently, differential expression of TUG1 was found in cancerous breast tissues and associated with breast cancer malignancy features. Although this is evidence of a potential role in breast cancer, TUG1 expression could not be associated with different subtypes, possibly due to the small number of samples analyzed. Breast cancer is a heterogeneous disease and, based on molecular signatures, may be classified into different subtypes with prognostic implications. In the present study, we include analysis of TUG1 expression in 796 invasive breast carcinoma and 105 normal samples of RNA sequencing (RNA-seq datasets from The Cancer Genome Atlas (TCGA and describe that TUG1 expression is increased in HER2-enriched and basal-like subtypes compared to luminal A. Additionally, TUG1 expression is associated with survival in HER2-enriched patients. These results reinforce the importance of TUG1 in breast cancer and outline its potential impact on specific subtypes.

  5. Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma.

    Science.gov (United States)

    Wang, P-Q; Wu, Y-X; Zhong, X-D; Liu, B; Qiao, G

    2017-01-01

    The long non-coding RNAs (lncRNAs) study has gradually become one of the hot topics in the field of RNA biology. However, little is known about the pathological role of lncRNA TUG1 in clear cell renal cell carcinoma (ccRCC) patients. This study attempted to investigate the association of lncRNA TUG1 expression with progression and prognosis in ccRCC patients. Using qRT-PCR, the expression of TUG1 was measured in 203 ccRCC tissues and 45 adjacent non-cancerous tissues. Then, the relationships between TUG1 level and the clinicopathological factors of patients with ccRCC were analyzed. The prognostic significance was evaluated using Kaplan-Meier and Cox regression analyses. The relative level of TUG1was significantly higher in ccRCC tissues compared to the adjacent non-tumor tissues (p TUG1 was associated significantly with histological grade, tumor stage, lymph node metastasis and distant metastasis (all p TUG1 expression levels were associated with a shorter overall survival (p TUG1 expression was an independent prognostic marker of poor outcome. These findings suggested that TUG1 may act as a tumor promoter in ccRCC and could serve as a potential therapeutic target for this tumor.

  6. An in vitro study of the long non-coding RNA TUG1 in tongue squamous cell carcinoma.

    Science.gov (United States)

    Li, Zhi-Qiang; Zou, Rui; Ouyang, Ke-Xiong; Ai, Wei-Jian

    2017-11-01

    This study sought to study the expression of the long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) in tongue squamous cell carcinoma (TSCC) and reveal its possible function. qRT-PCR was used to evaluate 27 samples of fresh TSCC tissues and adjacent normal tongue tissues. siRNA technology was employed to downregulate TUG1 expression in CAL-27 and SCC-9 cell lines. The 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay was utilized to assess cell proliferation ability; apoptosis and cell-cycle phases were analysed via flow cytometry. qRT-PCR findings indicated that the lncRNA TUG1 was upregulated in TSCC tissues compared with adjacent normal tongue tissues (PTUG1 expression was downregulated using siRNA technology, cell proliferation was significantly inhibited (PTUG1 may represent a potential oncogene in TSCC. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Regulatory Roles of Long Non-Coding RNAs in the Central Nervous System and Associated Neurodegenerative Diseases

    Directory of Open Access Journals (Sweden)

    Zhenzhen Quan

    2017-06-01

    Full Text Available Accumulating studies have revealed that the human genome encodes tens of thousands of long non-coding RNAs (lncRNAs, which participate in multiple biological networks modulating gene expression via transcriptional, post-transcriptional and epigenetic regulation. Strikingly, a large fraction of tissue-specific lncRNAs are expressed in the Central Nervous System (CNS with precisely regulated temporal and spatial expression patterns. These brain-specific lncRNAs are also featured with the cell-type specificity, the highest signals of evolutionary conservation, and their preferential location adjacent to brain-expressed protein-coding genes. Mounting evidence has indicated dysregulation or mutations in lncRNA gene loci are associated with a variety of CNS-associated neurodegenerative disorders, such as Alzheimer’s, Parkinson’s, Huntington’s diseases, Amyotrophic Lateral Sclerosis and others. However, how lncRNAs contribute to these disorders remains to be further explored and studied. In this review article, we systematically and comprehensively summarize the current studies of lncRNAs, demonstrate the specificity of lncRNAs expressed in the brain, their functions during neural development and expression profiles in major cell types of the CNS, highlight the regulatory mechanisms of several studied lncRNAs that may play essential roles in the pathophysiology of neurodegenerative diseases, and discuss the current challenges and future perspectives of lncRNA studies involved in neurodegenerative and other diseases.

  8. The essential Drosophila CLAMP protein differentially regulates non-coding roX RNAs in male and females.

    Science.gov (United States)

    Urban, Jennifer A; Doherty, Caroline A; Jordan, William T; Bliss, Jacob E; Feng, Jessica; Soruco, Marcela M; Rieder, Leila E; Tsiarli, Maria A; Larschan, Erica N

    2017-06-01

    Heterogametic species require chromosome-wide gene regulation to compensate for differences in sex chromosome gene dosage. In Drosophila melanogaster, transcriptional output from the single male X-chromosome is equalized to that of XX females by recruitment of the male-specific lethal (MSL) complex, which increases transcript levels of active genes 2-fold. The MSL complex contains several protein components and two non-coding RNA on the X ( roX) RNAs that are transcriptionally activated by the MSL complex. We previously discovered that targeting of the MSL complex to the X-chromosome is dependent on the chromatin-linked adapter for MSL proteins (CLAMP) zinc finger protein. To better understand CLAMP function, we used the CRISPR/Cas9 genome editing system to generate a frameshift mutation in the clamp gene that eliminates expression of the CLAMP protein. We found that clamp null females die at the third instar larval stage, while almost all clamp null males die at earlier developmental stages. Moreover, we found that in clamp null females roX gene expression is activated, whereas in clamp null males roX gene expression is reduced. Therefore, CLAMP regulates roX abundance in a sex-specific manner. Our results provide new insights into sex-specific gene regulation by an essential transcription factor.

  9. Intragenic DNA methylation of PITX1 and the adjacent long non-coding RNA C5orf66-AS1 are prognostic biomarkers in patients with head and neck squamous cell carcinomas.

    Science.gov (United States)

    Sailer, Verena; Charpentier, Arthur; Dietrich, Joern; Vogt, Timo J; Franzen, Alina; Bootz, Friedrich; Dietrich, Dimo; Schroeck, Andreas

    2018-01-01

    Patients with squamous cell cancer of the head and neck region (HNSCC) are at risk for disease recurrence and metastases, even after initial successful therapy. A tissue-based biomarker could be beneficial to guide treatment as well as post-treatment surveillance. Gene methylation status has been recently identified as powerful prognostic biomarker in HNSCC. We therefore evaluated the methylation status of the homeobox gene PITX1 and the adjacent long intergenic non-coding RNA (lincRNA) C5orf66-AS1 in publicly available datasets. Gene methylation and expression data from 528 patients with HNSCC included in The Cancer Genome Atlas (TCGA, there obtained by using the Infinium HumanMethylation450 BeadChip Kit) were evaluated and methylation and expression levels of PITX1 and lincRNA C5orf66-AS1 was correlated with overall survival and other parameters. Thus, ten beads targeting PITX1 exon 3 and three beads targeting lincRNA C5orf66-AS1 were identified as significant candidates. The mean methylation of these beads was used for further correlation and the median was employed for dichotomization. Both PITX1 exon 3 and lincRNA C5orf66-AS1 were significantly higher methylated in tumor tissue than in normal adjacent tissue (NAT) (PITX1 exon 3: tumor tissue 58.1%, NAT: 31.7%, phuman papilloma virus (HPV)-negative and p16-negative tumors and tumor grade. Kaplan-Meier analysis showed, that lincRNA C5orf66-AS1 hypomethylation was significantly associated with overall survival (p = 0.001) in the entire cohort as well in a subgroup of HPV-negative tumors (p = 0.003) and in patients with laryngeal tumors (p = 0.022). Methylation status of PITX1 and even more so of lincRNA C5orf66-AS1 is a promising prognostic biomarker in HNSCC, in particular for HPV-negative patients. Further prospective evaluation is warranted.

  10. The intergenic spacer region of the rDNA in Haplopappus gracilis (Nutt.) Gray.

    Science.gov (United States)

    Ruffini Castiglione, M; Gelati, M T; Cremonini, R; Frediani, M

    2013-06-01

    In this paper, we provide further information on the genome organisation of Haplopappus gracilis, one of the six angiosperms showing the lowest chromosome number, i.e. 2n = 4, by determining the nucleotide sequence of the intergenic spacer region of the ribosomal RNA genes and its cytological localization on metaphase chromosomes. DNA sequence analysis reveals the occurring of a product of 4,382 bp in length, characterised by the presence of four blocks of different repeated sequences. Our analysis also evidenced putative promoter regions with three transcription initiation sites for polymerase I, as previously reported in Artemisia absinthium, belonging to the same Asteraceae family. A fluorescent in situ hybridization with the intergenic spacer probe indicates the presence of rDNA genes only in the satellited chromosomes of H. gracilis; besides, differences in the signal intensity between homologous chromosomes were frequently observed, thus suggesting for these chromosome sites the presence of a variable number of rDNA gene copies, even if a divergent chromatin organisation in corresponding regions cannot be ruled out.

  11. Pan-cancer screen for mutations in non-coding elements with conservation and cancer specificity reveals correlations with expression and survival

    DEFF Research Database (Denmark)

    Hornshøj, Henrik; Nielsen, Morten Muhlig; Sinnott-Armstrong, Nicholas A

    2018-01-01

    Cancer develops by accumulation of somatic driver mutations, which impact cellular function. Mutations in non-coding regulatory regions can now be studied genome-wide and further characterized by correlation with gene expression and clinical outcome to identify driver candidates. Using a new two-...

  12. Circulating long-non coding RNAs as biomarkers of left ventricular diastolic function and remodelling in patients with well-controlled type 2 diabetes

    NARCIS (Netherlands)

    Gonzalo-Calvo, D. de; Kenneweg, F.; Bang, C.; Toro, R.; Meer, R.W. van der; Rijzewijk, L.J.; Smit, J.W.; Lamb, H.J.; Llorente-Cortes, V.; Thum, T.

    2016-01-01

    Contractile dysfunction is underdiagnosed in early stages of diabetic cardiomyopathy. We evaluated the potential of circulating long non-coding RNAs (lncRNAs) as biomarkers of subclinical cardiac abnormalities in type 2 diabetes. Forty-eight men with well-controlled type 2 diabetes and 12 healthy

  13. Extracellular vesicle-mediated transfer of long non-coding RNA ROR modulates chemosensitivity in human hepatocellular cancer☆

    Science.gov (United States)

    Takahashi, Kenji; Yan, Irene K.; Kogure, Takayuki; Haga, Hiroaki; Patel, Tushar

    2014-01-01

    Hepatocellular cancers (HCC) are highly resistant to chemotherapy. TGFβ has been associated with chemoresistance in some human cancers but the mechanisms involved are unknown. We explored how TGFβ might contribute to altered responses to therapy by assessing the involvement and mechanistic contribution of extracellular vesicle long non-coding RNA (lncRNA) in mediating TGFβ-dependent chemoresistance. TGFβ reduced the sensitivity of HCC cells to sorafenib or doxorubicin and altered the release of both extracellular vesicles and of selected lncRNA within these vesicles. Amongst these, lincRNA-ROR (linc-ROR), a stress-responsive lncRNA was highly expressed in HCC cells and enriched within extracellular vesicles derived from tumor cells. Incubation with HCC-derived extracellular vesicles increased linc-ROR expression and reduced chemotherapy-induced cell death in recipient cells. Sorafenib increased linc-ROR expression in both tumor cells and extracellular vesicles, whereas siRNA to linc-ROR increased chemotherapy-induced apoptosis and cytotoxicity. Tumor-initiating cells that express CD133 have an increased resistance to therapy. TGFβ increased expression of CD133+ cells and colony growth in limiting dilution assays, both of which were attenuated by linc-ROR knockdown. These data provide mechanistic insights into primary chemoresistance in HCC by showing that: (a) TGFβ selectively enriches linc-RoR within extracellular vesicles, which has a potential role in intercellular signaling in response to TGFβ; (b) expression and enrichment of linc-ROR during chemotherapeutic stress plays a functional role in chemoresistance; and (c) the effects of TGFβ on chemoresistance in HCC may involve linc-RoR-dependent effects on tumor-initiating cells. These findings implicate extracellular vesicle lncRNA as mediators of the chemotherapeutic response, and support targeting linc-ROR to enhance chemosensitivity in HCC. PMID:24918061

  14. Extracellular vesicle-mediated transfer of long non-coding RNA ROR modulates chemosensitivity in human hepatocellular cancer.

    Science.gov (United States)

    Takahashi, Kenji; Yan, Irene K; Kogure, Takayuki; Haga, Hiroaki; Patel, Tushar

    2014-01-01

    Hepatocellular cancers (HCC) are highly resistant to chemotherapy. TGFβ has been associated with chemoresistance in some human cancers but the mechanisms involved are unknown. We explored how TGFβ might contribute to altered responses to therapy by assessing the involvement and mechanistic contribution of extracellular vesicle long non-coding RNA (lncRNA) in mediating TGFβ-dependent chemoresistance. TGFβ reduced the sensitivity of HCC cells to sorafenib or doxorubicin and altered the release of both extracellular vesicles and of selected lncRNA within these vesicles. Amongst these, lincRNA-ROR (linc-ROR), a stress-responsive lncRNA was highly expressed in HCC cells and enriched within extracellular vesicles derived from tumor cells. Incubation with HCC-derived extracellular vesicles increased linc-ROR expression and reduced chemotherapy-induced cell death in recipient cells. Sorafenib increased linc-ROR expression in both tumor cells and extracellular vesicles, whereas siRNA to linc-ROR increased chemotherapy-induced apoptosis and cytotoxicity. Tumor-initiating cells that express CD133 have an increased resistance to therapy. TGFβ increased expression of CD133+ cells and colony growth in limiting dilution assays, both of which were attenuated by linc-ROR knockdown. These data provide mechanistic insights into primary chemoresistance in HCC by showing that: (a) TGFβ selectively enriches linc-RoR within extracellular vesicles, which has a potential role in intercellular signaling in response to TGFβ; (b) expression and enrichment of linc-ROR during chemotherapeutic stress plays a functional role in chemoresistance; and (c) the effects of TGFβ on chemoresistance in HCC may involve linc-RoR-dependent effects on tumor-initiating cells. These findings implicate extracellular vesicle lncRNA as mediators of the chemotherapeutic response, and support targeting linc-ROR to enhance chemosensitivity in HCC.

  15. Long non-coding RNA expression profiles in different severity EV71-infected hand foot and mouth disease patients.

    Science.gov (United States)

    Meng, Jun; Yao, Zhenyu; He, Yaqing; Zhang, Renli; Yang, Hong; Yao, Xiangjie; Chen, Long; Zhang, Hailong; Cheng, Jinquan

    2017-12-02

    Enterovirus 71 (EV71) is associated with the severe hand foot and mouth disease (HFMD) outcomes, however the host-virus interaction mechanism and the pathogenesis remain poorly understood. Long non-coding RNAs (lncRNAs) are involved in variety physiological and pathological processes, but the functions of lncRNAs in EV71 infection remain elusive. Here we profiled the expression of lncRNAs in peripheral blood mononuclear cells (PBMCs) from EV71-infected mild patients, severe patients as well as the healthy controls, and identified 8541 lncRNAs were differentially expressed. Focused on the dynamic changed lncRNAs, we performed systematic bioinformatics analysis with Series Test of Cluster (STC) algorithm, Gene Ontology (GO) analysis, pathway analysis and lncRNA-mRNA co-expression network analysis, and revealed the potential functions and related pathways of these lncRNAs were associated with immunity and inflammation during the clinical process of EV71-infected HFMD. Among the significant dynamic changed lncRNAs, ten lncRNAs were screened whose expression were further validated in EV71-infected mild patients, severe patients and healthy control. These results shed light on the potential roles of lncRNAs in EV71-infected HFMD, especially in distinguishing the mild and severe cases for early diagnose and treatment, moreover, provide deeper insight into the mechanism of EV71-induced immune and inflammatory responses, as well as the pathogenesis of the imbalanced inflammation in severe EV71 infection. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. BAP1 dependent expression of long non-coding RNA NEAT-1 contributes to sensitivity to gemcitabine in cholangiocarcinoma.

    Science.gov (United States)

    Parasramka, Mansi; Yan, Irene K; Wang, Xue; Nguyen, Phuong; Matsuda, Akiko; Maji, Sayantan; Foye, Catherine; Asmann, Yan; Patel, Tushar

    2017-01-25

    Genetic alterations in chromatin modulators such as BRCA-1 associated protein-1 (BAP1) are the most frequent genetic alteration in intrahepatic cholangiocarcinomas (CCA). We evaluated the contribution of BAP1 expression on tumor cell behavior and therapeutic sensitivity to identify rationale therapeutic strategies. The impact of BAP1 expression on sensitivity to therapeutic agents was evaluated in CCA cells with a 7-fold difference in BAP1 expression (KMBC-low, HuCCT1-high) and genetically engineered haplo-insufficient BAP1 knockout cells. We also identified long non-coding RNA genes associated with loss of BAP1 and their role in therapeutic sensitivity. Sensitivity to gemcitabine was greater in low BAP1 expressing or BAP1 knockout cells compared with the high BAP1 expressing cells or control haplo-insufficient cells respectively. Similar results were observed with TSA, olaparib, b-AP15 but not with GSK126. A differential synergistic effect was observed in combinations of gemcitabine with olaparib or GSK126 in KMBC cells and TSA or bAP15 in HuCCT1 cells, indicating BAP1 dependent target-specific synergism and sensitivity to gemcitabine. A BAP1 dependent alteration in expression of lncRNA NEAT-1 was identified by RT-PCR based lncRNA expression profiling, and an inverse relationship between this lncRNA and BAP1 was observed in analysis of the Tumor Cancer Genome Atlas cholangiocarcinoma dataset. Exogenous modulation of NEAT-1 and/or BAP1 expression altered tumor cell phenotype and modulated sensitivity to gemcitabine. NEAT-1 is a downstream effector of gemcitabine sensitivity in CCA. The expression of BAP1 is a determinant of sensitivity to therapeutic drugs that can be exploited to enhance responses through combination strategies.

  17. BRAF activated non-coding RNA (BANCR) promoting gastric cancer cells proliferation via regulation of NF-κB1

    International Nuclear Information System (INIS)

    Zhang, Zhi-Xin; Liu, Zhi-Qiang; Jiang, Biao; Lu, Xin-Yang; Ning, Xiao-Fei; Yuan, Chuan-Tao; Wang, Ai-Liang

    2015-01-01

    Background and objective: Long non-coding RNA, BANCR, has been demonstrated to contribute to the proliferation and migration of tumors. However, its molecular mechanism underlying gastric cancer is still unknown. In present study, we investigated whether BANCR was involved in the development of gastric cancer cells via regulation of NF-κB1. Methods: Human gastric cancer tissues were isolated as well as human gastric cell lines MGC803 and BGC823 were cultured to investigate the role of BANCR in gastric cancer. Results: BANCR expression was significantly up-regulated in gastric tumor tissues and gastric cell lines. Down-regulation of BANCR inhibited gastric cancer cell growth and promoted cell apoptosis, and it also contributed to a significant decrease of NF-κB1 (P50/105) expression and 3′UTR of NF-κB1 activity. Overexpression of NF-κB1 reversed the effect of BANCR on cancer cell growth and apoptosis. MiroRNA-9 (miR-9) targeted NF-κB1, and miR-9 inhibitor also reversed the effects of BANCR on gastric cancer cell growth and apoptosis. Conclusion: BANCR was highly expressed both in gastric tumor tissues and in cancer cells. NF-κB1 and miR-9 were involved in the role of BANCR in gastric cancer cell growth and apoptosis. - Highlights: • BANCR up-regulated in gastric cancer (GC) tissues and cell lines MGC803 and BGC823. • Down-regulation of BANCR inhibited GC cell growth and promoted cell apoptosis. • Down-regulation of BANCR contributed to decreased 3′UTR of NF-κB1 and its expression. • Overexpressed NF-κB1 reversed the effect of BANCR on GC cell growth. • miR-9 inhibitor reversed the effect of BANCR on cancer GC cell growth

  18. Inhibition of long non-coding RNA UCA1 by CRISPR/Cas9 attenuated malignant phenotypes of bladder cancer.

    Science.gov (United States)

    Zhen, Shuai; Hua, Ling; Liu, Yun-Hui; Sun, Xiao-Min; Jiang, Meng-Meng; Chen, Wei; Zhao, Le; Li, Xu

    2017-02-07

    CRISPR/Cas9 is a novel and effective genome editing technique, but its application is not widely expanded to manipulate long non-coding RNA (lncRNA) expression. The lncRNA urothelial carcinoma-associated 1 (UCA1) is upregulated in bladder cancer and promotes the progression of bladder cancer. Here, we design gRNAs specific to UCA1 and construct CRISPR/Cas9 systems targeting UCA1. Single CRISPR/Cas9-UCA1 can effectively inhibit UCA1 expression when transfected into 5637 and T24 bladder cancer cells, while the combined transfection of the two most effective CRISPR/Cas9-UCA1s can generate more satisfied inhibitory effect. CRISPR/Cas9-UCA1s attenuate UCA1 expression via targeted genome-specific DNA cleavage, resulting in the significant inhibition of cell proliferation, migration and invasion in vitro and in vivo. The mechanisms associated with the inhibitory effect of CRISPR/Cas9-UCA1 on malignant phenotypes of bladder cancer are attributed to the induction of cell cycle arrest at G1 phase, a substantial increase of apoptosis, and an enhanced activity of MMPs. Additionally, urinary UCA1 can be used as a non-invasive diagnostic marker for bladder cancer as revealed by a meta-analysis. Collectively, our data suggest that CRISPR/Cas9 technique can be used to down-modulate lncRNA expression, and urinary UCA1 may be used as a non-invasive marker for diagnosis of bladder cancer.

  19. Defects in the NC2 repressor affect both canonical and non-coding RNA polymerase II transcription initiation in yeast.

    Science.gov (United States)

    Gómez-Navarro, Natalia; Jordán-Pla, Antonio; Estruch, Francisco; E Pérez-Ortín, José

    2016-03-03

    The formation of the pre-initiation complex in eukaryotic genes is a key step in transcription initiation. The TATA-binding protein (TBP) is a universal component of all pre-initiation complexes for all kinds of RNA polymerase II (RNA pol II) genes, including those with a TATA or a TATA-like element, both those that encode proteins and those that transcribe non-coding RNAs. Mot1 and the negative cofactor 2 (NC2) complex are regulators of TBP, and it has been shown that depletion of these factors in yeast leads to defects in the control of transcription initiation that alter cryptic transcription levels in selected yeast loci. In order to cast light on the molecular functions of NC2, we performed genome-wide studies in conditional mutants in yeast NC2 essential subunits Ydr1 and Bur6. Our analyses show a generally increased level of cryptic transcription in all kinds of genes upon depletion of NC2 subunits, and that each kind of gene (canonical or ncRNAs, TATA or TATA-like) shows some differences in the cryptic transcription pattern for each NC2 mutant. We conclude that NC2 plays a general role in transcription initiation in RNA polymerase II genes that is related with its known TBP interchange function from free to promoter bound states. Therefore, loss of the NC2 function provokes increases in cryptic transcription throughout the yeast genome. Our results also suggest functional differences between NC2 subunits Ydr1 and Bur6.

  20. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.

    Science.gov (United States)

    Lennox, Kim A; Behlke, Mark A

    2016-01-29

    Thousands of long non-coding RNAs (lncRNAs) have been identified in mammalian cells. Some have important functions and their dysregulation can contribute to a variety of disease states. However, most lncRNAs have not been functionally characterized. Complicating their study, lncRNAs have widely varying subcellular distributions: some reside predominantly in the nucleus, the cytoplasm or in both compartments. One method to query function is to suppress expression and examine the resulting phenotype. Methods to suppress expression of mRNAs include antisense oligonucleotides (ASOs) and RNA interference (RNAi). Antisense and RNAi-based gene-knockdown methods vary in efficacy between different cellular compartments. It is not known if this affects their ability to suppress lncRNAs. To address whether localization of the lncRNA influences susceptibility to degradation by either ASOs or RNAi, nuclear lncRNAs (MALAT1 and NEAT1), cytoplasmic lncRNAs (DANCR and OIP5-AS1) and dual-localized lncRNAs (TUG1, CasC7 and HOTAIR) were compared for knockdown efficiency. We found that nuclear lncRNAs were more effectively suppressed using ASOs, cytoplasmic lncRNAs were more effectively suppressed using RNAi and dual-localized lncRNAs were suppressed using both methods. A mixed-modality approach combining ASOs and RNAi reagents improved knockdown efficacy, particularly for those lncRNAs that localize to both nuclear and cytoplasmic compartments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Mutation of Rubie, a novel long non-coding RNA located upstream of Bmp4, causes vestibular malformation in mice.

    Directory of Open Access Journals (Sweden)

    Kristina A Roberts

    Full Text Available The vestibular apparatus of the vertebrate inner ear uses three fluid-filled semicircular canals to sense angular acceleration of the head. Malformation of these canals disrupts the sense of balance and frequently causes circling behavior in mice. The Epistatic circler (Ecl is a complex mutant derived from wildtype SWR/J and C57L/J mice. Ecl circling has been shown to result from the epistatic interaction of an SWR-derived locus on chromosome 14 and a C57L-derived locus on chromosome 4, but the causative genes have not been previously identified.We developed a mouse chromosome substitution strain (CSS-14 that carries an SWR/J chromosome 14 on a C57BL/10J genetic background and, like Ecl, exhibits circling behavior due to lateral semicircular canal malformation. We utilized CSS-14 to identify the chromosome 14 Ecl gene by positional cloning. Our candidate interval is located upstream of bone morphogenetic protein 4 (Bmp4 and contains an inner ear-specific, long non-coding RNA that we have designated Rubie (RNA upstream of Bmp4 expressed in inner ear. Rubie is spliced and polyadenylated, and is expressed in developing semicircular canals. However, we discovered that the SWR/J allele of Rubie is disrupted by an intronic endogenous retrovirus that causes aberrant splicing and premature polyadenylation of the transcript. Rubie lies in the conserved gene desert upstream of Bmp4, within a region previously shown to be important for inner ear expression of Bmp4. We found that the expression patterns of Bmp4 and Rubie are nearly identical in developing inner ears.Based on these results and previous studies showing that Bmp4 is essential for proper vestibular development, we propose that Rubie is the gene mutated in Ecl mice, that it is involved in regulating inner ear expression of Bmp4, and that aberrant Bmp4 expression contributes to the Ecl phenotype.

  2. Dynamic transcription of long non-coding RNA genes during CD4+ T cell development and activation.

    Directory of Open Access Journals (Sweden)

    Fei Xia

    Full Text Available BACKGROUND: Recent evidence shows that long non-coding RNA (LncRNA play important regulatory roles in many biology process, including cell development, activation and oncogenesis. However, the roles of these LncRNAs in the development and activation of CD4+ T cells, which is an important component of immune response, remain unknown. RESULTS: To predict the function of LncRNA in the development and activation of CD4+ T cells, first, we examined the expression profiles of LncRNAs and mRNAs in CD4-CD8- (DN, CD4+CD8+ (DP, CD4+CD8-, and activated CD4+CD8- T cells in a microarray analysis and verified these results by real time PCRs (qPCR. We found that the expression of hundreds of LncRNAs significantly changed in each process of developmental transition, including DN into DP, DP into CD4+CD8-, and CD4+CD8- into activated CD4+ T cells. A Kendall distance analysis suggested that the expression of LncRNAs in DN, DP, CD4+CD8- T cells and activated CD4+ T cells were correlated with the expression of mRNAs in these T cells. The Blat algorithm and GO analysis suggested that LncRNAs may exert important roles in the development and activation of CD4+ T cells. These roles included proliferation, homeostasis, maturation, activation, migration, apoptosis and calcium ion transportation. CONCLUSION: The present study found that the expression profiles of LncRNAs in different stages of CD4+ T cells are distinguishable. LncRNAs are involved in the key biological process in CD4+ T cell development and activation.

  3. Global identification and analysis of long non-coding RNAs in diploid strawberry Fragaria vesca during flower and fruit development.

    Science.gov (United States)

    Kang, Chunying; Liu, Zhongchi

    2015-10-19

    Long non-coding RNAs (lncRNAs) are a new class of regulatory molecules with roles in diverse biological processes. While much effort has been invested in the analysis of lncRNAs from established plant models Arabidopsis, maize, and rice, almost nothing is known about lncRNAs from fruit crops, including those in the Rosaceae family. Here, we present a genome-scale identification and characterization of lncRNAs from a diploid strawberry, Fragaria vesca, based on rich RNA-seq datasets from 35 different flower and fruit tissues. 5,884 Fve-lncRNAs derived from 3,862 loci were identified. These lncRNAs were carefully cataloged based on expression level and whether or not they contain repetitive sequences or generate small RNAs. About one fourth of them are termed high-confidence lncRNAs (hc-lncRNAs) because they are expressed at a level of FPKM higher than 2 and produce neither small RNAs nor contain repetitive sequence. To identify regulatory interactions between lncRNAs and their potential protein-coding (PC) gene targets, pairs of lncRNAs and PC genes with positively or negatively correlated expression trends were identified based on their expression; these pairs may be candidates of cis- or trans-acting lncRNAs and their targets. Finally, blast searches within plant species indicate that lncRNAs are not well conserved. Our study identifies a large number of tissue-specifically expressed lncRNAs in F. vesca, thereby highlighting their potential contributions to strawberry flower and fruit development and paving the way for future functional studies.

  4. Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.

    Science.gov (United States)

    Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui

    2018-04-01

    Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.

  5. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  6. Identification and Characterization of Long Non-Coding RNAs in Osteogenic Differentiation of Human Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Guangxin Huang

    2017-06-01

    Full Text Available Background/Aims: Long noncoding RNAs (lncRNAs play important roles in stem cell differentiation. However, their role in osteogenesis of human adipose-derived stem cells (ASCs, a promising cell source for bone regeneration, remains unknown. Here, we investigated the expression profile and potential roles of lncRNAs in osteogenic differentiation of human ASCs. Methods: Human ASCs were induced to differentiate into osteoblasts in vitro, and the expression profiles of lncRNAs and mRNAs in undifferentiated and osteogenic differentiated ASCs were obtained by microarray. Bioinformatics analyses including subgroup analysis, gene ontology analysis, pathway analysis and co-expression network analysis were performed. The function of lncRNA H19 was determined by in vitro knockdown and overexpression. Quantitative reverse transcription polymerase chain reaction was utilized to examine the expression of selected genes. Results: We identified 1,460 upregulated and 1,112 downregulated lncRNAs in osteogenic differentiated human ASCs as compared with those of undifferentiated cells (Fold change ≥ 2.0, P < 0.05. Among these, 94 antisense lncRNAs, 85 enhancer-like lncRNAs and 160 lincRNAs were further recognized. We used 12 lncRNAs and 157 mRNAs to comprise a coding-non-coding gene expression network. Additionally, silencing of H19 caused a significantly increase in expression of osteogenesis-related genes, including ALPL and RUNX2, while a decrease was observed after H19 overexpression. Conclusion: This study revealed for the first time the global expression profile of lncRNAs involved in osteogenic differentiation of human ASCs and provided a foundation for future investigations of lncRNA regulation of human ASC osteogenesis.

  7. Short non-coding RNAs as bacteria species identifiers detected by surface plasmon resonance enhanced common path interferometry

    Science.gov (United States)

    Greef, Charles; Petropavlovskikh, Viatcheslav; Nilsen, Oyvind; Khattatov, Boris; Plam, Mikhail; Gardner, Patrick; Hall, John

    2008-04-01

    Small non-coding RNA sequences have recently been discovered as unique identifiers of certain bacterial species, raising the possibility that they can be used as highly specific Biowarfare Agent detection markers in automated field deployable integrated detection systems. Because they are present in high abundance they could allow genomic based bacterial species identification without the need for pre-assay amplification. Further, a direct detection method would obviate the need for chemical labeling, enabling a rapid, efficient, high sensitivity mechanism for bacterial detection. Surface Plasmon Resonance enhanced Common Path Interferometry (SPR-CPI) is a potentially market disruptive, high sensitivity dual technology that allows real-time direct multiplex measurement of biomolecule interactions, including small molecules, nucleic acids, proteins, and microbes. SPR-CPI measures differences in phase shift of reflected S and P polarized light under Total Internal Reflection (TIR) conditions at a surface, caused by changes in refractive index induced by biomolecular interactions within the evanescent field at the TIR interface. The measurement is performed on a microarray of discrete 2-dimensional areas functionalized with biomolecule capture reagents, allowing simultaneous measurement of up to 100 separate analytes. The optical beam encompasses the entire microarray, allowing a solid state detector system with no scanning requirement. Output consists of simultaneous voltage measurements proportional to the phase differences resulting from the refractive index changes from each microarray feature, and is automatically processed and displayed graphically or delivered to a decision making algorithm, enabling a fully automatic detection system capable of rapid detection and quantification of small nucleic acids at extremely sensitive levels. Proof-of-concept experiments on model systems and cell culture samples have demonstrated utility of the system, and efforts are in

  8. Long non-coding RNA TUG1 acts as a miR-26a sponge in human glioma cells.

    Science.gov (United States)

    Li, Jun; An, Gang; Zhang, Meng; Ma, Qingfang

    2016-09-02

    Long non-coding RNA taurine upregulated gene 1 (TUG1) acts as an important regulator in cancer pathogenesis; however, its functional mechanism in glioma development remains unclear. This study aims to explore the potential function of TUG1 in glioma by sponging miR-26a. The expression of TUG1, miR-26a, and phosphatase and tensin homolog (PTEN) in 20 paired glioma tissues was detected by quantitative real-time PCR and subjected to correlation analysis. Bioinformatics analysis was performed by using DIANA Tools. Abnormal TUG1 expression was conducted in two glioma cells to analyze its regulation on miR-26a and PTEN using real-time PCR, western blot, and luciferase reporter assay. TUG1 expression was confirmed to be upregulated in glioma tissues, and showed an inverse correlation with downregulated miR-26a. TUG1 could negatively regulate the expression of miR-26a in glioma cells. The bioinformatics prediction revealed putative miR-26a binding sites within TUG1 transcripts. Further experiments demonstrated the positive regulation of TUG1 on the miR-26a target, PTEN, wherein TUG1 could inhibit the negative regulation of miR-26a on PTEN by binding its 3'UTR. Additionally, the expression of PTEN was also upregulated in glioma tissues, showing a positive or negative correlation with TUG1 or miR-26a, respectively. TUG1 could serve as a miR-26a sponge in human glioma cells, contributing to the upregulation of PTEN. This study revealed a new TUG1/miR-26a/PTEN regulatory mechanism and provided a further understanding of the tumor-suppressive role of TUG1 in glioma development. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Prognostic role of long non-coding RNA TUG1 expression in various cancers: a meta-analysis.

    Science.gov (United States)

    Zhou, Yongping; Lu, Yuxuan; Li, Runmin; Yan, Nana; Li, Xiding; Dai, Tu

    2017-11-21

    Several studies were conducted to explore the prognostic role of long non-coding RNA taurine upregulated gene 1 (lncRNA TUG1) expression in various cancers, with contradictory. This study aims to summarize the prognostic role of lncRNA TUG1 expression in various cancers. Embase, PubMed and Cochrane Library were completely retrieved. The cohort studies focusing on the prognostic role of lncRNA TUG1 expression in various cancers were eligible. The endpoints were overall survival (OS) and clinicopathological parameters. 9 studies involving a total of 1,078 patients were identified. The results showed that high lncRNA TUG1 expression was obviously associated with worse OS when compared to the low lncRNA TUG1 expression (HR = 1.37, 95% CI = 1.07-1.76, P = 0.01; I 2 = 85%). However, No distinct relationship was observed between the lncRNA TUG1 expression and age (OR = 0.99, 95% CI = 0.76-1.28, P = 0.92; I2 = 4%), gender (OR = 0.92, 95% CI = 0.70-1.22, P = 0.57; I 2 = 0%), diameter (OR = 0.83, 95% CI = 0.34-2.01, P = 0.67; I 2 = 85%), smoking (OR = 1.09, 95% CI = 0.37-3.21, P = 0.87; I 2 = 73%), TNM stage (OR = 0.60, 95% CI = 0.25-1.43, P = 0.25; I 2 = 86%) and lymph node metastasis (OR = 1.07, 95% CI = 0.47-2.45, P = 0.87; I 2 = 86%). In conclusion, it was revealed that high lncRNA TUG1 expression is an unfavorable predictor of OS in patients with cancers, and lncRNA TUG1 expression is a promising prognostic biomarker for various cancers.

  10. microRNA-22 can regulate expression of the long non-coding RNA MEG3 in acute myeloid leukemia

    Science.gov (United States)

    Yao, Hongxia; Sun, Pei; Duan, Mengling; Lin, Lie; Pan, Yanping; Wu, Congming; Fu, Xiangjun; Wang, Hua; Guo, Li; Jin, Tianbo; Ding, Yipeng

    2017-01-01

    Aim Acute myeloid leukemia (AML) is the most common blood tumor with poor prognosis. At present, the research found that the pathogenesis of AML is related to many factors, such as recurrent somatic mutations and gene expression and epigenetic changes, however, the molecular mechanism of AML is still unclear. Long non-coding RNA MEG3 is a newly found tumor suppressor and plays a very important role in the regulation of a variety of tumor formation and progression. Studies found that the MEG3 expression was significantly decreased in AML. However, to date, it is not clear the cause of its abnormal expression. Therefore, the molecular mechanism of AML is urgently needed to study the molecular mechanism of AML. Methods The different expression level of MEG3, TET2, miR-22-3p, miR-22-5p in AML was detected by real-time quantification PCR. MEG3, TET2, miR-22-3p, miR-22-3p expression cell pools in K562 cells was used to interfering and TET2, MEG3 TET2, relations with miR-22-3p, miR-22-5p. The effect of AML cell on proliferation was evaluated by TET2 lower expression. Results 1. The lower expression of MEG3 and TET2 in AML cell lines was detected by RT-qPCR. 2. The stable MEG3, TET2 overexpression cell pools in K562 cells was successful established. 3. After transfection, MTT assay revealed that cell growth was significantly increased in AML cell lines transfected with TET2 compared with controls. Conclusions Our findings suggested that MEG3 is significantly down regulated in AML cell lines. PMID:29029424

  11. Optimisation of automated ribosomal intergenic spacer analysis for the estimation of microbial diversity in fynbos soil

    Directory of Open Access Journals (Sweden)

    Karin Jacobs

    2010-07-01

    Full Text Available Automated ribosomal intergenic spacer analysis (ARISA has become a commonly used molecular technique for the study of microbial populations in environmental samples. The reproducibility and accuracy of ARISA, with and without the polymerase chain reaction (PCR are important aspects that influence the results and effectiveness of these techniques. We used the primer set ITS4/ITS5 for ARISA to assess the fungal community composition of two sites situated in the Sand Fynbos. The primer set proved to deliver reproducible ARISA profiles of the fungal community composition with little variation observed between ARISA-PCRs. Variation that occurred in a sample due to repeated DNA extraction is expected for ecological studies. This reproducibility made ARISA a useful tool for the assessment and comparison of diversity in ecological samples. In this paper, we also offered particular suggestions concerning the binning strategy for the analysis of ARISA profiles.

  12. Genome-wide identification, characterization and evolutionary analysis of long intergenic noncoding RNAs in cucumber.

    Directory of Open Access Journals (Sweden)

    Zhiqiang Hao

    Full Text Available Long intergenic noncoding RNAs (lincRNAs are intergenic transcripts with a length of at least 200 nt that lack coding potential. Emerging evidence suggests that lincRNAs from animals participate in many fundamental biological processes. However, the systemic identification of lincRNAs has been undertaken in only a few plants. We chose to use cucumber (Cucumis sativus as a model to analyze lincRNAs due to its importance as a model plant for studying sex differentiation and fruit development and the rich genomic and transcriptome data available. The application of a bioinformatics pipeline to multiple types of gene expression data resulted in the identification and characterization of 3,274 lincRNAs. Next, 10 lincRNAs targeted by 17 miRNAs were also explored. Based on co-expression analysis between lincRNAs and mRNAs, 94 lincRNAs were annotated, which may be involved in response to stimuli, multi-organism processes, reproduction, reproductive processes, and growth. Finally, examination of the evolution of lincRNAs showed that most lincRNAs are under purifying selection, while 16 lincRNAs are under natural selection. Our results provide a rich resource for further validation of cucumber lincRNAs and their function. The identification of lincRNAs targeted by miRNAs offers new clues for investigations into the role of lincRNAs in regulating gene expression. Finally, evaluation of the lincRNAs suggested that some lincRNAs are under positive and balancing selection.

  13. Adaptation of the short intergenic spacers between co-directional genes to the Shine-Dalgarno motif among prokaryote genomes

    DEFF Research Database (Denmark)

    Caro, Albert Pallejà; García-Vallvé, Santiago; Romeu, Antoni

    2009-01-01

    , the stop codon usage of the upstream gene changes to accommodate the overlap between the SD sequence and the stop codon. CONCLUSION: The SD presence makes the intergenic lengths from 5 to 8 bps less frequent and causes an adaptation of the stop codon usage. Our results introduce new elements...

  14. Determination of the differential expression of mitochondrial long non-coding RNAs as a noninvasive diagnosis of bladder cancer.

    Science.gov (United States)

    Rivas, Alexis; Burzio, Verónica; Landerer, Eduardo; Borgna, Vincenzo; Gatica, Sebastian; Ávila, Rodolfo; López, Constanza; Villota, Claudio; de la Fuente, Rodrigo; Echenique, Javiera; Burzio, Luis O; Villegas, Jaime

    2012-12-18

    Bladder cancer is a significant cause of morbidity and mortality with a high recurrence rate. Early detection of bladder cancer is essential in order to remove the tumor, to preserve the organ and to avoid metastasis. The aim of this study was to analyze the differential expression of mitochondrial non-coding RNAs (sense and antisense) in cells isolated from voided urine of patients with bladder cancer as a noninvasive diagnostic assay. The differential expression of the sense (SncmtRNA) and the antisense (ASncmtRNAs) transcripts in cells isolated from voided urine was determined by fluorescent in situ hybridization. The test uses a multiprobe mixture labeled with different fluorophores and takes about 1 hour to complete. We examined the expression of these transcripts in cells isolated from urine of 24 patients with bladder cancer and from 15 healthy donors. This study indicates that the SncmtRNA and the ASncmtRNAs are stable in cells present in urine. The test reveals that the expression pattern of the mitochondrial transcripts can discriminate between normal and tumor cells. The analysis of 24 urine samples from patients with bladder cancer revealed expression of the SncmtRNA and down-regulation of the ASncmtRNAs. Exfoliated cells recovered from the urine of healthy donors do not express these mitochondrial transcripts. This is the first report showing that the differential expression of these mitochondrial transcripts can detect tumor cells in the urine of patients with low and high grade bladder cancer. This pilot study indicates that fluorescent in situ hybridization of cells from urine of patients with different grades of bladder cancer confirmed the tumor origin of these cells. Samples from the 24 patients with bladder cancer contain cells that express the SncmtRNA and down-regulate the ASncmtRNAs. In contrast, the hybridization of the few exfoliated cells recovered from healthy donors revealed no expression of these mitochondrial transcripts. This assay

  15. Determination of the differential expression of mitochondrial long non-coding RNAs as a noninvasive diagnosis of bladder cancer

    Directory of Open Access Journals (Sweden)

    Rivas Alexis

    2012-12-01

    Full Text Available Abstract Background Bladder cancer is a significant cause of morbidity and mortality with a high recurrence rate. Early detection of bladder cancer is essential in order to remove the tumor, to preserve the organ and to avoid metastasis. The aim of this study was to analyze the differential expression of mitochondrial non-coding RNAs (sense and antisense in cells isolated from voided urine of patients with bladder cancer as a noninvasive diagnostic assay. Methods The differential expression of the sense (SncmtRNA and the antisense (ASncmtRNAs transcripts in cells isolated from voided urine was determined by fluorescent in situ hybridization. The test uses a multiprobe mixture labeled with different fluorophores and takes about 1 hour to complete. We examined the expression of these transcripts in cells isolated from urine of 24 patients with bladder cancer and from 15 healthy donors. Results This study indicates that the SncmtRNA and the ASncmtRNAs are stable in cells present in urine. The test reveals that the expression pattern of the mitochondrial transcripts can discriminate between normal and tumor cells. The analysis of 24 urine samples from patients with bladder cancer revealed expression of the SncmtRNA and down-regulation of the ASncmtRNAs. Exfoliated cells recovered from the urine of healthy donors do not express these mitochondrial transcripts. This is the first report showing that the differential expression of these mitochondrial transcripts can detect tumor cells in the urine of patients with low and high grade bladder cancer. Conclusion This pilot study indicates that fluorescent in situ hybridization of cells from urine of patients with different grades of bladder cancer confirmed the tumor origin of these cells. Samples from the 24 patients with bladder cancer contain cells that express the SncmtRNA and down-regulate the ASncmtRNAs. In contrast, the hybridization of the few exfoliated cells recovered from healthy donors

  16. A Salmonella small non-coding RNA facilitates bacterial invasion and intracellular replication by modulating the expression of virulence factors.

    Directory of Open Access Journals (Sweden)

    Hao Gong

    2011-09-01

    Full Text Available Small non-coding RNAs (sRNAs that act as regulators of gene expression have been identified in all kingdoms of life, including microRNA (miRNA and small interfering RNA (siRNA in eukaryotic cells. Numerous sRNAs identified in Salmonella are encoded by genes located at Salmonella pathogenicity islands (SPIs that are commonly found in pathogenic strains. Whether these sRNAs are important for Salmonella pathogenesis and virulence in animals has not been reported. In this study, we provide the first direct evidence that a pathogenicity island-encoded sRNA, IsrM, is important for Salmonella invasion of epithelial cells, intracellular replication inside macrophages, and virulence and colonization in mice. IsrM RNA is expressed in vitro under conditions resembling those during infection in the gastrointestinal tract. Furthermore, IsrM is found to be differentially expressed in vivo, with higher expression in the ileum than in the spleen. IsrM targets the mRNAs coding for SopA, a SPI-1 effector, and HilE, a global regulator of the expression of SPI-1 proteins, which are major virulence factors essential for bacterial invasion. Mutations in IsrM result in disregulation of expression of HilE and SopA, as well as other SPI-1 genes whose expression is regulated by HilE. Salmonella with deletion of isrM is defective in bacteria invasion of epithelial cells and intracellular replication/survival in macrophages. Moreover, Salmonella with mutations in isrM is attenuated in killing animals and defective in growth in the ileum and spleen in mice. Our study has shown that IsrM sRNA functions as a pathogenicity island-encoded sRNA directly involved in Salmonella pathogenesis in animals. Our results also suggest that sRNAs may represent a distinct class of virulence factors that are important for bacterial infection in vivo.

  17. Integrated analysis of coding genes and non-coding RNAs during hair follicle cycle of cashmere goat (Capra hircus).

    Science.gov (United States)

    Wang, Shanhe; Ge, Wei; Luo, Zhixin; Guo, Yang; Jiao, Beilei; Qu, Lei; Zhang, Zhiying; Wang, Xin

    2017-10-11

    Cashmere growth is a seasonal and cyclic phenomenon under the control of photoperiod and multiple stimulatory and inhibitory signals. Beyond relevant coding genes, microRNA (miRNA) and long non coding RNA (lncRNA) play an indispensable role in hair follicle (HF) development and skin homeostasis. Furthermore, the influence of lncRNA upon miRNA function is also rapidly emerging. However, little is known about miRNAs, lncRNAs and their functions as well as their interactions on cashmere development and cycling. Here, based on lncRNA and miRNA high-throughput sequencing and bioinformatics analysis, we have identified 1108 lncRNAs and 541 miRNAs in cashmere goat skin during anagen and telogen. Compared with telogen, 1388 coding genes, 41 lncRNAs and 15 miRNAs were upregulated, while 1104 coding genes, 157 lncRNAs and 8 miRNAs were downregulated in anagen (adjusted P-value ≤0.05 and relative fold-change ≥2). Subsequently, we investigated the impact of lncRNAs on their target genes in cis and trans, indicating that these lncRNAs are functionally conserved during HF development and cycling. Furthermore, miRNA-mRNA and miRNA-lncRNA interaction were identified through the bioinformatics algorithm miRanda, then the ceRNA networks, miR-221-5p-lnc_000679-WNT3, miR-34a-lnc_000181-GATA3 and miR-214-3p-lnc_000344-SMAD3, were constructed under defined rules, to illustrate their roles in cashmere goat HF biology. The present study provides a resource for lncRNA, miRNA and mRNA studies in cashmere cycling and development. We also demonstrate potential ceRNA regulatory networks in cashmere goat HF cycling for the first time. It expands our knowledge about lncRNA and miRNA biology as well as contributes to the annotation of the goat genome.

  18. Long Non-Coding RNA Profiling in a Non-Alcoholic Fatty Liver Disease Rodent Model: New Insight into Pathogenesis

    Directory of Open Access Journals (Sweden)

    Yi Chen

    2017-01-01

    Full Text Available Non-alcoholic fatty liver disease (NAFLD is one of the most prevalent chronic liver diseases worldwide with an unclear mechanism. Long non-coding RNAs (lncRNAs have recently emerged as important regulatory molecules. To better understand NAFLD pathogenesis, lncRNA and messenger RNA (mRNA microarrays were conducted in an NAFLD rodent model. Potential target genes of significantly changed lncRNA were predicted using cis/trans-regulatory algorithms. Gene Ontology (GO analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway enrichment analysis were then performed to explore their function. In the current analysis, 89 upregulated and 177 downregulated mRNAs were identified, together with 291 deregulated lncRNAs. Bioinformatic analysis of these RNAs has categorized these RNAs into pathways including arachidonic acid metabolism, circadian rhythm, linoleic acid metabolism, peroxisome proliferator-activated receptor (PPAR signaling pathway, sphingolipid metabolism, steroid biosynthesis, tryptophan metabolism and tyrosine metabolism were compromised. Quantitative polymerase chain reaction (qPCR of representative nine mRNAs and eight lncRNAs (named fatty liver-related lncRNA, FLRL was conducted and this verified previous microarray results. Several lncRNAs, such as FLRL1, FLRL6 and FLRL2 demonstrated to be involved in circadian rhythm targeting period circadian clock 3 (Per3, Per2 and aryl hydrocarbon receptor nuclear translocator-like (Arntl, respectively. While FLRL8, FLRL3 and FLRL7 showed a potential role in PPAR signaling pathway through interaction with fatty acid binding protein 5 (Fabp5, lipoprotein lipase (Lpl and fatty acid desaturase 2 (Fads2. Functional experiments showed that interfering of lncRNA FLRL2 expression affected the expression of predicted target, circadian rhythm gene Arntl. Moreover, both FLRL2 and Arntl were downregulated in the NAFLD cellular model. The current study identified lncRNA and corresponding mRNA in NAFLD

  19. SINEUPs are modular antisense long-non coding RNAs that increase synthesis of target proteins in cells

    Directory of Open Access Journals (Sweden)

    Silvia eZucchelli

    2015-05-01

    Full Text Available Despite recent efforts in discovering novel long non-coding RNAs (lncRNAs and unveiling their functions in a wide range of biological processes their applications as biotechnological or therapeutic tools are still at their infancy. We have recently shown that AS Uchl1, a natural lncRNA antisense to the Parkinson’s disease-associated gene Ubiquitin carboxyl-terminal esterase L1 (Uchl1, is able to increase UchL1 protein synthesis at post-transcriptional level. Its activity requires two RNA elements: an embedded inverted SINEB2 sequence to increase translation and the overlapping region to target its sense mRNA. This functional organization is shared with several mouse lncRNAs antisense to protein coding genes. The potential use of AS Uchl1-derived lncRNAs as enhancers of target mRNA translation remains unexplored. Here we define AS Uchl1 as the representative member of a new functional class of natural and synthetic antisense lncRNAs that activate translation. We named this class of RNAs SINEUPs for their requirement of the inverted SINEB2 sequence to UP-regulate translation in a gene-specific manner. The overlapping region is indicated as the Binding Doman (BD while the embedded inverted SINEB2 element is the Effector Domain (ED. By swapping BD, synthetic SINEUPs are designed targeting mRNAs of interest. SINEUPs function in an array of cell lines and can be efficiently directed towards N-terminally tagged proteins. Their biological activity is retained in a miniaturized version within the range of small RNAs length. Its modular structure was exploited to successfully design synthetic SINEUPs targeting endogenous Parkinson’s disease-associated DJ-1 and proved to be active in different neuronal cell lines.In summary, SINEUPs represent the first scalable tool to increase synthesis of proteins of interest. We propose SINEUPs as reagents for molecular biology experiments, in protein manufacturing as well as in therapy of haploinsufficiencies.

  20. Upregulation of long non-coding RNA TUG1 correlates with poor prognosis and disease status in osteosarcoma.

    Science.gov (United States)

    Ma, Bing; Li, Meng; Zhang, Lei; Huang, Ming; Lei, Jun-Bin; Fu, Gui-Hong; Liu, Chun-Xin; Lai, Qi-Wen; Chen, Qing-Quan; Wang, Yi-Lian

    2016-04-01

    The pathogenesis of osteosarcoma involves complex genetic and epigenetic factors. This study was to explore the impact and clinical relevance of long non-coding RNA (lncRNA), Taurine up-regulated gene 1 (TUG1) on patients with osteosarcoma. Seventy-six osteosarcoma tissues and matched adjacent normal tissues were included for analysis. The plasma samples were obtained from 29 patients with osteosarcoma at pre-operation and post-operation, 42 at newly diagnosed, 18 who experienced disease progression or relapse, 45 post-treatment, 36 patients with benign bone tumor, and 20 healthy donors. Quantitative real-time reverse transcript polymerase chain reactions were used to assess the correlation of the expression levels of TUG1 with clinical parameters of osteosarcoma patients. TUG1 was significantly overexpressed in the osteosarcoma tissues compared with matched adjacent normal tissues (P TUG1 strongly correlated with poor prognosis and was an independent prognostic indicator for overall survival (HR = 2.78, 95% CI = 1.29-6.00, P = 0.009) and progression-free survival (HR = 1.81, 95% CI = 1.01-3.54, P = 0.037). Our constructed nomogram containing TUG1 had more predictive accuracy than that without TUG1 (c-index 0.807 versus 0.776, respectively). In addition, for plasma samples, TUG1 expression levels were obviously decreased in post-operative patients (mean ΔCT -4.98 ± 0.22) compared with pre-operation patients (mean ΔCT -6.09 ± 0.74), and the changes of TUG1 expression levels were significantly associated with disease status. Receiver operating characteristic (ROC) curve analysis demonstrated that TUG1 could distinguish patients with osteosarcoma from healthy individuals compared with alkaline phosphatase (ALP) (the area under curve 0.849 versus 0.544). TUG1 was overexpressed in patients with osteosarcoma and strongly correlated with disease status. In addition, TUG1 may serve as a molecular indicator in maintaining surveillance

  1. Integrating RNA-seq and ChIP-seq data to characterize long non-coding RNAs in Drosophila melanogaster.

    Science.gov (United States)

    Chen, Mei-Ju May; Chen, Li-Kai; Lai, Yu-Shing; Lin, Yu-Yu; Wu, Dung-Chi; Tung, Yi-An; Liu, Kwei-Yan; Shih, Hsueh-Tzu; Chen, Yi-Jyun; Lin, Yan-Liang; Ma, Li-Ting; Huang, Jian-Long; Wu, Po-Chun; Hong, Ming-Yi; Chu, Fang-Hua; Wu, June-Tai; Li, Wen-Hsiung; Chen, Chien-Yu

    2016-03-11

    Recent advances in sequencing technology have opened a new era in RNA studies. Novel types of RNAs such as long non-coding RNAs (lncRNAs) have been discovered by transcriptomic sequencing and some lncRNAs have been found to play essential roles in biological processes. However, only limited information is available for lncRNAs in Drosophila melanogaster, an important model organism. Therefore, the characterization of lncRNAs and identification of new lncRNAs in D. melanogaster is an important area of research. Moreover, there is an increasing interest in the use of ChIP-seq data (H3K4me3, H3K36me3 and Pol II) to detect signatures of active transcription for reported lncRNAs. We have developed a computational approach to identify new lncRNAs from two tissue-specific RNA-seq datasets using the poly(A)-enriched and the ribo-zero method, respectively. In our results, we identified 462 novel lncRNA transcripts, which we combined with 4137 previously published lncRNA transcripts into a curated dataset. We then utilized 61 RNA-seq and 32 ChIP-seq datasets to improve the annotation of the curated lncRNAs with regards to transcriptional direction, exon regions, classification, expression in the brain, possession of a poly(A) tail, and presence of conventional chromatin signatures. Furthermore, we used 30 time-course RNA-seq datasets and 32 ChIP-seq datasets to investigate whether the lncRNAs reported by RNA-seq have active transcription signatures. The results showed that more than half of the reported lncRNAs did not have chromatin signatures related to active transcription. To clarify this issue, we conducted RT-qPCR experiments and found that ~95.24% of the selected lncRNAs were truly transcribed, regardless of whether they were associated with active chromatin signatures or not. In this study, we discovered a large number of novel lncRNAs, which suggests that many remain to be identified in D. melanogaster. For the lncRNAs that are known, we improved their

  2. The human PINK1 locus is regulated in vivo by a non-coding natural antisense RNA during modulation of mitochondrial function

    DEFF Research Database (Denmark)

    Scheele, Camilla; Petrovic, Natasa; Faghihi, Mohammad A

    2007-01-01

    . RESULTS: Herein we characterize a novel splice variant of PINK1 (svPINK1) that is homologous to the C-terminus regulatory domain of the protein kinase. Naturally occurring non-coding antisense provides sophisticated mechanisms for diversifying genomes and we describe a human specific non-coding antisense...... expressed at the PINK1 locus (naPINK1). We further demonstrate that PINK1 varies in vivo when human skeletal muscle mitochondrial content is enhanced, supporting the idea that PINK1 has a physiological role in mitochondrion. The observation of concordant regulation of svPINK1 and naPINK1 during in vivo......-transcribed mRNA under physiological abundance conditions. While our analysis implies a possible human specific and dsRNA-mediated mechanism for stabilizing the expression of svPINK1, it also points to a broader genomic strategy for regulating a human disease locus and increases the complexity through which...

  3. Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae.

    Science.gov (United States)

    Burgess, Alice Louise; David, Rakesh; Searle, Iain Robert

    2015-08-14

    , demonstrating the function of tRNA methylation in regulating translation. Additionally we demonstrate that nuclear large subunit 25S rRNA methylation requires the conserved RNA methyltransferase NSUN5. Our results also suggest functional redundancy of at least two of the NOP2 paralogs in Arabidopsis. Our data demonstrates widespread occurrence and conservation of non-coding RNA methylation in the kingdom Plantae, suggesting important and highly conserved roles of this post-transcriptional modification.

  4. Variants in the non-coding region of the TLR2 gene associated with infectious subphenotypes in pediatric sickle cell anemia

    OpenAIRE

    David, Susana; Aguiar, Pedro; Antunes, Liliana; Dias, Alexandra; Morais, Anabela; Sakuntabhai, Anavaj; Lavinha, João

    2017-01-01

    Sickle cell anemia (SCA) is characterized by chronic hemolysis, severe vasoocclusive crises (VOCs), and recurrent often severe infections. A cohort of 95 SCA pediatric patients was the background for genotype-to-phenotype association of the patient's infectious disease phenotype and three non-coding polymorphic regions of the TLR2 gene, the -196 to -174 indel, SNP rs4696480, and a (GT)n short tandem repeat. The infectious subphenotypes included (A) recurrent respiratory infections and (B) sev...

  5. Acadian variant of Fanconi syndrome is caused by mitochondrial respiratory chain complex I deficiency due to a non-coding mutation in complex I assembly factor NDUFAF6

    Czech Academy of Sciences Publication Activity Database

    Hartmannová, H.; Piherová, L.; Tauchmannová, Kateřina; Kidd, K.; Acott, P. D.; Crocker, J. F. S.; Oussedik, Y.; Mallet, M.; Hodaňová, K.; Stránecký, V.; Přistoupilová, A.; Barešová, V.; Jedličková, I.; Živná, M.; Sovová, J.; Hůlková, H.; Robins, V.; Vrbacký, Marek; Pecina, Petr; Kaplanová, Vilma; Houštěk, Josef; Mráček, Tomáš; Thibeault, Y.; Bleyer, A. J.; Kmoch, S.

    2016-01-01

    Roč. 25, č. 18 (2016), s. 4062-4079 ISSN 0964-6906 R&D Projects: GA ČR(CZ) GB14-36804G; GA MŠk(CZ) LL1204 Institutional support: RVO:67985823 Keywords : Acadian variant of Fanconi syndrome * mitochondrial complex I deficiency * NDUFAF6 * C8ORF38 * non-coding mutation * alternative splicing variant * protein isoforms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.340, year: 2016

  6. Study characterizes long non-coding RNA’s response to DNA damage in colon cancer cells | Center for Cancer Research

    Science.gov (United States)

    Researchers led by Ashish Lal, Ph.D., Investigator in the Genetics Branch, have shown that when the DNA in human colon cancer cells is damaged, a long non-coding RNA (lncRNA) regulates the expression of genes that halt growth, which allows the cells to repair the damage and promote survival. Their findings suggest an important pro-survival function of a lncRNA in cancer cells.  Read more...

  7. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions.

    Science.gov (United States)

    Nolte-'t Hoen, Esther N M; Buermans, Henk P J; Waasdorp, Maaike; Stoorvogel, Willem; Wauben, Marca H M; 't Hoen, Peter A C

    2012-10-01

    Cells release RNA-carrying vesicles and membrane-free RNA/protein complexes into the extracellular milieu. Horizontal vesicle-mediated transfer of such shuttle RNA between cells allows dissemination of genetically encoded messages, which may modify the function of target cells. Other studies used array analysis to establish the presence of microRNAs and mRNA in cell-derived vesicles from many sources. Here, we used an unbiased approach by deep sequencing of small RNA released by immune cells. We found a large variety of small non-coding RNA species representing pervasive transcripts or RNA cleavage products overlapping with protein coding regions, repeat sequences or structural RNAs. Many of these RNAs were enriched relative to cellular RNA, indicating that cells destine specific RNAs for extracellular release. Among the most abundant small RNAs in shuttle RNA were sequences derived from vault RNA, Y-RNA and specific tRNAs. Many of the highly abundant small non-coding transcripts in shuttle RNA are evolutionary well-conserved and have previously been associated to gene regulatory functions. These findings allude to a wider range of biological effects that could be mediated by shuttle RNA than previously expected. Moreover, the data present leads for unraveling how cells modify the function of other cells via transfer of specific non-coding RNA species.

  8. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  9. Long Non-Coding RNA Malat-1 Is Dispensable during Pressure Overload-Induced Cardiac Remodeling and Failure in Mice.

    Directory of Open Access Journals (Sweden)

    Tim Peters

    Full Text Available Long non-coding RNAs (lncRNAs are a class of RNA molecules with diverse regulatory functions during embryonic development, normal life, and disease in higher organisms. However, research on the role of lncRNAs in cardiovascular diseases and in particular heart failure is still in its infancy. The exceptionally well conserved nuclear lncRNA Metastasis associated in lung adenocarcinoma transcript 1 (Malat-1 is a regulator of mRNA splicing and highly expressed in the heart. Malat-1 modulates hypoxia-induced vessel growth, activates ERK/MAPK signaling, and scavenges the anti-hypertrophic microRNA-133. We therefore hypothesized that Malat-1 may act as regulator of cardiac hypertrophy and failure during cardiac pressure overload induced by thoracic aortic constriction (TAC in mice.Absence of Malat-1 did not affect cardiac hypertrophy upon pressure overload: Heart weight to tibia length ratio significantly increased in WT mice (sham: 5.78±0.55, TAC 9.79±1.82 g/mm; p<0.001 but to a similar extend also in Malat-1 knockout (KO mice (sham: 6.21±1.12, TAC 8.91±1.74 g/mm; p<0.01 with no significant difference between genotypes. As expected, TAC significantly reduced left ventricular fractional shortening in WT (sham: 38.81±6.53%, TAC: 23.14±11.99%; p<0.01 but to a comparable degree also in KO mice (sham: 37.01±4.19%, TAC: 25.98±9.75%; p<0.05. Histological hallmarks of myocardial remodeling, such as cardiomyocyte hypertrophy, increased interstitial fibrosis, reduced capillary density, and immune cell infiltration, did not differ significantly between WT and KO mice after TAC. In line, the absence of Malat-1 did not significantly affect angiotensin II-induced cardiac hypertrophy, dysfunction, and overall remodeling. Above that, pressure overload by TAC significantly induced mRNA levels of the hypertrophy marker genes Nppa, Nppb and Acta1, to a similar extend in both genotypes. Alternative splicing of Ndrg2 after TAC was apparent in WT (isoform ratio

  10. Long non-coding RNA TUG1 can promote proliferation and migration of pancreatic cancer via EMT pathway.

    Science.gov (United States)

    Qin, C-F; Zhao, F-L

    2017-05-01

    This paper aimed to investigate the effect of long non-coding RNA TUG1 (lncRNA TUG1) on cell proliferation, as well as cell migration in pancreatic cancer. The mRNA levels of Taurine-up-regulated gene 1 (TUG1) in three kinds of pancreatic cancer cells BxPC3, PaTu8988 and SW1990 was detected by RT-qPCR. Meantime, RT-qPCR was used to examine the mRNA levels of TUG1 in 20 cases of human pancreatic cancer tissues and its para-carcinoma tissues. pCDH-TUG1 plasmid and its empty plasmid pCDH were transfected into BxPC3 and PaTu8988 cells to up-regulate TUG1 expression. siRNA targeting TUG1 and the control siRNA were transfected into SW1990 cells to down-regulate TUG1 expression. Cell clone formation and CCK-8 assay were used to detect the cell proliferation capacity. Transwell assay was used to evaluate cell migration capacity. Western blot was applied to examine the protein expressions of MMP2, MMP9, E-cadherin, Smad 2, Smad 3, p-Smad 2, p-Smad 3, TGF-β and TGF-βR. RT-qPCR was used to detect the levels of MMP2 and MMP9. The results showed that TUG1 was differentially expressed in the three kinds of pancreatic cancer cells, among which the expression level of SW1990 was relatively high, and the expression levels of BxPC3 and PaTu8988 were relatively low. TUG1 had more expression in pancreatic cancer tissues than that in para-carcinoma tissues. After the up-regulation of TUG1, cell proliferation and migration capacities were increased, protein levels of MMP2 and MMP9 were increased and protein level of E-cadherin was declined. Conversely, after down-regulation of TUG1 expression, cell proliferation and migration capacities were weakened, protein levels of MMP2 and MMP9 were decreased and protein level of E-cadherin was increased. In addition, over-expressed TUG1 could promote Smad2 and Smad3 phosphorylation, but Smad2 and Smad3 phosphorylation were weakened after down-regulated expression of TUG1. The protein expression of TGF-β and TGF-β receptor were more in the TUG1

  11. Upregulated long non-coding RNAs demonstrate promising efficacy for breast cancer detection: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Yu G

    2018-03-01

    Full Text Available Guozheng Yu,1,2 Wei Zhang,2,3 Linyan Zhu,1,2 Lin Xia2,4 1Department of General Surgery, Huangshi Central Hospital of Edong Healthcare Group, Affiliated Hospital of Hubei Polytechnic University, 2Hubei Key Laboratory of Kidney Disease Pathogenesis and Intervention, 3Department of Clinical Laboratory, 4Department of Medical Oncology, Huangshi Central Hospital of Edong Healthcare Group, Affiliated Hospital of Hubei Polytechnic University, Huangshi, China Purpose: Focusing on the latest literature, dysregulated long non-coding RNAs (lncRNAs have been extensively explored in breast cancer (BC research. The purpose of this meta-analysis is to synthesize the evidence on the diagnostic performance of abnormally expressed lncRNAs for BC.Materials and methods: Relevant studies were searched in multiple electronic databases. The Quality Assessment of Diagnosis Accuracy Studies II criteria were applied to assess the quality of included studies. The bivariate meta-analysis model was applied to synthesize the diagnostic parameters using Stata 12.0 software. Publication bias was judged in terms of the Deek’s funnel plot asymmetry test.Results: We included 10 eligible studies, which comprised 835 BC patients and 725 paired controls for this meta-analysis. The pooled sensitivity, specificity, diagnostic odds ratio, likelihood ratio positive, likelihood ratio negative, and area under the curve (AUC of upregulated lncRNA expression signature in confirming BC were 0.79 (95% CI: 0.70–0.85, 0.80 (95% CI: 0.73–0.85, 14.61 (95% CI: 10.91–19.55, 3.90 (95% CI: 3.03–5.02, 0.27 (95% CI: 0.20–0.36, and 0.86, respectively. Stratified analyses yielded a sensitivity of 0.83 (95% CI: 0.80–0.86 for serum-based analysis, which was higher than plasma-based analysis, whereas plasma-based analysis revealed a greater specificity of 0.88 (95% CI: 0.85–0.91. Moreover, lncRNA-homeotic genes (HOX transcript antisense RNA showed a pooled specificity of 0.89 (95% CI: 0.84

  12. The expression pattern of long non-coding RNA PVT1 in tumor tissues and in extracellular vesicles of colorectal cancer correlates with cancer progression.

    Science.gov (United States)

    Guo, Kai; Yao, Jie; Yu, Qiang; Li, Zijian; Huang, Hu; Cheng, Jianguo; Wang, Zhigang; Zhu, Yunfeng

    2017-04-01

    The plasmacytoma variant translocation 1 gene (PVT1) is a large non-coding locus at adjacent of c-Myc, and long non-coding RNA PVT1 is now recognized as a cancerous gene co-amplified with c-Myc in various cancers. But the expression and functional role of PVT1 in colorectal cancer are still unelucidated. In addition, all the reported long non-coding RNAs so far are discovered in either cells or tissues, but no research about long non-coding RNAs detection in extracellular vesicles has been reported yet. In the present study, we firstly investigated the expression of PVT1 in colorectal cancer specimens and its correlation with the expression of c-Myc and other related genes by real-time polymerase chain reaction. Then, we isolated the extracellular vesicles from colorectal cancer cells culturing medium by differential centrifugation and detected the PVT1 expression in extracellular vesicles by using real-time polymerase chain reaction. The PVT1 targeting siRNA was transfected into SW480 and SW620 cells, and 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay and flow cytometry were used to evaluate the cell proliferation and apoptosis. The results showed that the PVT1 expression in tumor tissues was higher than that in normal tissues, which was significantly correlated with the expression of c-Myc and three c-Myc regulating genes FUBP1, EZH2, and NPM1 and also correlated with the expression of two other PVT1-associated transcript factors nuclear factor-κB and myocyte-specific enhancer factor 2A. Here, we reported for the first time that PVT1 as a long non-coding RNA was successfully detected in extracellular vesicles excluded from SW620 and SW480 cells, and the expression level of PVT1 was higher in extracellular vesicles from the more aggressive cell SW620 than from SW480. The results also showed that by down-regulating the PVT1 expression, the c-Myc expression was suppressed, the cell proliferation was inhibited, and

  13. Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

    Directory of Open Access Journals (Sweden)

    Argüello-Astorga Gerardo R

    2010-10-01

    Full Text Available Abstract Background Euphorbia mosaic virus (EuMV is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in

  14. A novel intergenic ETnII-β insertion mutation causes multiple malformations in polypodia mice.

    Directory of Open Access Journals (Sweden)

    Jessica A Lehoczky

    Full Text Available Mouse early transposon insertions are responsible for ~10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd, a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5' LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development.

  15. Ribosomal intergenic spacer analysis as a tool for monitoring methanogenic Archaea changes in an anaerobic digester.

    Science.gov (United States)

    Ciesielski, Slawomir; Bułkowska, Katarzyna; Dabrowska, Dorota; Kaczmarczyk, Dariusz; Kowal, Przemyslaw; Możejko, Justyna

    2013-08-01

    The applicability of a newly-designed PCR primer pair in examination of methanogenic Archaea in a digester treating plant biomass was evaluated by Ribosmal Intergenic Spacer Analysis (RISA). To find a suitable approach, three variants of RISA were tested: (1) standard, polyacrylamide gel-based, (2) automated, utilized capillary electrophoresis (GA-ARISA), and (3) automated microfluidics-based (MF-ARISA). All three techniques yielded a consistent picture of archaeal community structure changes during anaerobic digestion monitored for more than 6 weeks. While automated variants were more practical for handling and rapid analysis of methanogenic Archaea, the gel-based technique was advantageous when micro-organism identification was required. A DNA-sequence analysis of dominant bands extracted from the gel revealed that the main role in methane synthesis was played by micro-organisms affiliated with Methanosarcina barkeri. The obtained results revealed that RISA is a robust method allowing for detailed analysis of archaeal community structure during organic biomass conversion into biogas. In addition, our results showed that GA-ARISA has a higher resolution and reproducibility than other variants of RISA and could be used as a technique for tracking changes in methanogenic Archaea in an anaerobic digester.

  16. The evolutionary landscape of intergenic trans-splicing events in insects

    Science.gov (United States)

    Kong, Yimeng; Zhou, Hongxia; Yu, Yao; Chen, Longxian; Hao, Pei; Li, Xuan

    2015-01-01

    To explore the landscape of intergenic trans-splicing events and characterize their functions and evolutionary dynamics, we conduct a mega-data study of a phylogeny containing eight species across five orders of class Insecta, a model system spanning 400 million years of evolution. A total of 1,627 trans-splicing events involving 2,199 genes are identified, accounting for 1.58% of the total genes. Homology analysis reveals that mod(mdg4)-like trans-splicing is the only conserved event that is consistently observed in multiple species across two orders, which represents a unique case of functional diversification involving trans-splicing. Thus, evolutionarily its potential for generating proteins with novel function is not broadly utilized by insects. Furthermore, 146 non-mod trans-spliced transcripts are found to resemble canonical genes from different species. Trans-splicing preserving the function of ‘breakup' genes may serve as a general mechanism for relaxing the constraints on gene structure, with profound implications for the evolution of genes and genomes. PMID:26521696

  17. The Intergenic Recombinant HLA-B*46:01 Has a Distinctive Peptidome that Includes KIR2DL3 Ligands

    DEFF Research Database (Denmark)

    Hilton, Hugo G.; McMurtrey, Curtis P.; Han, Alex S.

    2017-01-01

    HLA-B*46:01 was formed by an intergenic mini-conversion, between HLA-B*15:01 and HLA-C*01:02, in Southeast Asia during the last 50,000 years, and it has since become the most common HLA-B allele in the region. A functional effect of the mini-conversion was introduction of the C1 epitope into HLA...

  18. Genome-wide profiling of miRNAs and other small non-coding RNAs in the Verticillium dahliae-inoculated cotton roots.

    Directory of Open Access Journals (Sweden)

    Zujun Yin

    Full Text Available MicroRNAs (miRNAs and small interfering RNAs (siRNAs are short (19-25 nucleotides non-coding RNA molecules that have large-scale regulatory effects on development and stress responses in plants. Verticillium wilt is a vascular disease in plants caused by the fungal pathogen Verticillium dahliae. The objective of this study is to investigate the transcriptional profile of miRNAs and other small non-coding RNAs in Verticillium-inoculated cotton roots. Four small RNA libraries were constructed from mocked and infected roots of two cotton cultured species which are with different Verticillium wilt tolerance ('Hai-7124', Gossypium barbadense L., a Verticillium-tolerant cultivar, and 'Yi-11', Gossypium hirsutum L. a Verticillium-sensitive cultivar. The length distribution of obtained small RNAs was significantly different between libraries. There were a total of 215 miRNA families identified in the two cotton species. Of them 14 were novel miRNAs. There were >65 families with different expression between libraries. We also identified two trans-acting siRNAs and thousands of endogenous siRNA candidates, and hundred of them exhibited altered expression after inoculation of Verticillium. Interesting, many siRNAs were found with a perfect match with retrotransposon sequences, suggested that retrotransposons maybe one of sources for the generation of plant endogenous siRNAs. The profiling of these miRNAs and other small non-coding RNAs lay the foundation for further understanding of small RNAs function in the regulation of Verticillium defence responses in cotton roots.

  19. Lymphoid hyperplasia and lymphoma in transgenic mice expressing the small non-coding RNA, EBER1 of Epstein-Barr virus.

    Directory of Open Access Journals (Sweden)

    Claire E Repellin

    2010-02-01

    Full Text Available Non-coding RNAs have critical functions in diverse biological processes, particularly in gene regulation. Viruses, like their host cells, employ such functional RNAs and the human cancer associated Epstein-Barr virus (EBV is no exception. Nearly all EBV associated tumours express the EBV small, non-coding RNAs (EBERs 1 and 2, however their role in viral pathogenesis remains largely obscure.To investigate the action of EBER1 in vivo, we produced ten transgenic mouse lines expressing EBER1 in the lymphoid compartment using the mouse immunoglobulin heavy chain intronic enhancer Emicro. Mice of several of these EmicroEBER1 lines developed lymphoid hyperplasia which in some cases proceeded to B cell malignancy. The hallmark of the transgenic phenotype is enlargement of the spleen and mesenteric lymph nodes and in some cases enlargement of the thymus, liver and peripheral lymph nodes. The tumours were found to be of B cell origin and showed clonal IgH rearrangements. In order to explore if EBER1 would cooperate with c-Myc (deregulated in Burkitt's lymphoma to accelerate lymphomagenesis, a cross-breeding study was undertaken with EmicroEBER1 and EmicroMyc mice. While no significant reduction in latency to lymphoma onset was observed in bi-transgenic mice, c-Myc induction was detected in some EmuEBER1 single transgenic tumours, indicative of a functional cooperation.This study is the first to describe the in vivo expression of a polymerase III, non-coding viral gene and demonstrate its oncogenic potential. The data suggest that EBER1 plays an oncogenic role in EBV associated malignant disease.

  20. Cloning and over expression of non-coding RNA rprA in E.coli and its resistance to Kanamycin without osmotic shock.

    Science.gov (United States)

    Sahni, Azita; Hajjari, Mohammadreza; Raheb, Jamshid; Foroughmand, Ali Mohammad; Asgari, Morteza

    2017-01-01

    Recent reports have indicated that small RNAs have key roles in the response of the E.coli to stress and also in the regulating of virulence factors. It seems that some small non-coding RNAs are involved in multidrug resistance. Previous studies have indicated that rprA can increase the tolerance to Kanamycin in RcsB-deficient Escherichia coli K-12 following osmotic shock. The current study aims to clone and over-express the non-coding RNA rprA in E.coli and investigate its effect on the bacterial resistance to Kanamycin without any osmotic shock. For this purpose, rprA gene was amplified by the PCR and then cloned into the PET-28a (+) vector. The recombinant plasmid was transformed into wild type E.coli BL21 (DE3). The over expression was induced by IPTG and confirmed by qRT-PCR. The resistance to the kanamycin was then measured in different times by spectrophotometry. The statistical analysis showed that the rprA can increase the resistance to Kanamycin in Ecoli K12. The interaction between rprA and rpoS was reviewed and analyzed by in silico methods. The results showed that the bacteria with over-expressed rprA were more resistant to Kanamycin. The present study is an important step to prove the role of non-coding RNA rprA in bacterial resistance. The data can be the basis for future works and can also help to develop and deliver next-generation antibiotics.

  1. Identification of kakusei, a Nuclear Non-Coding RNA, as an Immediate Early Gene from the Honeybee, and Its Application for Neuroethological Study

    Directory of Open Access Journals (Sweden)

    Taketoshi Kiya

    2012-11-01

    Full Text Available The honeybee is a social insect that exhibits various social behaviors. To elucidate the neural basis of honeybee behavior, we detected neural activity in freely-moving honeybee workers using an immediate early gene (IEG that is expressed in a neural activity-dependent manner. In European honeybees (Apis mellifera, we identified a novel nuclear non-coding RNA, termed kakusei, as the first insect IEG, and revealed the neural activity pattern in foragers. In addition, we isolated a homologue of kakusei, termed Acks, from the Japanese honeybee (Apis cerana, and detected active neurons in workers fighting with the giant hornet.

  2. Long non-coding RNA TUG1 promotes progression of oral squamous cell carcinoma through upregulating FMNL2 by sponging miR-219

    OpenAIRE

    Yan, Guangqi; Wang, Xue; Yang, Mingliang; Lu, Li; Zhou, Qing

    2017-01-01

    Oral squamous cell carcinoma (OSCC) is a prevalent oral disease with a high morbidity and mortality rate. Several long non-coding RNAs (lncRNAs) were identified as important regulators of carcinogenesis. However, the pathogenic implications of TUG1 in OSCC are still unclear. In the present study, the expression of TUG1 was increased in OSCC cells. Knockdown of TUG1 inhibited cell proliferation, migration, and invasion, and induced cell cycle arrest at G0/G1 phase, whereas overexpression of TU...

  3. The Investigation of Promoter Sequences of Marseilleviruses Highlights a Remarkable Abundance of the AAATATTT Motif in Intergenic Regions.

    Science.gov (United States)

    Oliveira, Graziele Pereira; Lima, Maurício Teixeira; Arantes, Thalita Souza; Assis, Felipe Lopes; Rodrigues, Rodrigo Araújo Lima; da Fonseca, Flávio Guimarães; Bonjardim, Cláudio Antônio; Kroon, Erna Geessien; Colson, Philippe; La Scola, Bernard; Abrahão, Jônatas Santos

    2017-11-01

    Viruses display a wide range of genomic profiles and, consequently, a variety of gene expression strategies. Specific sequences associated with transcriptional processes have been described in viruses, and putative promoter motifs have been elucidated for some nucleocytoplasmic large DNA viruses (NCLDV). Among NCLDV, the Marseilleviridae is a well-recognized family because of its genomic mosaicism. The marseilleviruses have an ability to incorporate foreign genes, especially from sympatric organisms inhabiting Acanthamoeba , its main known host. Here, we identified for the first time an eight-nucleotide A/T-rich promoter sequence (AAATATTT) associated with 55% of marseillevirus genes that is conserved in all marseilleviruses lineages, a higher level of conservation than that of any giant virus described to date. We instigated our prediction about the promoter motif by biological assays and by evaluating how single mutations in this octamer can impact gene expression. The investigation of sequences that regulate the expression of genes relative to lateral transfer revealed that the promoter motifs do not appear to be incorporated by marseilleviruses from donor organisms. Indeed, analyses of the intergenic regions that regulate lateral gene transfer-related genes have revealed an independent origin of the marseillevirus intergenic regions that does not match gene-donor organisms. About 50% of AAATATTT motifs spread throughout intergenic regions of the marseilleviruses are present as multiple copies. We believe that such multiple motifs are associated with increased expression of a given gene or are related to incorporation of foreign genes into the mosaic genome of marseilleviruses. IMPORTANCE The marseilleviruses draw attention because of the peculiar features of their genomes; however, little is known about their gene expression patterns or the factors that regulate those expression patterns. The limited published research on the expression patterns of the

  4. Analysis of a ribosomal DNA intergenic spacer region from the yellow fever mosquito, Aedes aegypti.

    Science.gov (United States)

    Wu, C C; Fallon, A M

    1998-02-01

    We have sequenced the 1.8 kb intergenic spacer (IGS) region from an Aedes aegypti ribosomal DNA repeat and have identified conserved functional motifs shared with the related mosquito, Aedes albopictus. Despite the shorter length and greater homogeneity of the Ae. aegypti IGS region, the sequences of two potential RNA polymerase I core promoters and closely associated terminator elements were highly conserved. Primer extension analysis indicated that the predominant transcription initiation site in the Ae. aegypti rDNA repeat unit region lay at or near the A residue at nucleotide position 1003 in the 'upstream' RNA polymerase I promoter. This observation was supported by the higher sequence identity between the upstream promoters in Ae. aegypti and Ae. albopictus, relative to the downstream promoters. In contrast to strong similarities among proximal regulatory elements, the Ae. aegypti IGS sequence upstream of the transcription initiation site lacked the ordered array of contiguous approximately 200 nucleotide subrepeats previously found in the IGS of Ae. albopictus. In Ae. aegypti, only 4 approximately 50 nucleotide R subrepeats separated by unique sequences, followed by 2 approximately 50 nucleotide E subrepeats, occurred upstream of the transcription initiation site. Despite their differences in size and sequence, however, the four Ae. aegypti R subrepeats shared an internal structural organization that included a conserved core with 'spacer' promoters and recombinogenic elements similar to those in the longer Ae. albopictus subrepeats. These observations provide an important basis for further characterization of transcription specificity among mosquito RNA polymerase I promoters and associated regulatory elements, and contribute towards the eventual use of these elements in transgenic applications.

  5. Intergenic DNA sequences from the human X chromosome reveal high rates of global gene flow

    Directory of Open Access Journals (Sweden)

    Wall Jeffrey D

    2008-11-01

    Full Text Available Abstract Background Despite intensive efforts devoted to collecting human polymorphism data, little is known about the role of gene flow in the ancestry of human populations. This is partly because most analyses have applied one of two simple models of population structure, the island model or the splitting model, which make unrealistic biological assumptions. Results Here, we analyze 98-kb of DNA sequence from 20 independently evolving intergenic regions on the X chromosome in a sample of 90 humans from six globally diverse populations. We employ an isolation-with-migration (IM model, which assumes that populations split and subsequently exchange migrants, to independently estimate effective population sizes and migration rates. While the maximum effective size of modern humans is estimated at ~10,000, individual populations vary substantially in size, with African populations tending to be larger (2,300–9,000 than non-African populations (300–3,300. We estimate mean rates of bidirectional gene flow at 4.8 × 10-4/generation. Bidirectional migration rates are ~5-fold higher among non-African populations (1.5 × 10-3 than among African populations (2.7 × 10-4. Interestingly, because effective sizes and migration rates are inversely related in African and non-African populations, population migration rates are similar within Africa and Eurasia (e.g., global mean Nm = 2.4. Conclusion We conclude that gene flow has played an important role in structuring global human populations and that migration rates should be incorporated as critical parameters in models of human demography.

  6. The music of trees: the intergenerative tie between primary care and public health.

    Science.gov (United States)

    Whitehouse, Peter

    2016-01-01

    Stories help us frame and understand complex ideas and challenges. Metaphors are particularly powerful linguistic devices that guide and extend our thinking by bridging conceptual domains, for example to consider the brain as a digital computer. Trees are widely used as metaphors for broad concepts like evolution, history, society, and even life itself, i.e. 'the tree of life'. Tree-like diagrams of roots and branches are used to demonstrate historical and cultural relationships, for example, between different species or different languages. In this paper, we describe a theatrical character called a tree doctor which is a living metaphor. A human being, namely the author, lectures, acts or dances as a tree and offers lessons to Homo Sapiens about 'holistic' ideas of health. The character teaches us to not only see the value of our relationships to trees, but the importance of seeing forests as well the individual trees. The metaphorical statement that we should not 'miss the forest for the trees' means we should learn to think of health embedded in systems and communities. In medicine, we too often focus on individual molecules, pharmaceuticals, or even patients and miss the bigger picture of public and environmental health. In a time of great ecological system change, the tree doctor points to broad ethical responsibility for each other and future generations of humans and other living creatures. The character embraces arts and particularly music as a powerful way of infusing purpose and improving the qualities of our lives together, especially as we age. The tree doctor knows the value of intergenerational relationships. But it also points to intergenerative innovations across many cultural domains, disciplines and professions. The tree doctor supports primary care and empowers the value of intergenerational relationships, art and music in the recommendations doctors make to patients to improve their health and well-being.

  7. Molecular identification of Azospirillum spp.: Limitations of 16S rRNA and qualities of rpoD as genetic markers.

    Science.gov (United States)

    Maroniche, Guillermo A; García, Julia E; Salcedo, Florencia; Creus, Cecilia M

    2017-01-01

    Since their discovery, plant-growth promoting rhizobacteria from the genus Azospirillum have been subjected to intensive research due to their biotechnological potential as crop inoculants. Phylogenetic analysis of Azospirillum spp. is carried out by 16S rRNA sequencing almost exclusively, but inconsistencies and low confidence often arise when working with close species. In this work, it was observed that these difficulties might be explained by a high number of rRNA operons with considerable inter-genic variability within Azospirillum genomes. To search for alternative genetic markers from a list of housekeeping genes, the correlation between pairwise gene and whole-genome similarities was examined. Due to its good performance, rpoD was selected for further analyses. Genus-specific primers for the PCR-amplification and sequencing of rpoD from Azospirillum spp. were designed and tested on 16 type strains of different species. The sequences obtained were used for inferring a phylogenetic tree of the genus, which was in turn used as a reference to successfully identify a collection of 31 azospirilla isolated from many different locations of Argentine. In addition, several strains that might represent novel species were detected. The results indicate that the sequencing of rpoD is a suitable alternative method for a confident molecular identification in Azospirillum spp. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.

    Science.gov (United States)

    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed.

  9. Changes in the Coding and Non-coding Transcriptome and DNA Methylome that Define the Schwann Cell Repair Phenotype after Nerve Injury

    Directory of Open Access Journals (Sweden)

    Peter J. Arthur-Farraj

    2017-09-01

    Full Text Available Repair Schwann cells play a critical role in orchestrating nerve repair after injury, but the cellular and molecular processes that generate them are poorly understood. Here, we perform a combined whole-genome, coding and non-coding RNA and CpG methylation study following nerve injury. We show that genes involved in the epithelial-mesenchymal transition are enriched in repair cells, and we identify several long non-coding RNAs in Schwann cells. We demonstrate that the AP-1 transcription factor C-JUN regulates the expression of certain micro RNAs in repair Schwann cells, in particular miR-21 and miR-34. Surprisingly, unlike during development, changes in CpG methylation are limited in injury, restricted to specific locations, such as enhancer regions of Schwann cell-specific genes (e.g., Nedd4l, and close to local enrichment of AP-1 motifs. These genetic and epigenomic changes broaden our mechanistic understanding of the formation of repair Schwann cell during peripheral nervous system tissue repair.

  10. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    Science.gov (United States)

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  11. Long non-coding RNA TUG1 promotes endometrial cancer development via inhibiting miR-299 and miR-34a-5p.

    Science.gov (United States)

    Liu, Lifen; Chen, Xin; Zhang, Ying; Hu, Yanrong; Shen, Xiaoqing; Zhu, Weipei

    2017-05-09

    It is generally known that the human genome makes a large amount of noncoding RNAs compared with coding genes. Long non-coding RNAs (lncRNAs) which composed of more than 200 nucleotides have been described as the largest subclass of the non-coding transcriptome in human noncoding RNAs. Existing research shows that lncRNAs exerted biological functions in various tumors via participating in both oncogenic and tumor suppressing pathways. The previous studies indicated that lncRNA taurine upregulated 1 (TUG1) play important roles in the initiation and progression of malignancies. In this study,based on previous research, we investigated the expression and biological role of the lncRNA-TUG1. We analyzed the relationship between lncRNA-TUG1and endometrial carcinoma (EC) in a total 104 EC carcinoma specimens, compared with that in normal tissues. We found that lncRNA-TUG1 expression in cancer tissues was significantly higher than that in adjacent tissues. Through a series of experiments, the results demonstrated that lncRNA-TUG1 enhances the evolution and progression of EC through inhibiting miR-299 and miR-34a-5p.

  12. Characterization of non-coding DNA satellites associated with sweepoviruses (genus Begomovirus, Geminiviridae - definition of a distinct class of begomovirus-associated satellites

    Directory of Open Access Journals (Sweden)

    Gloria eLozano

    2016-02-01

    Full Text Available Begomoviruses (family Geminiviridae are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas. Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus–satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus, with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed.

  13. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  14. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  15. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  16. Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4

    Directory of Open Access Journals (Sweden)

    Zoghbi Huda Y

    2001-10-01

    Full Text Available Abstract Background The tropomodulins (TMODs are a family of proteins that cap the pointed ends of actin filaments. Four TMODs have been identified in humans, with orthologs in mice. Mutations in actin or actin-binding proteins have been found to cause several human diseases, ranging from hypertrophic cardiomyopathy to immunodefiencies such as Wiskott-Aldrich syndrome. We had previously mapped Tropomodulin 2 (TMOD2 to the genomic region containing the gene for amyotrophic lateral sclerosis 5 (ALS5. We determined the genomic structure of Tmod2 in order to better analyze patient DNA for mutations; we also determined the genomic structure of Tropomodulin 4 (TMOD4. Results In this study, we determined the genomic structure of TMOD2 and TMOD4 and found the organization of both genes to be similar. Sequence analysis of TMOD2 revealed no mutations or polymorphisms in ALS5 patients or controls. Interestingly, we discovered that another gene, YL-1, intergenically splices into TMOD4. YL-1 encodes six exons, the last of which is 291 bp from a 5' untranslated exon of TMOD4. We used 5' RACE and RT-PCR from TMOD4 to identify several intergenic RACE products. YL-1 was also found to undergo unconventional splicing using non-canonical splice sites within exons (intraexonic splicing to produce several alternative transcripts. Conclusions The genomic structure of TMOD2 and TMOD4 have been delineated. This should facilitate future mutational analysis of these genes. In addition, intergenic splicing at TMOD4/YL-1 was discovered, demonstrating yet another level of complexity of gene organization and regulation.

  17. Dengue virus genomic variation associated with mosquito adaptation defines the pattern of viral non-coding RNAs and fitness in human cells.

    Directory of Open Access Journals (Sweden)

    Claudia V Filomatori

    2017-03-01

    Full Text Available The Flavivirus genus includes a large number of medically relevant pathogens that cycle between humans and arthropods. This host alternation imposes a selective pressure on the viral population. Here, we found that dengue virus, the most important viral human pathogen transmitted by insects, evolved a mechanism to differentially regulate the production of viral non-coding RNAs in mosquitos and humans, with a significant impact on viral fitness in each host. Flavivirus infections accumulate non-coding RNAs derived from the viral 3'UTRs (known as sfRNAs, relevant in viral pathogenesis and immune evasion. We found that dengue virus host adaptation leads to the accumulation of different species of sfRNAs in vertebrate and invertebrate cells. This process does not depend on differences in the host machinery; but it was found to be dependent on the selection of specific mutations in the viral 3'UTR. Dissecting the viral population and studying phenotypes of cloned variants, the molecular determinants for the switch in the sfRNA pattern during host change were mapped to a single RNA structure. Point mutations selected in mosquito cells were sufficient to change the pattern of sfRNAs, induce higher type I interferon responses and reduce viral fitness in human cells, explaining the rapid clearance of certain viral variants after host change. In addition, using epidemic and pre-epidemic Zika viruses, similar patterns of sfRNAs were observed in mosquito and human infected cells, but they were different from those observed during dengue virus infections, indicating that distinct selective pressures act on the 3'UTR of these closely related viruses. In summary, we present a novel mechanism by which dengue virus evolved an RNA structure that is under strong selective pressure in the two hosts, as regulator of non-coding RNA accumulation and viral fitness. This work provides new ideas about the impact of host adaptation on the variability and evolution of

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  19. Gene expression profile and long non-coding RNA analysis, using RNA-Seq, in chicken embryonic fibroblast cells infected by avian leukosis virus J.

    Science.gov (United States)

    Hu, Xuming; Chen, Shihao; Jia, Chongxin; Xue, Songlei; Dou, Chunfeng; Dai, Zhenqing; Xu, Hui; Sun, Zhen; Geng, Tuoyu; Cui, Hengmi

    2018-03-01

    Avian leukosis virus J (ALVJ) infection induces hematopoietic malignancy in myeloid leukemia and hemangioma in chickens. However, little is known about the mechanisms underpinning the unique pathogenesis of ALVJ. In this study, we investigated the gene expression profiles of ALVJ-infected chicken cells and performed a comprehensive analysis of the long non-coding RNAs (lncRNAs) in CEF cells using RNA-Seq. As a result, 36 differentially expressed lncRNAs and 91 genes (FC > 2 and q-values IL4I1, and IRF1 (FC > 2 and correlation > 0.95), were highly correlated with the upregulation of several lncRNAs, including MG066618, MG066617, MG066601, MG066629, MG066609 and MG066616. These findings identify the expression profile of lncRNAs in chicken CEF cells infected by ALVJ virus and provide new insights into the molecular mechanisms of ALVJ infection.

  20. Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism

    OpenAIRE

    Zhang, Shanshan; Liu, Shuang; Wu, Nan; Yuan, Youhua; Zhang, Wenhong; Zhang, Ying

    2018-01-01

    As dormant phenotypic variants of bacteria, persisters account for many chronic infections affecting human health. Despite numerous studies, the role of small non-coding RNA (sRNA) in bacterial persistence has not been reported. To investigate the role of Hfq-interacting sRNA in persistence, we constructed the deletion mutants of 20 Hfq-interacting sRNAs (RyhB, GcvB, MgrR, RybB, MicF, SgrS, RprA, DicF, SsrS, FnrS, GadY, DsrA, OmrB, ArcZ, RyeB, RydC, OmrA, MicA, MicC, and ChiX) to assess their...

  1. [Expression of long non-coding RNA SNHG8 in Epstein-Barr virus-related gastric cancer and clinical outcome].

    Science.gov (United States)

    Chen, B Z; Lin, X D; Chen, G; Hu, D; Zhu, Q; Shi, Y; Wang, X J; Jin, S F; Wang, H F; Zheng, X W

    2017-02-08

    Objective: To investigate the expression of long non-coding RNA (lncRNA) SNHG8 in EB virus related gastric cancer and their correlation prognosis. Methods: The expression of SNHG8 in 93 gastric cancers and 93 cancer-free controls, matched by age and sex, were determined by real-time PCR. EB virus expression was detected by EBER in situ hybridization. Results: Forty-one gastric cancers were EB virus associated. For all gastric cancers, SNHG8 expression was 14 times higher ( P =0.001) than that in non-cancer controls; in the EB virus related gastric cancers, SNHG8 expression was increased 25 times ( P virus negative gastric cancers. SNHG8 expression level was also significantly associated with TNM staging ( P virus infection of gastric mucosa may promote SNHG8 expression.

  2. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    BACKGROUND: The variant surface antigen family Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) is an important target for protective immunity and is implicated in the pathology of malaria through its ability to adhere to host endothelial receptors. The sequence diversity and organiz......BACKGROUND: The variant surface antigen family Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) is an important target for protective immunity and is implicated in the pathology of malaria through its ability to adhere to host endothelial receptors. The sequence diversity...... and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  3. Genome defense against exogenous nucleic acids in eukaryotes by non-coding DNA occurs through CRISPR-like mechanisms in the cytosol and the bodyguard protection in the nucleus.

    Science.gov (United States)

    Qiu, Guo-Hua

    2016-01-01

    In this review, the protective function of the abundant non-coding DNA in the eukaryotic genome is discussed from the perspective of genome defense against exogenous nucleic acids. Peripheral non-coding DNA has been proposed to act as a bodyguard that protects the genome and the central protein-coding sequences from ionizing radiation-induced DNA damage. In the proposed mechanism of protection, the radicals generated by water radiolysis in the cytosol and IR energy are absorbed, blocked and/or reduced by peripheral heterochromatin; then, the DNA damage sites in the heterochromatin are removed and expelled from the nucleus to the cytoplasm through nuclear pore complexes, most likely through the formation of extrachromosomal circular DNA. To strengthen this hypothesis, this review summarizes the experimental evidence supporting the protective function of non-coding DNA against exogenous nucleic acids. Based on these data, I hypothesize herein about the presence of an additional line of defense formed by small RNAs in the cytosol in addition to their bodyguard protection mechanism in the nucleus. Therefore, exogenous nucleic acids may be initially inactivated in the cytosol by small RNAs generated from non-coding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. Exogenous nucleic acids may enter the nucleus, where some are absorbed and/or blocked by heterochromatin and others integrate into chromosomes. The integrated fragments and the sites of DNA damage are removed by repetitive non-coding DNA elements in the heterochromatin and excluded from the nucleus. Therefore, the normal eukaryotic genome and the central protein-coding sequences are triply protected by non-coding DNA against invasion by exogenous nucleic acids. This review provides evidence supporting the protective role of non-coding DNA in genome defense. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Long non-coding RNA CCAT2 is associated with poor prognosis in hepatocellular carcinoma and promotes tumor metastasis by regulating Snail2-mediated epithelial–mesenchymal transition

    Directory of Open Access Journals (Sweden)

    Xu Y

    2017-02-01

    Full Text Available Yongfu Xu,* Binfeng Wang,* Fabiao Zhang, Aidong Wang, Xuefeng Du, Peng Hu, Yu Zhu, Zheping Fang Department of Hepatobiliary Surgery, Taizhou Hospital of Zhejiang Province, Wenzhou Medical University, Linhai, Zhejiang, People’s Republic of China *These authors contributed equally to this work Abstract: Increasing evidence has demonstrated that aberrant expressions of long non-coding RNAs (lncRNAs are involved in various malignancies, including hepatocellular carcinoma (HCC. This study aimed to investigate the role of lncRNA colon cancer-associated transcript 2 (CCAT2 in the progression of HCC. Quantitative real-time polymerase chain reaction analysis confirmed that CCAT2 was upregulated in HCC cell lines and cancerous tissues compared with normal liver cell line and adjacent normal tissue samples. The level of CCAT2 was positively associated with tumor–node–metastasis stages and vessel invasion. Survival analyses revealed that high CCAT2 expression predicted poor prognostic outcomes, serving as an independent prognostic factor for HCC patients. Patients with high CCAT2 expression had a 1.849-fold increased risk of death compared with those with low CCAT2 expression. Moreover, we also found that knockdown of CCAT2 expression reduced cell migration and invasion in vitro. We further demonstrated that CCAT2 played a key role in enhancing the epithelial–mesenchymal transition (EMT through the regulation of vimentin, E-cadherin and transcription factor snail2 expression. Taken together, our findings showed that high CCAT2 expression is associated with poor survival in HCC patients. CCAT2 promotes HCC progression by regulating Snail2-induced EMT. CCAT2 may be a prognostic biomarker and therapeutic target for HCC. Keywords: long non-coding RNA, CCAT2, hepatocellular carcinoma, epithelial–mesenchymal transition, survival

  5. Long non-coding RNA ANRIL is up-regulated in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Hongxue [Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Department of Urology, Hospital of Xinjiang Production and Construction Corps, Urumqi 830002 (China); Li, Xuechao; Song, Yarong; Zhang, Peng; Xiao, Yajun [Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Xing, Yifei, E-mail: yifei_xing@163.com [Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China)

    2015-11-13

    Antisense non-coding RNA in the INK4 locus (ANRIL) is a member of long non-coding RNAs and has been reported to be dysregulated in several human cancers. However, the role of ANRIL in bladder cancer remains unclear. This present study aimed to investigate whether and how ANRIL involved in bladder cancer. Our results showed up-regulation of ANRIL in bladder cancer tissues versus the corresponding adjacent non-tumor tissues. To explore the specific mechanisms, ANRIL was silenced by small interfering RNA or short hairpin RNA transfection in human bladder cancer T24 and EJ cells. Knockdown of ANRIL repressed cell proliferation and increased cell apoptosis, along with decreased expression of Bcl-2 and increased expressions of Bax, cytoplasmic cytochrome c and Smac and cleaved caspase-9, caspase-3 and PARP. However, no change of cleaved caspase-8 level was observed. Furthermore, in vivo experiment confirmed that knockdown of ANRIL inhibited tumorigenic ability of EJ cells in nude mice. Meanwhile, in accordance with in vitro study, knockdown of ANRIL inhibited expression of Bcl-2 and up-regulated expressions of Bax and cleaved caspase-9, but did not affect cleaved caspase-8 level. In conclusion, we first report that ANRIL possibly serves as an oncogene in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic apoptosis pathway. - Highlights: • We first report the role of ANRIL in bladder cancer. • ANRIL is obviously up-regulated in bladder cancer tissues. • ANRIL regulates bladder cancer cell proliferation and cell apoptosis through the intrinsic pathway.

  6. Identification of mRNA-like non-coding RNAs and validation of a mighty one named MAR in Panax ginseng.

    Science.gov (United States)

    Wang, Meizhen; Wu, Bin; Chen, Chao; Lu, Shanfa

    2015-03-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) play significant roles in plants. However, little is known about lncRNAs in Panax ginseng C. A. Meyer, an economically significant medicinal plant species. A total of 3,688 mRNA-like non-coding RNAs (mlncRNAs), a class of lncRNAs, were identified in P. ginseng. Approximately 40% of the identified mlncRNAs were processed into small RNAs, implying their regulatory roles via small RNA-mediated mechanisms. Eleven miRNA-generating mlncRNAs also produced siRNAs, suggesting the coordinated production of miRNAs and siRNAs in P. ginseng. The mlncRNA-derived small RNAs might be 21-, 22-, or 24-nt phased and could be generated from both or only one strand of mlncRNAs, or from super long hairpin structures. A full-length mlncRNA, termed MAR (multiple-function-associated mlncRNA), was cloned. It generated the most abundant siRNAs. The MAR siRNAs were predominantly 24-nt and some of them were distributed in a phased pattern. A total of 228 targets were predicted for 71 MAR siRNAs. Degradome sequencing validated 68 predicted targets involved in diverse metabolic pathways, suggesting the significance of MAR in P. ginseng. Consistently, MAR was detected in all tissues analyzed and responded to methyl jasmonate (MeJA) treatment. It sheds light on the function of mlncRNAs in plants. © 2014 Institute of Botany, Chinese Academy of Sciences.

  7. Identification of intermediate-size non-coding RNAs involved in the UV-induced DNA damage response in C. elegans.

    Directory of Open Access Journals (Sweden)

    Aqian Li

    Full Text Available BACKGROUND: A network of DNA damage response (DDR mechanisms functions coordinately to maintain genome integrity and prevent disease. The Nucleotide Excision Repair (NER pathway is known to function in the response to UV-induced DNA damage. Although numbers of coding genes and miRNAs have been identified and reported to participate in UV-induced DNA damage response (UV-DDR, the precise role of non-coding RNAs (ncRNAs in UV-DDR remains largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: We used high-throughput RNA-sequencing (RNA-Seq to discover intermediate-size (70-500 nt ncRNAs (is-ncRNAs in C. elegans, using the strains of L4 larvae of wild-type (N2, UV-irradiated (N2/UV100 and NER-deficient mutant (xpa-1, and 450 novel non-coding transcripts were initially identified. A customized microarray assay was then applied to examine the expression profiles of both novel transcripts and known is-ncRNAs, and 57 UV-DDR-related is-ncRNA candidates showed expression variations at different levels between UV irradiated strains and non- irradiated strains. The top ranked is-ncRNA candidates with expression differences were further validated by qRT-PCR analysis, of them, 8 novel is-ncRNAs were significantly up-regulated after UV irradiation. Knockdown of two novel is-ncRNAs, ncRNA317 and ncRNA415, by RNA interference, resulted in higher UV sensitivity and significantly decreased expression of NER-related genes in C. elegans. CONCLUSIONS/SIGNIFICANCE: The discovery of above two novel is-ncRNAs in this study indicated the functional roles of is-ncRNAs in the regulation of UV-DDR network, and aided our understanding of the significance of ncRNA involvement in the UV-induced DNA damage response.

  8. Long non-coding RNA ANRIL is up-regulated in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic pathway

    International Nuclear Information System (INIS)

    Zhu, Hongxue; Li, Xuechao; Song, Yarong; Zhang, Peng; Xiao, Yajun; Xing, Yifei

    2015-01-01

    Antisense non-coding RNA in the INK4 locus (ANRIL) is a member of long non-coding RNAs and has been reported to be dysregulated in several human cancers. However, the role of ANRIL in bladder cancer remains unclear. This present study aimed to investigate whether and how ANRIL involved in bladder cancer. Our results showed up-regulation of ANRIL in bladder cancer tissues versus the corresponding adjacent non-tumor tissues. To explore the specific mechanisms, ANRIL was silenced by small interfering RNA or short hairpin RNA transfection in human bladder cancer T24 and EJ cells. Knockdown of ANRIL repressed cell proliferation and increased cell apoptosis, along with decreased expression of Bcl-2 and increased expressions of Bax, cytoplasmic cytochrome c and Smac and cleaved caspase-9, caspase-3 and PARP. However, no change of cleaved caspase-8 level was observed. Furthermore, in vivo experiment confirmed that knockdown of ANRIL inhibited tumorigenic ability of EJ cells in nude mice. Meanwhile, in accordance with in vitro study, knockdown of ANRIL inhibited expression of Bcl-2 and up-regulated expressions of Bax and cleaved caspase-9, but did not affect cleaved caspase-8 level. In conclusion, we first report that ANRIL possibly serves as an oncogene in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic apoptosis pathway. - Highlights: • We first report the role of ANRIL in bladder cancer. • ANRIL is obviously up-regulated in bladder cancer tissues. • ANRIL regulates bladder cancer cell proliferation and cell apoptosis through the intrinsic pathway.

  9. Long non-coding RNA HOTAIR inhibits miR-17-5p to regulate osteogenic differentiation and proliferation in non-traumatic osteonecrosis of femoral head.

    Directory of Open Access Journals (Sweden)

    Biaofang Wei

    Full Text Available The biological functions of non-coding RNAs (ncRNAs have been widely identified in many human diseases. In the present study, the relationship between long non-coding RNA HOTAIR and microRNA-17-5p (miR-17-5p and their roles in osteogenic differentiation and proliferation in non-traumatic osteonecrosis of femoral head (ONFH were investigated.The expression levels of HOTAIR and miR-17-5p in the mesenchymal stem cells (MSCs derived from patients with non-traumatic ONFH and osteoarthritis (OA were examined by real-time PCR. BMP-2 induced human MSCs from bone marrow (hMSC-BM were used for osteogenic differentiation.It was observed that the expression level of miR-17-5p was lower and the level of HOTAIR was higher in samples of non-traumatic ONFH compared with OA. HOTAIR downregulation induced by si-HOTAIR led to the increase of miR-17-5p expression and the decrease of miR-17-5p target gene SMAD7 expression. The values of osteogenic differentiation markers, including RUNX2 and COL1A1 mRNA expression and ALP activity, were also elevated by si-HOTAIR. However, the increase of these values was canceled by miR-17-5p inhibitor or SMAD7 upregulation.HOTAIR played a role in regulating osteogenic differentiation and proliferation through modulating miR-17-5p and its target gene SMAD7 in non-traumatic ONFH.

  10. Dendrosomal curcumin increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer.

    Science.gov (United States)

    Zamani, Mina; Sadeghizadeh, Majid; Behmanesh, Mehrdad; Najafi, Farhood

    2015-09-15

    Hepatocellular carcinoma is the fifth most common cancer worldwide, with poor prognosis and resistance to chemotherapy. This gives novel cancer treatment methods an overwhelming significance. Epigenetic therapy of cancer is useful in reversing some of the cancer defects because of reversibility of the epigenetic alterations. Non-protein coding transcripts are the major part of our transcriptome. MEG3 is a tumor suppressor long non-coding RNA being expressed in many normal tissues. Methylation of MEG3 promoter region elicits the decrease in its expression in hepatocellular cancer cells. Bioactive nutrients including curcumin offer great potential in altering DNA methylation status which is catalyzed via DNMT1, DNMT3A and 3B. Herein, we aimed to study RNA-based epigenetic effects of dendrosomal curcumin (DNC) on hepatocellular cancer (HCC). To this end miRNA-dependent regulation of MEG3 expression under treatment with DNC was studied by evaluating the modulatory involvement of miR-29a for DNMT3A and 3B and miR-185 for DNMT1. We evaluated DNC entrance to HCC cells with the use of fluorescent characteristics of curcumin. Next we performed the MTT assay to evaluate DNC and dendrosome effects on HCC cell viability. The coding and non-coding genes expression analyses were done using quantitative-PCR. In result we found that the DNC dependent overexpression of miR-29a and miR-185 (P DNC potentially can induce DNA hypomethylation and reexpression of silenced tumor suppressor genes in HCC. These data suggest that DNC could be an effective choice for epigenetic therapy of HCC. Copyright © 2015 Elsevier GmbH. All rights reserved.

  11. Evaluation of the Genetic Variation of Non Coding Control Region of BK Virus Using Nested-PCR Sequencing Method in Renal Graft Patients

    Directory of Open Access Journals (Sweden)

    A Emami

    2015-05-01

    Full Text Available Background & aim: Polyomaviruses (BK is a comprehensive infection with more than of 80% prevalence in the world. One of the most important reasons of BK virus nephropathy is in the renal transplant recipients and rejection of transplanted tissue between them. Non Coding region of this virus play a regulatory role in replication and amplification of the virus. The aim of this study was to evaluate the genetic patterns of this area in renal graft at Namazi Transplantation Center, Shiraz, Iran. Methods: In the present experimental study, 380 renal allograft serums were collected. DNAs of 129 eligible samples were extracted and evaluated using a virus genome. The presence of the virus was determined by qualitative and sequencing. Of these, 129 samples were tested for the presence of virus according to the condition study, using quantitative, qualitative genomic amplification and sequencing. Results: The study showed symptoms of nephropathy, 76 (58.9% of them were males and 46 (35.7% were females with the mean age 38.0±.089 years of age. In general, 46 patients (35.7% percent were positive for BK Polyomaviruses. After comparing the genomic sequence with applications of molecular they were categorized in three groups and then recorded in gene bank. Conclusion: About 35% of renal transplant recipients with high creatinine levels were positive for the presence of BK virus. Non-coding region of respondents in the sample survey revealed that among patients with the most common genotypes were rearranged the entire transplant patients were observed at this tranplant center. Examination of these sequences indicated that this rearrangments had a specific pattern, different from the standard strain of archaea type.

  12. Overexpression of long non-coding RNA TUG1 predicts poor prognosis and promotes cancer cell proliferation and migration in high-grade muscle-invasive bladder cancer.

    Science.gov (United States)

    Iliev, Robert; Kleinova, Renata; Juracek, Jaroslav; Dolezel, Jan; Ozanova, Zuzana; Fedorko, Michal; Pacik, Dalibor; Svoboda, Marek; Stanik, Michal; Slaby, Ondrej

    2016-10-01

    Long non-coding RNA TUG1 is involved in the development and progression of a variety of tumors. Little is known about TUG1 function in high-grade muscle-invasive bladder cancer (MIBC). The aims of our study were to determine expression levels of long non-coding RNA TUG1 in tumor tissue, to evaluate its relationship with clinico-pathological features of high-grade MIBC, and to describe its function in MIBC cells in vitro. TUG1 expression levels were determined in paired tumor and adjacent non-tumor bladder tissues of 47 patients with high-grade MIBC using real-time PCR. Cell line T-24 and siRNA silencing were used to study the TUG1 function in vitro. We observed significantly increased levels of TUG1 in tumor tissue in comparison to adjacent non-tumor bladder tissue (P TUG1 levels were significantly increased in metastatic tumors (P = 0.0147) and were associated with shorter overall survival of MIBC patients (P = 0.0241). TUG1 silencing in vitro led to 34 % decrease in cancer cell proliferation (P = 0.0004) and 23 % reduction in migration capacity of cancer cells (P TUG1 silencing on cell cycle distribution and number of apoptotic cells. Our study confirmed overexpression of TUG1 in MIBC tumor tissue and described its association with worse overall survival in high-grade MIBC patients. Together with in vitro observations, these data suggest an oncogenic role of TUG1 and its potential usage as biomarker or therapeutic target in MIBC.

  13. Short-lived long non-coding RNAs as surrogate indicators for chemical exposure and LINC00152 and MALAT1 modulate their neighboring genes.

    Directory of Open Access Journals (Sweden)

    Hidenori Tani

    Full Text Available Whole transcriptome analyses have revealed a large number of novel long non-coding RNAs (lncRNAs. Although accumulating evidence demonstrates that lncRNAs play important roles in regulating gene expression, the detailed mechanisms of action of most lncRNAs remain unclear. We previously reported that a novel class of lncRNAs with a short half-life (t1/2 < 4 h in HeLa cells, termed short-lived non-coding transcripts (SLiTs, are closely associated with physiological and pathological functions. In this study, we focused on 26 SLiTs and nuclear-enriched abundant lncRNA, MALAT1(t1/2 of 7.6 h in HeLa cells in neural stem cells (NSCs derived from human induced pluripotent stem cells, and identified four SLiTs (TUG1, GAS5, FAM222-AS1, and SNHG15 that were affected by the following typical chemical stresses (oxidative stress, heavy metal stress and protein synthesis stress. We also found the expression levels of LINC00152 (t1/2 of 2.1 h in NSCs, MALAT1 (t1/2 of 1.8 h in NSCs, and their neighboring genes were elevated proportionally to the chemical doses. Moreover, we confirmed that the overexpression of LINC00152 or MALAT1 upregulated the expressions of their neighboring genes even in the absence of chemical stress. These results reveal that LINC00152 and MALAT1 modulate their neighboring genes, and thus provide a deeper understanding of the functions of lncRNAs.

  14. Genic non-coding microsatellites in the rice genome: characterization, marker design and use in assessing genetic and evolutionary relationships among domesticated groups

    Directory of Open Access Journals (Sweden)

    Singh Nagendra

    2009-03-01

    Full Text Available Abstract Background Completely sequenced plant genomes provide scope for designing a large number of microsatellite markers, which are useful in various aspects of crop breeding and genetic analysis. With the objective of developing genic but non-coding microsatellite (GNMS markers for the rice (Oryza sativa L. genome, we characterized the frequency and relative distribution of microsatellite repeat-motifs in 18,935 predicted protein coding genes including 14,308 putative promoter sequences. Results We identified 19,555 perfect GNMS repeats with densities ranging from 306.7/Mb in chromosome 1 to 450/Mb in chromosome 12 with an average of 357.5 GNMS per Mb. The average microsatellite density was maximum in the 5' untranslated regions (UTRs followed by those in introns, promoters, 3'UTRs and minimum in the coding sequences (CDS. Primers were designed for 17,966 (92% GNMS repeats, including 4,288 (94% hypervariable class I types, which were bin-mapped on the rice genome. The GNMS markers were most polymorphic in the intronic region (73.3% followed by markers in the promoter region (53.3% and least in the CDS (26.6%. The robust polymerase chain reaction (PCR amplification efficiency and high polymorphic potential of GNMS markers over genic coding and random genomic microsatellite markers suggest their immediate use in efficient genotyping applications in rice. A set of these markers could assess genetic diversity and establish phylogenetic relationships among domesticated rice cultivar groups. We also demonstrated the usefulness of orthologous and paralogous conserved non-coding microsatellite (CNMS markers, identified in the putative rice promoter sequences, for comparative physical mapping and understanding of evolutionary and gene regulatory complexities among rice and other members of the grass family. The divergence between long-grained aromatics and subspecies japonica was estimated to be more recent (0.004 Mya compared to short

  15. Characterization and Analysis of Whole Transcriptome of Giant Panda Spleens: Implying Critical Roles of Long Non-Coding RNAs in Immunity

    Directory of Open Access Journals (Sweden)

    Rui Peng

    2018-04-01

    Full Text Available Background/Aims: Giant pandas, an endangered species, are a powerful symbol of species conservation. Giant pandas may suffer from a variety of diseases. Owing to their highly specialized diet of bamboo, giant pandas are thought to have a relatively weak ability to resist diseases. The spleen is the largest organ in the lymphatic system. However, there is little known about giant panda spleen at a molecular level. Thus, clarifying the regulatory mechanisms of spleen could help us further understand the immune system of the giant panda as well as its conservation. Methods: The two giant panda spleens were from two male individuals, one newborn and one an adult, in a non-pathological condition. The whole transcriptomes of mRNA, lncRNA, miRNA, and circRNA in the two spleens were sequenced using the Illumina HiSeq platform. EBseq and IDEG6 were used to observe the differentially expressed genes (DEGs between these two spleens. Gene Ontology and KEGG analyses were used to annotate the function of DEGs. Furthermore, networks between non-coding RNAs and protein-coding genes were constructed to investigate the relationship between non-coding RNAs and immune-associated genes. Results: By comparative analysis of the whole transcriptomes of these two spleens, we found that one of the major roles of lncRNAs could be involved in the regulation of immune responses of giant panda spleens. In addition, our results also revealed that microRNAs and circRNAs may have evolved to regulate a large set of biological processes of giant panda spleens, and circRNAs may function as miRNA sponges. Conclusion: To our knowledge, this is the first report of lncRNAs and circRNAs in giant panda, which could be a useful resource for further giant panda research. Our study reveals the potential functional roles of miRNAs, lncRNAs, and circRNAs in giant panda spleen.

  16. Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines.

    Science.gov (United States)

    Mo, Chu-Fan; Wu, Fang-Chun; Tai, Kang-Yu; Chang, Wei-Chun; Chang, Kai-Wei; Kuo, Hung-Chih; Ho, Hong-Nerng; Chen, Hsin-Fu; Lin, Shau-Ping

    2015-01-05

    Pluripotent stem cells are increasingly used to build therapeutic models, including the transplantation of neural progenitors derived from human embryonic stem cells (hESCs). Recently, long non-coding RNAs (lncRNAs), including delta-like homolog 1 gene and the type III iodothyronine deiodinase gene (DLK1-DIO3) imprinted locus-derived maternally expressed gene 3 (MEG3), were found to be expressed during neural development. The deregulation of these lncRNAs is associated with various neurological diseases. The imprinted locus DLK1-DIO3 encodes abundant non-coding RNAs (ncRNAs) that are regulated by differential methylation of the locus. We aim to study the correlation between the DLK1-DIO3-derived ncRNAs and the capacity of hESCs to differentiate into neural lineages. We classified hESC sublines into MEG3-ON and MEG3-OFF based on the expression levels of MEG3 and its downstream microRNAs as detected by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). A cDNA microarray was used to analyze the gene expression profiles of hESCs. To investigate the capacity of neural differentiation in MEG3-ON and MEG3-OFF hESCs, we performed neural lineage differentiation followed by neural lineage marker expression and neurite formation analyses via qRT-PCR and immunocytochemistry, respectively. MEG3-knockdown via small interfering RNA (siRNA) and small hairpin RNA (shRNA) was used to investigate the potential causative effect of MEG3 in regulating neural lineage-related gene expression. DLK1-DIO3-derived ncRNAs were repressed in MEG3-OFF hESCs compared with those in the MEG3-ON hESCs. The transcriptome profile indicated that many genes related to nervous system development and neural-type tumors were differentially expressed in MEG3-OFF hESCs. Three independent MEG3-knockdown assays using different siRNA and shRNA constructs consistently resulted in downregulation of some neural lineage genes. Lower expression levels of stage-specific neural lineage markers and

  17. Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.

    Science.gov (United States)

    Dong, Xiaomin; Chen, Kenian; Cuevas-Diaz Duran, Raquel; You, Yanan; Sloan, Steven A; Zhang, Ye; Zong, Shan; Cao, Qilin; Barres, Ben A; Wu, Jia Qian

    2015-12-01

    Long non-coding RNAs (lncRNAs) (> 200 bp) play crucial roles in transcriptional regulation during numerous biological processes. However, it is challenging to comprehensively identify lncRNAs, because they are often expressed at low levels and with more cell-type specificity than are protein-coding genes. In the present study, we performed ab initio transcriptome reconstruction using eight purified cell populations from mouse cortex and detected more than 5000 lncRNAs. Predicting the functions of lncRNAs using cell-type specific data revealed their potential functional roles in Central Nervous System (CNS) development. We performed motif searches in ENCODE DNase I digital footprint data and Mouse ENCODE promoters to infer transcription factor (TF) occupancy. By integrating TF binding and cell-type specific transcriptomic data, we constructed a novel framework that is useful for systematically identifying lncRNAs that are potentially essential for brain cell fate determination. Based on this integrative analysis, we identified lncRNAs that are regulated during Oligodendrocyte Precursor Cell (OPC) differentiation from Neural Stem Cells (NSCs) and that are likely to be involved in oligodendrogenesis. The top candidate, lnc-OPC, shows highly specific expression in OPCs and remarkable sequence conservation among placental mammals. Interestingly, lnc-OPC is significantly up-regulated in glial progenitors from experimental autoimmune encephalomyelitis (EAE) mouse models compared to wild-type mice. OLIG2-binding sites in the upstream regulatory region of lnc-OPC were identified by ChIP (chromatin immunoprecipitation)-Sequencing and validated by luciferase assays. Loss-of-function experiments confirmed that lnc-OPC plays a functional role in OPC genesis. Overall, our results substantiated the role of lncRNA in OPC fate determination and provided an unprecedented data source for future functional investigations in CNS cell types. We present our datasets and analysis results

  18. Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.

    Directory of Open Access Journals (Sweden)

    Xiaomin Dong

    2015-12-01

    Full Text Available Long non-coding RNAs (lncRNAs (> 200 bp play crucial roles in transcriptional regulation during numerous biological processes. However, it is challenging to comprehensively identify lncRNAs, because they are often expressed at low levels and with more cell-type specificity than are protein-coding genes. In the present study, we performed ab initio transcriptome reconstruction using eight purified cell populations from mouse cortex and detected more than 5000 lncRNAs. Predicting the functions of lncRNAs using cell-type specific data revealed their potential functional roles in Central Nervous System (CNS development. We performed motif searches in ENCODE DNase I digital footprint data and Mouse ENCODE promoters to infer transcription factor (TF occupancy. By integrating TF binding and cell-type specific transcriptomic data, we constructed a novel framework that is useful for systematically identifying lncRNAs that are potentially essential for brain cell fate determination. Based on this integrative analysis, we identified lncRNAs that are regulated during Oligodendrocyte Precursor Cell (OPC differentiation from Neural Stem Cells (NSCs and that are likely to be involved in oligodendrogenesis. The top candidate, lnc-OPC, shows highly specific expression in OPCs and remarkable sequence conservation among placental mammals. Interestingly, lnc-OPC is significantly up-regulated in glial progenitors from experimental autoimmune encephalomyelitis (EAE mouse models compared to wild-type mice. OLIG2-binding sites in the upstream regulatory region of lnc-OPC were identified by ChIP (chromatin immunoprecipitation-Sequencing and validated by luciferase assays. Loss-of-function experiments confirmed that lnc-OPC plays a functional role in OPC genesis. Overall, our results substantiated the role of lncRNA in OPC fate determination and provided an unprecedented data source for future functional investigations in CNS cell types. We present our datasets and

  19. iMir: an integrated pipeline for high-throughput analysis of small non-coding RNA data obtained by smallRNA-Seq.

    Science.gov (United States)

    Giurato, Giorgio; De Filippo, Maria Rosaria; Rinaldi, Antonio; Hashim, Adnan; Nassa, Giovanni; Ravo, Maria; Rizzo, Francesca; Tarallo, Roberta; Weisz, Alessandro

    2013-12-13

    Qualitative and quantitative analysis of small non-coding RNAs by next generation sequencing (smallRNA-Seq) represents a novel technology increasingly used to investigate with high sensitivity and specificity RNA population comprising microRNAs and other regulatory small transcripts. Analysis of smallRNA-Seq data to gather biologically relevant information, i.e. detection and differential expression analysis of known and novel non-coding RNAs, target prediction, etc., requires implementation of multiple statistical and bioinformatics tools from different sources, each focusing on a specific step of the analysis pipeline. As a consequence, the analytical workflow is slowed down by the need for continuous interventions by the operator, a critical factor when large numbers of datasets need to be analyzed at once. We designed a novel modular pipeline (iMir) for comprehensive analysis of smallRNA-Seq data, comprising specific tools for adapter trimming, quality filtering, differential expression analysis, biological target prediction and other useful options by integrating multiple open source modules and resources in an automated workflow. As statistics is crucial in deep-sequencing data analysis, we devised and integrated in iMir tools based on different statistical approaches to allow the operator to analyze data rigorously. The pipeline created here proved to be efficient and time-saving than currently available methods and, in addition, flexible enough to allow the user to select the preferred combination of analytical steps. We present here the results obtained by applying this pipeline to analyze simultaneously 6 smallRNA-Seq datasets from either exponentially growing or growth-arrested human breast cancer MCF-7 cells, that led to the rapid and accurate identification, quantitation and differential expression analysis of ~450 miRNAs, including several novel miRNAs and isomiRs, as well as identification of the putative mRNA targets of differentially expressed mi

  20. The Kcnq1ot1 Long Non-Coding RNA Affects Chromatin Conformation and Expression of Kcnq1, but Does Not Regulate Its Imprinting in the Developing Heart

    Science.gov (United States)

    Korostowski, Lisa; Sedlak, Natalie; Engel, Nora

    2012-01-01

    Although many of the questions raised by the discovery of imprinting have been answered, we have not yet accounted for tissue- or stage-specific imprinting. The Kcnq1 imprinted domain exhibits complex tissue-specific expression patterns co-existing with a domain-wide cis-acting control element. Transcription of the paternally expressed antisense non-coding RNA Kcnq1ot1 silences some neighboring genes in the embryo, while others are unaffected. Kcnq1 is imprinted in early cardiac development but becomes biallelic after midgestation. To explore this phenomenon and the role of Kcnq1ot1, we used allele-specific assays and chromosome conformational studies in wild-type mice and mice with a premature termination mutation for Kcnq1ot1. We show that Kcnq1 imprinting in early heart is established and maintained independently of Kcnq1ot1 expression, thus excluding a role for Kcnq1ot1 in repressing Kcnq1, even while silencing other genes in the domain. The exact timing of the mono- to biallelic transition is strain-dependent, with the CAST/EiJ allele becoming activated earlier and acquiring higher levels than the C57BL/6J allele. Unexpectedly, Kcnq1ot1 itself also switches to biallelic expression specifically in the heart, suggesting that tissue-specific loss of imprinting may be common during embryogenesis. The maternal Kcnq1ot1 transcript is shorter than the paternal ncRNA, and its activation depends on an alternative transcriptional start site that bypasses the maternally methylated promoter. Production of Kcnq1ot1 on the maternal chromosome does not silence Cdkn1c. We find that in later developmental stages, however, Kcnq1ot1 has a role in modulating Kcnq1 levels, since its absence leads to overexpression of Kcnq1, an event accompanied by an aberrant three-dimensional structure of the chromatin. Thus, our studies reveal regulatory mechanisms within the Kcnq1 imprinted domain that operate exclusively in the heart on Kcnq1, a gene crucial for heart development and function

  1. Characterization and Analysis of Whole Transcriptome of Giant Panda Spleens: Implying Critical Roles of Long Non-Coding RNAs in Immunity.

    Science.gov (United States)

    Peng, Rui; Liu, Yuliang; Cai, Zhigang; Shen, Fujun; Chen, Jiasong; Hou, Rong; Zou, Fangdong

    2018-01-01

    Giant pandas, an endangered species, are a powerful symbol of species conservation. Giant pandas may suffer from a variety of diseases. Owing to their highly specialized diet of bamboo, giant pandas are thought to have a relatively weak ability to resist diseases. The spleen is the largest organ in the lymphatic system. However, there is little known about giant panda spleen at a molecular level. Thus, clarifying the regulatory mechanisms of spleen could help us further understand the immune system of the giant panda as well as its conservation. The two giant panda spleens were from two male individuals, one newborn and one an adult, in a non-pathological condition. The whole transcriptomes of mRNA, lncRNA, miRNA, and circRNA in the two spleens were sequenced using the Illumina HiSeq platform. EBseq and IDEG6 were used to observe the differentially expressed genes (DEGs) between these two spleens. Gene Ontology and KEGG analyses were used to annotate the function of DEGs. Furthermore, networks between non-coding RNAs and protein-coding genes were constructed to investigate the relationship between non-coding RNAs and immune-associated genes. By comparative analysis of the whole transcriptomes of these two spleens, we found that one of the major roles of lncRNAs could be involved in the regulation of immune responses of giant panda spleens. In addition, our results also revealed that microRNAs and circRNAs may have evolved to regulate a large set of biological processes of giant panda spleens, and circRNAs may function as miRNA sponges. To our knowledge, this is the first report of lncRNAs and circRNAs in giant panda, which could be a useful resource for further giant panda research. Our study reveals the potential functional roles of miRNAs, lncRNAs, and circRNAs in giant panda spleen. © 2018 The Author(s). Published by S. Karger AG, Basel.

  2. Robust computational analysis of rRNA hypervariable tag datasets.

    Directory of Open Access Journals (Sweden)

    Maksim Sipos

    Full Text Available Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large (10(5-10(6 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods.

  3. Two rare deletions upstream of the NRXN1 gene (2p16.3) affecting the non-coding mRNA AK127244 segregate with diverse psychopathological phenotypes in a family

    DEFF Research Database (Denmark)

    Duong, Linh T. T.; Hoeffding, Louise K.; Petersen, Kirsten B.

    2015-01-01

    susceptibility. In this study, we describe a family affected by a wide range of psychiatric disorders including early onset schizophrenia, schizophreniform disorder, and affective disorders. Microarray analysis identified two rare deletions immediately upstream of the NRXN1 gene affecting the non-coding mRNA AK...... suggest that non-coding regions upstream of the NRXN1 gene affecting AK127244 might (as NRXN1) contain susceptibility regions for a wide spectrum of neuropsychiatric disorders. (C) 2015 Elsevier Masson SAS. All rights reserved....

  4. The non-coding RNA Ncr0700/PmgR1 is required for photomixotrophic growth and the regulation of glycogen accumulation in the cyanobacterium Synechocystis sp. PCC 6803

    DEFF Research Database (Denmark)

    de Porcellinis, Alice Jara; Klähn, Stephan; Rosgaard, Lisa

    2016-01-01

    activity and possible factors acting downstream of PmgA are unknown. Here, a genome-wide microarray analysis of a ΔpmgA strain identified the expression of 36 protein-coding genes and 42 non-coding transcripts as significantly altered. From these, the non-coding RNA Ncr0700 was identified as the transcript...... most strongly reduced in abundance. Ncr0700 is widely conserved among cyanobacteria. In Synechocystis its expression is inversely correlated with light intensity. Similarly to a ΔpmgA mutant, a Δncr0700 deletion strain showed an approximately 2-fold increase in glycogen content under photoautotrophic...

  5. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L..

    Directory of Open Access Journals (Sweden)

    Morad M Mokhtar

    Full Text Available The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6% were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4% were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

  6. The Long Non-coding RNA HIF1A-AS2 Facilitates the Maintenance of Mesenchymal Glioblastoma Stem-like Cells in Hypoxic Niches

    Directory of Open Access Journals (Sweden)

    Marco Mineo

    2016-06-01

    Full Text Available Long non-coding RNAs (lncRNAs have an undefined role in the pathobiology of glioblastoma multiforme (GBM. These tumors are genetically and phenotypically heterogeneous with transcriptome subtype-specific GBM stem-like cells (GSCs that adapt to the brain tumor microenvironment, including hypoxic niches. We identified hypoxia-inducible factor 1 alpha-antisense RNA 2 (HIF1A-AS2 as a subtype-specific hypoxia-inducible lncRNA, upregulated in mesenchymal GSCs. Its deregulation affects GSC growth, self-renewal, and hypoxia-dependent molecular reprogramming. Among the HIF1A-AS2 interactome, IGF2BP2 and DHX9 were identified as direct partners. This association was needed for maintenance of expression of their target gene, HMGA1. Downregulation of HIF1A-AS2 led to delayed growth of mesenchymal GSC tumors, survival benefits, and impaired expression of HMGA1 in vivo. Our data demonstrate that HIF1A-AS2 contributes to GSCs’ speciation and adaptation to hypoxia within the tumor microenvironment, acting directly through its interactome and targets and indirectly by modulating responses to hypoxic stress depending on the subtype-specific genetic context.

  7. Overexpression of long non-coding RNA colon cancer-associated transcript 2 is associated with advanced tumor progression and poor prognosis in patients with colorectal cancer.

    Science.gov (United States)

    Zhang, Junling; Jiang, Yong; Zhu, Jing; Wu, Tao; Ma, Ju; Du, Chuang; Chen, Shanwen; Li, Tengyu; Han, Jinsheng; Wang, Xin

    2017-12-01

    The aim of the present study was to explore the clinicopathological and prognostic significance of long non-coding RNA (lncRNA) colon cancer-associated transcript 2 (CCAT2) expression in human colorectal cancer (CRC). Expression levels of lncRNA CCAT2 in CRC, adjacent non-tumor and healthy colon mucosa tissues were detected by quantitative polymerase chain reaction. The disease-free survival and overall survival rates were evaluated using the Kaplan-Meier method, and multivariate analysis was performed using Cox proportional hazard analysis. The expression level of lncRNA CCAT2 in CRC tissues was increased significantly compared with adjacent normal tissues or non-cancerous tissues. CCAT2 expression was observed to be progressively increased between tumor-node-metastasis (TNM) stages I and IV. A high level of CCAT2 expression was revealed to be associated with poor cell differentiation, deeper tumor infiltration, lymph node metastasis, distance metastasis, vascular invasion and advanced TNM stage. Compared with patients with low levels of CCAT2 expression, patients with high levels of CCAT2 expression had shorter disease-free survival and overall survival times. Multivariate analyses indicated that high CCAT2 expression was an independent poor prognostic factor. Therefore, increased lncRNA CCAT2 expression maybe a potential diagnostic biomarker for CRC, and an independent predictor of prognosis in patients with CRC.

  8. Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    Directory of Open Access Journals (Sweden)

    J. Hsiao

    2016-07-01

    Full Text Available Dravet syndrome is a devastating genetic brain disorder caused by heterozygous loss-of-function mutation in the voltage-gated sodium channel gene SCN1A. There are currently no treatments, but the upregulation of SCN1A healthy allele represents an appealing therapeutic strategy. In this study we identified a novel, evolutionary conserved mechanism controlling the expression of SCN1A that is mediated by an antisense non-coding RNA (SCN1ANAT. Using oligonucleotide-based compounds (AntagoNATs targeting SCN1ANAT we were able to induce specific upregulation of SCN1A both in vitro and in vivo, in the brain of Dravet knock-in mouse model and a non-human primate. AntagoNAT-mediated upregulation of Scn1a in postnatal Dravet mice led to significant improvements in seizure phenotype and excitability of hippocampal interneurons. These results further elucidate the pathophysiology of Dravet syndrome and outline a possible new approach for the treatment of this and other genetic disorders with similar etiology.

  9. Long Non-Coding RNA HOTAIR Promotes Cell Migration and Invasion via Down-Regulation of RNA Binding Motif Protein 38 in Hepatocellular Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Chaofeng Ding

    2014-03-01

    Full Text Available Long non-coding RNA HOTAIR exerts regulatory functions in various biological processes in cancer cells, such as proliferation, apoptosis, mobility, and invasion. We previously found that HOX transcript antisense RNA (HOTAIR is a negative prognostic factor and exhibits oncogenic activity in hepatocellular carcinoma (HCC. In this study, we aimed to investigate the role and molecular mechanism of HOTAIR in promoting HCC cell migration and invasion. Firstly, we profiled its gene expression pattern by microarray analysis of HOTAIR loss in Bel-7402 HCC cell line. The results showed that 129 genes were significantly down-regulated, while 167 genes were significantly up-regulated (fold change >2, p < 0.05. Bioinformatics analysis indicated that RNA binding proteins were involved in this biological process. HOTAIR suppression using RNAi strategy with HepG2 and Bel-7402 cells increased the mRNA and protein expression levels of RNA binding motif protein 38 (RBM38. Moreover, the expression levels of RBM38 in HCC specimens were significantly lower than paired adjacent noncancerous tissues. In addition, knockdown of HOTAIR resulted in a decrease of cell migration and invasion, which could be specifically rescued by down-regulation of RBM38. Taken together, HOTAIR could promote migration and invasion of HCC cells by inhibiting RBM38, which indicated critical roles of HOTAIR and RBM38 in HCC progression.

  10. Long non-coding RNA ZFAS1 interacts with miR-150-5p to regulate Sp1 expression and ovarian cancer cell malignancy.

    Science.gov (United States)

    Xia, Bairong; Hou, Yan; Chen, Hong; Yang, Shanshan; Liu, Tianbo; Lin, Mei; Lou, Ge

    2017-03-21

    We reported that long non-coding RNA ZFAS1 was upregulated in epithelial ovarian cancer tissues, and was negatively correlated to the overall survival rate of patients with epithelial ovarian cancer in this study. While depletion of ZFAS1 inhibited proliferation, migration, and development of chemoresistance, overexpression of ZFAS1 exhibited an even higher proliferation rate, migration activity, and chemoresistance in epithelial ovarian cancer cell lines. We further found miR-150-5p was a potential target of ZFAS1, which was downregulated in epithelial ovarian cancer tissue. MiR-150-5p subsequently inhibited expression of transcription factor Sp1, as evidence by luciferase assays. Inhibition of miR-150-5p rescued the suppressed proliferation and migration induced by depletion of ZFAS1 in epithelial ovarian cancer cells, at least in part. Taken together, our findings revealed a critical role of ZFAS1/miR-150-5p/Sp1 axis in promoting proliferation rate, migration activity, and development of chemoresistance in epithelial ovarian cancer. And ZFAS1/miR-150-5p may serve as novel markers and therapeutic targets of epithelial ovarian cancer.

  11. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Jonathan F Schmitz

    2017-01-01

    Full Text Available Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo-emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes.

  12. Prognostic and clinicopathological role of long non-coding RNA taurine upregulated 1 in various human malignancies: A systemic review and meta-analysis.

    Science.gov (United States)

    Wang, Xiaoxiong; Chen, Xin; Zhang, Daming; Yang, Guang; Yang, Zhao; Yin, Zhiqin; Zhao, Shiguang

    2017-07-01

    The aberrant dysregulation of taurine upregulated 1, a novel discovered long non-coding RNA, was ubiquitous in different human solid tumors. Accumulating researches have indicated that taurine upregulated 1 is an independent prognostic indicator in cancer patients. This investigation aimed to further explore the prognostic and clinical significance of taurine upregulated 1 in various types of cancers. Eligible studies were systematically searched in PubMed, Embase, Medline, and Web of Science databases. A total of 12/14 studies with 1303/1228 individuals were included to evaluate the association of taurine upregulated 1 with overall survival and clinicopathological features by pooled hazard ratio and odds ratio in malignancies. The meta-analysis suggested overexpression of taurine upregulated 1 was significantly correlated with unfavorable overall survival in patients with cancer (pooled hazard ratio = 1.63, 95% confidence interval: 1.29-2.06). There was also a significantly positive correlation between high level of taurine upregulated 1 and high pathological grade carcinoma (pooled odds ratio = 4.41, 95% confidence interval: 3.07-6.43) and positive lymphatic metastasis (pooled odds ratio = 2.00, 95% confidence interval: 1.31-3.06). In summary, upregulated taurine upregulated 1 is correlated with more advanced clinicopathological characteristics and poor prognosis, suggesting that taurine upregulated 1 may serve as a novel predictive biomarker of patients with numerous tumors.

  13. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Comparative analysis of hepatitis C virus phylogenies from coding and non-coding regions: the 5' untranslated region (UTR fails to classify subtypes

    Directory of Open Access Journals (Sweden)

    Leitner Thomas

    2006-12-01

    Full Text Available Abstract Background The duration of treatment for HCV infection is partly indicated by the genotype of the virus. For studies of disease transmission, vaccine design, and surveillance for novel variants, subtype-level classification is also needed. This study used the Shimodaira-Hasegawa test and related statistical techniques to compare phylogenetic trees obtained from coding and non-coding regions of a whole-genome alignment for the reliability of subtyping in different regions. Results Different regions of the HCV genome yield inconsistent phylogenies, which can lead to erroneous conclusions about classification of a given infection. In particular, the highly conserved 5' untranslated region (UTR yields phylogenetic trees with topologies that differ from the HCV polyprotein and complete genome phylogenies. Phylogenetic trees from the NS5B gene reliably cluster related subtypes, and yield topologies consistent with those of the whole genome and polyprotein. Conclusion These results extend those from previous studies and indicate that, unlike the NS5B gene, the 5' UTR contains insufficient variation to resolve HCV classifications to the level of viral subtype, and fails to distinguish genotypes reliably. Use of the 5' UTR for clinical tests to characterize HCV infection should be replaced by a subtype-informative test.

  15. Expression of coding (mRNA) and non-coding (microRNA) RNA in lung tissue and blood isolated from pigs suffering from bacterial pleuropneumonia

    DEFF Research Database (Denmark)

    Skovgaard, Kerstin; Schou, Kirstine Klitgaard; Wendt, Karin Tarp

    2010-01-01

    MicroRNAs are small non-coding RNA molecules (18-23 nt), that regulate the activity of other genes at the post-transcriptional level. Recently it has become evident that microRNA plays an important role in modulating and fine tuning innate and adaptive immune responses. Still, little is known about...... the impact of microRNAs in the development and pathogenesis of lung infections. Expression of microRNA known to be induced by bacterial (i.e., LPS) ligands and thus supposed to play a role in the regulation of antimicrobial defence, were studied in lung tissue and in blood from pigs experimentally infected...... with Actinobacillus pleuropneumoniae (AP). Expression differences of mRNA and microRNA were quantified at different time points (6h, 12h, 24h, 48h PI) using reverse transcription quantitative real-time PCR (Rotor-Gene and Fluidigm). Expression profiles of miRNA in blood of seven animals were further studied using mi...

  16. A novel brown adipocyte-enriched long non-coding RNA that is required for brown adipocyte differentiation and sufficient to drive thermogenic gene program in white adipocytes.

    Science.gov (United States)

    Xiong, Yan; Yue, Feng; Jia, Zhihao; Gao, Yun; Jin, Wen; Hu, Keping; Zhang, Yong; Zhu, Dahai; Yang, Gongshe; Kuang, Shihuan

    2018-04-01

    The thermogenic activities of brown and beige adipocytes can be exploited to reduce energy surplus and counteract obesity. Recent RNA sequencing studies have uncovered a number of long noncoding RNAs (lncRNAs) uniquely expressed in white and brown adipose tissues (WAT and BAT), but whether and how these lncRNAs function in adipogenesis remain largely unknown. Here, we report the identification of a novel brown adipocyte-enriched LncRNA (AK079912), and its nuclear localization, function and regulation. The expression of AK079912 increases during brown preadipocyte differentiation and in response to cold-stimulated browning of white adipocytes. Knockdown of AK079912 inhibits brown preadipocyte differentiation, manifested by reductions in lipid accumulation and down-regulation of adipogenic and BAT-specific genes. Conversely, ectopic expression of AK079912 in white preadipocytes up-regulates the expression of genes involved in thermogenesis. Mechanistically, inhibition of AK079912 reduces mitochondrial copy number and protein levels of mitochondria electron transport chain (ETC) complexes, whereas AK079912 overexpression increases the levels of ETC proteins. Lastly, reporter and pharmacological assays identify Pparγ as an upstream regulator of AK079912. These results provide new insights into the function of non-coding RNAs in brown adipogenesis and regulating browning of white adipocytes. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Human DNA contains sequences homologous to the 5'-non-coding region of hepatits C virus: characterization with restriction endonucleases reveals individual varieties.

    Science.gov (United States)

    Dennin, Reinhard H; Wo, Jianer

    2003-07-01

    To investigate a 272 base pair section of the 5'-non-coding region of genomic DNA from the peripheral blood monounuclear cells of healthy hepatitis virus C (HCV)-negative human subjects (not patients). This sequence section bears interest because (1) it harbors several potential methylation (Cp-rich) sites, and (2) it represents the largest part of its internal ribosomal entry site. A pre-PCR digestion protocol was established making consistent use of four restriction endonucleases selected for certain features: SmaI, XmaCI, MspI, and HpaII are inhibited if methylation(s) are present at certain cytosines within their cutting sequences. The suspected HCV-specific sequence was found in the DNA of each subject tested. The pre-PCR digestion assay reveals individual differences in their pattern of methylation, which may be due to possible epigenetic phenomena. The results provide formal proof that these HCV-specific sequences are contained in the genomic or extra chromosomal target DNA, and probably belong to a new class of endogenous sequences.

  18. Transcriptomic Analysis of Long Non-Coding RNAs and Coding Genes Uncovers a Complex Regulatory Network That Is Involved in Maize Seed Development

    Directory of Open Access Journals (Sweden)

    Ming Zhu

    2017-10-01

    Full Text Available Long non-coding RNAs (lncRNAs have been reported to be involved in the development of maize plant. However, few focused on seed development of maize. Here, we identified 753 lncRNA candidates in maize genome from six seed samples. Similar to the mRNAs, lncRNAs showed tissue developmental stage specific and differential expression, indicating their putative role in seed development. Increasing evidence shows that crosstalk among RNAs mediated by shared microRNAs (miRNAs represents a novel layer of gene regulation, which plays important roles in plant development. Functional roles and regulatory mechanisms of lncRNAs as competing endogenous RNAs (ceRNA in plants, particularly in maize seed development, are unclear. We combined analyses of consistently altered 17 lncRNAs, 840 mRNAs and known miRNA to genome-wide investigate potential lncRNA-mediated ceRNA based on “ceRNA hypothesis”. The results uncovered seven novel lncRNAs as potential functional ceRNAs. Functional analyses based on their competitive coding-gene partners by Gene Ontology (GO and KEGG biological pathway demonstrated that combined effects of multiple ceRNAs can have major impacts on general developmental and metabolic processes in maize seed. These findings provided a useful platform for uncovering novel mechanisms of maize seed development and may provide opportunities for the functional characterization of individual lncRNA in future studies.

  19. The DMD locus harbours multiple long non-coding RNAs which orchestrate and control transcription of muscle dystrophin mRNA isoforms.

    Science.gov (United States)

    Bovolenta, Matteo; Erriquez, Daniela; Valli, Emanuele; Brioschi, Simona; Scotton, Chiara; Neri, Marcella; Falzarano, Maria Sofia; Gherardi, Samuele; Fabris, Marina; Rimessi, Paola; Gualandi, Francesca; Perini, Giovanni; Ferlini, Alessandra

    2012-01-01

    The 2.2 Mb long dystrophin (DMD) gene, the largest gene in the human genome, corresponds to roughly 0.1% of the entire human DNA sequence. Mutations in this gene cause Duchenne muscular dystrophy and other milder X-linked, recessive dystrophinopathies. Using a custom-made tiling array, specifically designed for the DMD locus, we identified a variety of novel long non-coding RNAs (lncRNAs), both sense and antisense oriented, whose expression profiles mirror that of DMD gene. Importantly, these transcripts are intronic in origin and specifically localized to the nucleus and are transcribed contextually with dystrophin isoforms or primed by MyoD-induced myogenic differentiation. Furthermore, their forced ectopic expression in both human muscle and neuronal cells causes a specific and negative regulation of endogenous dystrophin full length isoforms and significantly down-regulate the activity of a luciferase reporter construct carrying the minimal promoter regions of the muscle dystrophin isoform. Consistent with this apparently repressive role, we found that, in muscle samples of dystrophinopathic female carriers, lncRNAs expression levels inversely correlate with those of muscle full length DMD isoforms. Overall these findings unveil an unprecedented complexity of the transcriptional pattern of the DMD locus and reveal that DMD lncRNAs may contribute to the orchestration and homeostasis of the muscle dystrophin expression pattern by either selective targeting and down-modulating the dystrophin promoter transcriptional activity.

  20. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea.

    Science.gov (United States)

    Bajaj, Deepak; Saxena, Maneesha S; Kujur, Alice; Das, Shouvik; Badoni, Saurabh; Tripathi, Shailesh; Upadhyaya, Hari D; Gowda, C L L; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K; Parida, Swarup K

    2015-03-01

    Phylogenetic footprinting identified 666 genome-wide paralogous and orthologous CNMS (conserved non-coding microsatellite) markers from 5'-untranslated and regulatory regions (URRs) of 603 protein-coding chickpea genes. The (CT)n and (GA)n CNMS carrying CTRMCAMV35S and GAGA8BKN3 regulatory elements, respectively, are abundant in the chickpea genome. The mapped genic CNMS markers with robust amplification efficiencies (94.7%) detected higher intraspecific polymorphic potential (37.6%) among genotypes, implying their immense utility in chickpea breeding and genetic analyses. Seventeen differentially expressed CNMS marker-associated genes showing strong preferential and seed tissue/developmental stage-specific expression in contrasting genotypes were selected to narrow down the gene targets underlying seed weight quantitative trait loci (QTLs)/eQTLs (expression QTLs) through integrative genetical genomics. The integration of transcript profiling with seed weight QTL/eQTL mapping, molecular haplotyping, and association analyses identified potential molecular tags (GAGA8BKN3 and RAV1AAT regulatory elements and alleles/haplotypes) in the LOB-domain-containing protein- and KANADI protein-encoding transcription factor genes controlling the cis-regulated expression for seed weight in the chickpea. This emphasizes the potential of CNMS marker-based integrative genetical genomics for the quantitative genetic dissection of complex seed weight in chickpea. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Long non-coding RNA UCA1 promotes lung cancer cell proliferation and migration via microRNA-193a/HMGB1 axis.

    Science.gov (United States)

    Wu, Hongyu; Zhou, Caicun

    2018-02-05

    Lung cancer is a leading cause of death worldwide. Long non-coding RNAs have been documented aberrantly expressed and exerted crucial role in variety of cancers. Urothelial carcinoma associated 1 (UCA1) is a potential new type of biomarkers for tumor diagnosis and exerts oncogenic effect on various human cancers. However, the mechanism of oncogenic role of UCA1 in lung cancer remains unclear. In this study, we firstly confirmed the role of UCA1 in lung cancer and found that UCA1 down-regulation inhibited cell proliferation and migration in both SKMES-1 and H520 lung cancer cells. Then we demonstrated that repressed UCA1 promoted the miR-193a expression and miR-193a could bind to the predicted binding site of UCA1. We then dissected the role of miR-193a in lung cancer and proved the anti-tumor role of miR-193a. Furthermore, we found that miR-193a displayed its role in lung cancer via modulating the HMGB1 expression. In addition, we found that over-expression of HMGB1 could restore the UCA1 knockdown induced repression of cell proliferation and migration. In summary, our study demonstrated that UCA1 exerts oncogenes activity in lung cancer, acting mechanistically by upregulating HMGB1 expression through 'sponging' miR-193a. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Microarray Expression Profile Analysis of Long Non-Coding RNAs in Umbilical Cord Plasma Reveals their Potential Role in Gestational Diabetes-Induced Macrosomia

    Directory of Open Access Journals (Sweden)

    Zhonghua Shi

    2015-05-01

    Full Text Available Background: Fetal macrosomia and its associated complications are the most frequent and serious morbidities for infants associated with gestational diabetes mellitus (GDM. The associations between long non-coding RNAs (lncRNAs and macrosomia have been rarely reported; therefore, we investigated the umbilical cord lncRNA profiles in GDM macrosomia. Method: Thirty pairs of GDM macrosomia and normal controls were divided into three subgroups randomly, and the umbilical cord vein blood from each subgroup was mixed, and hybridized to a microarray containing probes representing 33,000 lncRNA genes. Quantitative real-time polymerase chain reaction (qPCR was used to validate selected differentially expressed lncRNAs. The gene ontology (GO, pathway and network analysis were performed. Result: The microarray identified 8814 lncRNAs that were expressed in the umbilical cord blood, of which 349 were significantly upregulated and 892 were significantly downregulated (fold-change ≥ 2.0 in GDM group. The highest enriched GOs targeted by downregulated transcripts were biological regulation. Pathway analysis indicated that nine pathways corresponded to downregulated transcripts. Conclusions: Certain lncRNAs that were aberrantly expressed in the umbilical cord blood from GDM macrosomia might play a partial or key role in GDM macrosomia development. This study provided potential targets for treatment of macrosomia and novel insights into macrosomia biology.

  3. Microarray Expression Profile Analysis of Long Non-Coding RNAs in Umbilical Cord Plasma Reveals their Potential Role in Gestational Diabetes-Induced Macrosomia.

    Science.gov (United States)

    Shi, Zhonghua; Zhao, Chun; Long, Wei; Ding, Hongjuan; Shen, Rong

    2015-01-01

    Fetal macrosomia and its associated complications are the most frequent and serious morbidities for infants associated with gestational diabetes mellitus (GDM). The associations between long non-coding RNAs (lncRNAs) and macrosomia have been rarely reported; therefore, we investigated the umbilical cord lncRNA profiles in GDM macrosomia. Thirty pairs of GDM macrosomia and normal controls were divided into three subgroups randomly, and the umbilical cord vein blood from each subgroup was mixed, and hybridized to a microarray containing probes representing 33,000 lncRNA genes. Quantitative real-time polymerase chain reaction (qPCR) was used to validate selected differentially expressed lncRNAs. The gene ontology (GO), pathway and network analysis were performed. The microarray identified 8814 lncRNAs that were expressed in the umbilical cord blood, of which 349 were significantly upregulated and 892 were significantly downregulated (fold-change ≥ 2.0) in GDM group. The highest enriched GOs targeted by downregulated transcripts were biological regulation. Pathway analysis indicated that nine pathways corresponded to downregulated transcripts. Certain lncRNAs that were aberrantly expressed in the umbilical cord blood from GDM macrosomia might play a partial or key role in GDM macrosomia development. This study provided potential targets for treatment of macrosomia and novel insights into macrosomia biology. © 2015 S. Karger AG, Basel.

  4. The RNA targetome of Staphylococcus aureus non-coding RNA RsaA: impact on cell surface properties and defense mechanisms.

    Science.gov (United States)

    Tomasini, Arnaud; Moreau, Karen; Chicher, Johana; Geissmann, Thomas; Vandenesch, François; Romby, Pascale; Marzi, Stefano; Caldelari, Isabelle

    2017-06-20

    The virulon of Staphyloccocus aureus is controlled by intricate connections between transcriptional and post-transcriptional regulators including proteins and small non-coding RNAs (sRNAs). Many of the sRNAs regulate gene expression through base-pairings with mRNAs. However, characterization of the direct sRNA targets in Gram-positive bacteria remained a difficult challenge. Here, we have applied and adapted the MS2-affinity purification approach coupled to RNA sequencing (MAPS) to determine the targetome of RsaA sRNA of S. aureus, known to repress the synthesis of the transcriptional regulator MgrA. Several mRNAs were enriched with RsaA expanding its regulatory network. Besides mgrA, several of these mRNAs encode a family of SsaA-like enzymes involved in peptidoglycan metabolism and the secreted anti-inflammatory FLIPr protein. Using a combination of in vivo and in vitro approaches, these mRNAs were validated as direct RsaA targets. Quantitative differential proteomics of wild-type and mutant strains corroborated the MAPS results. Additionally, it revealed that RsaA indirectly activated the synthesis of surface proteins supporting previous data that RsaA stimulated biofilm formation and favoured chronic infections. All together, this study shows that MAPS could also be easily applied in Gram-positive bacteria for identification of sRNA targetome. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. The miR-223 host non-coding transcript linc-223 induces IRF4 expression in acute myeloid leukemia by acting as a competing endogenous RNA

    KAUST Repository

    Mangiavacchi, Arianna

    2016-08-10

    Alterations in genetic programs required for terminal myeloid differentiation and aberrant proliferation characterize acute myeloid leukemia (AML) cells. Here, we identify the host transcript of miR-223, linc-223, as a novel functional long non-coding RNA (lncRNA) in AML. We show that from the primary nuclear transcript, the alternative production of miR-223 and linc-223 is finely regulated during monocytic differentiation. Moreover, linc-223 expression inhibits cell cycle progression and promotes monocytic differentiation of AML cells. We also demonstrate that endogenous linc-223 localizes in the cytoplasm and acts as a competing endogenous RNA for miR-125-5p, an oncogenic microRNA in leukemia. In particular, we show that linc-223 directly binds to miR-125-5p and that its knockdown increases the repressing activity of miR-125-5p resulting in the downregulation of its target interferon regulatory factor 4 (IRF4), which it was previously shown to inhibit the oncogenic activity of miR-125-5p in vivo. Furthermore, data from primary AML samples show significant downregulation of linc-223 in different AML subtypes. Therein, these findings indicate that the newly identified lncRNA linc-223 may have an important role in myeloid differentiation and leukemogenesis, at least in part, by cross-talking with IRF4 mRNA.

  6. Long non-coding RNAs transcribed by ERV-9 LTR retrotransposon act in cis to modulate long-range LTR enhancer function.

    Science.gov (United States)

    Hu, Tianxiang; Pi, Wenhu; Zhu, Xingguo; Yu, Miao; Ha, Hongseok; Shi, Huidong; Choi, Jeong-Hyeon; Tuan, Dorothy

    2017-05-05

    LTR retrotransposons are repetitive DNA elements comprising ∼10% of the human genome. However, LTR sequences are disproportionately present in human long, non-coding RNAs (lncRNAs). Whether and how the LTR lncRNAs serve biological functions are largely unknown. Here we show that in primary human erythroblasts, lncRNAs transcribed from the LTR retrotransposons of ERV-9 human endogenous retrovirus activated transcription of key erythroid genes and modulated ex vivo erythropoiesis. To dissect the functional mechanism of ERV-9 lncRNAs, we performed genome-wide RNA and ChIRP analyses before and after global knockdown or locus-specific deletion of ERV-9 lncRNAs in human erythroblasts carrying ∼4000 copies of the ERV-9 LTRs and in transgenic mouse erythroblasts carrying a single copy of the primate-specific ERV-9 LTR in the 100 kb human β-globin gene locus. We found that ERV-9 lncRNAs acted in cis to stabilize assembly of the ERV-9 LTR enhancer complex and facilitate long-range LTR enhancer function in activating transcription of downstream, cis-linked globin genes. Our findings suggested that LTR lncRNAs transcribed from many of the 4000 copies of ERV-9 LTR retrotransposons acted by a similar cis mechanism to modulate LTR enhancer function in activating transcription of downstream genes critical to cellular processes including erythropoiesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Long Non-Coding RNA MALAT1 Mediates Transforming Growth Factor Beta1-Induced Epithelial-Mesenchymal Transition of Retinal Pigment Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Shuai Yang

    Full Text Available To study the role of long non-coding RNA (lncRNA MALAT1 in transforming growth factor beta 1 (TGF-β1-induced epithelial-mesenchymal transition (EMT of retinal pigment epithelial (RPE cells.ARPE-19 cells were cultured and exposed to TGF-β1. The EMT of APRE-19 cells is confirmed by morphological change, as well as the increased expression of alpha-smooth muscle actin (αSMA and fibronectin, and the down-regulation of E-cadherin and Zona occludin-1(ZO-1 at both mRNA and protein levels. The expression of lncRNA MALAT1 in RPE cells were detected by quantitative real-time PCR. Knockdown of MALAT1 was achieved by transfecting a small interfering RNA (SiRNA. The effect of inhibition of MALAT1 on EMT, migration, proliferation, and TGFβ signalings were observed. MALAT1 expression was also detected in primary RPE cells incubated with proliferative vitreoretinopathy (PVR vitreous samples.The expression of MALAT1 is significantly increased in RPE cells incubated with TGFβ1. MALAT1 silencing attenuates TGFβ1-induced EMT, migration, and proliferation of RPE cells, at least partially through activating Smad2/3 signaling. MALAT1 is also significantly increased in primary RPE cells incubated with PVR vitreous samples.LncRNA MALAT1 is involved in TGFβ1-induced EMT of human RPE cells and provides new understandings for the pathogenesis of PVR.

  8. Downregulation of the long non-coding RNA taurine-upregulated gene 1 inhibits glioma cell proliferation and invasion and promotes apoptosis.

    Science.gov (United States)

    Zhao, Zhijun; Wang, Bin; Hao, Junhai; Man, Weitao; Chang, Yongkai; Ma, Shunchang; Hu, Yeshuai; Liu, Fusheng; Yang, Jun

    2018-03-01

    Expression of the long non-coding RNA taurine-upregulated gene 1 (TUG1) is associated with various aggressive tumors. The present study aimed to investigate the biological function of TUG1 in regulating apoptosis, proliferation, invasion and cell cycle distribution in human glioma U251 cells. Lentivirus-mediated TUG1-specific microRNA was transfected into U251 cells to abrogate the expression of TUG1. Flow cytometry analysis was used to examine the cell cycle distribution and apoptosis of U251 cells. Cellular proliferation was examined using Cell Counting Kit-8 (CCK-8) assays and invasion was examined by Transwell assays. The apoptotic rate of cells in the TUG1-knockdown group was significantly higher than in the negative control (NC) group (11.58 vs. 9.14%, PTUG1-knockdown group was lower compared with that of the NC group. A Transwell invasion assay was performed, which revealed that the number of invaded cells from the TUG1-knockdown group was the less compared with that of the NC group. In addition, the G 0 /G 1 phase population was significantly increased within the treated group (44.85 vs. 38.45%, PTUG1 may inhibit proliferation and invasion, and promote glioma U251 cell apoptosis. In addition, knockdown of TUG1 may have an effect on cell cycle arrest. The data presented in the current study indicated that TUG1 may be a novel therapeutic target for glioma.

  9. Knockdown of long non-coding RNA Taurine Up-Regulated 1 inhibited doxorubicin resistance of bladder urothelial carcinoma via Wnt/β-catenin pathway.

    Science.gov (United States)

    Xie, Dalong; Zhang, Hui; Hu, Xuanhao; Shang, Chao

    2017-10-24

    In genitourinary system, bladder cancer (BC) is the most common and lethal malignant tumor, which most common type is bladder urothelial carcinoma (BUC). Long non-coding RNA (lncRNA) Taurine Up-Regulated 1 (TUG1) gene is high-expressed in several malignant tumors, including BC. In this study, over-expression of TUG1 was found in BUC tissues and cell line resistant to doxorubicin (Dox). Knockdown of TUG1 inhibited the Dox resistance and promoted the cytotoxicity induced by Dox in T24/Dox cells. TUG1 knockdown also depressed the Wnt/β-catenin pathway, and the activation the Wnt/β-catenin pathway partly reversed the inhibitory effects of TUG1 knockdown on Dox resistance in T24/Dox cells. In conclusion, up-regulation of lncRNA TUG1 was related with the poor response of BUC patients to Dox chemotherapy, knockdown of TUG1 inhibited the Dox resistance of BUC cells via Wnt/β-catenin pathway. These findings might assist in the discovery of novel potential diagnostic and therapeutic target for BUC, thereby improve the effects of clinical treatment in patients.

  10. Long non-coding RNA TUG1 promotes cervical cancer progression by regulating the miR-138-5p-SIRT1 axis.

    Science.gov (United States)

    Zhu, Jie; Shi, Huirong; Liu, Huina; Wang, Xiaojuan; Li, Fengmei

    2017-09-12

    Increasing evidences showed that long non-coding RNAs (lncRNAs) play vital roles in tumor progression. Recent studies indicated that lncRNA TUG1 was upregulated and promoted tumor processes in several cancers. However, the expression and underlying mechanism of TUG1 in cervical cancer remain unclear. In the present study, we found that TUG1 expression was upregulated in cervical cancer tissues and correlated with advanced clinical features and poor overall survival. TUG1 knockdown suppressed cervical cancer cell growth and metastasis in vitro and tumor growth in vivo . In addition, our results indicated that TUG1 could act as an endogenous sponge by directly binding to miR-138-5p and suppressed miR-138-5p expression. Furthermore, we found that TUG1 could reverse the inhibitory effect of miR-138-5p on cervical cancer cells processes, which might be involved in the activation of SIRT1, a target gene of miR-138-5p, and activation of Wnt/β-catenin signaling pathway. Taken together, we elucidated that TUG1 might promote cervical cancer malignant progression via miR-138-5p-SIRT1-Wnt/β-catenin signaling pathway axis.

  11. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2.

    Science.gov (United States)

    Huang, Ming-De; Chen, Wen-Ming; Qi, Fu-Zhen; Sun, Ming; Xu, Tong-Peng; Ma, Pei; Shu, Yong-Qian

    2015-09-04

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal squamous cell carcinoma (ESCC). However, its clinical significance and potential role in HCC remain unclear. In this study, expression of TUG1 was analyzed in 77 HCC tissues and matched normal tissues by using quantitative polymerase chain reaction (qPCR). TUG1 expression was up-regulated in HCC tissues and the higher expression of TUG1 was significantly correlated with tumor size and Barcelona Clinic Liver Cancer (BCLC) stage. Moreover, silencing of TUG1 expression inhibited HCC cell proliferation, colony formation, tumorigenicity and induced apoptosis in HCC cell lines. We also found that TUG1 overexpression was induced by nuclear transcription factor SP1 and TUG1 could epigeneticly repress Kruppel-like factor 2 (KLF2) transcription in HCC cells by binding with PRC2 and recruiting it to KLF2 promoter region. Our results suggest that lncRNA TUG1, as a growth regulator, may serve as a new diagnostic biomarker and therapy target for HCC.

  12. Non-coding RNAs at the Gnas and Snrpn-Ube3a imprinted gene loci and their involvement in hereditary disorders.

    Directory of Open Access Journals (Sweden)

    Antonius ePlagge

    2012-11-01

    Full Text Available Non-coding RNAs (ncRNAs have long been recognized at imprinted gene loci and provided early paradigms, to investigate their functions and molecular mechanisms of action. The characteristic feature of imprinted genes, their monoallelic, parental-origin-dependent expression, is achieved through complex epigenetic regulation, which is modulated by ncRNAs. This minireview focuses on two imprinted gene clusters, in which changes in ncRNA expression contribute to human disorders. At the GNAS locus loss of NESP RNA can cause autosomal dominant Pseudohypoparathyroidism type 1b (AD-PHP-Ib, while at the SNRPN-UBE3A locus a long ncRNA and processed snoRNAs play a role in Angelman-Syndrome (AS and Prader-Willi-Syndrome (PWS. The ncRNAs silence overlapping protein-coding transcripts in sense or anti-sense orientation through changes in histone modifications as well as DNA methylation at CpG-rich sequence motifs. Their epigenetic modulatory functions are required in early development in the pre-implantation embryo or already in the parental germ cells. However, it remains unclear whether the sequence homology-carrying ncRNA itself is required, or whether the process of its transcription through other promoters causes the silencing effect.

  13. The long non-coding RNA HOTAIR promotes the proliferation of serous ovarian cancer cells through the regulation of cell cycle arrest and apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Qiu, Jun-jun [Department of Gynecology, Obstetrics and Gynecology Hospital, Fudan University, 419 Fangxie Road, Shanghai 200011 (China); Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 138 Yixueyuan Road, Shanghai 200032 (China); Shanghai Key Laboratory of Female Reproductive Endocrine-Related Diseases, 413 Zhaozhou Road, Shanghai 200011 (China); Wang, Yan [Cancer Institute, Fudan University Shanghai Cancer Center, 270 Dong' an Road, Shanghai 200032 (China); Department of Oncology, Shanghai Medical College, Fudan University, 130 Dong' an Road, Shanghai 200032 (China); Ding, Jing-xin; Jin, Hong-yan [Department of Gynecology, Obstetrics and Gynecology Hospital, Fudan University, 419 Fangxie Road, Shanghai 200011 (China); Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 138 Yixueyuan Road, Shanghai 200032 (China); Shanghai Key Laboratory of Female Reproductive Endocrine-Related Diseases, 413 Zhaozhou Road, Shanghai 200011 (China); Yang, Gong, E-mail: yanggong@fudan.edu.cn [Cancer Institute, Fudan University Shanghai Cancer Center, 270 Dong' an Road, Shanghai 200032 (China); Department of Oncology, Shanghai Medical College, Fudan University, 130 Dong' an Road, Shanghai 200032 (China); Hua, Ke-qin, E-mail: huakeqin@126.com [Department of Gynecology, Obstetrics and Gynecology Hospital, Fudan University, 419 Fangxie Road, Shanghai 200011 (China); Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 138 Yixueyuan Road, Shanghai 200032 (China); Shanghai Key Laboratory of Female Reproductive Endocrine-Related Diseases, 413 Zhaozhou Road, Shanghai 200011 (China)

    2015-05-01

    HOX transcript antisense RNA (HOTAIR) is a well-known long non-coding RNA (lncRNA) whose dysregulation correlates with poor prognosis and malignant progression in many forms of cancer. Here, we investigate the expression pattern, clinical significance, and biological function of HOTAIR in serous ovarian cancer (SOC). Clinically, we found that HOTAIR levels were overexpressed in SOC tissues compared with normal controls and that HOTAIR overexpression was correlated with an advanced FIGO stage and a high histological grade. Multivariate analysis revealed that HOTAIR is an independent prognostic factor for predicting overall survival in SOC patients. We demonstrated that HOTAIR silencing inhibited A2780 and OVCA429 SOC cell proliferation in vitro and that the anti-proliferative effects of HOTAIR silencing also occurred in vivo. Further investigation into the mechanisms responsible for the growth inhibitory effects by HOTAIR silencing revealed that its knockdown resulted in the induction of cell cycle arrest and apoptosis through certain cell cycle-related and apoptosis-related proteins. Together, these results highlight a critical role of HOTAIR in SOC cell proliferation and contribute to a better understanding of the importance of dysregulated lncRNAs in SOC progression. - Highlights: • HOTAIR overexpression correlates with an aggressive tumour phenotype and a poor prognosis in SOC. • HOTAIR promotes SOC cell proliferation both in vitro and in vivo. • The proliferative role of HOTAIR is associated with regulation of the cell cycle and apoptosis.

  14. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  15. Characterization of Vibrio fischeri rRNA operons and subcloning of a ribosomal DNA promoter.

    Science.gov (United States)

    Amikam, D; Kuhn, J

    1987-01-01

    Analysis of rRNA genes in Vibrio fischeri indicates the presence of eight rRNA gene sets in this organism. It was found that the genes for 5S rRNA, 16S rRNA, and 23S rRNA are organized in operons in the following order: 5' end 16S rRNA 23S RNA 5S rRNA 3' end. Although the operons are homologous, they are not identical with regard to cleavage sites for various restriction endonucleases. A DNA library was constructed, and three ribosomal DNA clones were obtained. One of these clones contained an entire rRNA operon and was used as a source for subcloning. The promoter region which leads to plasmid instability was successfully subcloned into pHG165. The terminator region was subcloned into pBR322. PMID:3571170

  16. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  17. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  18. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...

  19. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    OpenAIRE

    Michot, B; Bachellerie, J P; Raynal, F

    1983-01-01

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other availabl...

  20. Identification of an ortholog of the eukaryotic RNA polymerase III subunit RPC34 in Crenarchaeota and Thaumarchaeota suggests specialization of RNA polymerases for coding and non-coding RNAs in Archaea.

    NARCIS (Netherlands)

    Blombach, F.; Makarova, K.S.; Marrero, J.; Siebers, B.G.; Koonin, E.V.; Oost, J. van der

    2009-01-01

    One of the hallmarks of eukaryotic information processing is the co-existence of 3 distinct, multi-subunit RNA polymerase complexes that are dedicated to the transcription of specific classes of coding or non-coding RNAs. Archaea encode only one RNA polymerase that resembles the eukaryotic RNA

  1. Non-coding RNAs in Mesenchymal Stem Cell-Derived Extracellular Vesicles: Deciphering Regulatory Roles in Stem Cell Potency, Inflammatory Resolve, and Tissue Regeneration

    Science.gov (United States)

    Fatima, Farah; Ekstrom, Karin; Nazarenko, Irina; Maugeri, Marco; Valadi, Hadi; Hill, Andrew F.; Camussi, Giovanni; Nawaz, Muhammad

    2017-01-01

    Extracellular vesicles (EVs) are heterogeneous populations of nano- and micro-sized vesicles secreted by various cell types. There is mounting evidence that EVs have widespread roles in transporting proteins, lipids, and nucleic acids between cells and serve as mediators of intercellular communication. EVs secreted from stem cells could function as paracrine factors, and appear to mimic and recapitulate several features of their secreting cells. EV-mediated transport of regulatory RNAs provides a novel source of trans-regulation between cells. As such, stem cells have evolved unique forms of paracrine mechanisms for recapitulating their potencies with specialized functions by transporting non-coding RNAs (ncRNAs) via EVs. This includes the dissemination of stem cell-derived EV-ncRNAs and their regulatory effects elicited in differentiation, self-renewal, pluripotency, and the induction of reparative programs. Here, we summarize and discuss the therapeutic effects of mesenchymal stem cell-derived EV-ncRNAs in the induction of intrinsic regenerative programs elicited through regulating several mechanisms. Among them, most noticeable are the EV-mediated enrichment of ncRNAs at the injury sites contributing the regulation of matrix remodeling, epithelial mesenchymal transitions, and attraction of fibroblasts. Additionally, we emphasize EV-mediated transmission of anti-inflammatory RNAs from stem cells to injury site that potentially orchestrate the resolution of the inflammatory responses and immune alleviation to better facilitate healing processes. Collectively, this knowledge indicates a high value and potential of EV-mediated RNA-based therapeutic approaches in regenerative medicine. PMID:29123544

  2. Interferon lambda polymorphisms associate with body iron indices and hepatic expression of interferon-responsive long non-coding RNA in chronic hepatitis C.

    Science.gov (United States)

    Wróblewska, Anna; Bernat, Agnieszka; Woziwodzka, Anna; Markiewicz, Joanna; Romanowski, Tomasz; Bielawski, Krzysztof P; Smiatacz, Tomasz; Sikorska, Katarzyna

    2017-05-01

    Single nucleotide polymorphisms (SNPs) within DNA region containing interferon lambda 3 (IFNL3) and IFNL4 genes are prognostic factors of treatment response in chronic hepatitis C (CHC). Iron overload, frequently diagnosed in CHC, is associated with unfavorable disease course and a risk of carcinogenesis. Its etiology and relationship with the immune response in CHC are not fully explained. Our aim was to determine whether IFNL polymorphisms in CHC patients associate with body iron indices, and whether they are linked with hepatic expression of genes involved in iron homeostasis and IFN signaling. For 192 CHC patients, four SNPs within IFNL3-IFNL4 region (rs12979860, rs368234815, rs8099917, rs12980275) were genotyped. In 185 liver biopsies, histopathological analyses were performed. Expression of five mRNAs and three long non-coding RNAs (lncRNAs) was determined with qRT-PCR in 105 liver samples. Rs12979860 TT or rs8099917 GG genotypes as well as markers of serum and hepatocyte iron overload associated with higher activity of gamma-glutamyl transpeptidase and liver steatosis. The presence of two minor alleles in any of the tested SNPs predisposed to abnormally high serum iron concentration and correlated with higher hepatic expression of lncRNA NRIR. On the other hand, homozygosity in any major allele associated with higher viral load. Patients bearing rs12979860 CC genotype had lower hepatic expression of hepcidin (HAMP; P = 0.03). HAMP mRNA level positively correlated with serum iron indices and degree of hepatocyte iron deposits. IFNL polymorphisms influence regulatory pathways of cellular response to IFN and affect body iron balance in chronic hepatitis C virus infection.

  3. Long non-coding RNA HOTAIR promotes HLA-G expression via inhibiting miR-152 in gastric cancer cells.

    Science.gov (United States)

    Song, Bingtan; Guan, Zhongzheng; Liu, Fengjun; Sun, Dong; Wang, Kexin; Qu, Hui

    2015-08-28

    Recent studies have shown that the long non-coding RNA HOTAIR plays critical roles in tumor biology, including cancer progression and metastasis. However, the potential biological role HOTAIR in tumor escap